WO2007049281A1 - Polypeptides ache, polynucléotides codant pour lesdits polypeptides et préparations et méthodes d'utilisation desdits polypeptides - Google Patents

Polypeptides ache, polynucléotides codant pour lesdits polypeptides et préparations et méthodes d'utilisation desdits polypeptides Download PDF

Info

Publication number
WO2007049281A1
WO2007049281A1 PCT/IL2006/001233 IL2006001233W WO2007049281A1 WO 2007049281 A1 WO2007049281 A1 WO 2007049281A1 IL 2006001233 W IL2006001233 W IL 2006001233W WO 2007049281 A1 WO2007049281 A1 WO 2007049281A1
Authority
WO
WIPO (PCT)
Prior art keywords
ache
cell
expression
polypeptide
nucleic acid
Prior art date
Application number
PCT/IL2006/001233
Other languages
English (en)
Inventor
Hermona Soreq
Debra Toiber
Amit Berson
David S. Greenberg
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem
Publication of WO2007049281A1 publication Critical patent/WO2007049281A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01007—Acetylcholinesterase (3.1.1.7)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to novel isoforms of ACIiE and uses thereof.
  • Acetylcholinesterase is an enzyme whose primary role is that of hydrolyzing synaptic acetylcholine (ACh).
  • AChE is one of the most efficient enzymes in nature, capable of hydrolyzing ACh at a rate so high, it is only limited by mere diffusion, making it evolutionarily an almost perfect terminator of cholinergic neurotransmission.
  • Human AChE is encoded by a single gene.
  • the primary AChE transcript is subject to alternative splicing yielding multiple polypeptide variants with distinct N- and C-termini.
  • the common catalytic core of human AChE consists of 543 amino acids encoded by exons 2-4.
  • the best known of the AChE variants, encoded by exons 2,3,4,6, is the one most prevalent in brain and muscle tissues AChE-S, the synaptic isoform.
  • the 40-residue long C-terminal extension of the common core contains a single cysteine, which allows oligomerization of the enzyme.
  • AChE-R isoform formed by continuous transcription through intron 4'
  • ACChE-R the "readthrough” isoform
  • AChE inhibition The hydrophilic 26-residue long C-terminal extension of AChE-R contains no cysteines, and is therefore expected to remain monomeric.
  • the third splicing option yields a 43 -residue long C-terminal sequence extending the common core (AChE-E, the "erythrocytic” form). This domain is subsequently cleaved after residue 14 of exon 5 to allow formation of a glycophospholipid linkage, anchoring AChE-E to erythrocyte membranes.
  • N-AChE is predicted to be Type I transmembrane protein and is developmentally regulated in human brain neurons and blood mononuclear cells.
  • Alternative promoter usage combined with alternative splicing may thus lead to stress-dependent combinatorial complexity of AChE mRNA transcripts and their protein products equipping them for their characteristic subunit structure and sub-cellular localization and may subtly change their enzymatic activity.
  • TgS and TgR mice over-expressing AChE-S or AChE-R display distinct characteristics [Soreq, H. & Seidman, S. Nat Rev Neurosci 2, 294-302. (2001)].
  • TgS mice show accelerated stress-related neuropathology [Sternfeld, M. et al. Proc Natl Acad Sci U S A 97, 8647-52. (2000)], including loss of dendritic arborizations and spines.
  • AD Alzheimer's disease
  • AD is among the best-studied neuropathologies associated with AChE alterations.
  • AD is the most prevalent type of dementia in the elderly and is characterized by the deposition of ⁇ -amyloid protein, processed by proteolytic cleavage of the ⁇ -amyloid protein precursor. These forming plaques are characteristic of the early pathogenesis in AD.
  • Acetylcholinesterase activity is not impaired until later stages of AD; nevertheless, recent evidence strongly suggests that AChE contributes to early plaque formation and pathogenesis. This might suggest non-hydrolytic role(s) for AChE in AD progression.
  • Most of the currently approved drugs for AD are anti-cholinesterases, which bind the active site of AChE and inhibit its action. However, active site inhibitors may not affect the non-catalytic actions of AChE, which possibly partake in disease progression and severity.
  • an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • an isolated oligonucleotide capable of specifically hybridizing to the isolated polynucleotide as set forth in SEQ ID NO: 4 and not to the isolated polynucleotide as set forth in SEQ ID NO: 7 or vice versa.
  • an isolated polypeptide as set forth in SEQ ID NO: 1.
  • an antibody capable of specifically recognizing the isolated polypeptide of claim 14 and not the isolated polypeptide of claim 15 or vice versa.
  • nucleic acid construct comprising the polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, the N-terminal extension being at least
  • nucleic acid construct comprising the polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE- S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • a cell comprising the nucleic acid construct comprising the polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • a cell comprising the nucleic acid construct comprising the polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • a method of producing ACHE comprising (a) introducing the nucleic acid constructs of the present invention into a cell; and (b) cultivating the cell under conditions which allow expression of the ACHE 5 thereby producing ACHE.
  • a pharmaceutical composition comprising as an active ingredient the isolated polypeptides of the present invention and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising as an active ingredient the nucleic acid construct of the present invention and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising as an active ingredient the cells of the present invention and a pharmaceutically acceptable carrier.
  • a method of inducing cell death comprising up-regulating activity and/or expression of the polypeptide as set forth in SEQ ID NO: 5 thereby inducing cell death.
  • a method of promoting cell survival comprising up-regulating activity and/or expression of the polypeptide as set forth in SEQ ID NO: 1, thereby promoting cell survival.
  • a method of treating an apoptosis related disorder comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of regulating the activity or expression of the polypeptide as set forth in SEQ ID NO: 5, thereby treating the apoptosis related disorder.
  • a method of treating a neurodegenerative disorder comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of regulating the activity or expression of the polypeptide as set forth in SEQ ID NO: 1, thereby treating the subject having a neurodegenerative disorder.
  • polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3, for the manufacture of a medicament identified for treating an apoptosis-related disorder.
  • polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, said N-terminal extension being at least 90 % homologous to SEQ ID NO: 3, for the manufacture of a medicament identified for treating a neurodegenerative disorder.
  • the polypeptide comprises a neuroprotecting activity.
  • amino acid sequence is as set forth in SEQ ID NO: 1.
  • an amino acid sequence of said ACHE-R is as set forth in SEQ ID NO: 2
  • N-terminal extension is as set forth in SEQ ID NO: 3.
  • the polypeptide comprises an apoptotic activity.
  • the amino acid sequence is as set forth in SEQ ID NO:5.
  • an amino acid sequence of the ACHE-S is as set forth in SEQ ID NO: 6
  • the nucleic acid sequence is as set forth in SEQ ID NO: 7.
  • N-terminal extension is as set forth in SEQ ID NO: 3
  • the antibody is a bi-specific antibody.
  • the antibody is capable of diagnosing an apoptosis-related disorder and/or a neurodegenerative disorder.
  • the nucleic acid further comprises a cis regulatory element.
  • the cis regulatory element is a promoter
  • the promoter mediates expression of the polynucleotide in a mammalian cell. According to still further features in the described preferred embodiments, the promoter mediates expression of the polynucleotide in a plant cell.
  • the promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, a developmentally regulated promoter and a tissue-specific promoter.
  • the nucleic acid construct further comprises an additional nucleic acid sequence encoding a signal sequence for targeted expression of the polynucleotide in a subcellular compartment of the plant cell.
  • the signal sequence is selected from the group consisting of an ER signal sequence, a cytosol signal sequence, a plastid signal sequence, a seed signal sequence, a vacuole signal sequence and an apoplast signal sequence.
  • the cell is a plant cell.
  • the plant cell forms part of a plant or a whole plant. According to still further features in the described preferred embodiments, the plant cell is in an isolated plant cell.
  • the method further comprises recovering the ACHE from the cell.
  • the method further comprising down-regulating activity and/or expression of the polypeptide as set forth in SEQ ID NO: 1.
  • the inducing cell death is effected in vivo.
  • the inducing cell death is effected ex vivo.
  • the inducing cell death is effected in vitro.
  • the method further comprises down-regulating activity and/or expression of the polypeptide as set forth in SEQ ID NO: 5.
  • the promoting cell survival is effected in vivo.
  • the promoting cell survival is effected ex vivo. According to still further features in the described preferred embodiments, the promoting cell survival is effected in vitro.
  • the apoptosis-related disorder is a neurodegenerative disorder or a hyperproliferative disorder.
  • the hyperproliferative disorder is cancer.
  • the regulating when the apoptosis-related disorder is the hyperproliferative disorder, the regulating is up-regulating. According to still further features in the described preferred embodiments, when the apoptosis-related disorder is the neurodegenerative disorder, the regulating is down-regulating.
  • the neurodegenerative disorder is Alzheimer's.
  • the agent comprises the isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • the agent is selected from the group consisting of an antibody, an antisense, an siRNA, a ribozyme and a DNAzyme.
  • the regulating is down- regulating.
  • the regulating is up-regulating.
  • the neurodegenerative disorder is selected from the group selected from Alzheimer's, ALS, a retinal disorder, Diabetes, macular degeneration and Lewy body disease.
  • the retinal disorder is retinitis pigmentosa or age-related macular degeneration.
  • the agent comprises the isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • the agent is selected from the group consisting of an antibody, an antisense, an siRNA, a ribozyme and a DNAzyme.
  • FIGs. IA-D are diagrams illustrating ACHE gene structure, alternative transcripts and protein products.
  • Figure IA Gene structure of mouse (top) and human (bottom) AChE. Exons are depicted as cylinders, introns as lines. Splicing options are shown as curved lines above the genes. GRE, glucocorticoid response element. Image is drawn to scale.
  • Figure IB Homologous regions in the AChE 3 kb upstream region between mouse (top) and human (bottom). Parallel homologies are shown in similar patterns. Shown underneath are the alternative 5' exons in similar colors to A.
  • Figure 1C Combinatorial complexity of mouse (left) and human (right) AChE mRNA transcripts.
  • FIG. 1 AChE alternative protein products, (a) Globular structure of tetrameric AChE-S (green), monomeric AChE-R (red) and dimeric AChE-E (right), (b) Conventional wisdom regarding AChE isoforms' membrane attachment. Synaptic docking of AChE-S through CoIQ in or PRiMA (black) and ACIiE-E through a GPI anchor (purple). AChE-R remains monomeric.
  • FIGs. 2A-E are schematic representations and graphs illustrating the biochemical properties of the expressed AChE variants.
  • Figure 2A Promoter and alternative splicing choices modify the AChE mRNA transcripts.
  • Scheme The nascent transcripts and AChE splice variants at the mRNA and protein levels. Putative ATG codons are noted below. Triangular and dashed lines note constitutive and alternative splicing events. Constitutive and variant exons are represented by colored and grey boxes.
  • Right schemes of the putative protein products. Parentheses: respective open reading frames (in encoded amino acids).
  • Figure 2B Km analysis. Acetylthicholine (ATCh) hydrolysis measurements served to determine Km values for the noted variants.
  • ATCh Acetylthicholine
  • FIG. 2E Cellular and Secreted AChE forms. Hydrolytic activity of AChE variants in nmol/min/mg cellular protein in cell extracts and secreted to the medium. Note that R and NR are mostly secreted whereas S and NS are mostly cellular.
  • FIGs. 3A-B are photomicrographs and graphs illustrating that the N-terminal extension confers plasma membrane and endocytotic vesicle localization.
  • Figure 3A is a photomicrograph of electron microscopy immunolabeling with gold beads- decorated antibodies targeted to the N terminus, or the core domain of N-AChE (top schemes) of U87MG cells transfected with N-AChE-S (NS) or N-AChE-R (NR) vectors. Note labeling (circled black dots) close to the plasma membrane or within endocytotic, clathrin-coated vesicles.
  • Figure 3B is a membranal localization scheme illustrating the putative positioning of NR and NS.
  • N-terminal extension and the core domain may be positioned at different sides of the membrane.
  • Both NS and NR accumulated at 0-6 nm distance from the plasma membrane (ca. 4-fold over intracellular labeling for both antibodies), far less than AChE and antibody diameter ( ⁇ 25nm).
  • the anti-N labeling of NS peaked intracellularly but its anti core labeling peaked extracellularly, whereas NR peaked intracellularly for both antibodies. This supports option No. 2 for NS.
  • Intracellular labeling of both variants (Scheme's option No. 3) often appeared within endocytotic vesicles (11% of intracellular labeling).
  • FIGs. 4A-E show that N-AChE-S induces Caspase-mediated and AChE-I preventable apoptosis.
  • Figure 4A N-AChE-S mediated apoptosis.
  • U87MG cells were transfected with plasmids encoding AChE-R (R), AChE-S (S) 5 N-AChE-R (NR) or N- AChE-S (NS); TUNEL staining was measured 24hr later. Transfection with an "empty" plasmid or incubation with medium of transfected cells served as controls. Note that NS alone increased TUNEL labeling (**p ⁇ 0.005, Student's t test).
  • Figure 4B Caspases induction.
  • Figure 4D U87MG cells transfected with the noted vectors were incubated with pyridostigmine (Pyr), propidium (Pro), or BW284C51 (BW). Inset drawing shows active and/or peripheral binding sites for the employed inhibitors. Transfected cells with no treatment served as controls (after normalization for data under "empty vector” transfection). Note increased TUNEL labeling in NS but not NR transfected cells and its suppression by AChE-I (*p ⁇ 0.05).
  • Figure 4E The apoptotic NS effect is an up-stream event.
  • FIG. 5 A is a bar chart illustrating various apoptotic stimuli which induce over- expression of N-terminally extended AChE.
  • Real Time RT-PCR tests revealed up- regulation of hEle exon (N) under apoptotic stimuli of thapsigargin, carbachol and ⁇ - Me in U87MG, while Cortisol down-regulated its expression and glutamate had no effect. Columns: fold change over non treated cells.
  • Figure 5B are photographs and bar charts illustrating thapsigargin-induced N-AChE labeling in promegakaryocytic cells. Shown is enhanced cytoplasmic N-AChE immunostaining in MEGOl cells cultured with thapsigargin, compared to control cells (**p ⁇ 0.001, Student's t test).
  • FIGs. 6A-E illustrate that apoptotic insults up-regulate antisense-suppressible hEle-associated apoptosis.
  • Figure 6A Antisense suppression of thapsigargin-induced apoptosis.
  • Scheme multiple apoptotic stimuli induce NS overproduction and subsequent DNA damage in MEGOl cells, both preventable by the AChE mRNA- targeted antisense agent Monarsen (Evron 2005).
  • Figure 6B Micrographs: N-AChE and TUNEL labeling of 24hr cultured MEGOl cells under the noted treatments. Columns: Fold increase in TUNEL labeling of over 1800 cells per sample.
  • Figure 6C Cells were treated with the noted concentrations of Thapsigargin, with or without Monarsen. Columns: Percent of control AChE activity in extracts of cells treated with Monarsen as compared with INV (**p ⁇ 0.005).
  • Figure 6D Apoptotic stimuli activate caspase 3 and prevent the replacement of the C-terminus of AChE-S with AChE-R. Columns: Both 50 ⁇ M Etoposide and 2OmM ⁇ -Me increase TUNEL and caspase 3 labeling, while enlarging AChE-S and decreasing AChE-R immunolabeling within 24hr (*p ⁇ 0.05,**p>0.005).
  • N-AChE staining increases under antisense preventable apoptotic stimuli.
  • Population analysis of N-AChE immunostaining shows a Monarsen-preventable shift to the right in etoposide and ⁇ -Me treated cells, reflecting the accumulation of intensively expressing cells.
  • FIGs. 7A-F illustrate that Bcl-2 proteins and inhibitors of Kinases and AChE suppress NS-activated apoptosis.
  • Figure 7A Tested hypothesis. Scheme presents putative causally involved steps in the apoptotic pathway and the corresponding inhibitors. Upstream induction of NS by thapsigargin co-activates caspases and Bax and, yielding apoptosis preventable by Bcl-2 family members or AChE, PKC, and GSK3 inhibitors.
  • Figure 7B NS induction associates with BW preventable Bcl-2 decreases. Shown is reduced Bcl-2 labeling in MEGOl cells treated with Thapsigargin (thapsi), reflecting increased risk of apoptosis.
  • Figure 7D Kinase signaling is causally involved. Normalized TUNEL increases in NS- transfected cells.
  • FIGs. 8A-D are photomicrographs illustrating the specificity and dose dependence of mossy fiber staining in the AD brain with anti N- and anti -S antibodies.
  • Figure 8A Immunostaining of paraffin-embedded hippocampal sections from AD patients and non demented controls (Ctrl) with antibodies targeted at synthetic peptides derived from the N and the S-termini, respectively (Schemes). Dilutions were 1:30, 1:50 andl:70. Note dose dependent increases in N-AChE staining intensity, attesting to specificity.
  • Figure 8B Staining with both antibodies increased in AD as compared with Ctrl sections, but was totally abolished when performed in the presence of excess of the respective peptides for S, the C16 peptide (Santa Cruz) and the KVRSHPSGNQHRPTRG and GSRSFHCRRGVRPRPA peptides which served for antibody preparation for the N extended portion.
  • Figure 8C Zoomed view of the stained hippocampus shows perikaryal neuronal staining in both cases.
  • Figure 8D illustrates enhance NS labeling in AD mossy fibers.
  • FIGs. 9A-B are the results of FISH analysis of prominent hEle expression in developing human tissues including cell types with massive apoptosis.
  • FIGs. lOA-C are photographs and diagrams illustrating that NS expression associates with apoptosis under development and in AD brains.
  • Figure 1OA hEle expression in developing neurons and epithelial cells, but not in muscle.
  • Scheme E6 (S encoding) and hEle (N encoding) targeted probes for NS mRNA.
  • Micrographs FISH examples of human embryonic tissues. Note expression of both E6 and hEle in developing grey matter neurons, and in the rapidly replaceable epithel of the stomach, both subject to frequent cell death, as compared with absent hEle staining in the E6- labeled muscle.
  • Figure 1OB Selective hEle up-regulation in AD dentate gyrus neurons.
  • FIGs. 1 IA-B illustrate that N-AChE-R over-expression protects cultured cells from apoptosis induced by protein synthesis inhibitors.
  • TUNEL assay was performed on U87 glioblastoma cells transfected with N-AChE-R (NR) or BlueScript (BS, empty vector) and treated with anisomycin or cyclohexamide, both of which block translation, which is RACKl regulated by the AChE-R binding protein RACKl.
  • Cell death was measured 24hr after transfection/ treatment. Anisomycin and cyclohexamide induced cell death. A significant protection from such death was obtained by N-AChE-R over expression.
  • FIGs. 12A-B illustrate the results from a spliceChip analysis of N-AChE-R over-expression showing modified transcripts related to protein folding and apoptosis.
  • the in-house "SpliceChip” carries 244 spotted probes, mostly for spliceosomal components or apoptosis-related genes undergoing alternative splicing.
  • Figure 12 A Histograms of the Iog2 expression ratios of transfected P19 cells over-expressing N- AChE-R. Up-regulated, down-regulated transcripts are marked in red and blue, respectively. Most genes remain unchanged (88%), the up-regulated transcripts showed larger differences from control as compared with the down regulated transcripts.
  • Figure 12B SpliceChip analysis of P19 semi-differentiated cells over- expressing the N-AChE-R variant shows a significant increase in genes related to protein folding and apoptotic and anti-apoptotic pathways such as ICAD L, Synuclein alpha, and caspase 1.
  • FIGs.13A-B illustrates 2D gel analysis of U87 glioblastoma cell extracts and mass spectrometry identification of modified spots. Percent change from control cells shows that N-AChE-R and AChE-R over-expression modify the levels of proteins related to protein translation, folding and degradation. AChE-R and N-AChE-R induce distinct effects, indicating different roles of each in protecting cells from stressful insults.
  • Figures 14A-F illustrate the expression of AChE-R mRNA (in-situ hybridization) and total AChE activity in the retinas of a control rat and of rats exposed to damaging light and sacrificed 1-day and 14-days following exposure. Average (+/- SE) density values at the photoreceptors inner segments (IS), inner nuclear layer (INL) and ganglion cells (GC), obtained from retinas of 4 rats, are shown to the right of each representative micrograph. AChE-R mRNA was found at a very low level in control rats ( Figure 14A), but was significantly expressed in rats exposed to bright damaging light ( Figures 14C and 14E).
  • AChE-R mRNA expression was evident in ganglion cells (GC), in neurons of the inner nuclear layer (INL), and in the inner segments of the photoreceptors (arrowheads).
  • High AChE activity was found in the inner plexiform layer (IPL) of retinas from unexposed control rat ( Figure 14B), and of experimental rats exposed to damaging light ( Figure 14D and 14F).
  • AChE activity was also evident in the inner segments of the photoreceptors (arrowheads) of the rats exposed to damaging light ( Figures 14D and 14F).
  • Calibration bar applies to all micrographs in the figure.
  • FIGs. 15A-D illustrate the effects of Monarsen, an orphan AChE mRNA- targeted antisense agent, on light-induced expression of AChE-R mRNA and total activity of AChE. Rats were treated daily with intraperitoneal injection of saline or
  • FIG. 16 illustrates the results of immuonocytochemistry of retinas from rats exposed to bright damaging light and treated with saline (2nd row) or Monarsen (3rd row) compared to that of a control rat that was not exposed to damaging light (1st row).
  • Two antibodies were used, one against the extended N-terminus of AChE (left column) and the other against the core domain of all AChE variants (middle column) as indicated in the scheme above the micrographs. The two micrographs were merged to show an overlap between the two proteins (right column). Exposure to damaging light clearly increased expression of N-AChE in the saline-treated retina, which was significantly prevented by Monarsen treatment.
  • N-AChE expression by exposure to bright light was mainly evident in the inner and outer segments of the photoreceptors (arrowheads) and in bipolar cells (arrows) as shown in the merged micrograph (middle row, right column). Calibration bar applies to all micrographs in the figure.
  • FIGs. 17A-D are graphs illustrating the effects of Monarsen on light-induced retinal damage, as assessed by the ERG responses.
  • Figure 17B Response-intensity curves of the ERG a- wave and b-wave (open and filled symbols respectively) of both rats, measured before (circles) and 30-days (squares) after exposure to damaging light.
  • FIGs. 18A-D are bar graphs illustrating the capability of N-AChE-R for elevating ATP levels in CHO cells stably transfected with the noted expression vectors.
  • both the R and the NR but not the S vector elevated ATP levels in the transfected cells ( Figure 18A), suggesting association with the R C-terminus and its interaction with Enolase.
  • NR-transfected cells expressed considerably less acetylthiocholine hydrolytic activity, likely due to lower expression efficacy o * f the G, C-rich sequence encoding the N-terminal extension ( Figure 18B and Meshorer, JBC 2004). Therefore, the increased ATP levels were due to considerably less NR protection ( Figure 18C). In vivo relevance of this effect was demonstrated in sperm cells from TgR mice, where overexpressed R protein elevated ATP levels ( Figure 18D).
  • the present invention is of ACHE polypeptides, polynucleotides, compositions comprising same and uses thereof.
  • acetylcholine (ACh)-hydrolyzing enzyme AChE
  • AChE acetylcholinesterase
  • PNS peripheral
  • CNS central
  • AChE also plays morphogenic roles and participates in various stress responses.
  • ACIiE valiants arising from 3' alternative splicing have been described such as the readthrough form designated AChE-R - ('R' for 'read-through').
  • AChE-R - Unlike the canonical tetrameric AChE-S ('S' for synaptic) isoform (a.k.a AChE-T; 'T' for 'tailed') produced by joining of exon 4 with exon 6, ACIiE-R is produced by retained intron 4/exon 5, yielding an AChE mRNA variant with an alternative 3' end (Figure IA).
  • This transcript generates an alternative protein product with a distinct, shorter C- terminus which lacks the cysteine residue present in the C-terminus of AChE-S and which enables the multimerization of AChE.
  • Stress-induced expression of AChE is accompanied by a prominent shift in the protein C-terminus from the "synaptic" variant to the "readthrough” sequence.
  • AChE alternatively spliced transcripts
  • the uniqueness of each variant is accentuated by its expression timing, i.e. during health or disease, during normal or stressful situations; its expression compartment, i.e. in neuritic processes, on synaptic membranes, etc. and its interaction partners. These three factors determine an additional dimension in the intricate control over the variant AChE proteins.
  • both AChE-R and AChE-S can either appear with a cleavable N-terminal signal peptide or with an extended N terminus potentially making it membrane-bound ( Figure ID).
  • N-AChE-S promotes apoptosis in a variety of cell types ( Figures 4A-E). Accordingly, in cultured cells, transfection or microinjection of N-AChE-S cDNA caused cell death preventable by AChE and kinase inhibitors. Importantly, various cytotoxic stimuli induced prominent accumulation of N-AChE-S, which was found to be membrane associated and inherently expressed in cell types subject to frequent apoptosis. In Alzheimer's disease, N-AChE-S increases occurred in the vulnerable hippocampal dentate gyrus neurons, reaching their axonal mossy fibers ( Figures 8A-D and Figures 1 OA-C).
  • N-AChE-S gain of apoptotic function in development and aging, compatible with the hypothesis that its induction causes premature death of cholinergic neurons in Alzheimer's disease
  • the N-AChE-R variant comprises a neuroprotective activity.
  • N-AChE-R over-expression protects cultured cells from apoptosis induced by protein synthesis inhibitors.
  • N-AChE-R may be considered as a promoter of cell survival and cell proliferation.
  • N- AChE-R induces down-regulation of the Alzheimer's disease ER protein encoding transcripts PSEN2 and APBBl ( Figure HA).
  • N-AChE-R serves to suppress cytoplasmic and ER stress by modifying translational regulation, and that its overproduction in Alzheimer's disease operates as a stress-induced effort for neuroprotection.
  • an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-R attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO: 3.
  • AChE-R refers to the AChE splice variant polypeptide as set forth in SEQ ID NO:2, which results from the readthrough mRNA transcript, AChE-R mRNA, which is as set forth in SEQ ID NO:4 - (Meshorer, E. & Soreq, H. (2006) Trends Neuroscl 29, 216-24).
  • the term "AChE” refers to the polypeptide EC 3.1.1.7, GenBank Accession No. P22303; ACES_HUMAN.
  • the N-terminal extension of the present invention is preferably at least 70 % homologous to SEQ ID NO: 3, or at least 80 % homologous to SEQ ID NO: 3 , or more preferably at least 90 % homologous to SEQ ID NO: 3, or more preferably at least 95 % homologous and even more preferably is as set forth in SEQ ID NO: 3.
  • N terminal extension prevents cleavage of a signal peptide, which could then serve as a transmembrane domain enabling AChE to anchor itself to the synaptic membrane.
  • an isolated polynucleotide refers to a single or double stranded nucleic acid sequences which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
  • complementary polynucleotide sequence refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent
  • genomic polynucleotide sequence refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.
  • composite polynucleotide sequence refers to a sequence, which is at least partially complementary and at least partially genomic.
  • a composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween.
  • the intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements.
  • the polynucleotides of the present invention are typically splice variants of the AChE gene associated with a distinct upstream promoter — see figure 1C.
  • the phrase "splice variant” refers to alternative forms of RNA transcribed from an AChE gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence.
  • the term splice variant is also used herein to denote a polypeptide encoded by a splice variant of an mRNA transcribed from a gene.
  • polynucleotides of the present invention may also be allelic variants of the sequence.
  • allelic variant refers to two or more alternative forms of a AChE gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. According to this aspect of the present invention, gene mutations encode polypeptides having altered amino acid sequence i.e. an extended N terminus.
  • allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
  • the nucleic acid sequence of the above-described isolated polynucleotides of the present invention are as set forth in SEQ ID NO:4 and SEQ ID NO: 7.
  • the polynucleotides of this aspect of the present invention may have a nucleic acid sequence at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 87 %, at least 89 %, at least 90 % at least 91 %, at least 93 %, at least 95 % or more say 100 % identical to SEQ ID NO: 4 or 7, as determined using BlastN software of the National Center of Biotechnology Information (NCBI) using default parameters. Methods of identifying homologues are further described hereinbelow.
  • NCBI National Center of Biotechnology Information
  • the present invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
  • polypeptide sequences of the present invention encode previously unidentified polypeptides
  • the present invention also encompasses novel polypeptides or portions thereof, which are encoded by the isolated polynucleotides and respective nucleic acid fragments thereof described hereinabove.
  • the present invention also encompasses polypeptides encoded by the polynucleotide sequences of the present invention.
  • Exemplary amino acid sequences of these novel polypeptides are set forth in SEQ ID NOs: 1 or 5.
  • the present invention also encompasses homologues of these polypeptides, such homologues can be at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to SEQ ID NOs: 1 or 5.
  • N-AChE-R The AChE-R polypeptide of this aspect of the present invention (hereinafter, referred to as N-AChE-R) preferably comprises a neuroprotecting activity.
  • neuroprotecting refers to reducing, arresting or ameliorating nervous insult (e.g. apoptotoic or oxidative stress), and protecting, resuscitating, or reviving nervous tissue that has suffered nervous insult.
  • nervous insult e.g. apoptotoic or oxidative stress
  • the present inventors have shown that N-AChE-R over-expression protects cultured cells from apoptosis induced by protein synthesis inhibitors (see Figures 1 IA-B). In the most simplistic phrasing the term encompasses induction of neural cell proliferation and/or at least cell survival
  • an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence of ACHE-S attached to an N-terminal extension, the N-terminal extension being at least 90 % homologous to SEQ ID NO:
  • AChE-S refers to the AChE splice variant polypeptide as set forth in SEQ ID NO: 6, which results from the synaptic mRNA transcript, AChE-S mRNA as set forth in SEQ ID NO: 6 (Seidman S, et al.,. MoI Cell Biol. 1995;15(6):2993-3002).
  • N-AChE-S The AChE-S polypeptide of this aspect of the present invention (hereinafter referred to as N-AChE-S) comprises an apoptotic activity.
  • the present inventors have shown that N-AChE-S over-expression in cultured cells induces apoptosis (see Figures 4A-E).
  • apoptotic activity refers to an ability to induce programmed cell death e.g. by the activation of caspases.
  • the present invention also encompasses fragments of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion.
  • the polypeptides of present invention can be biochemically synthesized such as by using standard solid phase techniques. These methods include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis. These methods are preferably used when the polypeptide is relatively short (i.e., 10 kDa) and/or when it cannot be produced by recombinant techniques (i.e., not encoded by a nucleic acid sequence) and therefore involves different chemistry. Solid phase polypeptide synthesis procedures are well known in the art and further described by John Morrow Stewart and Janis Dillaha Young, Solid Phase Polypeptide Syntheses (2nd Ed., Pierce Chemical Company, 1984).
  • Synthetic polypeptides can be purified by preparative high performance liquid chromatography [Creighton T. (1983) Proteins, structures and molecular principles. WH Freeman and Co. N. Y.] and the composition of which can be confirmed via amino acid sequencing.
  • Recombinant techniques are preferably used to generate the polypeptides of the present invention since these techniques are better suited for generation of relatively long polypeptides (e.g., longer than 20 amino acids) and large amounts thereof.
  • Such recombinant techniques are described by Bitter et al., (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89,
  • polynucleotide encoding a polypeptide of the present invention is ligated into a nucleic acid expression vector, which comprises the polynucleotide sequence under the transcriptional control of a cis-regulatory sequence (e.g., promoter sequence) suitable for directing constitutive, tissue specific or inducible transcription of the polypeptides of the present invention in the host cells.
  • a cis-regulatory sequence e.g., promoter sequence
  • trans acting regulatory element refers to a polynucleotide sequence, preferably a promoter, which binds a trans acting regulator and regulates the transcription of a coding sequence located downstream thereto.
  • operably linked refers to a functional positioning of the cis-regulatory element (e.g., promoter) so as to allow regulating expression of the selected nucleic acid sequence.
  • a promoter sequence may be located upstream of the selected nucleic acid sequence in terms of the direction of transcription and translation.
  • the expression vector of the present invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhances) and transcription and translation terminators (e.g., polyadenylation signals).
  • prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptides of the present invention.
  • microorganisms such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the polypeptide coding sequence; yeast transformed with recombinant yeast expression vectors containing the polypeptide coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the polypeptide coding sequence.
  • virus expression vectors e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV
  • yeast a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447.
  • vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N. Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • Polyadenylation sequences can also be added to the expression vector in order to increase the translation effeciency of a polypeptide expressed from the expression vector of the present invention.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • the expression vector of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
  • IRS internal ribosome entry site
  • polypeptides e.g. N-AChE-S
  • a pro-apoptotic polypeptide such as Bax, a member of the Bcl-2 family.
  • plant cells are used to express the polypeptides of the present invention.
  • plant refers to a whole plant, portions thereof, plant cell, plant cell culture or plant cell suspension.
  • the transformed or transfected plant of the present invention may be any monocotyledonous or dicotyledonous plant or plant cell, as well as, coniferous plants, moss, algae, monocot or dicot and other plants listed in www.nationmaster.com/encyclopedia/Plantae.
  • monocotyledonous plants include, which can be used in accordance with the present invention include, but are not limited to, corn, cereals, grains, grasses, and rice.
  • dicotyledonous plants which can be used in accordance with the present invention include, but are not limited to, tobacco, tomatoes, potatoes, and legumes including soybean and alfalfa.
  • the nucleic acid sequence encoding the AChE polypeptides of the present invention may be altered, to further improve expression levels in plant expression system.
  • the nucleic acid sequence of N-AChE-S or N-AChE-R may be modified in accordance with the preferred codon usage for plant expression.
  • Increased expression of the AChE polypeptides in plants may be obtained by utilizing a modified or derivative nucleotide sequence. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in plants, and the removal of codons atypically found in plants commonly referred to as codon optimization.
  • codon optimization refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within a plant.
  • the promoter in the nucleic acid construct of the present invention is a plant promoter which serves for directing expression of the nucleic acid molecule within plant cells.
  • plant promoter refers to a promoter which can direct transcription of the polynucleotide sequence in plant cells.
  • a promoter can be derived from a plant, bacterial, viral, fungal or animal origin.
  • the promoter may be constitutive, i.e., capable of directing high level of gene expression in a plurality of plant tissues, tissue specific, i.e., capable of directing gene expression in a particular plant tissue or tissues, developmentally regulated, inducible, i.e., capable of directing gene expression under a stimulus, or chimeric.
  • constitutive plant promoters include, but are not limited to CaMV35S and CaMV19S promoters, FMV34S promoter, sugarcane bacillifqrm badnavirus promoter, CsVMV promoter, Arabidpsis ACT2/ACT8 actin promoter, Arabidpsis ubiquitin UBQ 1 promoter, barley leaf thionin BTH6 promoter, and rice actin promoter.
  • protein expression is particularly high in the tissue from which extraction of the protein is desired.
  • expression may be targeted to the endosperm, aleurone layer, embryo (or its parts as scutellum and cotyledons), pericarp, stem, leaves, tubers, trichomes, seeds, roots, etc.
  • tissue specific promoters include, but are not limited to bean phaseolin storage protein promoter, DLEC promoter, PHS ⁇ promoter, zein storage protein promoter, conglutin gamma promoter from soybean, AT2S1 gene promoter, ACTIl actin promoter from Arabidpsis, napA promoter from Brassica napus and potato patatin gene promoter.
  • An inducible promoter is a promoter induced by a specific stimulus such as stress conditions comprising, for example, light, temperature, chemicals, drought, high salinity, osmotic shock, oxidant conditions or in case of pathogenicity. Usually the promoter is induced before the plant is harvested and as such is referred to as a pre-harvest promoter.
  • inducible pre-harvest promoters include, but are not limited to, the light-inducible promoter derived from the pea rbcS gene, the promoter from the alfalfa rbcS gene, the promoters DRE, MYC and MYB active in drought; the promoters INT, INPS, prxEa, Ha hspl7.7G4 and RD21 active in high salinity and osmotic stress, and the promoters hsr2O3J and str246C active in pathogenic stress.
  • the inducible promoter may also be an inducible post-harvest promoter e.g. the inducible MeGA.TM promoter (U.S. Pat. No. 5,689,056).
  • the preferred signal utilized for the rapid induction of the MeGA TM promoter is a localized wound after the plant has been harvested.
  • the nucleic acid construct of the present invention may also comprise an additional nucleic acid sequence encoding a signal peptide that allows transport of the AChE polypeptides in-frame fused thereto to a sub-cellular organelle within the plant, as desired.
  • subcellular organelles of plant cells include, but are not limited to, leucoplasts, chloroplasts, chromoplasts, mitochondria, nuclei, peroxisomes, endoplasmic reticulum and vacuoles. Compartmentalization of the AChE recombinant protein within the plant cell followed by its secretion is one pre-requisite of making the product easily purifiable.
  • Exemplary signal peptides that may be used herein include the tobacco pathogenesis related protein (PR-S) signal sequence (Sijmons et al, 1990, Bio/technology, 8:217-221), lectin signal sequence (Boehn et al, 2000, Transgenic Res, 9(6):477-86), signal sequence from the hydroxyproline-rich glycoprotein from Phaseolus vulgaris (Yan et al, 1997, Plant Phyiol. 115(3):915-24 and Corbin et al, 1987, MoI Cell Biol 7(12):4337-44), potato patatin signal sequence (Iturriaga, G et al, 1989, Plant Cell 1:381-390 and Bevan et al, 1986, Nuc.
  • PR-S tobacco pathogenesis related protein
  • targeting signals may be cleaved in vivo from the AChE variat sequence, which is typically the case when an apoplast targeting signal, such as the tobacco pathogenesis related protein-S (PR-S) signal sequence (Sijmons et al, 1990, Bio/technology, 8:217-221) is used.
  • PR-S tobacco pathogenesis related protein-S
  • Pat. Appl. No. 20050039235 teaches the use of signal and retention polypeptides for targeting recombinant insulin to the ER or in an ER derived storage vesicle (e.g. an oil body) in plant cells thereby increasing the accumulation of insulin in seeds.
  • ER retention motifs include KDEL, HDEL, DDEL, ADEL and
  • Yet another important strategy to facilitate purification is to fuse the recombinant N-AChE R and S variants of the present invention with an affinity tag by including a sequence of the tag in the nucleic acid construct of the present invention.
  • This method is widely utilized for in vitro purification of proteins.
  • Exemplary purification tags for purposes of the invention include but are not limited to polyhistidine, V5, myc, protein A, gluthatione-S-fransferase, maltose binding protein (MBP) and cellulose-binding domain (CBD) [Sassenfeld, 1990, TIBTECH, 8, 88-9].
  • the AChE polypeptides are fused to a substrate- binding region of a polysaccharidase (cellulases, chitinases and amylases, as well as xylanases and the beta.- 1,4 glycanases).
  • the affinity matrix containing the substrate such as cellulose can be employed to immobilize the AChE polypeptides.
  • the AChE polypeptides can be removed from the matrix using a protease cleavage site.
  • the nucleic acid construct of the present invention may also comprise a sequence that aids in proteolytic cleavage, e.g., a thrombin cleavage sequence. Such a sequence may permit the AChE polypeptides to be separated from an attached co- translated sequence such as the ER retention sequences described above.
  • the nucleic acid construct of the present invention may be capable of integrating into the plant genome and as such would direct the expression of a AChE polypeptide coding sequence.
  • the nucleic acid construct may be an episomal construct directing a transient AChE coding sequence expression.
  • the above-described nucleic acid construct can be used for producing N- AChE-R and N-AChE-S in plants. This can be effected by (a) introducing the nucleic acid construct described hereinabove into a plant; (b) cultivating the plant under conditions which allow expression of the acetylcholinesterase; and (c) recovering the acetylcholinesterase from the plant.
  • the Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in [Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach] employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledenous plants (as described in the Examples section which follows).
  • DNA transfer into plant cells There are various methods of direct DNA transfer into plant cells.
  • electroporation the protoplasts are briefly exposed to a strong electric field.
  • microinjection the DNA (i.e. nucleic acid construct encoding the AChE variants of the present invention) is mechanically injected directly into the cells using very small micropipettes.
  • microparticle bombardment the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
  • Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein.
  • the new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant.
  • Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant.
  • the advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
  • Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages.
  • the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening.
  • stage one initial tissue culturing
  • stage two tissue culture is established and certified contaminant-free.
  • stage two the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals.
  • stage three the tissue samples grown in stage two are divided and grown into individual plantlets.
  • the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
  • stable transformation is presently preferred, transient transformation of leaf cells, meristematic cells or the whole plant is also envisaged by the present invention.
  • Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
  • Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV) 5 EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et ah, Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
  • the AChE may be clinically used following recovery.
  • the term "recovery” refers to at least a partial purification to yield a plant extract, homogenate, fraction of plant homogenate or the like. Partial purification may comprise, but is not limited to disrupting plant cellular structures thereby creating a composition comprising soluble plant components, and insoluble plant components which may be separated for example, but not limited to, by centrifugation, filtration or a combination thereof.
  • proteins secreted within the extracellular space of leaf or other tissues could be readily obtained using vacuum or centrifugal extraction, or tissues could be extracted under pressure by passage through rollers or grinding or the like to squeeze or liberate the protein free from within the extracellular space.
  • Minimal recovery could also involve preparation of crude extracts of AChE variants, since these preparations would have negligible contamination from secondary plant products. Further, minimal recovery may involve methods such as those employed for the preparation of FlP as disclosed in Woodleif et ah, Tobacco Sci. 25, 83-86 (1981). These methods include aqueous extraction of soluble protein from green tobacco leaves by precipitation with any suitable salt, for example but not limited to KHSO 4 . Other methods may include large scale maceration and juice extraction in order to permit the direct use of the extract.
  • recovery of the AChE polypeptides from the plant (whole plant) or plant culture can be effected using more sophisticated purification methods which are well known in the art.
  • collection and/or purification of N-AChE variants from plant cells or plants can depend upon, the particular expression system and the expressed sequence.
  • Separation and purification techniques can include, for example, ultra filtration, affinity chromatography and or electrophoresis.
  • molecular biological techniques known to those skilled in the art can be utilized to produce variants having one or more heterologous peptides which can assist in protein purification (purification tags, as described above).
  • Such heterologous peptides can be retained in the final functional protein or can be removed during or subsequent to the collection/isolation/puriflcation processing.
  • AChE variants of the present invention is preferably highly purified such as to medical grade purity (e.g., > 95 %).
  • Recombinant proteins of the present invention may be modified prior to or following recovery as further described hereinbelow.
  • AChE is a glycoprotein comprising 3 potential N-glycosylation sites. Glycosylation at all sites is important for effective biosynthesis and secretion fVelan et al, Biochem J. 1993 December 15; 296(Pt 3): 649-656]. Although plants glycosylate human proteins at the correct position, the composition of fully processed complex plant glycans differ from mammalian N- linked glycans.
  • Plant glycans do not have the terminal sialic acid residue or galactose residues common in animal glycans and often contain a xylose or fucose residue with a linkage that is generally not found in mammals (Jenkins et al., 14 Nature Biotech 975-981 (1996); Chrispeels and Faye in transgenic plants pp. 99-114 (Owen, M. and Pen, J. eds. Wiley & Sons, N. Y. 1996; Russell 240 Curr. Top. Microbio. Immunol. (1999). Specifically, plants comprise additional beta 1-2 linked xylosyl- and alpha 1- 3 linked fucosyl-residues which are not found in mammals. Conversely they do not comprise fucosyl-l-6-residues which are present in mammals.
  • the present invention contemplates the use of various strategies to address the issue of "humanization" of glycans of the AChE variants products synthesized in plants. Such strategies are known in the art - see e.g. U.S. Pat. Appl. 20030033637 Amino acid sequence information of the polypeptides of the present invention can be used to generate antibodies, which bind to the polypeptide variants of the present invention.
  • antibody refers to both polyclonal and monoclonal antibodies and includes whole antibody molecules as well as functional fragments thereof, such as Fab, F(ab') 2 , and Fv that are capable of binding with antigenic portions of the target polypeptide.
  • functional antibody fragments constitute preferred embodiments of the present invention, and are defined as follows:
  • Fab the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;
  • Fab 1 the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule;
  • (Fab') 2 the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab') 2 is a dimer of two Fab' fragments held together by two disulfide bonds;
  • Fv defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
  • Single chain antibody a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule as described in, for example, U.S. Patent 4,946,778. Methods of generating such antibody fragments are well known in the art.
  • a humanized antibody has one or more amino acid residues introduced into it from a source, which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al, Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (U.S. Pat. No.. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. MoI. Biol., 227:381 (1991); Marks et al., J. MoI. Biol., 222:581 (1991)].
  • the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boemer et al., J. Immunol, 147(l):86-95 (1991)].
  • human monoclonal antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
  • the antibody of the present invention may be used to diagnose apoptosis-related disorders and/or neurodegenerative disorders.
  • diagnosis refers to classifying a disease or a symptom as an apoptosis-related disorders and/or neurodegenerative disorder, determining a predisposition to an apoptosis-related disorders and/or neurodegenerative disorder, determining a severity of a apoptosis-related disorders and/or neurodegenerative disorder, monitoring disease progression, forecasting an outcome of a disease and/or prospects of recovery.
  • neurodegenerative disease refers to any disorder, disease or condition of the nervous system (preferably CNS) which is characterized by gradual and progressive loss of neural tissue, neurotransmitter, or neural functions.
  • Examples of neurodegenerative disorders include, but are not limited to, Alzheimer's disease, Parkinson's disease, glaucatomus neuropathy, multiple sclerosis, retinal disorder, myasthenia gravis, amyotrophic lateral sclerosis, autoimmune encephalomyelitis, diabetic neuropathy, cerebrovascular accident (stroke), idiopathic dementia and Huntington's disease.
  • the neurodegenerative disease may also be a neural trauma e.g., injuries such as spinal cord injuries and head injuries. According to a preferred embodiment of this aspect of the present invention, the neurodegenerative disease is Alzheimer's.
  • the present invention also envisages oligonucleotides capable of specifically hybridizing the polynucleotides of the present invention.
  • oligonucleotide refers to a single-stranded or double-stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions.
  • Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art, such as enzymatic synthesis or solid-phase synthesis.
  • Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), "Molecular Cloning: A Laboratory Manual”; Ausubel, R. M. et al., eds.
  • the oligonucleotides of the present invention typically comprise about the same number of nucleotides as the polynucleotides of the present invention since the oligonucleotides must hybridise with both ends (i.e. 5' and 3' end) of the polynucleotides of the present invention in order to confer specificity.
  • the oligonucleotides of the present invention may be used to screen cDNA libraries so as to identify homologous variants. Screening may be performed at moderate to stringent hybridization conditions e.g. with a hybridization solution containing 10 % dextrane sulfate, 1 M NaCl, 1 % SDS and 5 x 10 6 cpm 32 P labeled probe, at 65 °C, with a final wash solution of 0.2 x SSC and 0.1 % SDS and final wash at 65 °C
  • the phrase "capable of hybridizing” refers to forming a double strand molecule such as RNA:RNA, RNA:DNA and/or DNA:DNA molecules.
  • novel homologous variants of the present invention may be identified by immunocloning.
  • an expression library of nerve cells may be screened using an antibody raised against an antibody of the present invention. Methods of generating antibodies to the polypeptides of the present invention are described hereinabove.
  • the N-AChE-S variant of the present invention has been shown to affect induce cell death via apopotosis.
  • a method of inducing cell death the method comprising up-regulating activity and/or expression of N-AChE-S.
  • polynucleotides encoding same are ligated into nucleic acid expression vectors, such that the polynucleotide sequence is under the transcriptional control of a cis-regulatory sequence as further described hereinabove.
  • the method further comprises down-regulating the expression and/or activity of N- AChE- R. Methods of down-regulating polypeptides are further described hereinbelow.
  • Regulating the expression and/or activity of the polypeptides of the present invention may be effected in vitro, ex vivo and/or in-vivo, as further described hereinbelow.
  • N-AChE-S has been shown to be associated with an up-regulation of apoptosis, it may be used to treat subjects with apoptosis-related disorders.
  • a method of treating an apoptosis related disorder comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of regulating the activity or expression of N-AChE-S.
  • treating refers to preventing, alleviating or diminishing a symptom associated with a cell migration-related disease.
  • treating cures, e.g., substantially eliminates, the symptoms associated with the apoptosis-related disease.
  • subject refers to any (e.g., mammalian) subject, preferably a human subject.
  • Medical conditions which would benefit from an upregulation of the N-AChE- S polypeptides of the present invention include hyperproliferative disorders such as cancer.
  • N-AChE-S is a membrane-bound protein and therefore cannot be administered as a protein as such
  • a particularly preferred method of administering the N-AChE-S polypeptides of the present invention is by gene therapy.
  • Gene therapy refers to the transfer of genetic material (e.g.
  • DNA or RNA of interest into a host to treat or prevent a genetic or acquired disease or condition or phenotype.
  • the genetic material of interest encodes a product (e.g. a protein, polypeptide, peptide, functional RNA, antisense) whose production in vivo is desired.
  • the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value.
  • ex vivo and (2) in vivo gene therapy Two basic approaches to gene therapy have evolved: (1) ex vivo and (2) in vivo gene therapy.
  • ex vivo gene therapy cells are removed from a patient, and while being cultured are treated in vitro.
  • a functional replacement gene is introduced into the cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the host/patient.
  • These genetically reimplanted cells have been shown to express the transfected genetic material in situ.
  • the cells may be autologous or non-autologous to the subject. Since non-autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non-autologous cells. These include either suppressing the recipient immune system or encapsulating the non-autologous cells in immunoisolating, semipermeable membranes before transplantation.
  • target cells are not removed from the subject rather the genetic material to be transferred is introduced into the cells of the recipient organism in situ, that is within the recipient.
  • the host gene if the host gene is defective, the gene is repaired in situ (Culver, 1998. (Abstract) Antisense DNA & RNA based therapeutics, February 1998, Coronado, CA).
  • nucleic acid constructs used to express the polypeptides of the present invention may comprise cell-specific promoter sequence elements.
  • nucleic acids by infection in both in vivo and ex vivo gene therapy offers several advantages over the other listed methods. Higher efficiency can be obtained due to their infectious nature. Moreover, viruses are very specialized and typically infect and propagate in specific cell types. Thus, their natural specificity can be used to target the vectors to specific cell types in vivo or within a tissue or mixed culture of cells. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through receptor mediated events.
  • recombinant viral vectors are useful for in vivo expression of a desired nucleic acid because they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • viruses are very specialized infectious agents that have evolved, in may cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral utilizes its natural specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the vector to be used in the methods of the invention will depend on desired cell type to be targeted and will be known to those skilled in the art.
  • N-AChE-S polypeptides of the present invention include neurodegenerative disorders such as Alzheimers.
  • Down-regulating the function or expression of the AChE variant polypeptides of the present invention can be effected at- the RNA level or at the protein level.
  • the agent is an oligonucleotide capable of specifically hybridizing (e.g., in cells under physiological conditions) to a polynucleotide encoding the AChE variant polypeptides.
  • Such ologonucleotide agents are further described hereinabove.
  • RNA interference is a two-step process. During the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA), probably by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner.
  • nt nucleotide small interfering RNAs
  • RNA 19-21 bp duplexes (siRNA), each strand with 2-nucleotide 3' overhangs [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); and Bernstein Nature 409:363-3.66 (2001)].
  • the siRNA duplexes bind to a nuclease complex to form the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC.
  • the active RISC targets the homologous transcript by base pairing interactions and cleaves the niRNA into 12 nucleotide fragments from the 3' terminus of the siRNA [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); Hammond et ah, (2001) Nat. Rev. Gen. 2:110-119 (2001); and Sharp Genes. Dev. 15:485-90 (2001)].
  • each RISC contains a single siRNA and an RNase [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)].
  • RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi amplification step within the RNAi pathway has been suggested. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC [Hammond et al, Nat. Rev. Gen. 2:110-119 (2001), Sharp Genes. Dev. 15:485-90 (2001); Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)]. For more information on RNAi see the following reviews Tuschl ChemBiochem. 2:239-245 (2001); Cullen Nat. Immunol. 3:597-599 (2002); and Brantl Biochem. Biophys. Act. 1575:15-25 (2002).
  • RNAi molecules suitable for use with the present invention can be effected as follows. First, the AChE variant polypeptide (e.g. N-AChE-S) polynucleotide sequence target is scanned downstream for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites.
  • AChE variant polypeptide e.g. N-AChE-S
  • potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.
  • an appropriate genomic database e.g., human, mouse, rat etc.
  • sequence alignment software such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/).
  • Qualifying target sequences are selected as template for siRNA synthesis.
  • Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %.
  • Several target sites are preferably selected along the length of the target gene for evaluation.
  • a negative control is preferably used in conjunction.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome.
  • a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • DNAzyme molecule capable of specifically cleaving its encoding polynucleotide.
  • DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R.R. and Joyce, G. Chemistry and Biology 1995;2:655; Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 1997;94:4262).
  • a general model (the "10-23" model) for the DNAzyme has been proposed.
  • DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each.
  • This type of DNAzyme can effectively cleave its substrate RNA at purine :pyrimidine junctions (Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 199; for rev of DNAzymes see Khachigian, LM [Curr Opin MoI Ther 4: 119-21 (2002)].
  • DNAzymes complementary to bcr-abl oncogenes were successful in inhibiting the oncogenes expression in leukemia cells, and lessening relapse rates in autologous bone marrow transplant in cases of Chronic Myelogenous Leukemia (CML) and Acute Lymphocytic Leukemia (ALL).
  • CML Chronic Myelogenous Leukemia
  • ALL Acute Lymphocytic Leukemia
  • Another agent capable of downregulating the expression of the AChE variant polypeptides of the present invention is a ribozyme molecule capable of specifically cleaving its encoding polynucleotide. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al, Curr Opin Biotechnol. 9:486-96 (1998)]. The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications.
  • TFOs triplex forming oligonuclotides
  • oligonuclotides Modification of the oligonuclotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation - concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer (2003) J Clin Invest;l 12:487-94).
  • the triplex-forming oligonucleotide has the sequence correspondence: oligo 3'-A G G T duplex 5' ⁇ A G C T duplex 3' ⁇ T C G A
  • triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.
  • Transfection of cells for example, via cationic liposomes
  • TFOs Transfection of cells (for example, via cationic liposomes) with TFOs, and subsequent formation of the triple helical structure with the target DNA, induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and results in the specific downregulation of gene expression.
  • Examples of such suppression of gene expression in cells treated with TFOs include knockout of episomal supFGl and endogenous HPRT genes in mammalian cells (Vasquez et al, Nucl Acids Res.
  • TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes [Seidman and Glazer, J Clin Invest (2003) 112:487-94].
  • Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et al, and 2002 0128218 and 2002 0123476 to Emanuele et al, and U.S. Pat. No. 5,721,138 to Lawn.
  • AChE variant polypeptide of the present invention can also be affected at the protein level.
  • an agent capable of downregulating an AChE variant polypeptide of the present invention is an antibody or antibody fragment capable of specifically binding to it, preferably to its active site, thereby preventing its function.
  • Methods of generating antibodies specific for the AChE variants of the present invention are further described hereinabove.
  • N-AChE-R variant of the present invention was shown to promote cell survival.
  • a method of promoting cell survival comprising up- regulating activity and/or expression of N-AChE-R.
  • the method may be effected in vivo, ex-vivo or in vitro as described for N- AChE-S. Methods of up-regulating expression of the polypeptides of the present invention have been described hereinabove. It will be appreciated that since N- AChE-R was shown to be a secretable polypeptide ( Figures 2A-E), lip-regulating N- AChE-R may be effected by providing the polypeptide itself. Furthermore, since N- AChE-S has an opposing effect on cell survival the method may further comprise down-regulating the activity and/or function of N-AChE-S.
  • N-AChE-R has been shown to be neuroprotective, an up-regulation therof may be effected to treat neurodegenerative disorders such as Alzheimers, ALS, Diabetes and Lewy body disease.
  • the present inventors have shown that N-AChE-R is detrimental to retinal- related disorders (See Example 6).
  • the present invention also contemplates down-regulating N-AChE-R in order to treat disorders such as retinitis pigmentosa and age-related macular degeneration.
  • N-ACIiE-R is capable of increasing ATP (See Example 7).
  • both the R and the NR but not the S vector elevated ATP levels in the transfected cells, suggesting association with the R C- terminus and its interaction with Enolase (see for example Mor et al, (2001) Faseb J 15, 2039-41).
  • NR-transfected cells expressed considerably less acetylthiocholine hydrolytic activity, likely due to lower expression efficacy of the G, C-rich sequence encoding the N-terminal extension (Panel B and Meshorer, JBC 2004). Therefore, the increased ATP levels were due to considerably less NR protection (Figure 18C). In vivo relevance of this effect was demonstrated in sperm cells from TgR mice, where overexpressed R protein elevated ATP levels (Figure 18D). Accordingly, the present invention also contemplates up-regulating N-AChE-
  • the AChE variants of the present invention can be provided to the treated subject (i.e. mammal) per se (e.g., purified or directly as part of a plant) or can be provided in a pharmaceutical composition comprising.
  • a pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the recombinant AChE variants of the present invention accountable for the biological effect.
  • pharmaceutically acceptable carrier refers to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • Pharmaceutical compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuos infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • compositions of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid construct) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., ischemia) or prolong the survival of the subject being treated.
  • a therapeutically effective amount means an amount of active ingredients (nucleic acid construct) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., ischemia) or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
  • Dosage amount and interval may be adjusted individually to provide plasma or brain levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • the amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
  • Tissue culture reagents were from Biological Industries (Beit HaEmek, Israel).
  • Chinese hamster ovary (CHO), human glioblastoma (U87MG), human embryonic kidney HEK293 and NIH/3T3 fibroblast cells are all grown in a humidified atmosphere with 5 % CO 2 at 37 0 C in Dulbecco's modified Eagle's medium (DMEM, Biological Industries) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 10% fetal calf serum (FCS) for U87MG, CHO and 293 cells.
  • DMEM Dulbecco's modified Eagle's medium
  • Human fibroblast T84 and SH-SY5Y neuroblastoma cells were cultured at 37°C in a humid 5 % CO 2 atmosphere, in a 1:1 mixture of Eagle's minimum essential medium and Fl 2 medium, containing 10 % fetal calf serum (FCS) and a mixture of 1 % penicillin/streptomycin/amphotericin.
  • Transfection with S 5 R, NS and NR plasmids was performed with lipofectamin 2000 (Invitrogen, Carlsbad, CA) as per the manufacturer's instructions.
  • the N-terminal extension enables only partial attenuation of the protein in membranes and/or vesicles, suggesting that the original signal peptide may function as a trans-membrane domain in only part of the NR and NS molecules.
  • up to 11 % of the intracellular fractions of both variants adhered to endocytotic vesicles (recognized by the clathrin- coated membrane, (5)).
  • This suggested that part of the N-AChE proteins may be internalized into clatherin coated vesicles, similar to TKR, PtdIns(4,5)P 2, etc. (reviewed in ((5)).
  • Cell culture and transfection Transfection of cultured cells with the "conventional” and the N-terminally extended AChE-S and AChE-R variants was followed by measuring cell death using the TUNEL technique. Cells transfected with an "empty vector" served as controls. The transfected cells included HEK 293 (human Embryonic Kidney), U87MG (glioblastoma), CHO (hamster ovary) and T84 (human lung epithelial) cells.
  • HEK 293 human Embryonic Kidney
  • U87MG glioblastoma
  • CHO hamster ovary
  • T84 human lung epithelial
  • RNA extraction and real-time RT-PCR The RNeasy kit (Qiagen, Valencia, CA) was used as per manufacturer's instructions for RNA extraction. DNase was applied to remove of DNA contamination. RNA integrity was confirmed by gel electrophoresis, and RNA concentration and purity was assessed spectrophotometrically. For cDNA synhtesis, 0.4 ⁇ g RNA was used for each sample (Promega, Madison, WI). Real-time PCR was performed in duplicate for each sample using ABI prism 7900HT and SYBR green master mix (Applied biosystems, Foster City, CA). ROX, a passive reference dye, was used for signal normalization across the plate. For normalization, ⁇ -actin mRNA was used as a reference transcript.
  • Annealing temperature was 60 0 C for all primers. Serial dilution of samples served to evaluate primers efficiency and the appropriate cDNA concentration that yields linear changes. Melting curve analysis and amplicons sequencing was used to verify the end product. Primers employed included: For N-AChE (EIe) SEQ ID NO: 8 (188+) AATGCTAGGCCTGGTGATGT and SEQ ID NO: 9 (285- )
  • TUNEL Apoptosis assay TUNEL (terminal UTP-trasferase nick end labeling) staining was performed using the Apo Alert kit from Clontech (Palo Alto, CA ). Cell numbers for each experiment ranged at 3000-11000. Cell counts were determined using a Zeiss Axiophot microscope, (magnification 40Ox). Average ⁇ s.e.m. values (percentage of positive cells) were counted in four independent fields in each cover slip.
  • PBS phosphate-buffered saline
  • Immunohistochemistty Paraffin slices handled simultaneously to minimize inter-slides variability were dewaxed and blocked for Ih in Tris 10 % serum-blocking solution containing horse and goat serum, 5 % each. Primary antibodies were diluted in 2 % TBS-milk /5 % serum mix and applied for 2 hours, RT or overnight at 4 0 C: Anti AChE-S C16 or N-extended; Corresponding biotin-conjugated secondary antibodies were used. Detection was with the ABC kit (Vector) with 3,3'- diaminobenzidine as substrate. Zeiss Axioplan or Bio-Rad MRC - 1024 confocal microscopy served for analysis. Labeling intensity was quantified with ImagePro Plus 4.5 (Media Cybernetics). AChE activities: Acetylthiocholine hydrolysis rates were measured as detailed
  • Total protein extraction Homogenates were diluted in Low Salt detergent, kept on ice for 1 hour; centrifuged at a table centrifuge at maximum speed (13000 rpm) for 30 minutes at 4 0 C, and supernatant transferred to a clean tube and kept frozen at -70°C until use.
  • Fluorescent In Situ hybridization Paraffin-embedded tissue sections were subjected to de-paraffmization with xylene (two 5 -min washes) followed by decreasing ethanol washes (100 %, 75 %, 50 % and 25 %) in PBT (0.13 M NaCl, 7 mM Na 2 HPO 4 -7H 2 O, 3 mM NaH 2 PO 4 -FGO, 0.1% Tween20), and finally twice with PBT. Quenching was applied to suppress autofluorescence.. Sections were then treated with 10 ⁇ g/ml proteinase K (Boehringer Mannheim) for 8 min at room temp and washed with PBT.
  • Prehybridization in 50 % formamide, 5X Sodium saline citrate (SSC), 50 ⁇ g/ml yeast tRNA (Boehringer Mannheim, Germany) and 50 ⁇ g/ml heparin (Sigma) in DDW was at 60 °C for 30 min.
  • Pre-heated hybridization mix including biotin-conjugated probes, 10 ⁇ g/ml was added (in a humid chamber, 90 min or over-night at 52 °C for hEle (N-AChE) and E6 (AChE-S) probes .
  • Detection involved 40 min incubation with streptavidin-conjugated Cy 3 (Jackson) diluted 1:100, at room tempSlides were then washed 3 times with TBST, once in DDW, and mounted with ImmunoMount (Shandon). All slides were handled simultaneously to minimize inter- slides variability. Negative control slides were incubated with a zeta-globin probe that is not expressed in the adult brain.
  • the 2'0-methyl, 5'-Biotinylated cRNA probes (Microsynth, Switzerland) are listed in Table 1, hereinbelow:
  • Confocal Microscopy Sections were captured by excitation at 543 nm of Cy3. Emission was measured with band-passes of 560-615 nm. The microscope detector and Amplifier were calibrated by referring to sections expected to have the highest signal as 100 %. Focus was adjusted to the point of maximal intensity, and the detector and amplifier were adjusted to obtain the optimal image. For subsequent sections, the focus was adjusted but the same amplifier and detector values were maintained to reach the narrow depth of maximal signal intensity.
  • Immunoblot SDS gels were prepared ranged from 10 to 15 % acrylamide depending on protein size. Blocking of phosphorylated proteins was performed using 5 % BSA in TBST, while non phosphorylated proteins used 5 % skim milk.
  • N-AChE-R and N-AChE-S are modifications of CMV-AChE-S and CMV AChE-R with the hEle exon inserted in the HindIII cloning sites.
  • Bcl-xL plasmids were kindly provided by Dr Nunez, of University of Michigan.
  • Bax Inhibitor Plasmid (BI) Science Reagents El Cajun, CA, US).
  • Caspase 3 detector was purchased from Clontech (Palo Alto, CA).
  • Bioinforniatic tools TMHMM Server v. 2.0 Prediction of transmembrane helices in proteins (http://www.cbs.dtu.dk/services/TMHMM-2.0 ⁇ . Classification and Secondary Structure Prediction of Membrane Proteins (http://bp.nuap.nagoya-u.ac.jp/sosui/ )
  • NIH3t3 cells were plated on 35 mm plates and injected with an AIS2 (cell biology trading) computer-assisted microinjection setup. Cells were followed on an 1X70 inverted Olympus microscope fitted with a heated stage, two filter wheels (Sutter) and a Magnafire CCD camera (Optronics). The cells were viewed using a YFP filter (Chroma) and the Magnafire was used in the monochrome mode. The entire setup was controlled using a macro-program developed in-house and running under ImagePro version 4.5 and ScopePro version 4 (Media Cybernetics).
  • AIS2 cell biology trading
  • Electron Microscope Examination Cells were fixed for 1 h in 1 % paraformaldehyde/2.5 % (vol/vol) glutaraldehyde/0.1 M sodium phosphate, pH 7.4 and washed three times. Following staining and rinsing, slides were transferred to 1 % osmium tetroxide for 1 hour, dehydrated in ethanol, embedded in Epon, and sectioned. Thin sections were counterstained with uranyl acetate and lead citrate and analyzed with a Philips 300 electron microscope.
  • CHO cells were grown in DMEM supplemented with 10 % FCS. Plasmids CMV-AChE-S and CMV-AChE-R are the AChE-S and AChE-R encoding cDNAs (Soreq and Seidman 2001) under the control of a CMV promoter.
  • CHO cells were co-transfected the respective plasmid and pEGFP-C2 (Clonetech), which contains the green fluorescent protein and a G-418 resistance gene, in a 1:10 molar ratio using Lipofection 2000 (Invitrogen, San Diego CA) following manufacturers directions. GFP control contains only the pEGFP-C2 plasmid. Cells were selected for approximately 21 days with 500 ⁇ g/ml G-418 in 10%FCS DMEM. Surviving colonies were pooled and grown in 10 % FCS DMEM supplemented with 200 ⁇ g/ml G-418.
  • CHO cells were cultured at 37 °C, 5 % CO 2 in Dulbecco's modified Eagle's medium (DMEM) containing L-glutamine (Sigma) supplemented with 10 % fetal calf serum. Cells were suspended by trypsinization, counted and samples were taken for ATP assay, Ellman's AChE activity assay and protein content determination (Mor et al, 2001, (2001) Faseb J 15, 2039-41).
  • DMEM Dulbecco's modified Eagle's medium
  • L-glutamine Sigma
  • Mouse cauda-epididymis was shredded in 15OmM NaCl, 5.5mM KCl, 0.4mM MgSO 4 , ImM CaCl 2 , 1OmM NaHCO 3 , Hepes-NaOH pH7.4 and 5mM glucose; allowed to sink for about one minute, and cell suspensions transferred to clean tubes.
  • ATP was extracted by boiling cells in 10 mM Tris-HCl buffer pH 8 containing EDTA as recommended by manufacturer.
  • Assay was performed by a luciferase bioluminescence assay (ATP Bioluminescence Assay kit CLSII; Roche) as per manufacturer's instructions for cultured cells and essentially as described elsewhere (Miki et al., 2004, Proc Natl Acad Sci U S A 101, 16501-6) for sperm suspensions.
  • ATP Bioluminescence Assay kit CLSII ATP Bioluminescence Assay kit
  • Acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) efficiently catalyze the hydrolysis of acetylthiocholine (ATCh) - a sulfur analog of the natural substrate of these enzymes. Upon hydrolysis, this substrate analog generates acetate and thiocholine.
  • Thiocholine, in the presence of the highly reactive dithiobisnitro-benzoate (DTNB) ion generates a yellow color, which is visible and can be quantitatively monitored by spectrophotometric absorption at 405 ran.
  • DTNB highly reactive dithiobisnitro-benzoate
  • Human hippocampal protein analysis Immunoblot analysis of hippocampal homogenate samples involved rabbit anti-human AChE-R antibodies directed at the unique C-terminus of AChE-R (1 :700) and anti ⁇ -tubulin (Santa Cruz, 1 :5000).
  • cDNA synthesis (Promega) involved 0.4 ⁇ g RNA samples in 20 ⁇ l reactions.
  • Duplicate real-time RT-PCR tests involved ABI prism 7900HT, SYBR green master mix (Applied biosystems) and ROX, a passive reference dye for signal normalization across the plate. Primer sequences are listed in Table S2. 18S rRNA served as a reference transcript. Annealing temperature was 60° C for all primers. Serial dilution of samples served to evaluate primers efficiency and the appropriate cDNA concentration that yields linear changes. Melting curve analysis and amplicons sequencing verified the identity of end products.
  • Fluorescent in-situ hybridization De-paraffinization of hippocampal coronal 7 ⁇ m paraffin sections involved two washes in xylene, then in 100 %, 75 %, 50 % and 25 % ethanol in PBT (0.13 M NaCl, 7 mM Na 2 HPO 4 -7H 2 O, 3 mM NaH 2 PO 4 -H2O, 0.1 % Tween20), and finally twice with PBT. Quenching was applied to suppress autofluorescence [Sun, A., Nguyen, X.V., and Bing, G. 2002.
  • Pre-heated hybridization mix (including biotin-conjugated probes, 10 ⁇ g/ml) was added (in a humid chamber, 90 min or over-night at 52 °C for the AChE- S and ACIiE-R probes, respectively).
  • AChE catalytic activity was measured by an adaptation of a spectrophotometric method as further described in Example 2 [Ellman, G.L., Courtney, K.D., Andres, V., Jr., and Feather-Stone, R.M. 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7:88- 95] to a microtiter plate assay, to a microtiter plate assay.
  • H134 and 6E10 detection was with the ABC kit (Vector) with 3,3'-diaminobenzidine as substrate.
  • detection involved streptavidin-conjugated Cy3 (1:100, Jackson).
  • RNA extraction and real-time RT-PCR The RNeasy kit (Qiagen, Valencia, CA)WAS USED as per manufacturer's instructions for RNA extraction. DNase was applied to remove of DNA contamination. RNA integrity was confirmed by gel electrophoresis, and RNA concentration and purity was assessed spectrophotometrically. For cDNA synhtesis, 0.4 ⁇ g RNA was used for each sample (Promega, Madison, WI). Real-time PCR was performed in duplicate for each sample using ABI prism 7900HT and SYBR green master mix (Applied biosystems, Foster City, CA). ROX, a passive reference dye, was used for signal normalization across the plate. For normalization, ⁇ -actin niRNA was used as a reference transcript.
  • Annealing temperature was 60 0 C for all primers. Serial dilution of samples served to evaluate primers efficiency and the appropriate cDNA concentration that yields linear changes. Melting curve analysis and amplicons sequencing was used to verify the end product. Primers employed were as for Example 2 (SEQ ID NOs: 8-11). RESULTS
  • glutamate the NMDA receptors agonist
  • Cortisol a glucocorticoid hormone hormone involved in protecting cells from acute stress responses( and caspase independent apoptosis), down-regulated hEle expression.
  • N-AChE protein levels were tested.
  • Thapsigargin significantly increased the immunolabeling of N-AChE in the pro-megakaryocytic MegOl cells ( Figure 5B)
  • ⁇ -Me and etoposide treatments enlarged the fractions of cells intensively expressing N-AChE ( Figures 6 A-E).
  • these increases were accompanied by caspase 3 activation.
  • the resultant cell death could be suppressed by antisense attenuation of N-AChE induction using Monarsen, showed to ameliorate newly synthesized AChE mRNA transcripts ( Figures 6A-E).
  • Bcl-2 anti-apoptotic BcI protein family members Bcl-2, Bcl-xL and BI, all of which disable Bax from triggering the permeabilization of mitochondrial membranes (10), prevented cell death when co- transfected with the NS vector (Figure 7C).
  • NS-induced cell death involves PKC, PKA and GSK3: Many different kinases exert both inhibitory and stimulatory influences on Bel-modulated apoptosis (11-13). To explore their possible involvement in NS-mediated apoptosis, those PKA and PKC inhibitors shown to modulate AChE-R-induced proliferation (14) were used, predicting that NS signaling may induce apoptosis or proliferation trough mutual pathways.
  • the PKA inhibitor H89 significantly suppressed and the PKC inhibitor, BIM showed yet more substantial suppression of the NS-induced cell death
  • Caspase 3 inhibition also suppressed the NS-induced cell death, confirming the relevance to mitochondrial mediated cell death (Figure 7D).
  • NS expression during development FISH analysis for the N and S probes involved a Tissue Array containing 30 different human tissues from embryonic week 33 and 35. hEle exon was expressed in the 33 rd week and was up-regulated in most of the tissues expressing it toward the 35 th week ( Figure 8A, Figures 9A-B). In most, but not all cell types, this was accompanied by E6 expression, denoting NS production. In particular, tissues with massive apoptotic events such as the brain, thymus and the stomach, rich with rapidly replaceable epithel, displayed prominent staining of both hEle and E6 indicating pronounced NS production.
  • NS overexpression in hippocampal dentate gyrus neurons of Alzheimer's disease patients AD patients experience premature death of cholinergic neurons, formation of amyloid fibrils and corresponding deterioration of higher brain functions. Having revealed an apoptotic role for NS, the present examiners searched for potential association(s) between its expression and AD. FISH analysis showed significantly increased hEle expression in dentate gyrus (DG) neurons within hippocampal sections from AD patients as compared to controls ( Figure 8B).This increase was selective to the AD vulnerable DG neurons, and did not occur in the hippocampal CA3 neurons ( Figure 8B).
  • DG dentate gyrus
  • Alzheimer's disease involves loss of cholinergic neurons due to incompletely understood origin(s).
  • transfection or microinjection of N-AChE-S cDNA caused cell death preventable by AChE and kinase inhibitors.
  • various cytotoxic stimuli induced prominent accumulation of N-AChE-S, which was found to be membrane associated and inherently expressed in cell types subject to frequent apoptosis.
  • N-AChE-S increases occurred in the vulnerable hippocampal dentate gyrus neurons, reaching their axonal mossy fibers.
  • the present findings attribute to N-AChE-S gain of apoptotic function in development and aging, compatible with the hypothesis that its induction causes premature death of cholinergic neurons in Alzheimer's disease.
  • Plasmids employed encoded human AChE-S or AChE-R, both under the cytomegalovirus (CMV) promoter- enhancer (Soreq and Seidman 2001).
  • CMV cytomegalovirus
  • the BS Blue-script; Stratagene, La Jolla, CA, USA
  • Overexpression of the different transcripts was confirmed by real-time RT-PCR and immunoblot.
  • Microarray design The in-house 'SpliceChip' oligonucleotide-based microarray was used for all experiments. This microarray carries 244 spotted probes, mostly for spliceosomal components or apoptosis-related genes undergoing alternative splicing. Mouse homologs of reported human spliceosomal proteins (Zhou et al.
  • NCBI BLAST http://www.ncbi.nlm.nih.gov/BLAST/
  • ENTREZ NUCLEOTIDE http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db/ ⁇ Nucleotide
  • EBI- ENSEMBL http://www.ensembl.org/
  • C6 amino- modified 70-mer oligonucleotides from the Operon mouse genome oligo set version 3.0 (Operon, Huntsville, AL, USA) were dissolved in spotting buffer [3 • saline sodium citrate (SSC), 1.5 M betain] to a final concentration of 20 inM, and printed on sialyated (SAL-I) Genorama slides (AsperBiotech, Tartu, Estonia) using the Micro- Grid spotter (Genomic Solutions, Holliston, MA, USA).
  • the array layout (17.76 • 13.26 mm) contains 12 subgrids, each composed of 12 rows and 12 columns.
  • oligonucleotides were spotted six times each on the array; negative controls were spotted 18 times.
  • Experimental design The -SpliceChip was designed for comparison of RNA from cells overexpressing a specific vector to RNA from cells transfected with the 'empty' vector. Data are therefore always relative in nature rather than absolute, based on the 'reference design' (Churchill 2002). To exclude dye-specific labeling differences, we performed dye-swapping tests (Dombkowski et al. 2004). Duplicate slides were used for each specific sample/label combination, so that each comparison includes four SpliceChip slides. Amplification involved 2.8 Ig of each RNA sample.
  • BSA bovine serum albumin
  • SDS sodium dodecyl sulfate
  • Cy3 and Cy5-labeld fragmented RNA (3 Ig each) were added to the hybridization solution (3 x SSC, 0.1 % SDS, 10 Ig polyA, 20 Ig tRNA), heated to 95 °C for 4 min to eliminate secondary structures and applied to the slides in hybridization chambers (Corning, NY, USA) for 15 h at 64 °C.
  • Hybridized slides were successively washed in: 1 x SSC 3 0.1 % SDS (5 min); O.lx SSC, 0.1 % SDS (5 min); and 0.1 x SSC (3 x 1.5 min) and were dried by centrifugation (approximately 1000 g).
  • the LOWESS algorithm (Quackenbush 2002) was applied to account for biases resulting from dependence of the Cy3/Cy5 ratios on signal intensities. The two dye-swapped pairs of replicates for each treatment were then used to correct for dye- specific effects of each transcript (Dombkowski et al. 2004).
  • Identifying significantly changed expression levels Two approaches were used to identify transcripts and groups of transcripts whose expression levels were significantly altered (Ben-Shaul et al. 2005, Faseb J. 19, 910-22). Following the discrete approach, changed transcripts were identified on the basis of those that (i) displayed median LR values larger than 0.3 or smaller than ) 0.3 (corresponding to a fold change threshold of 1.2311 and ) 1.2311, respectively) and that (ii) had a significant (p ⁇ 0.05) non-zero mean using the sign test, conducted on the ensemble of LR values for each transcript. The rationale for combining a statistical approach (sign test) and a threshold for a minimal fold change was to allow identification of small changes, yet without introducing many false positives.
  • the present inventors searched for functional categories of transcripts that were differentially regulated compared with all other transcripts on the SpliceChip. To this end, the cumulative distributions of the transcripts in each functional group were compared with those of the total population of transcripts on the chip, testing for significant differences between those two distributions by the two-sided Kolmogorov- Smirnov (KS) test (Ben-Shaul et al. 2005). Also, the overall LR profiles under AChE- S and AChE-R were compared.
  • KS Kolmogorov- Smirnov
  • RNA 200 ng was reverse-transcribed (RT) in 20 ⁇ l reaction mixture using either random or polyT primers and Improm-II reverse transcriptase (Promega, Madison, WI 5 USA). RNA from both RT reactions was used for real-time PCR, using either the LightCycler (Roche Diagnostics, Mannheim, Germany) or the ABI Prism 7900 instrument (Applied Biosystems, Foster City, CA, USA). Each sample was tested three times. Deviant replicates were omitted if standard deviation from the mean of the three replicates was larger than 0.15 cycles.
  • Quantification involved serial dilutions of the control (1 : 5, 1 : 10, 1 : 20, and 1 : 40) and experimental samples (1 : 15 or 1 : 20). Data were normalized to the quantity of Ndufcl, a housekeeping gene product found to maintain unchanged levels under both AChE-S and AChE-R overexpression. Table 2, hereinbelow lists the relevant primer pairs.
  • cells were incubated with 100 niM glycine (5 min • 3) followed by permabilization and wash with 0.5% Triton X-IOO in PBS, incubation (45 min, 23_C) in a blocking buffer (10% horse serum, 0.05% Tween in PBS) and then for 1 h at 23_C with monoclonal anti-SC35 antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) at a 1 : 40 dilution.
  • a blocking buffer (10% horse serum, 0.05% Tween in PBS
  • Detection was performed with biotin- conjugated secondary antibodies (Jackson, West Grove, PA 5 USA), in blocking buffer at a concentration of 1 : 200 (1 h, 23 °C), three washes (PBS, 5 min), incubation in Cy3-conjugated streptavidin (1 : 100), wash, and DAPI labeling for nuclear staining. Sections were cover-slipped in Shandon immunomount (Shandon, Pittsburgh PA 3 USA) and analyzed by fluorescence microscopy using a Zeiss Axiophot microscope (Zeiss, Oberkochen, Germany) equipped with a digital camera.
  • Image analysis was performed with IMAGEPRO PLUS software (Media Cybernetics, Silver Spring, MD, USA) using an intensity threshold to separate cells from their background, and background substraction. Then, mean intensities and standard deviations of the labeled cells were calculated. In all incubation and analysis steps, slides were treated in parallel, ensuring identical experimental conditions.
  • Immunodetection (4 °C, overnight) was with either polyclonal goat anti-AChE antibody (SC6431 ; Santa Cruz Biotechnology, Santa Cruz, CA, USA) directed against the human protein and diluted 1: 1000, or polyclonal rabbit anti-FAS antibody (SC7886; Santa Cruz) diluted 1: 1000.
  • Development 23 °C, 2 h was with horseradish peroxidase- conjugated donkey anti-goat (AChE detection) or goat antimouse (FAS detection), antibodies diluted 1 : 10 000 (Jackson Laboratories) and enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Little Chalfont, UK).
  • TUNEL terminal UTP transferase nick end labeling
  • N-AChE-R exacerbates photoreceptor death following photic stress MATERIALS AND METHODS
  • an electroretinogram ERG was recorded, the light-induced electrical activity of the retina.
  • rats were sacrificed by an overdose of sodium pentobarbital, injected intraperitoneally, and their retinas prepared for histochemical evaluation.
  • Eyes were enucleated and incubated (1- hr for cryo-sections and 24-hr for paraffin-sections) in 0.1 M phosphate buffer (pH- 7.4) containing 4 % paraformaldehyde (4 0 C).
  • Immuonocytochemistry Cryostat sections were incubated overnight, under agitation, with affinity purified primary rabbit antiserum targeted against a synthetic peptide unique for rodent N-AChE 15 at a dilution of 1:100 in 0.1 M PB 1% Triton X-100. An antibody for the core domain was also used, common to all AChE variants (N- 19, Santa Cruz, CA). Secondary antibodies were donkey anti-rabbit IgG coupled to fluorescein isothiocyanate (FITC) at a 1:100 dilution and a donkey anti-goat IgG coupled to Cy3 at a 1:100 dilution.
  • FITC fluorescein isothiocyanate
  • the BCIiE inhibitor, iso-OMPA (tetraisopropylpyrophosphoramide), (Sigma, St. Louis, MO) was added (10-5M) to specifically localize AChE activity.
  • the selective AChE inhibitor BW 284C51(10-5 M) was used as a negative control. Brownish staining, resulting from AThCh hydrolysis, was examined under Olympus BH2 light microscope.
  • In-situ hybridization was performed on paraffin sections, 5- ⁇ m thick, as previously described [Meshorer, E. et al. Science 295, 508-12 (2002). Hybridization involved overnight incubation at 52°C in hybridization mix with a 5'-biotinylated, 2'-O-methylated AChE mRNA probe complementary to either the AChE-S (exon 6) rat isoform: (5402)
  • Monarsen Antisense oligodeoxynucleotide directed against rat AChE mRNA a 20-mer oligodeoxynucleotide (5'- CTGCAATATTTTCTTGCACC-3') - SEQ ID NO: 31, complementary to a sequence in exon 2 of rat AChE mRNA, was used as previously described [Brenner et al., Faseb J. 17, 214-22 (2003)].
  • Experimental rats were treated for 30 days with daily intraperitoneal injection of Monarsen (0.1 ml at a dosage regimenof 500 ⁇ g/kg), beginning from one day before light exposure. Rats in the control group were daily injected intraperitonealy with an equal volume of saline.
  • ERG Electroretinogram
  • the ERG is the light-induced electrical activity of the retina and is used to assess retinal function [Armington, J.C. The Electroretinogram, (Academic Press, New York, 1974)]. It is composed of two major components; the negative a-wave reflects light-induced electrical activity in the photoreceptors, while the positive b-wave is generated in post-receptors retinal neurons, mainly ON-center bipolar cells [Lei, B. & Permian, I. Vis. Neurosci. 16,743- 754 (1999); Ripps, H. & Witkovsky, P. Prog. Retinal Res. 4, 181-219 (1985)].
  • the pupils were dilated (Cyclopentolate hydrochloride 1 %), and topical anesthetic drops (Benoxinate HCl 0.4%) were used.
  • a heating pad was used to maintain body temperature at 37 °C. ERG responses were recorded simultaneously from both eyes, as previously described [Li, Q., Zemel, E., Miller, B. & Perlman, I. Exp. Eye Res. 74, 615-625 (2002)].
  • Light stimuli were obtained from a Ganzfeld light source (LKC Technologies, Gaithersburg, MD) with a maximum intensity of 5.76 cd- s/m2. Light intensity was attenuated by a set of neutral density filters covering a range of 4 log units. Data analysis was based on amplitude measurements of the ERG waves. The amplitude of the a-wave was measured from baseline to the trough of the wave, while the amplitude of the b-wave was measured from the trough of the a-wave to the peak of the b-wave. Quantitative analysis of retinal function was obtained by fitting the response-intensity data of the ERG a-wave and b-wave to a hyperbolic function [Hood D.C.
  • V/Vmax 1/(1 + ⁇ )
  • V and Vmax were the amplitudes of the ERG waves that were elicited respectively by a flash of intensity I and by a flash of super-saturating intensity.
  • the parameter ⁇ was the semi-saturation constant.
  • AChE gene expression is notably subject to complex stress-induced changes.
  • retinas of 15 albino rats exposed to bright damaging light for 24 hr were compared,to those of 15 unexposed control albino rats, raised in 12/12 hr light/dark. All 30 rats were kept in regular 12/12 hr light/dark cycle with no further treatment for the entire 30-days of follow-up (experiment 1).
  • Retinal micrographs from rats participating in this experiment clearly demonstrate light-induced modifications in AChE expression and activity ( Figures 14 A-F).
  • In-situ hybridization in the control retina Figure 14A predictably indicated very low levels of expression of mRNA for the AChE-R variant in the retina.
  • AChE-S mRNA encoding the synaptic variant of AChE was relatively unchanged after light exposure, compared to normal rat retinas (not shown here).
  • the augmented expression of AChE-R mRNA led to increased cytochemical labeling for total AChE catalytic activity ( Figure 14, right column), albeit at a different pattern.
  • strong AChE activity was seen in the proximal part of the retina (IPL and ganglion cells), and very weak activity in the photoreceptor inner segments ( Figure 14B) in agreement with previous reports [Hutchins, J.B. Exp. Eye Res. 45, 1-38 (1987)].
  • This labeling pattern largely reflects the normal activity of the AChE-S variant in the rat retina.
  • AChE activity was strikingly increased in the photoreceptor inner segments at 1-day and 14-days post exposure (arrowheads in Figures 14D and 14F respectively). It was difficult to appreciate a stress-induced change in ACIiE activity in the proximal part of the retina (INL and GC), since histochemical staining was already high in the control retinas, and any stress-induced augmentation was obscured. Therefore, photic stress-related changes in AChE activity were analyzed quantitatively only for the photoreceptors inner segments (IS) as shown in Table 1, hereinabove. The increase in AChE activity in IS was statistically significant at 1-day and 14-days of follow-up (Table 1, hereinabove).
  • AChE activity in the photoreceptor inner segments was refractory to iso-OMPA, an inhibitor of the AChE-homologous protein butyrylcholinesterase (BChE), but was completely blocked by BW 284C51, a selective inhibitor of AChE (not shown here), indicating that exposure to bright damaging light increased AChE but not BChE activity in the photoreceptors.
  • BChE AChE-homologous protein butyrylcholinesterase
  • the light-exposure-induced AChE-R accumulation in the photoreceptor inner segments could be an irrelevant by-product of the damaging stress. Alternatively, it could have a detrimental role promoting light-induced photoreceptors death, or could be part of a recovery process.
  • rats were treated daily with intraperitoneal injection of rat Monarsen, an antisense agent directed against the consensus domain in AChE mRNA, but inducing selective destruction of nascent AChE mRNA transcripts [Brenner et al, Faseb J. 17, 214-22 (2003)]. Treatment was initiated one day before light exposure, and proceeded till the end of the follow-up period. Control rats in this experiment (experiment # 2), were also exposed to the damaging bright light, but were injected daily with saline solution.
  • Figures 15A-D shows micrographs of retinas that were obtained 14 days after exposure to damaging light and underwent in situ hybridization for AChE-R mRNA (15 A and C), or histochemical staining for total AChE activity (15B and D). Sections were derived from experimental rats treated with Monarsen (15C and 15D), and from control rats treated with saline (15 A and B). Densitometry measurements from retinas of 4 rats of each group in this experiment are shown to the right of each micrograph.
  • Monarsen treatment exerted no effects on the retinas of untreated rats, which were raised under 12/12 hr dark/light cycle (not shown), similarly to its null effects in the control brain.
  • Monarsen injections predictably suppressed the light- induced expression of AChE-R mRNA in all retinal cells, having the strongest effect in the photoreceptor inner segments (Figure 15C).
  • AChE activity in the photoreceptor inner segments was considerably weaker in the retina from rats treated with Monarsen (Figure 15D) compared to those injected with saline ( Figure 15B).
  • Monarsen did not alter AChE activity in the proximal retina (IPL and GC) 3 suggesting that these layers expressed AChE-S, which is considerably less sensitive to this agent.
  • Reproducible AChER suppression occurred in 6 rats treated with Monarsen as compared with 6 control rats. Densitometry measurements were used to calculate the effects of saline and Monarsen treatment on AChE-R mRNA expression in the different retinal layers and on AChE activity in the photoreceptor inner segments (Table 1, hereinaabove).
  • the amplitudes of the ERG a-wave and b-wave were measured.
  • the amplitude of the a- wave was measured from the baseline to the trough of the first negative wave.
  • the amplitude of the b- wave was measured from the trough of the a-wave to the peak of the following positive wave.
  • These amplitudes were plotted as a function of log light intensity to derive the response-intensity curves of the dark-adapted a-wave and b-wave, shown in Figure 17B for the two rats whose ERG responses are shown in Figure 17A.
  • the parameter ⁇ was the semi-saturation constant.
  • the present inventors have expanded on previous observations in the CNS, suggesting for the first time, that a "readthrough” isoform of AChE with extended N- terminus is induced by stress in the mammalian retina. Furthermore, they showed that this novel isoform of AChE exerted antisense-suppressible neuronal cell death in the albino rat retina.
  • the in-situ hybridization studies indicated that photic stress induced the expression of mRNA coding for the "readthrough" variant of AChE, while the immunostaining studies indicated expression of a protein isoform of AChE carrying an extended N terminus.
  • Thecurrent findings provide the first direct evidence both on its stress-induced accumulation in retinal photoreceptors, and on its causal involvement in light-induced death of these cells.
  • N-AChE-R protein was mainly found in the photoreceptors and the distal portion of the INL, regions which are not involved in cholinergic interactions, suggesting a morphogenic role for this protein.
  • N-AChE-R expression was suppressed using Monarsen treatment.
  • Monarsen antisense treatment effectively suppressed the expression of N-AChE-R in the retina, while enhancing the functional recovery of treated retinas.
  • AChE This role can be explained in at least two alternative ways.
  • ACh has been shown to suppress the production of pro-inflammatory cytokines, and to act via nicotinic receptors as a neuroprotector against excitoxicity.
  • ACh was found to protect ganglion cells from death [Wehrwein, E., et al., Invest. Ophthalmol. Vis. Sci. 45, 1531-43 (2004)].
  • over-expression of AChE by exposure to bright light may act to reduce the neuro-protection offered by endogenous ACh.
  • Figure 18C illustrates that sperm cells from AChE-R transgenic mice display elevated ATP levels.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des polynucléotides isolés comprenant une séquence d'acides nucléiques codant pour un polypeptide qui comprend une séquence d'acides aminés de ACHE-R ou de ACHE-S attachée à une extension N-terminale, ladite extension N-terminale étant homologue à au moins 90 % de SEQ ID NO: 3. La présente invention concerne également des polypeptides, des oligonucléotides, des anticorps et des préparations les comprenant, de même que leurs utilisations.
PCT/IL2006/001233 2005-10-26 2006-10-26 Polypeptides ache, polynucléotides codant pour lesdits polypeptides et préparations et méthodes d'utilisation desdits polypeptides WO2007049281A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US73004305P 2005-10-26 2005-10-26
US60/730,043 2005-10-26

Publications (1)

Publication Number Publication Date
WO2007049281A1 true WO2007049281A1 (fr) 2007-05-03

Family

ID=37670895

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2006/001233 WO2007049281A1 (fr) 2005-10-26 2006-10-26 Polypeptides ache, polynucléotides codant pour lesdits polypeptides et préparations et méthodes d'utilisation desdits polypeptides

Country Status (1)

Country Link
WO (1) WO2007049281A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012032520A1 (fr) 2010-09-07 2012-03-15 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Translecture d'acétylcholinestérase (ache-r) pour le traitement ou la prévention de la maladie de parkinson
WO2016097753A1 (fr) * 2014-12-19 2016-06-23 Neuro-Bio Ltd Peptide de l'extrémité c-terminale de l'acétylcholinestérase cyclique dans le traitement ou la prévention du cancer ou de la métastase
GB2538947A (en) * 2014-12-19 2016-12-07 Neuro-Bio Ltd Cancer
CN114410606A (zh) * 2014-11-26 2022-04-29 神经生物有限公司 神经变性障碍

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100555A2 (fr) * 2004-04-13 2005-10-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem NOUVEAUX VARIANTS AChE
WO2006027776A1 (fr) * 2004-09-07 2006-03-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions et methodes de traitement de pathologies dans lesquelles la regulation d'une voie biologique associee a l'acetylcholinesterase (ache) est benefique

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100555A2 (fr) * 2004-04-13 2005-10-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem NOUVEAUX VARIANTS AChE
WO2006027776A1 (fr) * 2004-09-07 2006-03-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions et methodes de traitement de pathologies dans lesquelles la regulation d'une voie biologique associee a l'acetylcholinesterase (ache) est benefique

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DARREH-SHORI T ET AL: "Long-lasting acetylcholinesterase splice variations in anticholinesterase-treated Alzheimer's disease patients", JOURNAL OF NEUROCHEMISTRY, NEW YORK, NY, US, vol. 88, no. 5, March 2004 (2004-03-01), pages 1102 - 1113, XP002336273, ISSN: 0022-3042 *
GUIMARAES-STERNBERG ET AL: "MicroRNA modulation of megakaryoblast fate involves cholinergic signaling", LEUKEMIA RESEARCH, NEW YORK,NY, US, vol. 30, no. 5, 24 October 2005 (2005-10-24), pages 583 - 595, XP005331352, ISSN: 0145-2126 *
MESHORER ERAN ET AL: "Combinatorial complexity of 5' alternative acetylcholinesterase transcripts and protein products", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 279, no. 28, 9 July 2004 (2004-07-09), pages 29740 - 29751, XP002336274, ISSN: 0021-9258 *
PICK M ET AL: "Blood-cell-specific acetylcholinesterase splice variations under changing stimuli", INTERNATIONAL JOURNAL OF DEVELOPMENTAL NEUROSCIENCE, PERGAMON, OXFORD, GB, vol. 22, no. 7, November 2004 (2004-11-01), pages 523 - 531, XP004588309, ISSN: 0736-5748 *
STERNFELD M ET AL: "Excess read-through acetylcholinesterase attenuates but the synaptic variant intensifies neurodeterioration correlates", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 97, no. 15, 18 July 2000 (2000-07-18), pages 8647 - 8652, XP002184253, ISSN: 0027-8424 *
ZHANG X J ET AL: "Induction of acetylcholinesterase expression during apoptosis in various cell types", CELL DEATH AND DIFFERENTIATION, vol. 9, no. 8, August 2002 (2002-08-01), pages 790 - 800, XP002418090, ISSN: 1350-9047 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012032520A1 (fr) 2010-09-07 2012-03-15 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Translecture d'acétylcholinestérase (ache-r) pour le traitement ou la prévention de la maladie de parkinson
CN114410606A (zh) * 2014-11-26 2022-04-29 神经生物有限公司 神经变性障碍
WO2016097753A1 (fr) * 2014-12-19 2016-06-23 Neuro-Bio Ltd Peptide de l'extrémité c-terminale de l'acétylcholinestérase cyclique dans le traitement ou la prévention du cancer ou de la métastase
GB2538947A (en) * 2014-12-19 2016-12-07 Neuro-Bio Ltd Cancer
US10441638B2 (en) 2014-12-19 2019-10-15 Neuro-Bio Ltd. Cyclic acetylcholinesterase c-terminal peptide in the treatment or prevention of cancer or metastasis
RU2711161C2 (ru) * 2014-12-19 2020-01-15 Нейро-Био Лтд Циклический с-концевой пептид ацетилхолинэстеразы в лечении или предупреждении рака или метастазирования
EP3613428A1 (fr) * 2014-12-19 2020-02-26 Neuro-Bio Ltd Peptide cyclique c-terminal de l'acetylcholinesterase pour traiter le cancer et les metastases
US11033609B2 (en) 2014-12-19 2021-06-15 Neuro-Bio Ltd Cyclic acetylcholinesterase C-terminal peptide in the treatment or prevention of cancer or metastasis
AU2015365606B2 (en) * 2014-12-19 2021-09-30 Neuro-Bio Ltd Cyclic acetylcholinesterase C-terminal peptide in the treatment or prevention of cancer or metastasis

Similar Documents

Publication Publication Date Title
EP3202914B1 (fr) Methode de traitement d'une maladie neurodegenerative
US8609617B2 (en) KLF family members regulate intrinsic axon regeneration ability
JP6309450B2 (ja) セロトニン関連の医学的状態、アドレナリン関連の医学的状態、ノルアドレナリン関連の医学的状態、グルタミン酸関連の医学的状態および副腎皮質刺激ホルモン放出ホルモン関連の医学的状態の処置および診断のためのミクロｒｎａおよび該ミクロｒｎａを含む組成物
MX2010006925A (es) Conjugados de polipeptido-acido nucleico y sus usos.
US20110065644A1 (en) Compositions comprising human pcsk9 and apolipoprotein b sirna and methods of use
JP2011172588A (ja) Ｄｐ７５をコードするｄｎａおよびその使用のためのプロセス
Sun et al. MicroRNA-9 induces defective trafficking of Nav1. 1 and Nav1. 2 by targeting Navβ2 protein coding region in rat with chronic brain hypoperfusion
Lim et al. Progranulin contributes to endogenous mechanisms of pain defense after nerve injury in mice
WO2007049281A1 (fr) Polypeptides ache, polynucléotides codant pour lesdits polypeptides et préparations et méthodes d'utilisation desdits polypeptides
Dietrich et al. Identification of cyclin D1 as a major modulator of 3-nitropropionic acid-induced striatal neurodegeneration
EP3655013B1 (fr) Ciblage de la synaptogyrine-3 dans le traitement de tauopathie
WO2017201425A1 (fr) Activateurs anaboliques pour améliorer la neurodégénérescence
Barker et al. Targeting transferrin receptor to transport antisense oligonucleotides across the blood-brain barrier
Masha'our et al. Acetylcholinesterase (AChE) is an important link in the apoptotic pathway induced by hyperglycemia in Y79 retinoblastoma cell line
Liu et al. Atsttrin reduces lipopolysaccharide-induced neuroinflammation by inhibiting the nuclear factor kappa B signaling pathway
JP4427639B2 (ja) 合成アンチセンスオリゴデオキシヌクレオチド類およびそれらを含む医薬組成物
US9347085B2 (en) Methods and compositions for reducing amyloid beta levels
Van Maerken et al. Adenovirus‐mediated hPNPaseold‐35 gene transfer as a therapeutic strategy for neuroblastoma
US11273161B2 (en) Methods of treating autism spectrum disorders
CN107137418A (zh) Let‑7c基因在制备治疗阿尔茨海默病药物中的应用
CN115768891A (zh) 用于抑制tdp-43和fus聚集的组合物和方法
CA3079239A1 (fr) Retrovirus endogene-k (ervk) codant une proteine d'enveloppe alternative
EP4289953A1 (fr) Molécule d'acide nucléique double brin pour le traitement de la vitréorétinopathie proliférative et son utilisation
Lee et al. ANKS1A regulates LDL receptor-related protein 1 (LRP1)-mediated cerebrovascular clearance in brain endothelial cells
US20240093195A1 (en) Nucleic acid molecules and their methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06809794

Country of ref document: EP

Kind code of ref document: A1