WO2007045398A2 - Neue cholinoxidasen mit veränderter substratspezifität - Google Patents

Neue cholinoxidasen mit veränderter substratspezifität Download PDF

Info

Publication number
WO2007045398A2
WO2007045398A2 PCT/EP2006/009890 EP2006009890W WO2007045398A2 WO 2007045398 A2 WO2007045398 A2 WO 2007045398A2 EP 2006009890 W EP2006009890 W EP 2006009890W WO 2007045398 A2 WO2007045398 A2 WO 2007045398A2
Authority
WO
WIPO (PCT)
Prior art keywords
acid
choline oxidase
choline
sequence
gly62asp
Prior art date
Application number
PCT/EP2006/009890
Other languages
English (en)
French (fr)
Other versions
WO2007045398A3 (de
Inventor
Cornelius Bessler
Regina Stehr
Karl-Heinz Maurer
Helmut Schwab
Doris Ribitsch
Peter Remler
Petra Schratl
Karl Gruber
Wolfgang Karl
Original Assignee
Henkel Central Eastern Europe Gesellschaft Mbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henkel Central Eastern Europe Gesellschaft Mbh filed Critical Henkel Central Eastern Europe Gesellschaft Mbh
Publication of WO2007045398A2 publication Critical patent/WO2007045398A2/de
Publication of WO2007045398A3 publication Critical patent/WO2007045398A3/de

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/189Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q11/00Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q11/00Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
    • A61Q11/02Preparations for deodorising, bleaching or disinfecting dentures
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/02Preparations for cleaning the hair
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/08Preparations for bleaching the hair
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/10Preparations for permanently dyeing the hair
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/12Preparations containing hair conditioners
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38636Preparations containing enzymes, e.g. protease or amylase containing enzymes other than protease, amylase, lipase, cellulase, oxidase or reductase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • DTEXTILES; PAPER
    • D06TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06LDRY-CLEANING, WASHING OR BLEACHING FIBRES, FILAMENTS, THREADS, YARNS, FABRICS, FEATHERS OR MADE-UP FIBROUS GOODS; BLEACHING LEATHER OR FURS
    • D06L4/00Bleaching fibres, filaments, threads, yarns, fabrics, feathers or made-up fibrous goods; Bleaching leather or furs
    • D06L4/40Bleaching fibres, filaments, threads, yarns, fabrics, feathers or made-up fibrous goods; Bleaching leather or furs using enzymes

Definitions

  • the present invention relates to novel cholinoxidases with altered substrate specificity, processes for their recovery, personal care products, hair care products, shampoos, oral, dental and denture care products, cosmetics, detergents, cleaners, rinse aids, hand detergents, hand dishwashing detergents and machine dishwashing detergents, containing novel cholinoxidases with altered substrate specificity and Uses of the new choline oxidases with altered substrate specificity.
  • Choline oxidases are known in the art (Ikuta, S., Imamura, S., Misaki, H., and Horiuti, Y. 1977. Purification and characterization of choline oxidase from Arthrobacter globiformis J Biochem (Tokyo) 82: 1741- 1749, Deshnium, P., Los, DA, Hayashi, H., Mustardy, L., and Murata, N. 1995. Plant Mol Biol. 29: 897. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress -907.).
  • oxidases alcohol oxidases, amino acid oxidases
  • oxidases can be used together with their substrates for the hydrogen peroxide generation for bleaching and dye transfer inhibition in detergents or for enzymatic hair coloring and bleaching in cosmetic products.
  • inorganic, alkaline hydrogen peroxide sources such as percarbonate or perborate are used in combination with bleach booster (TAED).
  • TAED bleach booster
  • the bleaching component hydrogen peroxide is formed by spontaneous decomposition of the addition compound and thus leads quickly but quickly to high concentrations. A gentle, bleaching is not possible.
  • bleaching is conventionally carried out for leveling shades of gray before dyeing with hydrogen peroxide and ammonia solution.
  • the short-term high hydrogen peroxide concentrations in combination with the alkaline pH lead to a significant hair damage.
  • choline oxidase preferably converts choline. Their specificity decreases from choline over bis (2-hydroxyethyl) dimethylammonium chloride (dimethyldiethanolammonium chloride, DMDEA) and triethanolamine (TEA) to tris (2-hydroxyethyl) methylammonium chloride (MTEA).
  • DMDEA dimethyldiethanolammonium chloride
  • TEA triethanolamine
  • the availability of enzymes with different substrate specificity is desirable.
  • the preferred substrate can be used in a single process.
  • DMDEA dimethyldiethanolammonium chloride
  • TEA triethanolamine
  • MTEA 2-hydroxyethyl) methylammonium chloride
  • choline oxidases which can be represented as mutants of the choline oxidase KC2s from the bacterium Arthrobacter nicotianiae (Sequence 3) and which are characterized in that they have mutations in molecular regions or domains, based on the choline oxidase KC2s ( Sequence 3) selected from the substrate binding domain and the FAD binding domain.
  • DMDEA or TEA and MTEA have two or three instead of one alcohol function. These alcohol groups can be oxidized by the choline oxidase according to the invention and thus to a yield of 4 or 6 eq. Hydrogen peroxide lead per molecule. Since the molecular mass does not increase linearly with the hydrogen peroxide yield, a higher power density is achieved in a technical process.
  • mutants according to the invention with modified substrate specificity are advantageous in processes in which, for certain reasons, no choline can be used, but only DMDEA, TEA or MTEA can be used.
  • a choline oxidase is preferred which has one or more mutations at amino acid sequence positions selected from positions 4, 21, 62, 69, 79, 116, 128, 166, 215, 243, 249, 260, 286, 321, 348, 349, 351, 393, 394, 530 and 531, wherein the numbering of the sequence positions is related to sequence 3.
  • a choline oxidase which has one or more mutations selected from Glu4Gly, Ala21Val, Gly62Asp, Ile69Val, Met79Val, Thr1116Ile, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val216Ile, Val286Ile, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly and Glu531Val.
  • a choline oxidase according to the invention has one or more amino acid substitutions selected from Glu4Gly, Ala21Val, Gly62Asp, He69Val, Met79Val, ThM161Ie, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260Ile, Val286Ile, Ser321Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu in combination with Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly and Glu531Val, and especially selected from Glu4Gly, Ala21Val, Gly62Asp, Ile69Val, Met79Val, Asp166Gly , Arg215Hi
  • a choline oxidase having one or more of the following combinations of amino acid substitutions: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly + Val260Ile + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + Me69Val + Ser348Leu, ThM161Ie + Lys128Met, Pro393Gln + Ser530Gly, where the numbering of the sequence positions is related to Sequence 3.
  • Another object of the present invention are also choline oxidases which have the aforementioned mutations in relation to sequence 3, but which also have other mutations, ie, starting from the abovementioned choline oxidases according to the invention by single or multiple amino acid replacement, in particular by a or multiple conservative amino acid substitutions, and / or those obtainable from the abovementioned choline oxidases according to the invention by derivatization, fragmentation, inversion mutation, deletion mutation or insertion mutation, it being of course imperative that the corresponding mutation position or combination of mutation positions in the choline oxidase thus obtained is maintained.
  • a further subject of the present invention are therefore, in particular, those choline oxidases which, in addition to the abovementioned mutations and / or mutation combinations, have up to 50, 45 or 40, in particular up to 35, 30, 25 or 20, especially up to 15, 10, 5, 4, 3 or 2 further punk mutations or exactly one more point mutation and / or deletions and / or insertions and / or inversions of sequences of a length of up to 60, 50 or 40, in particular up to 30, 20 or 10, preferably up to 5, 4, 3 or 2 amino acids, especially deletions and / or insertions of exactly one amino acid.
  • the choline oxidases according to the invention with altered substrate specificity advantageously have a high specific hydrogen formation rate.
  • the pH profile of the enzymes according to the invention is compatible with the required pH for industrial use and with typical products such as detergents and cleaners and hair dyes.
  • Suitable substrates include, for example, DMDEA, TEA, MTEA and choline and derivatives of N-substituted aminoethanol, having the structural formulas 1 or 2:
  • R 1 H 1
  • R 2 2-hydroxyethyl
  • R 1 methyl
  • R 2 methyl
  • R 1 2-hydroxyethyl
  • R 2 2-hydroxyethyl
  • Another suitable substrate according to the invention is betaine aldehyde (OHC-CH 2 ) N + (CH 3 ) 3
  • an expression of the form "at least X%” means “X% to 100% (inclusive of the X and 100 and all integer and non-integer percentage values in between)".
  • a protein is to be understood as meaning a polymer composed of the natural amino acids and having a largely linear structure and assuming a function which is generally three-dimensional in order to perform its function.
  • the proteinogenic, naturally occurring L-amino acids are designated by the internationally used 1- and 3-letter codes.
  • an enzyme is to be understood as meaning a protein which has a specific biocatalytic function.
  • proteins are formed as so-called pre-proteins, ie together with a signal peptide.
  • a signal peptide By this is meant the N-terminal part of the protein, the function of which is usually to ensure the discharge of the protein formed from the producing cell into the periplasm or the surrounding medium and / or its correct folding.
  • the signal peptide is cleaved under natural conditions by a signal peptidase from the rest of the protein, so that it exerts its actual catalytic activity without the initially present N-terminal amino acids.
  • the mature peptides ie the enzymes processed after their preparation, are preferred over the preproteins.
  • Pro-proteins are inactive precursors of proteins. Their signal sequence precursors are referred to as pre-pro proteins.
  • nucleic acids are understood to mean the molecules which are naturally constructed from nucleotides and serve as information carriers, which code for the linear amino acid sequence in proteins or enzymes. They can be present as a single strand, as a single strand that is complementary to this single strand, or as a double strand. As the naturally more durable information carrier, the nucleic acid DNA is preferred for molecular biology work. In contrast, for the realization of the invention in a natural environment, such as in an expressing cell, an RNA is formed, which is why essential RNA molecules of the invention are also embodiments of the present invention.
  • the information unit corresponding to a protein is also referred to as gene within the meaning of the present application.
  • the present invention encompasses the production of recombinant proteins. These are to be understood according to the invention as meaning all genetic engineering or microbiological processes which are based on the genes for the proteins of interest being introduced into a host organism suitable for production and being transcribed and translated by the latter. Suitably, the introduction of the relevant genes via vectors, in particular expression vectors; but also those that cause the gene of interest in the host organism can be inserted into an already existing genetic element such as the chromosome or other vectors.
  • the functional unit of gene and promoter and any other counterparts is referred to as expression cassette according to the invention. However, it does not necessarily have to exist as a physical entity.
  • a person skilled in the art can use well-known methods such as chemical synthesis or the polymerase chain reaction (PCR) in combination with molecular biological and / or proteinchemical standard methods, using known DNA and / or amino acid sequences, the corresponding nucleic acids to complete genes manufacture.
  • PCR polymerase chain reaction
  • Such methods are known, for example, from Sambrook, J., Fritsch, E.F. and Maniatis, T. 2001. Molecular cloning: a laboratory manual, 3rd Edition CoId Spring Laboratory Press.
  • mutations Changes in the nucleotide sequence, as can be brought about, for example, by molecular biological methods known per se, are referred to as mutations.
  • deletion, insertion or substitution mutations or those in which different genes or parts of genes are fused or recombined with one another are known; these are gene mutations.
  • the associated organisms are called mutants.
  • the proteins derived from mutant nucleic acids are called variants.
  • deletion, insertion substitution mutations or fusions lead to deletion, insertion-substitution-mutated or fusion genes and, at the protein level, to corresponding deletion, insertion or substitution variants or fusion proteins.
  • Fragments are understood to mean all proteins or peptides which are smaller than natural proteins or those which correspond to fully translated genes and, for example, can be obtained synthetically. Due to their amino acid sequences, they can be assigned to the relevant complete proteins. They can be the same, for example Accept structures or perform proteolytic activities or partial activities, such as the complexation of a substrate. Fragments and deletion variants of starting proteins are in principle similar; while fragments tend to be smaller fragments, the deletion mutants tend to lack only short regions, and thus only individual subfunctions.
  • the fragments correspond at the nucleic acid level to the partial sequences.
  • chimeras or hybrid proteins are to be understood as meaning proteins which are encoded by nucleic acid chains which naturally originate from different or from the same organism. This procedure is also called recombination mutagenesis. For example, the purpose of such recombination may be to induce or modify a particular enzymatic function using the fused protein portion. For the purposes of the present invention, it is irrelevant whether such a chimeric protein consists of a single polypeptide chain or several subunits on which different functions can be distributed.
  • Proteins obtained by insertion mutation are to be understood as meaning those variants which have been obtained by methods known per se by inserting a nucleic acid or protein fragment into the starting sequences. They are due to their principle similarity to the chimeric proteins. They differ from those only in the size ratio of the unchanged protein part to the size of the entire protein. In such insertionsmut elected proteins, the proportion of foreign protein is lower than in chimeric proteins.
  • Inversion mutagenesis ie a partial sequence reversal
  • derivatives are understood as meaning those proteins whose pure amino acid chain has been chemically modified.
  • derivatizations can be carried out, for example, biologically in connection with the protein biosynthesis by the host organism.
  • they can also be carried out chemically, for example by the chemical transformation of a side chain of an amino acid or by covalent binding of another compound to the protein.
  • Such a compound may, for example, also be other proteins which are bound, for example via bifunctional chemical compounds, to proteins according to the invention.
  • modifications may include, for example, the substrate specificity or the Affect binding strength to the substrate or cause a temporary blockage of the enzymatic activity, when the coupled substance is an inhibitor. This can be useful, for example, for the period of storage.
  • derivatization is the covalent attachment to a macromolecular carrier.
  • Proteins can also be grouped into groups of immunologically related proteins by reaction with an antiserum or antibody.
  • the members of a group are characterized by having the same antigenic determinant recognized by an antibody.
  • vectors are understood as consisting of nucleic acids which contain a gene of interest as a characteristic nucleic acid region. They can establish this in a species or cell line over several generations or cell divisions as a stable genetic element.
  • Vectors especially when used in bacteria, are special plasmids, ie circular genetic elements.
  • expression vectors are referred to as expression vectors.
  • the enzymatic activity of a considered enzyme can be deduced from the amino acid or nucleotide sequence. This can be qualitatively or quantitatively modified by other regions of the protein that are not involved in the actual reaction. This could, for example, relate to enzyme stability, activity, reaction conditions or substrate specificity.
  • Such a comparison is accomplished by associating similar sequences in the nucleotide or amino acid sequences of the proteins of interest. This is called homologization.
  • a tabular assignment of the respective positions is referred to as alignment.
  • alignments are created using computer programs, such as the algorithms FASTA or BLAST; This procedure is described, for example, by DJ Lipman and WR Pearson (1985) in Science, Vol. 227, pp. 1435-1441.
  • a summary of all matching positions in the compared sequences is called a consensus sequence.
  • Such a comparison also allows a statement about the similarity or homology of the compared sequences to each other. This is expressed in percent identity, that is, the proportion of identical nucleotides or amino acid residues at the same positions.
  • a broader concept of homology includes the conserved amino acid substitutions in this value. It then speaks of percent similarity. Such statements can be made about whole proteins or genes or only over individual areas.
  • Creating an alignment is the first step in defining a sequence space.
  • This hypothetical space includes all sequences to be derived by permutation in individual positions, taking into account all the variations occurring in the relevant individual positions of the alignment. Every hypothetically possible protein molecule forms a point in this sequence space. For example, two amino acid sequences which, when largely identical, have only two different amino acids at only two different sites, thus constitute a sequence space of four different amino acid sequences.
  • a very large sequence space is obtained if, in addition to individual sequences of a room, further homologous sequences are found. It is also possible to identify very low homologous sequences as belonging to a sequence space via such high homologies in pairs.
  • homologous regions of different proteins are defined by matches in amino acid sequence. These can also be identified by identical function. It goes as far as complete identities in the smallest areas, so-called boxes, which contain only a few amino acids and usually perform essential functions for the overall activity.
  • the functions of the homologous regions are to be understood as the smallest partial functions of the function carried out by the entire protein, such as, for example, the formation of individual hydrogen bonds for the complexation of a substrate or transition complex.
  • the nucleic acid is suitably cloned into a vector.
  • the molecular-biological dimension of the invention thus consists in vectors with the genes for the corresponding proteins. These may include, for example, those derived from bacterial plasmids, viruses or bacteriophages, or predominantly synthetic vectors or plasmids with elements of various origins. With the other genetic elements in each case, vectors are able to establish themselves as stable units in the respective host cells over several generations. It is in the process Meaning of the invention irrelevant, whether they establish themselves extrachomosomally as separate units or integrate into a chromosome. Which of the numerous systems known from the prior art is chosen depends on the individual case. Decisive factors may be, for example, the achievable copy number, the selection systems available, in particular antibiotic resistances, or the cultivability of the host cells capable of accepting the vectors.
  • the vectors form suitable starting points for molecular biological and biochemical investigations of the relevant gene or protein and for further developments according to the invention and ultimately for the amplification and production of proteins according to the invention. They represent embodiments of the present invention insofar as the sequences of the nucleic acid regions according to the invention contained are each within the homology regions specified above.
  • Preferred embodiments of the present invention are cloning vectors. These are suitable in addition to the storage, the biological amplification or the selection of the gene of interest for the characterization of the gene in question, such as the creation of a restriction map or sequencing. Cloning vectors are also preferred embodiments of the present invention because they are a transportable and storable form of the claimed DNA. They are also preferred starting points for molecular biology techniques that are not bound to cells, such as the polymerase chain reaction.
  • Expression vectors are chemically similar to the cloning vectors, but differ in those partial sequences that enable them to replicate in the host organisms optimized for the production of proteins and to express the contained gene there.
  • Preferred embodiments are expression vectors which themselves carry the genetic elements necessary for expression.
  • the expression is influenced, for example, by promoters which regulate the transcription of the gene.
  • the expression can be carried out by the natural, originally located in front of this gene promoter, but also after genetic engineering, both by a promoter provided on the expression vector of the host cell and by a modified or a completely different promoter of another organism.
  • Preferred embodiments are those expression vectors which are regulatable via changes in culture conditions or addition of certain compounds, such as cell density or specific factors.
  • Expression vectors allow the associated protein to be produced heterologously, that is, in an organism other than that from which it can naturally be obtained.
  • Embodiments of the present invention may also be cell-free expression systems in which protein biosynthesis is understood in vitro. Such expression systems are also established in the art.
  • the in vivo synthesis of an enzyme according to the invention requires the transfer of the associated gene into a host cell, the so-called transformation thereof.
  • host cells are in principle all organisms, that is prokaryotes or eukaryotes. Preference is given to those host cells which can be genetically well handled, for example, the transformation with the expression vector and its stable establishment, for example, unicellular fungi or bacteria.
  • preferred host cells are characterized by good microbiological and biotechnological handling. This concerns, for example, easy culturing, high growth rates, low demands on fermentation media and good production and secretion rates for foreign proteins. Frequently, the optimal expression systems for the individual case must be determined experimentally from the abundance of different systems available according to the prior art. Each protein of the invention can be obtained in this way from a variety of host organisms.
  • Preferred embodiments represent such host cells, which are regulatable in their activity due to genetic regulatory elements which are provided, for example, on the expression vector, but may also be present in these cells from the outset. For example, by controlled addition of chemical compounds that serve as activators, by changing the culture conditions or when reaching a specific cell density, these can be excited for expression. This allows a very economical production of the proteins of interest.
  • Preferred host cells are prokaryotic or bacterial cells.
  • bacteria are distinguished from eukaryotes by shorter generation times and lower demands on culturing conditions.
  • cost-effective methods for obtaining proteins according to the invention can be established.
  • Gram-negative bacteria such as Escherichia coli (E. coli)
  • E. coli Escherichia coli
  • a large number of proteins are secreted into the periplasmic space, ie into the compartment between the two membranes enclosing the cells. This can be advantageous for special applications.
  • Gram-positive bacteria such as Bacilli or Actinomycetes or other representatives of Actinomycetales
  • have no outer membrane so that secreted proteins readily into the cells surrounding Nutrient medium can be delivered, from which, according to another preferred embodiment, the expressed proteins of the invention can be purified directly.
  • a variant of this experimental principle represent expression systems in which additional genes, for example those which are made available on other vectors, influence the production of proteins according to the invention. These may be modifying gene products or those which are to be purified together with the protein according to the invention, for example in order to influence its enzymatic function. These may be, for example, other proteins or enzymes, inhibitors or elements that influence the interaction with various substrates.
  • Representative members of these genera are the K12 derivatives and B strains of Escherichia coli. Strains that can be derived from them by genetic and / or microbiological methods known per se, and thus can be regarded as derivatives thereof, have the greatest importance for genetic and microbiological work and are preferably used for the development of inventive methods. Such derivatives may, for example, be altered via deletion or insertion mutagenesis with respect to their requirements of the culture conditions, have different or additional selection markers or express other or additional proteins. In particular, these may be derivatives which, in addition to the protein produced according to the invention, express further economically interesting proteins.
  • microorganisms are preferred, which are characterized in that they have been obtained after transformation with one of the vectors described above.
  • These may, for example, be cloning vectors which have been introduced into any bacterial strain for storage and / or modification. Such steps are common in the storage and further development of related genetic elements. Since the relevant genetic elements can be directly transferred from these microorganisms into Gram-negative bacteria suitable for expression, the above-mentioned transformation products are also realizations of the subject matter of the invention.
  • Eukaryotic cells may also be suitable for the production of proteins according to the invention.
  • fungi such as Actinomycetes or yeasts such as Saccharomyces or Kluyveromyces. This may be particularly advantageous, for example, if the proteins are to undergo specific modifications in the context of their synthesis that enable such systems. These include, for example, the binding of low molecular weight compounds such as membrane anchors or Oligosaccaride.
  • the host cells of the process according to the invention are cultivated and fermented in a manner known per se, for example in discontinuous or continuous systems.
  • a suitable nutrient medium is inoculated with the organisms and the product is harvested from the medium after an experimentally determined period.
  • Continuous fermentations are characterized by achieving a flow equilibrium in which over a relatively long period of time cells partly die off but also regrow and at the same time product can be removed from the medium.
  • Fermentation processes are well known in the art and represent the actual large-scale production step; followed by a suitable one
  • the optimum conditions for the production processes used, for the host cells and / or the proteins to be produced must be experimentally determined on the basis of the previously optimized culture conditions of the relevant strains according to the knowledge of the person skilled in the art, for example regarding fermentation volume, media composition, oxygen supply or stirrer speed.
  • Fermentation processes characterized in that the fermentation is carried out via a feed strategy, are also contemplated.
  • the media components consumed by the ongoing cultivation are fed;
  • considerable increases in both the cell density and in the dry biomass and / or especially the activity of the protein of interest can be achieved.
  • the fermentation can also be designed so that unwanted metabolic products are filtered out or neutralized by the addition of buffer or matching counterions.
  • the produced protein can be harvested subsequently from the fermentation medium. This fermentation process is compared to the product preparation from the dry mass preferred, but requires the provision of suitable secretion markers and
  • choline oxidases By expression or cloning the choline oxidases according to the invention can be made available in the amount required for industrial use.
  • a further subject of the present invention is therefore a nucleic acid coding for a choline oxidase, which can be represented as a mutant of the choline oxidase KC2s from the bacterium Arthrobacter nicotianiae (Sequence 3) and which is characterized in that it has one or more mutations in molecular regions or domains, based on the choline oxidase KC2s (Sequence 3), which are selected from the substrate binding domain and the FAD binding domain
  • a further subject of the present invention is a nucleic acid encoding a choline oxidase having one or more mutations at amino acid sequence positions selected from positions 4, 21, 62, 69, 79, 116, 128, 166, 215, 243 , 249, 260, 286, 321, 348, 349, 351, 393, 394, 530 and 531, wherein the numbering of the sequence positions is related to sequence 3.
  • a further subject of the present invention is a nucleic acid having one or more codon exchanges at sequence positions selected from Glu4 (bp 10-12), Ala21 (bp 61-63), Gly62 (bp 184-186), Ile69 (bp 205-207), Met79 (bp 235-237), ThM 16 (bp 346-348), Lys128 (bp 382-384), Asp166 (bp 496-498), Arg215 (bp 643-645), Val243 (bp 727 -729), Arg249 (bp 745-747), Val260 (bp 778-780), Val286 (bp 856-858), Ser321 (bp 961-963), Ser348 (bp 1042-1044), Val349 (bp 1045-1047 ), Phe351 (bp 1051-1053), Pro393 (bp 1177-1179), Lys394 (bp 1180-1182), Ser530 (bp 1588-1590) and Glu531 (bp 1591-1593
  • Another object of the present invention is a nucleic acid encoding a choline oxidase, which has one or more of the amino acid substitutions, which are selected from Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, phm 161Ie 1 Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His , Val260Ile, Val286Ile, Ser321Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly, and Glu531Val, where the numbering of sequence positions is related to Sequence 3 is.
  • a further subject of the present invention is a nucleic acid coding for a choline oxidase which has one or more of the following combinations of amino acid substitutions: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly + Val260Ile + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + lle69Val + Ser348Leu, Thr1116Ile + Lys128Met, Pro393Gln, Ser530Gly, Pro393Gln + Ser530Gly, where the sequence numbering is Sequence 3 related.
  • a further subject of the present invention is a nucleic acid having one or more mutations at base sequence positions selected from positions 11, 62, 185, 205, 235, 347, 383, 497, 746, 778, 962, 1043, 1052, 1178, 1181 and 1588, wherein the numbering of the sequence positions is related to sequence 10.
  • a further subject of the present invention is a nucleic acid which has a base exchange or several base exchanges which are selected from A11G, C62T, G185A, A205G, A235G, C347T, A383T, A497G, G746A, G778A, C962T, C1043T, T1052A , C1178A, A1181G and A1588G, where the numbering of the sequence positions is related to sequence 10.
  • the choline oxidases according to the invention preferably have a pH optimum in the almost neutral to weakly alkaline range of about pH 6 to pH 10, particularly preferably pH 7 to pH 9.
  • the activity of such enzymes is usually expressed in terms of U, the unit corresponding to that amount of enzyme which generates 1 ⁇ mol of hydrogen peroxide (H 2 O 2 ) at a fixed pH and temperature in 1 minute.
  • U the unit corresponding to that amount of enzyme which generates 1 ⁇ mol of hydrogen peroxide (H 2 O 2 ) at a fixed pH and temperature in 1 minute.
  • H 2 O 2 hydrogen peroxide
  • the temperature optimum of the choline oxidases according to the invention is approximately in the range of 20 to 6O 0 C, more preferably at about 30 0 C.
  • a choline oxidase according to the invention preferably has a specific activity on choline of 0.1-100000 U / g, in particular of 0.1-1000 U / g; a specific activity on DMDEA of 0.1- 100,000 U / g, in particular from 0.9 to 1000 U / g; a specific activity on TE ⁇ A of 0.1-100000 U / g, in particular of 0.9-1000 U / g and a specific activity on MTEA of 0.1-100000 U / g, in particular 0.9-100 U / g g on.
  • the amount of the substrate for the oxidase contained in the detergent according to the invention depends on the amount of hydrogen peroxide required to achieve the desired bleaching result. It may serve as an indication that in enzyme-substrate systems which release up to two moles of hydrogen peroxide per mole of reacted substrate, the presence of from about 0.05% to 1% by weight of the substrate in the wash, Bleach or cleaning liquor is usually sufficient to achieve a good bleaching result.
  • oligonucleotides in particular PCR primers, with one of the in Seq. 15 to 40 indicated sequences, and oligonucleotides whose nucleotide sequences with one of Seq. 15 to 40 specified nucleotide sequence to at least 85%, in particular at least 90%, more preferably at least 95% and most preferably 100% match.
  • oligonucleotides or nucleic acids of the invention are useful for the identification and / or recovery of a novel choline oxidase.
  • a vector which contains a nucleic acid region according to the invention which can be, for example, a cloning vector or an expression vector.
  • a host cell which expresses one of the proteins or derivatives of the invention or can be stimulated to express it, preferably using an expression vector according to the invention.
  • the host cell is a bacterium, especially one that secretes the protein or derivative formed into the surrounding medium.
  • the host cell of the invention may be of the genus Escherichia, in particular of the species Escherichia coli or of the genus Bacillus, preferably of the species Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis or Bacillus alcalophilus or more preferably of the genus Arthrobacter and within this genus of the species oxidans.
  • the host cell can also be a eukaryotic cell, in particular one which modifies the protein formed posttranslationally.
  • Another object of the present invention is the use of a choline oxidase according to the invention as a hydrogen peroxide in situ generating agent.
  • a preferred embodiment of the use according to the invention is the use for bleaching, for color transfer inhibition and for disinfection.
  • choline oxidases according to the invention and the choline oxidases which can be used according to the invention can be advantageously used in personal care products, shampoos, hair care products, hair dyeing or bleaching agents, oral, dental or dental prosthesis care products, cosmetics, detergents, cleaners, rinse aids, hand washing agents, hand dishwashing detergents,
  • a washing or bleaching agent containing a bleach system which is capable of producing hydrogen peroxide under conditions of use of the composition and optionally synthetic surfactant, organic and / or inorganic builders and other customary bleach or detergent ingredients, characterized in that the bleach system consists of a choline oxidase according to the invention and a substrate for the choline oxidase.
  • the substrate is preferably choline or a choline derivative as described above.
  • the washing or bleaching agent according to the invention preferably has an oxidase activity of 1 U / g to 20,000 U / g; it is preferably present as a free-flowing powder having a bulk density of 300 g / l to 1200 g / l, in particular 500 g / l to 900 g / l before.
  • it may also be in the form of a pasty or liquid detergent, in particular in the form of a non-aqueous liquid detergent or a non-aqueous paste or in the form of an aqueous liquid detergent or a water-containing paste.
  • the detergent or bleach according to the invention may be packaged in an air-impermeable container from which it is released shortly before use or during the washing process, in particular the choline oxidase and / or the substrate for this enzyme may be at room temperature or in the absence of water
  • the washing or bleaching agent according to the invention preferably contains in addition to the bleaching system
  • a choline oxidase according to the invention can be used both in products for large consumers or technical users as well as in products for the private consumer, with all types of detergents established in the prior art also representing embodiments of the present invention.
  • detergents include, for example, concentrates and undiluted agents; for use on a commercial scale, in the washing machine or in hand washing or cleaning.
  • detergents for textiles, carpets, or natural fibers for which according to the present invention the term laundry detergent is used.
  • laundry detergents include, for example, dishwashing detergents for dishwashers or manual dishwashing detergents or cleaners for hard surfaces such as metal, glass, porcelain, ceramics, tiles, stone, painted surfaces, plastics, wood or leather; for such according to the present invention, the term cleaning agent is used.
  • Embodiments of the present invention include all established and / or all appropriate dosage forms. These include, for example, solid, powdery, liquid, gelatinous or pasty agents, optionally also of several phases, compressed or not compressed; further include, for example: extrudates, granules, tablets or pouches, packed both in large containers and in portions.
  • the choline oxidases according to the invention are combined, for example, with one or more of the following ingredients: nonionic, anionic and / or cationic surfactants, (optionally further) bleaching agents, bleach activators, bleach catalysts, builders and / or cobuilders, solvents, thickeners, sequestering agents, electrolytes, optical brighteners, grayness inhibitors, corrosion inhibitors, especially silver protectants, soil release agents, color transfer (or transfer) inhibitors, foam inhibitors, abrasives, dyes, fragrances, antimicrobial agents, UV protectants, enzymes such as proteases, amylases, lipases, cellulases , Hemicellulases or oxidases, stabilizers, especially enzyme stabilizers, and other components known in the art.
  • the nonionic surfactants used are preferably alkoxylated, advantageously ethoxylated, in particular primary, alcohols having preferably 8 to 18 carbon atoms and on average 1 to 12 moles of ethylene oxide (EO) per mole of alcohol, in which the alcohol radical can be linear or preferably methyl-branched in the 2-position , or may contain linear and methyl-branched radicals in the mixture, as they are usually present in Oxoalkoholresten.
  • EO ethylene oxide
  • alcohol ethoxylates with linear radicals of alcohols of native origin having 12 to 18 carbon atoms, for example of coconut, palm, tallow or oleyl alcohol, and on average 2 to 8 EO per mole of alcohol are preferred.
  • Preferred ethoxylated alcohols include, for example, C 12-14 alcohols with 3 EO or 4 EO, C 9 H -alcohol with 7 EO, C 13-15 alcohols containing 3 EO, 5 EO, 7 EO or 8 EO, C 12-18 -alcohols with 3 EO, 5 EO or 7 EO and mixtures of these, such as mixtures of Ci 2 -i 4 -alcohol with 3 EO and Ci 2- i 8 -alcohol with 5 EO.
  • the degrees of ethoxylation given represent statistical means which, for a particular product, may be an integer or a fractional number.
  • Preferred alcohol ethoxylates have a narrow homolog distribution (narrow rank ethoxylates, NRE).
  • fatty alcohols with more than 12 EO can also be used. Examples of these are tallow fatty alcohol with 14 EO, 25 EO, 30 EO or 40 EO.
  • nonionic surfactants used either as the sole nonionic surfactant or in combination with other nonionic surfactants are alkoxylated, preferably ethoxylated or ethoxylated and propoxylated fatty acid alkyl esters, preferably having from 1 to 4 carbon atoms in the alkyl chain, especially fatty acid methyl esters.
  • alkyl polyglycosides Another class of nonionic surfactants that can be used to advantage are the alkyl polyglycosides (APG).
  • APG alkyl polyglycosides
  • Usable alkypolyglycosides satisfy the general formula RO (G) Z in which R is a methylated or linear, in particular in the 2-position branched, saturated or unsaturated, aliphatic radical having 8 to 22, preferably 12 to 18 carbon atoms and G is the symbol which represents a glycose unit having 5 or 6 C-atoms, preferably glucose.
  • the degree of glycosylation z is between 1, 0 and 4.0, preferably between 1, 0 and 2.0 and in particular between 1, 1 and 1, 4.
  • Preference is given to using linear alkyl polyglucosides that is to say alkyl polyglycosides in which the polyglycosyl radical is a glucose radical and the alkyl radical is an n-alkyl radical.
  • Nonionic surfactants of the amine oxide type for example N-cocoalkyl-N, N-dimethylamine oxide and N-tallowalkyl-N, N-dihydroxyethylamine oxide, and the fatty acid alkanolamides may also be suitable.
  • the proportion of these nonionic surfactants is preferably not higher than that of the ethoxylated fatty alcohols, especially not more than half of them.
  • anionic surfactants for example, those of the sulfonate type and sulfates are used.
  • surfactants of the sulfonate type are preferably Cg. 13- Alkylbenzolsulfonate, olefinsulfonates, ie mixtures of alkene and hydroxyalkanesulfonates and disulfonates, as obtained for example from C 12 -i 8 monoolefins with terminal or internal double bond by sulfonation with gaseous sulfur trioxide and subsequent alkaline or acidic hydrolysis of the sulfonation, in consideration.
  • Alkanesulfonates which are obtained from C 12-18 -alkanes, for example by sulfochlorination or sulfoxidation with subsequent hydrolysis or neutralization, are also suitable.
  • esters of ⁇ -sulfo fatty acids esters of ⁇ -sulfo fatty acids (ester sulfonates), for example the ⁇ -sulfonated methyl esters of hydrogenated coconut, palm kernel or tallow fatty acids.
  • sulfated fatty acid glycerol esters are to be understood as meaning the mono-, di- and triesters and mixtures thereof, as in the preparation by esterification of a monoglycerol with 1 to 3 mol of fatty acid or in the transesterification of triglycerides with 0.3 to 2 mol Glycerol can be obtained.
  • Preferred sulfated fatty acid glycerol esters are the sulfonation products of saturated fatty acids having 6 to 22 carbon atoms, for example caproic acid, caprylic acid, capric acid, myristic acid, lauric acid, palmitic acid, stearic acid or behenic acid.
  • Alk (en) yl sulfates are the alkali and especially the sodium salts of the Schwefelhoffreraumester Ci 2 -C 18 fatty alcohols, for example coconut fatty alcohol, tallow fatty alcohol, lauryl, myristyl, cetyl or stearyl alcohol, or Cio-C 2 o-oxoalcohols and those half-esters of secondary alcohols of these chain lengths are preferred. Also preferred are alk (en) ylsulfates of said chain length, which contain a synthetic, produced on a petrochemical basis straight-chain alkyl radical, which have an analogous degradation behavior as the adequate compounds based on oleochemical raw materials.
  • Ci 2 -C 16 alkyl sulfates and C 12 -Ci 5 alkyl sulfates and C 4 -C 15 alkyl sulfates are preferred.
  • 2,3-alkyl sulfates are suitable anionic surfactants.
  • 2 i-alcohols such as 2-methyl-branched C 9-11 -AlkOhOIe with an average of 3.5 moles of ethylene oxide (EO) or Ci 2 -i 8 -Fettalkohole with 1 to 4 EO, are suitable. Due to their high foaming behavior, they are only used in detergents in relatively small amounts, for example in amounts of up to 5% by weight, usually from 1 to 5% by weight.
  • Suitable anionic surfactants are also the salts of alkylsulfosuccinic acid, which are also referred to as sulfosuccinates or as sulfosuccinic acid esters and the monoesters and / or diesters of sulfosuccinic acid with alcohols, preferably fatty alcohols and in particular ethoxylated fatty alcohols.
  • alcohols preferably fatty alcohols and in particular ethoxylated fatty alcohols.
  • Preferred sulfosuccinates contain C 8- i 8 fatty alcohol radicals or mixtures thereof.
  • Particularly preferred sulfosuccinates contain a fatty alcohol residue derived from ethoxylated fatty alcohols, which in themselves constitute nonionic surfactants (see description below).
  • Sulfosuccinates whose fatty alcohol residues are derived from ethoxylated fatty alcohols with a narrow homolog distribution, are again particularly preferred.
  • alk (en) ylsuccinic acid having preferably 8 to 18 carbon atoms in the alk (en) yl chain or salts thereof.
  • anionic surfactants are particularly soaps into consideration.
  • Suitable are saturated fatty acid soaps, such as the salts of lauric acid, myristic acid, palmitic acid, stearic acid, hydrogenated erucic acid and behenic acid and, in particular, soap mixtures derived from natural fatty acids, for example coconut, palm kernel or tallow fatty acids.
  • the anionic surfactants may be in the form of their sodium, potassium or ammonium salts and as soluble salts of organic bases, such as mono-, di- or triethanolamine.
  • the anionic surfactants are preferably present in the form of their sodium or potassium salts, in particular in the form of the sodium salts.
  • the surfactants may be contained in the detergents or detergents according to the invention overall in an amount of preferably from 5% by weight to 50% by weight, in particular from 8% by weight to 30% by weight, based on the finished composition ,
  • Compositions according to the invention may contain further bleaching agents.
  • bleaching agents are, for example, peroxopyrophosphates, citrate perhydrates and H 2 O 2 -producing peracidic salts or peracids, such as persulfates or persulfuric acid.
  • peroxopyrophosphates citrate perhydrates
  • H 2 O 2 -producing peracidic salts or peracids such as persulfates or persulfuric acid.
  • urea peroxohydrate percarbamide which can be described by the formula H 2 N-CO-NH 2 H 2 O 2 .
  • Bleaching agent from the group of organic bleach contain, although their use is possible in principle for detergents.
  • Typical organic bleaches are the diacyl peroxides, such as dibenzoyl peroxide.
  • Other typical organic bleaches are the peroxyacids, examples of which include the alkyl peroxyacids and the aryl peroxyacids.
  • Preferred representatives are the peroxybenzoic acid and its ring-substituted derivatives, such as alkylperoxybenzoic acids, but also peroxy- ⁇ -naphthoic acid and magnesium monoperphthalate, the aliphatic or substituted aliphatic peroxyacids, such as peroxylauric acid, peroxystearic acid, ⁇ -Phthalimidoperoxycapronsäure (Phthalimidoperoxy- hexanoic acid, PAP), o- Carboxybenzamidoperoxycaproic acid, N-Nonenylamidoperadipic acid and N-Nonenylamidopersuccinate, and aliphatic and araliphatic peroxydicarboxylic acids, such as 1,12-diperoxycarboxylic acid, 1,9-Diperoxyazelaic acid, Diperoxysebacic acid, Diperoxybrassylic acid, the diperoxyphthalic acids, 2-Decyldiperoxybut
  • the content of bleaching agent content may be from 1 to 40% by weight and in particular from 10 to 20% by weight, with perborate monohydrate or percarbonate being advantageously used.
  • perborate monohydrate or percarbonate is advantageously used.
  • the agents may also contain bleach activators.
  • bleach activators it is possible to use compounds which, under perhydrolysis conditions, give aliphatic peroxycarboxylic acids having preferably 1 to 10 C atoms, in particular 2 to 4 C atoms, and / or optionally substituted perbenzoic acid. Suitable substances are those which carry O- and / or N-acyl groups of the stated C atom number and / or optionally substituted benzoyl groups.
  • polyacylated alkylenediamines in particular tetraacetylethylenediamine (TAED), acylated triazine derivatives, in particular 1,5-diacetyl-2,4-dioxohexahydro-1,3,5-triazine (DADHT), acylated glycolurils, in particular 1, 3,4,6 Tetraacetylglycoluril (TAGU), N-acylimides, in particular N-nonanoylsuccinimide (NOSI), acylated phenolsulfonates, in particular n-nonanoyl or isononanoyloxybenzenesulfonate (n- or iso-NOBS), acylated hydroxycarboxylic acids, such as triethyl-O-acetylcitrate (TEOC), Carboxylic acid anhydrides, in particular phthalic anhydride, isoic anhydride and / or succinic an
  • hydrophilic substituted acyl acetals known from the German patent application DE 196 16 769 and the acyllactams described in the German patent application DE 196 16 770 and the international patent application WO 95/14075 are also preferably used.
  • the combinations of conventional bleach activators known from German patent application DE 44 43 177 can also be used.
  • nitrile derivatives such as cyanopyridines, nitrile quats, for example N-alkylammonium acetonitriles, and / or cyanamide derivatives can be used.
  • Preferred bleach activators are sodium 4- (octanoyloxy) benzenesulfonate, n-nonanoyl or isononanoyloxybenzenesulfonate (n- or iso-NOBS), undecenoyloxybenzenesulfonate (UDOBS), sodium dodecanoyloxybenzenesulfonate (DOBS) 1 decanoyloxybenzoic acid (DOBA, OBC 10) and / or dodecanoyloxybenzenesulfonate ( OBS 12), as well as N-methylmorpholinum acetonitrile (MMA).
  • Such bleach activators can be used in the customary amount range of from 0.01 to 20% by weight, preferably in amounts of from 0.1 to 15% by weight, in particular from 1% to 10% by weight, based on the total composition, be included.
  • bleach catalysts may also be included. These substances are bleach-enhancing transition metal salts or transition metal complexes such as Mn, Fe, Co, Ru or Mo-salene complexes or carbonyl complexes. Mn, Fe, Co, Ru, Mo, Ti, V and Cu complexes with N-containing tripod ligands and Co, Fe, Cu and Ru amine complexes are also suitable as bleach catalysts, wherein such compounds are preferably used, which are described in DE 197 09 284 A1. According to WO 99/63038 also acetonitrile derivatives and according to WO 99/63041 bleach-activating transition metal complex compounds in combination with amylases can develop a bleach-activating effect.
  • transition metal salts or transition metal complexes such as Mn, Fe, Co, Ru or Mo-salene complexes or carbonyl complexes.
  • Mn, Fe, Co, Ru, Mo, Ti, V and Cu complexes with N-containing tripod ligands and Co, Fe, Cu and Ru amine complexes
  • compositions according to the invention contain one or more builders, in particular zeolites, silicates, carbonates, organic cobuilders and - where there are no ecological reasons against their use - also the phosphates.
  • builders in particular zeolites, silicates, carbonates, organic cobuilders and - where there are no ecological reasons against their use - also the phosphates.
  • the latter are particularly preferred builders to be used in automatic dishwashing detergents.
  • NaMSi x O 2x + I yH 2 O where M is sodium or hydrogen, x is a number from 1, 6 to 4, preferably 1, 9 to 4.0 and y is a number from 0 to 20 and preferred values for x 2 , 3 or 4 are.
  • Such crystalline layered silicates are described, for example, in European Patent Application EP 0 164 514.
  • Preferred crystalline layered silicates of the formula given are those in which M is sodium and x assumes the values 2 or 3.
  • both SS and ⁇ -sodium Na 2 Si 2 O 5 ⁇ yH 2 O preferred.
  • SKS ® Celariant
  • SKS- 6® is predominantly a ⁇ -sodium disilicate of the formula
  • Na 2 Si 2 O S yH 2 O, SKS-7 ® is predominantly a beta-sodium disilicate. Reaction with acids (for example citric acid or carbonic acid) produces kanemite from the ⁇ -sodium disilicate
  • NaHSi 2 O 5 -VH 2 O commercially available under the names SKS- 9® or SKS- 10® (from Clariant). It may also be advantageous to use chemical modifications of these phyllosilicates.
  • the alkalinity of the layered silicates can be suitably influenced.
  • Phyllosilicates doped with phosphate or carbonate have, compared to the ⁇ -sodium disilicate, altered crystal morphologies, dissolve more rapidly and show an increased calcium binding capacity in comparison to ⁇ -sodium disilicate.
  • phyllosilicates of the general empirical formula x Na 2 O • y SiO 2 • z P 2 O 5 in which the ratio x to y is a number 0.35 to 0.6, the ratio x to z a number from 1, 75 to 1200 and the ratio y to z correspond to a number from 4 to 2800, described in the patent application DE 196 01 063.
  • the solubility of the layered silicates can also be increased by using particularly finely divided layered silicates. Also compounds from the crystalline layer silicates with other ingredients can be used.
  • compounds with cellulose derivatives which have advantages in the disintegrating effect and are used in particular in detergent tablets, and compounds with polycarboxylates, for example citric acid, or polymeric polycarboxylates, for example copolymers of acrylic acid, may be mentioned.
  • amorphous sodium silicates with a Na 2 O: SiO 2 modulus of from 1: 2 to 1: 3.3, preferably from 1: 2 to 1: 2.8 and in particular from 1: 2 to 1: 2.6, which Delayed and have secondary washing properties.
  • the dissolution delay compared with conventional amorphous sodium silicates may have been caused in various ways, for example by surface treatment, compounding, compaction / densification or by overdrying.
  • the term "amorphous” is also understood to mean "X-ray amorphous”.
  • the silicates do not yield sharp X-ray reflections typical of crystalline substances in X-ray diffraction experiments, but at most one or more maxima of the scattered X-rays having a width of several degrees of diffraction angle. However, it may well even lead to particularly good builder properties if the silicate particles provide blurred or even sharp diffraction maxima in electron diffraction experiments. This is to be interpreted as meaning that the products have microcrystalline regions of size 10 to a few hundred nm, values of up to max. 50 nm and in particular up to max. 20 nm are preferred. Particularly preferred are compacted / compacted amorphous silicates, compounded amorphous silicates and overdried X-ray amorphous silicates.
  • An optionally usable, finely crystalline, synthetic and bound water-containing zeolite is preferably zeolite A and / or P.
  • zeolite P zeolite MAP ® (commercial product from Crosfield) is particularly preferred.
  • zeolite X is also suitable and mixtures of A, X and / or P.
  • Commercially available and preferably used in the context of the present invention is, for example, a cocrystal of zeolite X and zeolite A (about 80 wt .-% zeolite X), available from the company CONDEA Augusta SpA is marketed under the brand name VEGOBOND AX ® and represented by the formula
  • Suitable zeolites have an average particle size of less than 10 ⁇ m (volume distribution, measuring method: Coulter Counter) and preferably contain 18 to 22% by weight, in particular 20 to 22% by weight, of bound water.
  • phosphates as builders are possible, unless such use should not be avoided for environmental reasons.
  • alkali metal phosphates with particular preference of pentasodium or pentakalium triphosphate (sodium or potassium tripolyphosphate) in the washing and cleaning industry have the greatest importance.
  • Alkali metal phosphates is the summary term for the alkali metal (especially sodium and potassium) salts of various phosphoric acids, in which one can distinguish metaphosphoric acids (HPO 3 ) n and orthophosphoric H 3 PO 4 in addition to higher molecular weight representatives.
  • the phosphates combine several advantages: they act as alkali carriers, prevent lime deposits on machine parts or lime incrustations in fabrics and also contribute to the cleaning performance.
  • Sodium dihydrogen phosphate, NaH 2 PO 4 exists as a dihydrate (density 1, 91 like “3 , melting point 60 °) and as a monohydrate (density 2.04 '3 ) Both salts are white powders which are very slightly soluble in water Heat lose the water of crystallization and at 200 0 C in the weakly acidic diphosphate (disodium hydrogenated diphosphate, Na 2 H 2 P 2 O 7 ), at higher temperature in sodium trimetaphosphate (Na 3 P 3 O 9 ) and Maddrell's salt (see below), go over.
  • NaH 2 PO 4 is acidic and is formed when phosphoric acid is adjusted to pH 4.5 with caustic soda and the mash is sprayed Potassium dihydrogen phosphate (potassium phosphate or potassium phosphate monobasic, KDP), KH 2 PO 4 , is white Salt of density 2.33, like '3 , has a melting point of 253 ° [decomposition to form potassium polyphosphate (KPO 3 ) J and is readily soluble in water.
  • Disodium hydrogen phosphate (secondary sodium phosphate), Na 2 HPO 4 , is a colorless, very slightly water-soluble crystalline salt. It exists anhydrous and with 2 moles (density 2.066 like “3 , water loss at 95 °), 7 moles (density 1, 68 like '3 , melting point 48 ° with loss of 5 H 2 O) and 12 moles water ( Density 1, 52 like "3 , melting point 35 ° with loss of 5 H 2 O), at 100 ° anhydrous and goes on stronger heating in the diphosphate Na 4 P 2 O 7 .
  • Disodium hydrogen phosphate is prepared by neutralization of phosphoric acid with soda solution using phenolphthalein as an indicator.
  • Dipotassium hydrogen phosphate (secondary or dibasic potassium phosphate), K 2 HPO 4 , is an amorphous, white salt that is readily soluble in water.
  • Trisodium phosphate, tertiary sodium phosphate, Na 3 PO 4 are colorless crystals containing as dodecahydrate a density of 1, 62 like '3 and a melting point of 73-76 0 C (decomposition), as decahydrate (corresponding 19-20% P 2 O 5) a melting point of 100 0 C and in anhydrous form (corresponding to 39-40% P 2 O 5) having a density of 2.536 like "3.
  • trisodium phosphate is readily soluble in water with an alkaline reaction and is prepared by evaporating a solution of exactly 1 Triphosphate (tertiary or tribasic potassium phosphate), K 3 PO 4 , is a white, deliquescent, granular powder of density 2.56 '3 , has a melting point of 1340 ° and is alkaline in water Reaction slightly soluble, for example, when heating Thomas slag with coal and potassium sulphate Despite the higher price, in the detergent industry, the more soluble, therefore highly effective, potassium phosphates often preferred over corresponding sodium compounds.
  • Triphosphate tertiary or tribasic potassium phosphate
  • K 3 PO 4 is a white, deliquescent, granular powder of density 2.56 '3 , has a melting point of 1340 ° and is alkaline in water Reaction slightly soluble, for example, when heating Thomas slag with coal and potassium sulphate Despite the higher price, in the detergent industry, the more soluble
  • Tetrasodium diphosphate (sodium pyrophosphate), Na 4 P 2 O 7 , exists in anhydrous form (density 2.534 like “3 , melting point 988 °, also indicated 880 °) and as decahydrate (density 1, 815-1, 836 like '3 , melting point 94 ° Both substances are colorless crystals which are soluble in water with an alkaline reaction Na 4 P 2 O 7 is formed by heating disodium phosphate to> 200 ° C.
  • Kali diphosphate potassium pyrophosphate
  • K 4 P 2 O 7 exists in the form of the trihydrate and produces a colorless hygroscopic powder with a density of 2.33% * 3 which is soluble in water, wherein the pH of the 1% solution at 25 ° is 10.4.
  • Condensation of the NaH 2 PO 4 or of the KH 2 PO 4 gives rise to relatively high molecular weight sodium and potassium phosphates, in which cyclic representatives, the sodium or potassium metaphosphates and chain-type, the sodium or potassium polyphosphates, can be distinguished.
  • cyclic representatives, the sodium or potassium metaphosphates and chain-type, the sodium or potassium polyphosphates can be distinguished.
  • melting or annealing phosphates melting or annealing phosphates
  • Graham's salt Kurrolsches
  • Maddrell's salt All higher sodium and potassium phosphates are collectively referred to as condensed phosphates.
  • pentasodium triphosphate Na 5 P 3 O 10 (sodium tripolyphosphate)
  • sodium tripolyphosphate sodium tripolyphosphate
  • n 3
  • 10O g of water dissolve at room temperature about 17 g, at 60 ° about 20 g, at 100 ° about 32 g of the salt water-free salt; after two hours of heating the solution to 100 ° caused by hydrolysis about 8% orthophosphate and 15% diphosphate.
  • pentasodium triphosphate In the preparation of pentasodium triphosphate, phosphoric acid is reacted with soda solution or sodium hydroxide solution in a stoichiometric ratio and the solution is dewatered by spraying. Similar to Graham's salt and sodium diphosphate, pentasodium triphosphate dissolves many insoluble metal compounds (including lime soaps, etc.). Pentakaliumtriphosphat, K 5 P 3 Oi 0 (potassium tripolyphosphate), for example, in the form of a 50 wt .-% solution (> 23% P 2 O 5 , 25% K 2 O) in the trade. The potassium polyphosphates are widely used in the washing and cleaning industry. There are also sodium potassium tripolyphosphates which can also be used in the context of the present invention. These arise, for example, when hydrolyzed sodium trimetaphosphate with KOH:
  • organic cobuilders it is possible in particular to use in the detergents and cleaners according to the invention polycarboxylates or polycarboxylic acids, polymeric polycarboxylates, polyaspartic acid, polyacetals, optionally oxidized dextrins, further organic cobuilders (see below) and phosphonates. These classes of substances are described below.
  • Useful organic builder substances are, for example, the polycarboxylic acids which can be used in the form of their sodium salts, polycarboxylic acids meaning those carboxylic acids which carry more than one acid function. These are, for example, citric acid, adipic acid, succinic acid, glutaric acid, malic acid, tartaric acid, maleic acid, fumaric acid, sugar acids, aminocarboxylic acids, nitrilotriacetic acid (NTA), if such use can not be avoided for ecological reasons, and mixtures of these.
  • Preferred salts are the salts of polycarboxylic acids such as citric acid, adipic acid, succinic acid, glutaric acid, tartaric acid, sugar acids and mixtures thereof.
  • the acids themselves can also be used. In addition to their builder effect, they typically also have the property of an acidifying component and thus also serve to establish a lower and milder pH of detergents or cleaners, if not the desired resulting from the mixture of the remaining components pH is desired.
  • Particular mention should be made here of system and organic acids such as citric acid, acetic acid, tartaric acid, malic acid, lactic acid, glycolic acid, succinic acid, glutaric acid, adipic acid, gluconic acid and any mixtures thereof.
  • mineral acids, in particular sulfuric acid or bases, in particular ammonium or alkali hydroxides can serve as pH regulators.
  • Such regulators are contained in the agents according to the invention in amounts of preferably not more than 20% by weight, in particular from 1.2% by weight to 17% by weight.
  • polymeric polycarboxylates for example the alkali metal salts of polyacrylic acid or of polymethacrylic acid, for example those having a relative molecular weight of 500 to 70,000 g / mol.
  • the molecular weights stated for polymeric polycarboxylates are weight-average molar masses M w of the particular acid form, which were determined in principle by means of gel permeation chromatography (GPC), a UV detector being used. The measurement was carried out against an external polyacrylic acid standard, which provides realistic molecular weight values due to its structural relationship with the polymers investigated. These data differ significantly from the molecular weight data, in which polystyrene sulfonic acids are used as standard. The molar masses measured against polystyrenesulfonic acids are generally significantly higher than the molecular weights specified in this document.
  • Suitable polymers are in particular polyacrylates, which preferably have a molecular weight of from 2,000 to 20,000 g / mol. Because of their superior solubility, the short-chain polyacrylates, which have molecular weights of from 2,000 to 10,000 g / mol, and particularly preferably from 3,000 to 5,000 g / mol, may again be preferred from this group.
  • copolymeric polycarboxylates in particular those of acrylic acid with methacrylic acid and of acrylic acid or methacrylic acid with maleic acid.
  • Copolymers of acrylic acid with maleic acid which contain 50 to 90% by weight of acrylic acid and 50 to 10% by weight of maleic acid have proven to be particularly suitable.
  • Their relative molecular weight, based on free acids, is generally from 2,000 to 70,000 g / mol, preferably from 20,000 to 50,000 g / mol and in particular from 30,000 to 40,000 g / mol.
  • the (co) polymeric polycarboxylates can be used either as a powder or as an aqueous solution.
  • the content of the (co) polymeric polycarboxylates may be from 0.5 to 20% by weight, in particular from 1 to 10% by weight.
  • the polymers may also contain allylsulfonic acids such as allyloxybenzenesulfonic acid and methallylsulfonic acid as a monomer.
  • allylsulfonic acids such as allyloxybenzenesulfonic acid and methallylsulfonic acid
  • biodegradable polymers of more than two different monomer units for example those which contain as monomers salts of acrylic acid and maleic acid and vinyl alcohol or vinyl alcohol derivatives or as monomers salts of acrylic acid and 2-alkylallylsulfonic acid and sugar derivatives.
  • copolymers are those which have as monomers preferably acrolein and acrylic acid / acrylic acid salts or acrolein and vinyl acetate.
  • polymeric aminodicarboxylic acids their salts or their precursors.
  • polyaspartic acids or their salts and derivatives are particularly preferred.
  • polyacetals which can be obtained by reacting dialdehydes with polyolcarboxylic acids which have 5 to 7 C atoms and at least 3 hydroxyl groups.
  • Preferred polyacetals are obtained from dialdehydes such as glyoxal, glutaraldehyde, terephthalaldehyde and mixtures thereof and from polyol carboxylic acids such as gluconic acid and / or glucoheptonic acid.
  • dextrins for example oligomers or polymers of carbohydrates, which can be obtained by partial hydrolysis of starches.
  • the hydrolysis can be carried out by customary, for example acid or enzyme catalyzed processes.
  • it is hydrolysis products having average molecular weights in the range of 400 to 500 000 g / mol.
  • a polysaccharide with a dextrose equivalent (DE) in the range from 0.5 to 40, in particular from 2 to 30 is preferred, DE being a customary measure of the reducing action of a polysaccharide in comparison to dextrose, which is a DE of 100 has.
  • DE dextrose equivalent
  • Both maltodextrins with a DE of between 3 and 20 and dry glucose syrups with a DE of between 20 and 37 and also yellow dextrins and white dextrins with relatively high molecular weights in the range from 2 000 to 30 000 g / mol are useful.
  • oxidized derivatives of such dextrins are their reaction products with oxidizing agents which are capable of oxidizing at least one alcohol function of the saccharide ring to the carboxylic acid function.
  • oxidizing agents which are capable of oxidizing at least one alcohol function of the saccharide ring to the carboxylic acid function.
  • Particularly preferred organic builders for agents according to the invention are oxidized starches or their derivatives from applications EP 472 042, WO 97/25399, and EP 755 944.
  • Ethylenediamine-N, N '- disuccinate (EDDS) is preferably in the form of its sodium or magnesium salts.
  • glycerol disuccinates and glycerol trisuccinates are also preferred in this context. Suitable amounts are in zeolithissen and / or silicate-containing formulations between 3 and 15 wt .-%.
  • organic cobuilders are, for example, acetylated hydroxycarboxylic acids or their salts, which may optionally also be present in lactone form and which contain at least 4 carbon atoms and at least one hydroxyl group and a maximum of two acid groups.
  • phosphonates are, in particular, hydroxyalkane or aminoalkanephosphonates.
  • hydroxyalkane phosphonates 1-hydroxyethane-1,1-diphosphonate (HEDP) is of particular importance as a co-builder. It is preferably used as the sodium salt, the disodium salt neutral and the tetrasodium salt alkaline (pH 9).
  • Preferred aminoalkanephosphonates are ethylenediamine tetramethylenephosphonate (EDTMP), diethylenetriaminepentamethylenephosphonate (DTPMP) and their higher homologs.
  • the builder used here is preferably HEDP from the class of phosphonates.
  • the aminoalkanephosphonates also have a pronounced heavy metal binding capacity. Accordingly, in particular if the agents also contain bleach, it may be preferable to use aminoalkanephosphonates, in particular DTPMP, or to use mixtures of the phosphonates mentioned.
  • Builder substances may optionally be present in the compositions according to the invention in amounts of up to 90% by weight. They are preferably contained in amounts of up to 75% by weight. Detergents according to the invention have builder contents of, in particular, from 5% by weight to 50% by weight. In agents according to the invention for the cleaning of hard surfaces, in particular for the automated cleaning of dishes, the content of builder substances is in particular from 5% by weight to 88% by weight, wherein preferably no water-insoluble builder materials are used in such agents.
  • means for the particular automatic cleaning of dishes are 20 wt .-% to 40 wt .-% of water-soluble organic builder, in particular alkali, 5 wt .-% to 15 wt .-% alkali carbonate and 20 wt .-% bis 40 wt .-% Alkalidisilikat included.
  • Solvents that can be used in the liquid to gelatinous compositions of detergents and cleaners for example, from the group of monohydric or polyhydric alcohols, alkanolamines or glycol ethers, if they are listed in the Concentration range are miscible with water.
  • the solvents are preferably selected from ethanol, n- or i-propanol, butanols, ethylene glycol methyl ether, ethylene glycol ethyl ether, ethylene glycol propyl ether, ethylene glycol mono-n-butyl ether, diethylene glycol methyl ether, diethylene glycol ethyl ether, propylene glycol methyl, -ethyl or -propyl ether, dipropylene glycol monomethyl, or -ethyl ether, di-isopropylene glycol monomethyl, or -ethyl ether, methoxy, ethoxy or Butoxytriglykol, 1-butoxyethoxy-2-propanol, 3-methyl-3-methoxybutanol, propylene glycol t-butyl ether and mixtures of these solvents.
  • Solvents may be used in the liquid to gelled detergents and cleaners according to the invention in amounts of between 0.1 and 20% by weight, but preferably below 15% by weight and in particular below 10% by weight.
  • compositions according to the invention may be admixed with one or more thickeners or thickening systems.
  • These high-molecular substances which are also called swelling agents, usually absorb the liquids and swell up to finally pass into viscous true or colloidal solutions.
  • Suitable thickeners are inorganic or polymeric organic compounds.
  • the inorganic thickeners include, for example, polysilicic acids, clay minerals such as montmorillonites, zeolites, silicas and bentonites.
  • the organic thickeners are derived from the groups of natural polymers, modified natural polymers and fully synthetic polymers.
  • Such naturally derived polymers include, for example, agar-agar, carrageenan, tragacanth, gum arabic, alginates, pectins, polyoses, guar gum, locust bean gum, starch, dextrins, gelatin and casein.
  • Modified natural products, which are used as thickeners come mainly from the group of modified starches and celluloses.
  • Fully synthetic thickeners are polymers such as polyacrylic and polymethacrylic compounds, vinyl polymers, polycarboxylic acids, polyethers, polyimines, polyamides and polyurethanes.
  • the thickeners may be present in an amount of up to 5% by weight, preferably from 0.05 to 2% by weight, and more preferably from 0.1 to 1.5% by weight, based on the finished composition ,
  • washing or cleaning agent according to the invention may contain sequestering agents, electrolytes and other auxiliaries as further customary ingredients.
  • Detergents according to the invention may contain, as optical brighteners, derivatives of diaminostilbenedisulfonic acid or their alkali metal salts.
  • derivatives of diaminostilbenedisulfonic acid or their alkali metal salts for example, salts of the 4,4'-bis (2-anilino-4-morpholino-1,3,5-triazinyl-6-amino) stilbene-2,2'- disulfonic acid or similarly constructed compounds which carry a diethanolamino group, a methylamino group, an anilino group or a 2-methoxyethylamino group instead of the morpholino group.
  • brighteners of the substituted diphenylstyrene type may be present, for example, the alkali salts of 4,4'-bis (2-sulfostyryl) -diphenyl, 4,4'-bis (4-chloro-3-sulfostyryl) -diphenyl, or 4 - (4-chlorostyryl) -4 '- (2-sulfostyryl).
  • Mixtures of the aforementioned optical brightener can be used.
  • Graying inhibitors have the task of keeping suspended from the textile fiber dirt suspended in the fleet.
  • Water-soluble colloids of mostly organic nature are suitable for this purpose, for example starch, glue, gelatin, salts of ether carboxylic acids or ether sulfonic acids of starch or of cellulose or salts of acidic sulfuric acid esters of cellulose or starch.
  • water-soluble polyamides containing acidic groups are suitable for this purpose.
  • starch derivatives can be used, for example aldehyde starches.
  • cellulose ethers such as carboxymethylcellulose (Na salt), methylcellulose, hydroxyalkylcellulose and mixed ethers, such as methylhydroxyethylcellulose, methylhydroxypropylcellulose, methylcarboxymethylcellulose and mixtures thereof, for example in amounts of from 0.1 to 5% by weight, based on the compositions ,
  • silver corrosion inhibitors can be used in dishwashing detergents according to the invention.
  • dishwashing detergents Such are known in the art, for example benzotriazoles, iron (III) chloride or CoSO 4 .
  • particularly suitable silver corrosion inhibitors for use in conjunction with enzymes are manganese, titanium, zirconium, hafnium, vanadium, cobalt or cerium salts and / or complexes where the said metals are present in one of the oxidation states II, III, IV, V or VI.
  • examples of such compounds are MnSO4, V 2 O 5, V 2 O 4, VO 2, TiOSO 4, K 2 TiF 6, K 2 ZrF 6, Co (N0 3) 2, Co (NO 3) 3l and mixtures thereof ,
  • Soil-release or “soil repellents” are mostly polymers which impart soil repellency when used in a laundry detergent detergent and / or aid in the soil release performance of the other detergent ingredients. A similar effect can also be observed in their use in hard surface cleaners.
  • Particularly effective and long-known soil release agents are copolyesters with dicarboxylic acid, alkylene glycol and polyalkylene glycol units.
  • Examples thereof are copolymers or copolymers of polyethylene terephthalate and polyoxyethylene glycol (DT 16 17 141, or DT 22 OO 911).
  • German Offenlegungsschrift DT 22 53 063 acidic agents are mentioned which contain, inter alia, a copolymer of a dibasic carboxylic acid and an alkylene or cycloalkylene polyglycol.
  • Polymers of ethylene terephthalate and polyethylene oxide terephthalate and their use in detergents are described in German patents DE 28 57 292 and DE 33 24 258 and European patent EP 0 253 567.
  • European patent EP 066 944 relates to compositions containing a copolyester of ethylene glycol, polyethylene glycol, aromatic dicarboxylic acid and sulfonated aromatic dicarboxylic acid in certain molar ratios.
  • European Patent EP 0 185 427 discloses methyl or ethyl end-capped polyesters having ethylene and / or propylene terephthalate and polyethylene oxide terephthalate units and detergents containing such soil release polymer.
  • European patent EP 0 241 984 relates to a polyester which, besides oxyethylene groups and terephthalic acid units, also contains substituted ethylene units and also glycerine units.
  • European Patent EP 0 241 985 discloses polyesters which, in addition to oxyethylene groups and terephthalic acid units, contain 1, 2-propylene, 1, 2-butylene and / or 3-methoxy-1, 2-propylene groups and also glycerol units and with C 1 - to C 4 alkyl groups are end lawver liability.
  • European Patent Application EP 0 272 033 discloses, at least proportionally, polyesters terminated by C 1 -C 4 -alkyl or acyl groups and having polypropylene propylene terephthalate and polyoxyethylene terephthalate units.
  • European Patent EP 0 274 907 describes sulfoethyl end-capped terephthalate-containing soil release polyesters.
  • sulfonation of unsaturated end groups produces soil release polyesters with terephthalate, alkylene glycol and poly-C 2-4 glycol units.
  • International Patent Application WO 95/32232 relates to acidic, aromatic soil release polymers.
  • International Patent Application WO 97/31085 discloses non-polymeric soil repellent active ingredients for multi-functional cotton materials: a first entity, which may be cationic, for example, is capable of adsorption to the cotton surface by electrostatic interaction, and a second Unit that is hydrophobic is responsible for the retention of the drug at the water / cotton interface.
  • the color transfer inhibitors which are suitable for use in textile detergents according to the invention include in particular polyvinylpyrrolidones, polyvinylimidazoles, polymeric N-oxides such as poly (vinylpyridine-N-oxide) and copolymers of vinylpyrrolidone with vinylimidazole.
  • foam inhibitors are, for example, soaps of natural or synthetic origin, which have a high proportion of Ci 8 -C 24 fatty acids.
  • Suitable non-surfactant foam inhibitors are, for example, organopolysiloxanes and mixtures thereof with microfine, optionally signed silica and paraffins, waxes, microcrystalline waxes and mixtures thereof with silanated silica or bistearylethylenediamide. It is also advantageous to use mixtures of various foam inhibitors, for example those of silicones, paraffins or waxes.
  • the foam inhibitors in particular silicone and / or paraffin-containing foam inhibitors, are bound to a granular, water-soluble, or dispersible carrier substance.
  • a hard surface cleaning agent according to the invention may contain abrasive constituents, in particular from the group comprising quartz flours, wood flours, plastic flours, chalks and glass microspheres and mixtures thereof.
  • Abrasive substances are preferably not more than 20% by weight, in particular from 5% by weight to 15% by weight, in the cleaning agents according to the invention.
  • Dyes and fragrances are added to detergents and cleaners in order to improve the aesthetic appearance of the products and to provide the consumer with a visually and sensory "typical and unmistakable" product in addition to the washing and cleaning performance.
  • perfume oils or fragrances individual perfume compounds, for example the synthetic products of the ester type, ethers, aldehydes, ketones, alcohols and hydrocarbons can be used.
  • ester-type fragrance compounds are benzyl acetate, phenoxyethyl isobutyrate, p-tert-butylcyclohexyl acetate, linalyl acetate, dimethylbenzylcarbinylacetate, phenylethylacetate, linalylbenzoate, benzylformate, ethylmethylphenylglycinate, allylcyclohexylpropionate, styrallylpropionate and benzylsalicylate.
  • the ethers include, for example, benzyl ethyl ether, to the aldehydes, for example, the linear alkanals having 8-18 C atoms, citral, citronellal, citronellyloxyacetaldehyde, cyclamen aldehyde, hydroxycitronellal, lilial and bourgeonal, to the ketones, for example, the ionone, ⁇ -lsomethylionon and methyl cedryl ketone, to the alcohols anethole, citronellol, eugenol, geraniol, linalool, phenylethyl alcohol and terpineol, the hydrocarbons include mainly the terpenes such as limonene and pinene.
  • fragrance oils may also contain natural fragrance mixtures such as are available from vegetable sources, for example, pine, citrus, jasmine, patchouly, rose or ylang-ylang oil. Also suitable are muscatel, sage, chamomile, clove, lemon balm, mint, cinnamon, lime, juniper, vetiver, olibanum, galbanum and labdanum, and orange blossom, neroliol, orange peel and sandalwood.
  • the content of detergents and cleaners to dyes is less than 0.01 wt .-%, while perfumes can account for up to 2 wt .-% of the total formulation.
  • the fragrances can be incorporated directly into the detergents and cleaners, but it can also be advantageous to apply the fragrances to carriers, which enhance the adhesion of the perfume to the items to be cleaned and provide a slower fragrance release for long-lasting fragrance, especially of treated textiles.
  • carrier materials for example, cyclodextrins have been proven, the cyclodextrin-perfume complexes can be additionally coated with other excipients.
  • a further preferred carrier for fragrances is the described zeolite X, which can also absorb fragrances instead of or in mixture with surfactants. Washing and cleaning agents which are described are therefore preferred Zeolite X and fragrances which are preferably at least partially absorbed on the zeolite.
  • Preferred dyes the selection of which presents no difficulty to the skilled person, have a high storage stability and insensitivity to the other ingredients of the agents and to light and no pronounced substantivity to textile fibers so as not to stain them.
  • Detergents or cleaners may contain antimicrobial agents to combat microorganisms. Depending on the antimicrobial spectrum and mechanism of action, a distinction is made between bacteriostatic agents and bactericides, fungistatics and fungicides, etc. Important substances from these groups are, for example, benzalkonium chlorides, alkylarylsulfonates, halophenols and phenolmercuric acetate.
  • antimicrobial action and antimicrobial active substance have the usual meaning within the scope of the teaching according to the invention, which is described, for example, by KH Wallophen in "Praxis der Sterilisation, Disinfection - Conservation: Germ Identification - Company Hygiene” (5th edition - Stuttgart, New York: Thieme, 1995
  • Suitable antimicrobial agents are preferably selected from the groups of alcohols, amines, aldehydes, antimicrobial acids or their salts, carboxylic esters, acid amides, phenols, phenol derivatives, diphenyls, diphenylalkanes, Urea derivatives, oxygen, nitrogen acetals and formals, benzamidines, isothiazolines, phthalimide derivatives, pyridine derivatives, antimicrobial surface-active compounds, guanidines, antimicrobial amphoteric compounds, quinolines, 1,2-dibromo-2,4-dicyanobutane, iodo-2-propyl butyl
  • the antimicrobial agent may be selected from ethanol, n-propanol, i-propanol, 1,3-butanediol, phenoxyethanol, 1,2-propylene glycol, glycerol, undecylenic acid, benzoic acid, salicylic acid, dihydracetic acid, o-phenylphenol, N-methylmorpholine.
  • acetonitrile MMA
  • 2-benzyl-4-chlorophenol 2,2'-methylenebis (6-bromo-4-chlorophenol), 4,4'-dichloro-2'-hydroxydiphenyl ether (dichlosan), 2,4 , 4'-trichloro-2'-hydroxydiphenyl ether (trichlosan), chlorhexidine, N- (4-chlorophenyl) -N- (3,4-dichlorophenyl) -urea, N, N '- (1, 10-decanediyldi- 1-pyridinyl-4-ylidene) bis- (1-octanamine) dihydrochloride, N.N'-bis-chloro-chloro-O-S-i-diimino-Al, .is-tetraaza-tetradecandiimidamide, glucoprotamines, antimicrobial quaternary surfactant Compounds, guanidines including the bi-
  • halogenated xylene and cresol derivatives such as p-chlorometacresol or p-chloro-meta-xylene, and natural antimicrobial agents of plant origin (for example, from spices or herbs), animal and microbial origin.
  • antimicrobial surface-active quaternary compounds a natural antimicrobial agent of plant origin and / or a natural antimicrobial agent of animal origin, most preferably at least one natural antimicrobial agent of plant origin from the group comprising caffeine, theobromine and theophylline and essential oils such as eugenol, thymol and geraniol, and / or at least one natural antimicrobial agent of animal origin from the group, comprising enzymes such as protein from milk, lysozyme and lactoperoxidase, and / or at least one antimicrobial surface-active quaternary compound with an ammonium, sulfonium, phosphonium, iodonium - or Arsonium distr, peroxo compounds and chlorine compounds are used. Also substances of microbial origin, so-called bacteriocins, can be used.
  • the quaternary ammonium compounds (QAV) suitable as antimicrobial agents have the general formula (R 1 ) (R 2 ) (R 3 ) (R 4 ) N + X " , in which R 1 to R 4 are identical or different C 1 -C 22 -alkyl radicals, C 7 -C 2 8-aralkyl radicals or heterocyclic radicals, where two or in the case of an aromatic inclusion as in pyridine even three radicals together with the nitrogen atom Heterocycle, for example a pyridinium or imidazolinium compound, and X "are halide ions, sulfate ions, hydroxide ions or similar anions.
  • at least one of the residues has a chain length of 8 to 18, in particular 12 to 16, carbon atoms. Atoms on.
  • QACs can be prepared by reacting tertiary amines with alkylating agents, such as, for example, methyl chloride, benzyl chloride, dimethyl sulfate, dodecyl bromide, but also ethylene oxide.
  • alkylating agents such as, for example, methyl chloride, benzyl chloride, dimethyl sulfate, dodecyl bromide, but also ethylene oxide.
  • alkylating agents such as, for example, methyl chloride, benzyl chloride, dimethyl sulfate, dodecyl bromide, but also ethylene oxide.
  • alkylating agents such as, for example, methyl chloride, benzyl chloride, dimethyl sulfate, dodecyl bromide, but also ethylene oxide.
  • alkylating agents such as, for example, methyl chloride, benzyl chloride, dimethyl sulfate, dodecyl bromide, but also
  • Suitable QACs are, for example, benzalkonium chloride (N-alkyl-N, N-dimethylbenzylammonium chloride, CAS No. 8001-54-5), benzalkone B (m, p-dichlorobenzyldimethyl-C 12 -alkylammonium chloride, CAS No. 58390-78-6), benzoxonium chloride (benzyldodecylbis (2-hydroxyethyl) ammonium chloride), cetrimonium bromide (N-hexadecyl-N, N-trimethylammonium bromide, CAS No.
  • benzetonium chloride N, N-dimethyl-N- [2- [2- [p- (1,1,3,3-tetramethylbutyl) phenoxy] ethoxy] ethyl] benzyl ammonium chloride, CAS No 121-54-0
  • dialkyldimethylammonium chlorides such as di-n-decyldimethylammonium chloride (CAS No. 7173-51-5-5), didecyldimethylammonium bromide (CAS No. 2390-68-3), dioctyl- dimethyl ammonium chloride, 1-cetylpyridinium chloride (CAS No.
  • QACs are the benzalkonium chlorides having C 8 -C 18 -alkyl radicals, in particular C 1 -C 4 -alkyl-benzyl-dimethyl-ammonium chloride.
  • Benzalkonium halides and / or substituted benzalkonium halides are for example commercially available as Barquat ® ex Lonza, Marquat® ® ex Mason, Variquat ® ex Witco / Sherex and Hyamine ® ex Lonza and as Bardac ® ex Lonza.
  • antimicrobial agents are N- (3-chloroallyl) hexaminium chloride such as Dowicide and Dowicil ® ® ex Dow, benzethonium chloride such as Hyamine ® 1622 ex Rohm & Haas, methylbenzethonium as Hyamine ® 1ox ex Rohm & Haas, cetylpyridinium chloride such as Cepacol ex Merrell Labs ,
  • the antimicrobial agents are used in amounts of 0.0001 wt .-% to 1 wt .-%, preferably from 0.001 wt .-% to 0.8 wt .-%, particularly preferably from 0.005 wt .-% to 0.3 wt .-% and in particular from 0.01 to 0.2 wt .-% used.
  • the agents may contain UV absorbers (UV absorbers), which are applied to the treated textiles and improve the light resistance of the fibers and / or the light resistance of other formulation ingredients.
  • UV absorber are organic substances (Sunscreen) to understand that are able to absorb ultraviolet rays and the absorbed energy in the form of long-wave radiation, for example, to give off heat.
  • Compounds having these desired properties include, for example, the non-radiative deactivating compounds and derivatives of benzophenone having substituents in the 2- and / or 4-position.
  • substituted benzotriazoles in the 3-position phenyl-substituted acrylates (cinnamic acid derivatives, optionally with cyano groups in the 2-position), salicylates, organic Ni complexes and natural products such as umbelliferone and the body's own urocanic acid are suitable.
  • UV-B absorbers may be mentioned: 3-Benzylidencampher or 3-Benzylidennorcampher and its derivatives, for example 3- (4-methylbenzylidene) camphor, as described in EP 0693471 B1; 4-aminobenzoic acid derivatives, preferably 2-ethylhexyl 4- (dimethylamino) benzoate, 2-octyl 4- (dimethylamino) benzoate and 4- (dimethylamino) benzoic acid ester; Esters of cinnamic acid, preferably 4-methoxycinnamic acid 2-ethylhexyl ester, 4-methoxycinnamic acid propyl ester, 4-methoxycinnamic acid isoamyl ester, 2-cyano-3,3-phenylcinnamic acid 2-ethylhexyl ester (octocrylene); Esters of salicylic acid, preferably 2-ethylhexyl salicylate,
  • 2-phenylbenzimidazole-5-sulfonic acid and its alkali metal, alkaline earth metal, ammonium, alkylammonium, alkanolammonium and glucammonium salts Sulfonic acid derivatives of benzophenones, preferably 2-hydroxy-4-methoxybenzophenone-5-sulfonic acid and its salts
  • Sulfonic acid derivatives of 3-Benzylidencamphers such as 4- (2-oxo-3-bionylidenemethyl) benzenesulfonic acid and 2-methyl-5- (2-oxo-3-bomylidene) sulfonic acid and salts thereof.
  • UV-A filter in particular derivatives of benzoylmethane come into question, such as 1- (4'-tert-butylphenyl) -3- (4'-methoxyphenyl) propane-1, 3-dione, 4-tert-butyl 4'-methoxydibenzoylmethane (Parsol 1789), 1-phenyl-3- (4'-isopropylphenyl) -propane-1, 3-dione and also enamine compounds, as described in DE 19712033 A1 (BASF).
  • the UV-A and UV-B filters can also be used in mixtures.
  • insoluble photoprotective pigments namely finely dispersed, preferably nano-metal oxides or salts
  • suitable metal oxides are, in particular, zinc oxide and titanium dioxide and, in addition, oxides of iron, Zirconium, silicon, manganese, aluminum and cerium, and mixtures thereof.
  • salts silicates (talc), barium sulfate or zinc stearate can be used.
  • the oxides and salts are already used in the form of the pigments for skin-care and skin-protecting emulsions and decorative cosmetics.
  • the particles should have an average diameter of less than 100 nm, preferably between 5 and 50 nm and in particular between 15 and 30 nm.
  • the pigments may have a spherical shape, but it is also possible to use those particles which have an ellipsoidal or otherwise deviating shape from the spherical shape.
  • the pigments can also be surface-treated, ie hydrophilized or hydrophobized. Typical examples are coated titanium dioxides, for example titanium dioxide T 805 (Degussa) or Eusolex® T2000 (Merck; preferred hydrophilic coating agents are silicones and particularly preferably trialkoxyoctylsilanes or simethicones.) Micronized zinc oxide is preferably used the review by P. Finkel in S ⁇ FW Journal, Volume 122 (1996), p 543.
  • the UV absorbents are usually used in amounts of from 0.01% by weight to 5% by weight, preferably from 0.03% by weight to 1% by weight.
  • compositions according to the invention may contain, in addition to the enzymes according to the invention, further enzymes in order to increase the washing or cleaning performance, it being possible in principle to use all enzymes established for this purpose in the prior art.
  • enzymes include in particular proteases, amylases, lipases, hemicellulases, cellulases or oxidoreductases, and preferably mixtures thereof.
  • These enzymes are basically of natural origin; Starting from the natural molecules, improved variants are available for use in detergents and cleaners, which are preferably used accordingly.
  • Agents according to the invention preferably contain enzymes in total amounts of 1 ⁇ 10 -6 to 5 weight-percent based on active protein
  • the protein concentration can be determined by known methods, for example the BCA method (bicinchoninic acid, 2,2'-biquinolyl-4,4 'dicarboxylic acid) or the biuret method (AG Gornall, CS Bardawill and MM David, J. BbI Chem, 177 (1948), pp. 751-766).
  • subtilisin type examples thereof are the subtilisins BPN 'and Carlsberg, the protease PB92, the subtilisins 147 and 309, the alkaline protease from Bacillus lentus, subtilisin DY and the enzymes thermitase, proteinase K and the subtilases, but not the subtilisins in the narrower sense Proteases TW3 and TW7.
  • subtilisin Carlsberg in a developed form under the trade names Alcalase ® from Novozymes A / S, Bagsvaerd, Denmark.
  • subtilisins 147 and 309 are sold under the trade names Esperase ®, or Savinase ® from Novozymes.
  • Esperase ® or Savinase ® from Novozymes.
  • the protease from Bacillus lentus DSM 5483 (WO 91/02792 A1) the listed under the name BLAP ® variants, particularly in WO 92/21760 A1, WO 95/23221 A1, WO 02/088340 A2 and WO 03 derive, / 038082 A2.
  • Further useful proteases from various Bacillus sp. and B. gibsonii are apparent from the patent applications WO 03/054185 A1, WO 03/056017 A2, WO 03/055974 A2 and WO 03/054184 A1.
  • proteases are, for example, under the trade names Durazym ®, relase ®, Everlase® ®, Nafizym, Natalase ®, Kannase® ® and Ovozymes ® from Novozymes, under the trade names Purafect ®, Purafect ® OxP and Properase.RTM ® by the company Genencor, that under the trade name Protosol® ® from Advanced Biochemicals Ltd., Thane, India, under the trade name Wuxi ® from Wuxi Snyder Bioproducts Ltd., China, under the trade names Proleather® ® and protease P ® by the company Amano Pharmaceuticals Ltd., Nagoya, Japan, and the enzyme available under the name Proteinase K-16 from Kao Corp., Tokyo, Japan.
  • amylases which can be used according to the invention are the ⁇ -amylases from Bacillus licheniformis, B. amyloliquefaciens or B. stearothermophilus and also their further developments improved for use in detergents and cleaners.
  • the enzyme from B. licheniformis is available from Novozymes under the name Termamyl ® and from Genencor under the name Purastar® ® ST. Development products of this ⁇ - amylase are available from Novozymes under the trade names Duramyl ® and Termamyl ® ultra, from Genencor under the name Purastar® ® OxAm and from Daiwa Seiko Inc., Tokyo, Japan, as Keistase ®.
  • the ⁇ -amylase from B. amyloliquefaciens is marketed by Novozymes under the name BAN ®, and variants derived from the ⁇ -amylase from B. stearothermophilus under the names BSG ® and Novamyl ®, likewise from Novozymes.
  • ⁇ -amylase from Bacillus sp. Disclosed in the application WO 02/10356 A2 for this purpose.
  • a 7-7 (DSM 12368) and the cyclodextrin glucanotransferase (CGTase) from B. agaradherens (DSM 9948) described in the application WO 02/44350 A2.
  • the amylolytic enzymes which belong to the sequence space of ⁇ -amylases, which is defined in the application WO 03/002711 A2, and those which are described in the application WO 03/054177 A2 can be used.
  • fusion products of the molecules mentioned can be used, for example those from application DE 10138753 A1.
  • compositions according to the invention may contain lipases or cutinases, in particular because of their triglyceride-cleaving activities, but also in order to supplement the present invention to generate suitable precursors in situ peracids.
  • lipases or cutinases include, for example, the lipases originally obtainable from Humicola lanuginosa (Thermomyces lanuginosus) or further developed, in particular those with the amino acid exchange D96L. They are for example marketed by Novozymes under the trade names Lipolase ®, Lipolase Ultra ®, LipoPrime® ®, Lipozyme® ® and Lipex ®.
  • the cutinases can be used, which were originally isolated from Fusarium solani pisi and Humicola insolens.
  • useable lipases are available from Amano under the designations Lipase CE ®, Lipase P ®, Lipase B ®, or lipase CES ®, Lipase AKG ®, Bacillis sp.
  • Lipase® , Lipase AP® , Lipase M- AP® and Lipase AML® are available.
  • the lipases, or cutinases can be used, the initial enzymes were originally isolated from Pseudomonas mendocina and Fusarium solanii.
  • Detergents according to the invention may contain cellulases, depending on the purpose, as pure enzymes, as enzyme preparations or in the form of mixtures in which the individual components advantageously supplement each other in terms of their various performance aspects.
  • These performance aspects include, in particular, contributions to the primary washing performance, the secondary washing performance of the composition (anti-redeposition effect or graying inhibition) and softening (fabric effect), up to the exercise of a "stone washed" effect.
  • EG endoglucanase
  • Novozymes under the trade name Celluzyme ®.
  • the products Endolase® ® and Carezyme ® available also from Novozymes based on the 50 kD EG and 43 kD EG applicable from H. insolens DSM 1800.
  • Further commercial products of this company are Cellusoft® ® and Renozyme ®. The latter is based on the application WO 96/29397 A1.
  • Performance-enhanced cellulase variants are disclosed, for example, in the application WO 98/12307 A1.
  • cellulases disclosed in the application WO 97/14804 A1 can be used; For example, it revealed 20 kD EG Melanocarpus, available from AB Enzymes, Finland, under the trade names Ecostone® ® and Biotouch ®. Further commercial products from AB Enzymes are Econase® ® and ECOPULP ®. Other suitable cellulases from Bacillus sp. CBS 670.93 and CBS 669.93 are disclosed in WO 96/34092 A2, wherein those derived from Bacillus sp. CBS 670.93 from the company Genencor under the trade name Puradax ® is available.
  • Suitable mannanases are available, for example under the name Gamanase ® and Pektinex AR ® from Novozymes, under the name Rohapec ® B1 L from AB Enzymes and under the name Pyrolase® ® from Diversa Corp., San Diego, CA 1 USA ,
  • a suitable ⁇ -glucanase from a S. alcalophilus is disclosed, for example, in the application WO 99/06573 A1.
  • the .beta.-glucanase obtained from B. subtilis is available under the name Cereflo ® from Novozymes.
  • detergents and cleaners according to the invention may be oxidoreductases, for example oxidases, oxygenases, catalases, peroxidases, such as halo, chloro, bromo, lignin, glucose or manganese peroxidases, dioxygenases or laccases (phenol oxidases, polyphenol oxidases) contain.
  • oxidases oxygenases, catalases, peroxidases, such as halo, chloro, bromo, lignin, glucose or manganese peroxidases, dioxygenases or laccases (phenol oxidases, polyphenol oxidases) contain.
  • Suitable commercial products Denilite® ® 1 and 2 from Novozymes should be mentioned.
  • organic, particularly preferably aromatic, compounds which interact with the enzymes in order to enhance the activity of the relevant oxidoreductases (enhancers) or to ensure the flow of electrons (mediators) at greatly varying redox potentials between the oxidizing enzymes and the soils.
  • the enzymes used in agents of the invention are either originally from microorganisms, such as the genera Bacillus, Streptomyces, Humicola, or Pseudomonas, and / or are produced by biotechnological methods known per se by suitable microorganisms, such as transgenic expression hosts of the genera Bacillus or filamentous fungi.
  • the purification of the relevant enzymes is conveniently carried out by conventional methods, for example by precipitation, sedimentation, concentration, filtration of the liquid phases, microfiltration, ultrafiltration, exposure to chemicals, deodorization or suitable combinations of these steps.
  • the agents of the invention may be added to the enzymes in any form known in the art. These include, for example, the solid preparations obtained by granulation, extrusion or lyophilization or, especially in the case of liquid or gel-form detergents, solutions of the enzymes, advantageously as concentrated as possible, sparing in water and / or added with stabilizers.
  • the enzymes can be encapsulated for both the solid and liquid dosage forms, for example by spray drying or extrusion of the enzyme solution together with a, preferably natural polymer or in the form of capsules, for example those in which the enzymes are entrapped as in a solidified gel or in those of the core-shell type in which an enzyme-containing core with a water, air and water / or chemical impermeable protective layer is coated.
  • additional active ingredients for example stabilizers, emulsifiers, pigments, bleaches or dyes can be applied.
  • Such capsules are applied by methods known per se, for example by shaking or rolling granulation or in fluid-bed processes.
  • such granules for example by applying polymeric film-forming agent, low in dust and storage stable due to the coating.
  • the protein concentration attributable to the enzymes contained, in particular to the contained choline oxidases can be determined by known methods, for example the BCA method (bicinchoninic acid, 2,2'-biquinolyl-4,4'-dicarboxylic acid) or the biuret method (AG Gornall, CS Bardawill and MM David, J. BbI. Chem. 177 (1948), pp. 751-766).
  • BCA method bicinchoninic acid, 2,2'-biquinolyl-4,4'-dicarboxylic acid
  • the biuret method AG Gornall, CS Bardawill and MM David, J. BbI. Chem. 177 (1948), pp. 751-766.
  • a protein and / or enzyme contained in an agent according to the invention can be protected against damage, for example inactivation, denaturation or decomposition, for example by physical influences, oxidation or proteolytic cleavage, in particular during storage.
  • damage for example inactivation, denaturation or decomposition, for example by physical influences, oxidation or proteolytic cleavage, in particular during storage.
  • inhibition of proteolysis is particularly preferred, especially if the agents also contain proteases.
  • Preferred agents according to the invention contain stabilizers for this purpose.
  • One group of stabilizers are reversible protease inhibitors.
  • Benzamidine hydrochloride, borax, boric acids, boronic acids or their salts or esters are frequently used for this purpose, including, in particular, derivatives with aromatic groups, for example ortho, meta or para-substituted phenylboronic acids, in particular 4-formylphenylboronic acid, or the salts or Esters of the compounds mentioned.
  • peptide aldehydes that is oligopeptides with a reduced C-terminus, especially those of 2 to 50 monomers are used for this purpose.
  • the peptidic reversible protease inhibitors include ovomucoid and leupeptin.
  • specific, reversible peptide inhibitors for the protease subtilisin and fusion proteins from proteases and specific peptide inhibitors are suitable.
  • enzyme stabilizers are amino alcohols such as mono-, di-, triethanol- and -propanolamine and mixtures thereof, aliphatic carboxylic acids up to C 12 , such as succinic acid, other dicarboxylic acids or salts of said acids. End-capped fatty acid amide alkoxylates are also suitable for this purpose. Certain used as builders organic acids, as disclosed in WO 97/18287, additionally stabilize a contained enzyme.
  • Lower aliphatic alcohols but especially polyols such as glycerol, ethylene glycol, propylene glycol or sorbitol are other frequently used enzyme stabilizers.
  • Di-glycerol phosphate also protects against denaturation due to physical influences.
  • calcium and / or magnesium salts are used, such as calcium acetate or calcium formate.
  • Polyamide oligomers or polymeric compounds such as lignin, water-soluble vinyl copolymers or cellulose ethers, acrylic polymers and / or polyamides stabilize the enzyme preparation, inter alia, against physical influences or pH fluctuations.
  • Polyamine N-oxide containing polymers act simultaneously as enzyme stabilizers and as dye transfer inhibitors.
  • Other polymeric stabilizers are linear C 8 -C 18 polyoxyalkylenes.
  • alkylpolyglycosides can stabilize the enzymatic components of the agent according to the invention and, preferably, are capable of additionally increasing their performance.
  • Crosslinked N-containing compounds preferably perform a dual function as soil release agents and as enzyme stabilizers. Hydrophobic, nonionic polymer stabilizes in particular an optionally contained cellulase.
  • Reducing agents and antioxidants increase the stability of the enzymes to oxidative degradation; Sulfur-containing reducing agents, for example, are suitable for this purpose.
  • Other examples include sodium sulfite and reducing sugars.
  • peptide-aldehyde stabilizers for example of polyols, boric acid and / or borax, the combination of boric acid or borate, reducing salts and succinic acid or other dicarboxylic acids or the combination of boric acid or borate with polyols or polyamino compounds and with reducing salts.
  • the effect of peptide-aldehyde stabilizers is favorably enhanced by the combination with boric acid and / or boric acid derivatives and polyols, and still further by the additional action of divalent cations, such as calcium ions.
  • Agents according to the invention are characterized in a preferred embodiment in that they consist of more than one phase, for example in order to release the active substances contained in time or in space. These may be phases in different, but in particular phases in the same physical states.
  • compositions according to the invention which are composed of more than one solid component, can be prepared in a simple manner by mixing various solid components, in particular powders, granules or extrudates with different ingredients and / or different release behavior in total loose form are mixed together.
  • the preparation of solid agents according to the invention from one or more phases can be carried out in a known manner, for example by spray drying or granulation, the enzymes and any other thermally sensitive ingredients such as, for example, bleaching agents optionally being added separately later.
  • compositions according to the invention having an increased bulk density in particular in the range from 650 g / l to 950 g / l, preference is given to a process known from the European patent EP 0 486 592 which has an extrusion step.
  • Another preferred preparation by means of a granulation process is described in the European patent EP 0 642 576.
  • Proteins can be used for solid agents, for example in dried, granulated, encapsulated or encapsulated and additionally dried form. They may be added separately, ie as a separate phase, or with other ingredients together in the same phase, with or without compaction. If microencapsulated enzymes are to be processed in solid form, the water can be removed by methods known from the prior art from the aqueous solutions resulting from the workup, such as spray drying, centrifuging or by solubilization. The particles obtained in this way usually have a particle size between 50 and 200 microns.
  • the encapsulated form lends itself, as discussed above, also to protecting the enzymes from other ingredients, such as bleaches, or to allow for controlled release.
  • Such capsules are disclosed, for example, with the patent applications WO 97/24177 and DE 199 18 267.
  • Another possible encapsulation method is that the enzymes suitable for use in detergents or cleaning agents, starting from a mixture of the enzyme solution with a solution or suspension of starch or a starch derivative, are encapsulated in starch or the starch derivative. Such an encapsulation process is described in the German application DE 199 56 382.
  • compositions according to the invention in tablet form, which may be single-phase or multiphase, monochromatic or multicolored and / or consist of a plurality of layers, preferably all constituents - optionally one layer at a time - are mixed together in a mixer and the mixture is mixed by means of conventional tablet presses, For example, eccentric or rotary presses, pressed with compressive forces in the range of about 50 to 100 kN / cm 2 , preferably at 60 to 70 kN / cm 2 .
  • a tablet produced in this way has a weight of from 10 g to 50 g, in particular from 15 g to 40 g.
  • the spatial form of the tablets is arbitrary and can be round, oval or angular, with intermediate forms are also possible.
  • At least one of the phases contains an amylase-sensitive material, in particular starch, or is at least partially surrounded or coated by it.
  • this phase is mechanically stabilized and / or protected against external influences and simultaneously attacked by an effective in the wash liquor amylase, so that the release of the ingredients is facilitated.
  • agents according to the invention are characterized in that they are in total liquid, gelatinous or pasty.
  • the proteins contained, preferably a protein of the invention are preferably based on a carried out in the prior art protein recovery and preparation in concentrated aqueous or nonaqueous solution, for example in liquid form, such as solution, suspension or emulsion, but also in gel form or encapsulated or added as a dried powder.
  • Such detergents or cleaners according to the invention in the form of solutions in customary solvents are generally prepared by simple mixing of the ingredients which can be added in bulk or as a solution in an automatic mixer.
  • One embodiment of the present invention is those liquid, gelatinous or pasty compositions to which a protein essential to the invention and / or one of the other proteins contained and / or one of the other ingredients contained has been encapsulated, preferably added in the form of microcapsules.
  • Particularly preferred are those with capsules of amylase sensitive material.
  • Such co-use of amylase-sensitive materials and an amylolytic enzyme in a detergent may exhibit synergistic effects, such as the starch-cleaving enzyme assisting cleavage of the microcapsules, thus controlling the release process of the encapsulated ingredients so that their release will not occur during the period Storage and / or not at the beginning of the cleaning process, but only at a certain time takes place.
  • complex detergent and cleaner systems can be based on a wide variety of ingredients and various capsule types, which are particularly preferred embodiments of the present invention.
  • a comparable effect is given when the ingredients of the detergent or cleaner are distributed over at least two different phases, for example two or more solid, interconnected phases of a tablet detergent or detergent, or different granules within the same powdered agent.
  • Two- or polyphase cleaners are prior art for use in both automatic dishwashers and detergents.
  • the activity of an amylolytic enzyme in an earlier activated phase is a prerequisite for the activation of a later phase when it is surrounded by an amylase-sensitive envelope or coating or the amylase-sensitive material is an integral part of the solid phase, in its partial or complete Hydrolysis disintegrates the relevant phase.
  • the ingredients of detergents and cleaners are suitably able to assist one another in their performance.
  • polymers which can be used simultaneously as co-builders such as, for example, alkyl polyglycosides, can stabilize and increase the activity and the stability of enzymes contained.
  • a Carlsberg variant according to the invention modified by one of the other ingredients listed above, in particular stabilized and / or increased in its contribution to the washing or cleaning performance of the agent.
  • a further subject of the invention are processes for the cleaning of textiles or of hard surfaces, which are characterized in that in at least one of the process steps an above-described choline oxidase variant according to the invention becomes active.
  • the invention is realized in that the inventive improved enzymatic properties are exploited in terms of improvement in principle every cleaning process.
  • Each purification process is enriched for the activity in question if it is added in at least one process step.
  • Such methods are realized, for example, with machines such as common household dishwashers or household washing machines. Preferred methods are preferred according to the information given above. Further preferred are such methods, which are characterized in that the choline oxidase variant is used via an agent described above.
  • a further subject of the invention is a hair-washing and / or hair-care composition containing choline oxidases according to the invention.
  • the hair washing and / or hair care products as well as bubble baths, shower baths, creams, gels, lotions, alcoholic and aqueous / alcoholic solutions, emulsions, wax / fat compositions, stick preparations, powders or ointments which comprise choline oxidases which can be used according to the invention and choline oxidases according to the invention in particular as auxiliaries and additives mild surfactants, oil bodies, emulsifiers, superfatting agents, pearlescent waxes, bodying agents, thickeners, polymers, silicone compounds, fats, waxes, stabilizers, biogenic agents, deodorants, antiperspirants, antidandruff agents, film formers, swelling agents, UV light Protective factors, antioxidants, hydrotropes, preservatives, insect repellents, tans, solubilizers, perfume oils, dyes and the like.
  • Suitable mild, i. particularly skin-compatible surfactants are fatty alcohol polyglycol ether sulfates, monoglyceride sulfates, mono- and / or dialkyl sulfosuccinates, fatty acid isethionates, fatty acid sarcosinates, fatty acid taurides, fatty acid glutamates, D-olefinsulfonates, ethercarboxylic acids, alkyl oligoglucosides, fatty acid glucamides, alkylamidobetaines and / or protein fatty acid condensates, the latter preferably based on wheat proteins.
  • Suitable oil bodies are, for example, Guerbet alcohols based on fatty alcohols having 6 to 18, preferably 8 to 10 carbon atoms, esters of linear C 6 -C 22 fatty acids with linear C 6 - C 22 -fatty alcohols, esters of branched C 6 -C 3 -carboxylic acids with linear C 6 -C 22 -fatty alcohols, such as myristyl myristate, myristyl palmitate, myristyl stearate, Myristylisostearat, myristyl, Myristylbehenat, Myristylerucat, cetyl myristate, cetyl palmitate, cetyl stearate, Cetylisostearat, cetyl oleate, cetyl behenate, Cetylerucat, Stearylmyristat, stearyl palmitate, stearyl stearate, Stearylisostearat, stearyl oleate, stearyl
  • esters of linear C 6 -C 22 fatty acids with branched alcohols in particular 2-ethylhexanol
  • esters of hydroxycarboxylic acids with linear or branched C 6 -C 22 fatty alcohols in particular dioctyl malates
  • esters of linear and / or branched fatty acids with polyhydric alcohols for example propylene glycol, dimer diol or trimer triol
  • polyhydric alcohols for example propylene glycol, dimer diol or trimer triol
  • Guerbet alcohols triglycerides based on C 6 - C 10 fatty acids, liquid mono- / di- / triglyceride mixtures based on C 6 -C 18 fatty acids
  • esters of C 6 -C 22 fatty alcohols and / or Guerbet alcohols with aromatic carboxylic acids in particular benzoic acid, esters of C 1 -C 4 -dicarboxylic acids with linear or branched alcohols having
  • Suitable emulsifiers are nonionic surfactants from at least one of the following groups: (1) addition products of 2 to 30 moles of ethylene oxide and / or 0 to 5 moles of propylene oxide to linear fatty alcohols having 8 to 22 carbon atoms, to fatty acids having 12 to 22 carbon atoms, to alkylphenols having 8 to 15 carbon atoms in the alkyl group and alkylamines having 8 to 22 carbon atoms in the alkyl radical;
  • alkyl and / or alkenyl mono- and oligoglycosides having 8 to 22 carbon atoms in the alk (en) yl radical and their ethoxylated analogs;
  • partial esters based on linear, branched, unsaturated or saturated C 6/22 fatty acids, ricinoleic acid and 12-hydroxystearic acid and glycerol, polyglycerol, pentaerythritol, dipentaerythritol, sugar alcohols (eg sorbitol), alkyl glucosides (eg methyl glucoside, butyl glucoside, lauryl glucoside) as well as polyglucosides (eg cellulose);
  • Alkyl and / or alkenyl mono- and oligoglycosides are known in the art. They are produced, in particular, by the implementation of Glu cose or oligosaccharides with primary alcohols having 8 to 18 carbon atoms.
  • the glycoside radical both monoglycosides in which a cyclic sugar residue is glycosidically linked to the fatty alcohol and oligomeric glycosides having a degree of oligomerization of preferably approximately 8 are suitable.
  • the degree of oligomerization is a statistical mean, which is based on a homolog distribution typical for such technical products.
  • zwitterionic surfactants can be used as emulsifiers.
  • Zwitterionic surfactants are those surface-active compounds which carry at least one quaternary ammonium group and at least one carboxylate and one sulfonate group in the molecule.
  • Particularly suitable zwitterionic surfactants are the so-called betaines, such as N-alkyl-N, N-dimethylammonium glycinates, for example cocoalkyldimethylammonium glycinate, N-acylaminopropyl N, N-dimethylammonium glycinates, for example cocoacylaminopropyldimethylammonium glycinate, and 2-alkyl-3-carboxylmethyl-3 Hydroxyethylimidazoline having in each case 8 to 18 carbon atoms in the alkyl or acyl group and the cocoacylaminoethyl hydroxyethylcarboxymethylglycinat.
  • betaines such as N-alkyl-N, N-dimethylammonium glycinates, for example cocoalkyldimethylammonium glycinate, N-acylaminopropyl N, N-dimethylammonium glycinates, for example coco
  • fatty acid amide derivative known under the CTFA name Cocamidopropyl Betaine.
  • ampholytic surfactants are surface-active compounds which, apart from a C / i ⁇ alkyl or acyl group containing 8 in the molecule at least one free amino group and at least one -COOH or -SO3H group and are capable of forming inner salts.
  • ampholytic surfactants are N-alkylglycines, N-alkylpropionic acids, N-alkylaminobutyric acids, N-alkyliminodipropionic acids, N-hydroxyethyl-N-alkylamidopropylglycines, N-alkyltaurines, N-alkylsarcosines, 2-alkylaminopropionic acids and alkylaminoacetic acids each having about 8 to 18 C atoms in the alkyl group.
  • Particularly preferred ampholytic surfactants are N-cocoalkylaminopropionate, cocoacylaminoethylaminopropionate and C 12 / i ⁇ -acylsarcosine.
  • quaternary emulsifiers are also suitable, with those of the esterquat type, preferably methyl-quaternized difatty acid triethanolamine ester salts, being particularly preferred.
  • substances such as lanolin and lecithin as well as polyethoxylated or acylated lanolin and lecithin derivatives, polyol fatty acid esters, monoglycerides and fatty acid alkanolamides can be used, the latter also serving as foam stabilizers.
  • Suitable pearlescing waxes are, for example: alkylene glycol esters, especially ethylene glycol distearate; Fatty acid alkanolamides, especially coconut fatty acid diethanolamide; Partial glycerides, especially stearic acid monoglyceride; Esters of polybasic, optionally hydroxy-substituted carboxylic acids with fatty alcohols having 6 to 22 carbon atoms, especially long-chain esters of tartaric acid; Fatty substances, such as fatty alcohols, fatty ketones, fatty aldehydes, fatty ethers and fatty carbonates, which in total have at least 24 carbon atoms, especially lauron and distearyl ether; Fatty acids such as stearic acid, hydroxystearic acid or behenic acid, ring-opening products of olefin epoxides having 12 to 22 carbon atoms with fatty alcohols having 12 to 22 carbon atoms and / or polyols having 2 to 15 carbon atoms
  • fatty alcohols or hydroxy fatty alcohols having 12 to 22 and preferably 16 to 18 carbon atoms and in addition partial glycerides, fatty acids or hydroxy fatty acids into consideration. Preference is given to a combination of these substances with alkyl oligoglucosides and / or fatty acid N-methylglucamides of the same chain length and / or polyglycerol poly-12-hydroxystearates.
  • Suitable thickening agents are, for example, Aerosil types (hydrophilic silicic acids), polysaccharides, in particular xanthan gum, guar guar, agar agar, alginates and tyloses, carboxymethyl cellulose and hydroxyethyl cellulose, and also higher molecular weight
  • surfactants such as ethoxylated fatty acid glycerides, esters of fatty acids with polyols such as pentaerythritol or trimethylolpropane, fatty alcohol ethoxylates with narrow homolog distribution or alkyl oligoglucosides and electrolytes such as saline and ammonium chloride.
  • Suitable cationic polymers are, for example, cationic cellulose derivatives, such as, for example, a quaternized hydroxyethylcellulose which is obtainable under the name Polymer JR 400® from Amerchol, cationic starch, copolymers of diallylammonium salts and acrylamides, quaternized vinylpyrrolidone / vinylimidazole polymers, such as, for example, Luviquat® (BASF) , Condensation products of polyglycols and amines, quaternized collagen polypeptides such as lauryldimonium hydroxypropyl hydrolyzed collagen (Lamequat®L / Grünau), quaternized wheat polypeptides, polyethylenimine, cationic silicone polymers such as amidomethicones, copolymers of adipic acid and dimethylaminohydroxypropyldiethylenetriamine (Cartaretine® / Sandoz), copolymers of Acrylic acid with di
  • anionic, zwitterionic, amphoteric and nonionic polymers are vinyl acetate / crotonic acid copolymers, vinylpyrrolidone / vinyl acrylate copolymers,
  • Suitable silicone compounds are, for example, dimethylpolysiloxanes,
  • Methylphenylpolysiloxanes cyclic silicones and amino, fatty acid, alcohol, polyether, epoxy, fluorine, glycoside and / or alkyl-modified silicone compounds which may be both liquid and resinous at room temperature.
  • simethicones which are mixtures of dimethicones having an average chain length of from 200 to 300 dimethylsiloxane units and hydrogenated silicates.
  • suitable volatile silicones can also be found in Todd et al. in Cosm.Toil. 91, 27 (1976).
  • fats are glycerides, as waxes u.a. natural waxes, e.g. Candelilla wax, carnauba wax, Japan wax, esparto wax wax, cork wax, guaruma wax, rice germ oil wax, sugarcane wax, ouricury wax, montan wax, beeswax, shellac wax, spermaceti, lanolin (wool wax), crepe fat, ceresin, ozokerite (ground wax), petrolatum, paraffin waxes, microwaxes; chemically modified waxes (hard waxes), e.g. Montan ester waxes, sasol waxes, hydrogenated jojoba waxes and synthetic waxes, such as e.g. Polyalkylene waxes and polyethylene glycol waxes in question.
  • natural waxes e.g. Candelilla wax, carnauba wax, Japan wax, esparto wax wax, cork wax, gua
  • metal salts of fatty acids e.g. Magnesium, aluminum and / or zinc stearate or ricinoleate can be used.
  • Biogenic active substances are, for example, tocopherol, tocopherol acetate, tocopherol palmitate, ascorbic acid, deoxyribonucleic acid, retinol, bisabolol, allantoin, phytantriol, panthenol, AHA acids, amino acids, ceramides, pseudoceramides, essential oils, plant extracts and vitamin complexes.
  • deodorants counteract, cover or eliminate body odors. Body odors are caused by the action of skin bacteria on apocrine Sweat, whereby unpleasant-smelling degradation products are formed. Accordingly, deodorants contain active ingredients which act as anti-sprouting agents, enzyme inhibitors, odor absorbers or odor maskers.
  • germ-inhibiting agents which may optionally be added to the cosmetics of the invention, in principle all substances effective against gram-positive bacteria are suitable, such as.
  • Enzyme inhibitors can also be added to the cosmetics of the invention.
  • esterase inhibitors may be suitable enzyme inhibitors. These are preferably trialkyl citrates such as trimethyl citrate, tripropyl citrate, triisopropyl citrate, tributyl citrate and in particular triethyl citrate (Hydagen® CAT, Henkel KGaA, Dusseldorf / FRG). The substances inhibit the enzyme activity and thereby reduce odors.
  • esterase inhibitors are sterol sulfates or phosphates, such as, for example, lanosterol, cholesterol, campesterol, stigmasterol and sitosterol sulfate or phosphate, dicarboxylic acids and their esters, for example glutaric acid, monoethyl glutarate, glutaric acid diethyl ester, Adipic acid, adipic acid monoethyl ester, diethyl adipate, malonic acid and diethyl malonate, hydroxycarboxylic acids and their esters such as citric acid, malic acid, tartaric acid or diethyl tartrate, and zinc glycinate.
  • sterol sulfates or phosphates such as, for example, lanosterol, cholesterol, campesterol, stigmasterol and sitosterol sulfate or phosphate
  • dicarboxylic acids and their esters for example glutaric acid, monoethyl glutarate, glutaric
  • Suitable odor absorbers are substances that absorb and largely retain odor-forming compounds. They reduce the partial pressure of the individual components and thus also reduce their propagation speed. It is important that perfumes must remain unimpaired. Odor absorbers have no activity against bacteria. They contain, for example, as a main component of a complex zinc salt of ricinoleic acid or special, largely odorless fragrances, which are known in the art as "fixatives", such. B. Extracts of Labdanum or Styrax or certain Abietinklarivate. Odor maskers are fragrances or perfume oils which, in addition to their function as odor maskers, give the deodorants their respective scent. Examples of perfume oils are mixtures of natural and synthetic fragrances.
  • Natural fragrances are extracts of flowers, stems and leaves, fruits, fruit peel, roots, woods, herbs and grasses, needles and twigs, as well as resins and balsams. Furthermore, animal raw materials come into question, such as civet and Castoreum.
  • typical Synthetic fragrance compounds are ester type products, ethers, aldehydes, ketones, alcohols and hydrocarbons.
  • Antiperspirants reduce the formation of sweat by influencing the activity of eccrine sweat glands and thus counteract underarm wetness and body odor.
  • Aqueous or anhydrous formulations of antiperspirants typically contain the following ingredients:
  • adjuvants such as. B. thickener or complexing agent and / or
  • non-aqueous solvents such as. As ethanol, propylene glycol and / or glycerol.
  • Salts of aluminum, zirconium or zinc are especially suitable as astringent antiperspirant active ingredients.
  • suitable antiperspirant active ingredients are e.g. Aluminum chloride, aluminum chlorohydrate, aluminum dichlorohydrate, aluminum sesquichlorohydrate and their complex compounds e.g. With propylene glycol-1, 2. Aluminiumhydroxyallantoinat, aluminum chloride tartrate, aluminum zirconium trichlorohydrate, aluminum zirconium tetrachlorohydrate, aluminum zirconium pentachlorohydrate and their complex compounds z. With amino acids such as glycine.
  • antiperspirants may contain customary oil-soluble and water-soluble adjuvants in smaller amounts.
  • oil-soluble adjuvants may be e.g. be:
  • Usual water-soluble additives are e.g. Preservatives, water-soluble fragrances, pH adjusters, e.g. Buffer mixtures, water-soluble thickeners, e.g. water-soluble natural or synthetic polymers such as e.g. Xanthan gum, hydroxyethyl cellulose, polyvinyl pyrrolidone or high molecular weight polyethylene oxides.
  • Climbazole, octopirox and zinc pyrethion can be used as anti-dandruff agents.
  • Common film formers are, for example, chitosan, microcrystalline chitosan, quaternized chitosan, polyvinylpyrrolidone, vinylpyrrolidone-vinyl acetate copolymers, polymers of the Acrylic acid series, quaternary cellulose derivatives, collagen, hyaluronic acid or salts thereof and similar compounds.
  • Suitable swelling agents for aqueous phases are montmorillonites, clay minerals, pemulen and alkyl-modified carbopol types (Goodrich). Further suitable polymers or swelling agents can be reviewed by R. Lochhead in Cosm.Toil. 108, 95 (1993).
  • UVB filters can be oil-soluble or water-soluble. As oil-soluble substances are e.g. to call:
  • 3-benzylidene camphor or 3-benzylidene norcamphor and its derivatives e.g. 3- (4-methylbenzylidene) camphor as described in EP 0693471 B1;
  • 4-aminobenzoic acid derivatives preferably 4-dimethylamino) benzoic acid 2-ethylhexyl ester, 4- (dimethylamino) benzoic acid 2-octyl ester and 4- (dimethylamino) benzoic acid amyl ester;
  • Esters of cinnamic acid preferably 4-methoxycinnamic acid 2-ethylhexyl ester, 4-methoxycinnamic acid propyl ester, 4-methoxycinnamic acid isoamyl ester 2-cyano-3,3-phenylcinnamic acid 2-ethylhexyl ester (octocrylene);
  • Esters of salicylic acid preferably 2-ethylhexyl salicylate, 4-isopropylbenzyl salicylate, homomenthyl salicylate;
  • benzophenone preferably 2-hydroxy-4-methoxybenzophenone, 2-hydroxy-4-methoxy-4'-methylbenzophenone, 2,2'-dihydroxy-4-methoxybenzophenone;
  • Esters of benzalmalonic acid preferably di-2-ethylhexyl 4-methoxybenzmalonate
  • Triazine derivatives e.g. 2,4,6-Trianilino- (p-carbo-2'-ethyl-1'-hexyloxy) -1, 3,5-triazine and octyl triazone, as described in EP 0818450 A1 or dioctyl butamido triazone (Uvasorb® HEB );
  • Propane-1,3-diones e.g. 1- (4-tert-butylphenyl) -3-4'-methoxyphenyl) propane-1,3-dione;
  • Suitable water-soluble substances are:
  • Sulfonic acid derivatives of benzophenones preferably 2-hydroxy-4-methoxybenzophenone-5-sulfonic acid and its salts;
  • Sulfonic acid derivatives of the 3-benzylidene camphor such as, for example, 4- (2-oxo-3-bomylidenemethyl) benzenesulfonic acid and 2-methyl-5- (2-oxo-3-bomylidene) sulfonic acid and salts thereof.
  • UV-A filter in particular derivatives of benzoylmethane come into question, such as 1- (4'-tert-butylphenyl) -3- (4'-methoxyphenyl) propane-1, 3-dione, 4-tert-butyl 4'-methoxydibenzoylmethane (Parsol 1789), 1-phenyl-3- (4'-isopropylphenyl) -propane-1, 3-dione and also enamine compounds, as described in DE 19712033 A1 (BASF).
  • the UV-A and UV-B filters can also be used in mixtures.
  • insoluble photoprotective pigments namely finely dispersed metal oxides or salts
  • suitable metal oxides are in particular zinc oxide and titanium dioxide and, in addition, oxides of iron, zirconium, silicon, manganese, aluminum and cerium and mixtures thereof.
  • salts silicates (talc), barium sulfate or zinc stearate can be used.
  • the oxides and salts are used in the form of the pigments for skin-care and skin-protecting emulsions and decorative cosmetics.
  • the particles should have an average diameter of less than 100 nm, preferably between 5 and 50 nm and in particular between 15 and 30 nm.
  • the pigments may have a spherical shape, but it is also possible to use those particles which have an ellipsoidal or otherwise deviating shape from the spherical shape.
  • the pigments can also be surface-treated, ie hydrophilized or hydrophobized. Typical examples are coated titanium dioxides, such as titanium dioxide T 805 (Degussa) or Eusolex® T2000 (Merck). Suitable hydrophobic coating agents are in particular silicones and in particular trialkoxyoctylsilanes or simethicones. In sunscreens, so-called micro- or nanopigments are preferably used. Preferably, micronized zinc oxide is used. Further suitable UV photoprotective filters can be found in the review by P.Finkel in S ⁇ FW-Journal 122, 543 (1996).
  • secondary light stabilizers of the antioxidant type which interrupt the photochemical reaction chain which is triggered when UV radiation penetrates into the skin.
  • Typical examples are amino acids (eg glycine, histidine, tyrosine, tryptophan) and their derivatives, imidazoles (eg urocaninic acid) and their derivatives, peptides such as D, L-carnosine, D-carnosine, L-carnosine and their derivatives (eg anserine) , Carotenoids, carotenes (eg ⁇ -carotene, ⁇ -carotene, lycopene) and their derivatives, chlorogenic acid and its derivatives, lipoic acid and its derivatives (eg dihydrolipoic acid), aurothioglucose, propylthiouracil and other thiols (eg thioredoxin, glutathione, cysteine, cystine, Cy
  • Hydrotropes such as, for example, ethanol, isopropyl alcohol, or polyols can also be used to improve the flow behavior.
  • Polyols contemplated herein preferably have from 2 to 15 carbon atoms and at least two hydroxyl groups.
  • the polyols may contain other functional groups, in particular amino groups, or be modified with nitrogen. Typical examples are
  • Alkylene glycols such as ethylene glycol, diethylene glycol, propylene glycol, butylene glycol, hexylene glycol, and polyethylene glycols having an average molecular weight of 100 to 1,000 daltons;
  • MethyolENSen in particular trimethylolethane, trimethylolpropane, trimethylolbutane, pentaerythritol and dipentaerythritol;
  • Lower alkyl glucosides especially those having 1 to 8 carbons in the alkyl radical, such as, for example, methyl and butyl glucoside;
  • Sugar alcohols having 5 to 12 carbon atoms such as sorbitol or mannitol,
  • sugars having 5 to 12 carbon atoms such as glucose or sucrose
  • Dialcoholamines such as diethanolamine or 2-amino-1,3-propanediol.
  • Suitable preservatives are, for example, phenoxyethanol, formaldehyde solution, parabens, pentanediol or sorbic acid and the other classes of substances listed in Appendix 6, Part A and B of the Cosmetics Regulation.
  • Suitable insect repellents are N, N-diethyl-m-toluamide, 1,2-pentanediol or ethyl butylacetylaminopropionate, suitable as a self-tanner is dihydroxyacetone.
  • perfume oils are called mixtures of natural and synthetic fragrances.
  • Natural fragrances are extracts of flowers (lily, lavender, roses, jasmine, neroli, ylang-ylang), stems and leaves (geranium, patchouli, petitgrain), fruits (aniseed, coriander, caraway, juniper), fruit peel (bergamot, lemon, Oranges), roots (macis, angelica, celery, cardamom, costus, iris, calmus), wood (pine, sandal, guaiac, cedar, rosewood), herbs and grasses (tarragon, lemongrass, sage, thyme), Needles and twigs (spruce, fir, pine, pines), resins and balsams (galbanum, elemi, benzoin, myrrh, olibanum, opoponax). Furthermore, animal raw materials come into question, such as civet and Castoreum. Typical synthetic fragrance compounds are ester type products, ethers, aldehydes, ketones, alcohols and hydrocarbons.
  • dyes the substances suitable and suitable for cosmetic purposes can be used, as compiled, for example, in the publication "Cosmetic Colorants” of the Dye Commission of the Irish Klastician, Verlag Chemie, Weinheim, 1984, pp. 81-106. These dyes are usually used in concentrations of 0.001 to 0.1 wt .-%, based on the total mixture.
  • the total amount of auxiliaries and additives may be 1 to 50, preferably 5 to 40 wt .-% - based on the means - amount.
  • the preparation of the agent can be carried out by conventional cold or hot processes; It is preferable to work according to the phase inversion temperature method.
  • Another object of the invention is an oxidation dye for dyeing keratin fibers containing choline oxidases useful in the invention and in particular choline oxidases according to the invention.
  • keratin fibers are wool, feathers, furs and especially human hair to understand.
  • the oxidation dye precursors and the choline oxidases are incorporated into a suitable aqueous carrier with the exclusion of atmospheric oxygen.
  • suitable aqueous carrier with the exclusion of atmospheric oxygen.
  • Such carriers are z.
  • thickened aqueous solutions creams (emulsions), gels or surfactant-containing foaming preparations, eg. As shampoos or foam aerosols or other preparations that are suitable for use on the hair.
  • anhydrous powders are also suitable as carriers; in this case, the oxidation colorants are dissolved or dispersed in water immediately before use.
  • carrier components are preferred
  • Reducing agents hair conditioning additives fragrances and
  • Solvents such as water, glycols or lower alcohols.
  • anionic surfactants As wetting and emulsifying z. As anionic, zwitterionic, ampholytic and nonionic surfactants. Also cationic surfactants can be used to achieve certain effects.
  • Suitable thickeners are the water-soluble high molecular weight polysaccharide derivatives or Polypep-tide, z.
  • cellulose or starch ethers gelatin, plant gums, biopolymers (xanthan gum) or water-soluble synthetic polymers such.
  • polyvinylpyrrolidone polyvinyl alcohol, polyethylene oxides, polyacrylamides, polyurethanes, polyacrylates and others.
  • surfactant-containing preparations can also be thickened by solubilization or emulsification of polar lipids.
  • lipids are for.
  • gel-based carrier based on aqueous soap gels, z. For example, of ammonium oleate.
  • Reducing agents added to the carrier to prevent premature oxidative development of the dye before application to the hair are e.g., sodium sulfite or sodium ascorbate.
  • Hair care additives may e.g. Fats, oils or waxes in emulsified form, structuring additives such.
  • structuring additives such.
  • glucose or pyridoxine avivierende components such.
  • water-soluble proteins protein degradation products, amino acids, water-soluble cationic polymers, silicones, vitamins, panthenol or plant extracts.
  • fragrances and solvents such as.
  • glycols such as 1, 2-propylene glycols, glycerol, glycol ethers such as.
  • butyl glycol ethyl diglycol or lower monohydric alcohols such as ethanol or isopropanol.
  • adjuvants may be included which improve the stability and performance characteristics of the oxydation dyes, e.g. As complexing agents such as EDTA, NTA or organophosphonates, swelling and penetration agents such. As urea, guanidine, bicarbonates, buffer salts such. As ammonium chloride, ammonium citrate, ammonium sulfate or alkanolammonium salts and optionally propellants.
  • Another object of the invention is an agent for oral, dental or denture care, in particular prosthesis cleaner containing choline oxidases according to the invention for bleaching or disinfection.
  • both the administration as denture cleansing tablets, as well as mouthwash or mouthwash or toothpaste is suitable.
  • the oral, dental and / or dental prosthesis care products according to the invention can be present, for example, as a mouthwash, gel, liquid toothbrush lotion, stiff toothpaste, denture cleaner or denture adhesive cream.
  • pulverulent preparations or aqueous-alcoholic solutions serve as mouthwash 0 to 15 wt .-% ethanol, 1 to 1, 5 wt .-% flavor oils and 0.01 to 0.5 wt .-% sweeteners or as mouthwash concentrates From 15 to 60% by weight of ethanol, from 0.05 to 5% by weight of flavoring oils, from 0.1 to 3% by weight of sweeteners and, if appropriate, further auxiliaries may be included and diluted with water before use.
  • the concentration of the components must be so high that, after dilution, the specified lower concentration limits are not undershot during use.
  • gels and more or less flowable pastes which are expressed from flexible plastic containers or tubes and applied to the teeth with the aid of a toothbrush, can also serve as the carrier.
  • Such products contain higher levels of humectants and binders or consistency regulators and polishing components.
  • aromatic oils, sweeteners and water are also contained in these preparations.
  • humectants e.g. Glycerol, sorbitol, XyNt, propylene glycols, Polyethenylenglycole or mixtures of these polyols, in particular those Polyethenylenglycole be used with molecular weights of 200 to 800 (from 400 to 2000).
  • sorbitol is contained as humectant in an amount of 25-40 wt .-%.
  • condensed phosphates may be present in the form of their alkali metal salts, preferably in the form of their sodium or potassium salts.
  • the aqueous solutions of these phosphates react alkaline due to hydrolytic effects.
  • the pH of the oral, dental and / or dental prosthesis care agents according to the invention is adjusted to the preferred values of 7.5-9.
  • mixtures of different condensed phosphates or else hydrated salts of the condensed phosphates are also possible to use mixtures of different condensed phosphates or else hydrated salts of the condensed phosphates.
  • the condensed phosphate is a sodium or potassium tripolyphosphate in an amount of 5-10% by weight of the composition.
  • a preferred active ingredient is a caries-inhibiting fluorine compound, preferably from the group of fluorides or monofluorophosphates in an amount of 0.1 to 0.5 wt .-% fluorine.
  • Suitable fluorine compounds are, for example, sodium monofluorophosphate (Na 2 PO 3 F), potassium monofluorophosphate, sodium or potassium fluoride, tin fluoride or the fluoride of an organic amino compound.
  • Suitable binders and consistency regulators are, for example, natural and synthetic water-soluble polymers such as carrageenan, tragacanth, guar, starch and their non-ionic derivatives such as hydroxypropyl guar, hydroxyethyl starch, cellulose ethers such as hydroxyethyl cellulose or methylhydroxypropyl cellulose.
  • agar-agar, xanthan gum, pectins water-soluble carboxyvinyl polymers (for example Carbopol ® types), polyvinyl alcohol, polyvinyl pyrrolidone, high molecular weight polyethylene glycols (molecular weight 10 3 to 10 6 D).
  • Further substances which are suitable for viscosity control are phyllosilicates such as montmorillonite clays, colloidal thickening silicas, eg airgel silica or fumed silicas.
  • polishing components may all heretofore known polishing agent, but preferably precipitated and gel silicas, aluminum hydroxide, aluminum silicate, alumina, alumina trihydrate, insoluble sodium metaphosphate, calcium pyrophosphate, calcium hydrogen phosphate, dicalcium phosphate, chalk, hydroxyapatite, hydrotalcites, talc, magnesium aluminum silicate (Veegum ®), calcium sulfate, magnesium carbonate, Magnesium oxide, sodium aluminum silicates, such as zeolite A or organic polymers, such as polymethacrylate, are used.
  • the polishing agents are preferably used in smaller amounts of eg 1-10% by weight.
  • Aromatic oils are all natural and synthetic flavors which are customary for oral, dental and / or dental care products. Natural flavors can be used both in the form of the essential oils isolated from the drugs and the individual components isolated from them. At least one aromatic oil from the group of peppermint oil, spearmint oil, aniseed oil, caraway oil, eucalyptus oil, fennel oil, cinnamon oil, geranium oil, sage oil, thyme oil, marjoram oil, basil oil, citrus oil, Gaultheria oil or one or more synthetically produced components of these oils isolated therefrom should preferably be present.
  • oils mentioned are, for example, menthol, carvone, anethole, cineole, eugenol, cinnamaldehyde, geraniol, citronellol, linalool, salvos, thymol, terpinene, terpinol, methylchavicol and methyl salicylate.
  • suitable flavors are, for example, menthyl acetate, vanillin, ionone, linalyl acetate, rhodinol and piperitone.
  • Suitable sweeteners are either natural sugars such as sucrose, maltose, Lactose and fructose or synthetic sweeteners such as saccharin sodium salt, sodium cyclamate or aspartame.
  • alkyl and / or alkenyl (oligo) glycosides can be used as surfactants.
  • Their preparation and use as surfactants are described, for example, in US Pat. No. 3,839,318, US Pat. No. 3,707,535, US Pat. No. 3,547,828 DE-A-19 43 689, DE-A-20 36 472 and DE -A-30 01 064 and EP-A-77 167 known.
  • the degree of oligomerization is a statistical mean, which is based on a homolog distribution typical for such technical products.
  • alkyl and / or alkenyl (oligo) glycoside As alkyl and / or alkenyl (oligo) glycoside, an alkyl and / or alkenyl (oligo) glucoside of the formula RO (C 6 H 10 O) x -H in which R is an alkyl radical and is preferably suitable / or alkenyl group having 8 to 14 carbon atoms and x has an average of 1 to 4.
  • Alkyl oligoglucoside glucoside are particularly preferred based on hydrogenated C12 / i 4 coconut alcohol with a DP of 1 to 3.
  • the alkyl and / or alkenyl glycoside surfactant can be very efficient use, wherein already amounts of 0.005 to 1 weight .-% are sufficient.
  • nonionic, ampholytic and cationic surfactants may also be present, for example: fatty alcohol polyglycol ether sulfates, monoglyceride sulfates, monoglyceride ether sulfates, mono- and / or dialkyl sulfosuccinates, fatty acid isethionates, fatty acid sarcosinates, fatty acid taurides, fatty acid glutamates,
  • Ethercarbon yarn, Fettkladreglucamide, Alkylamido betaine and / or protein fatty acid condensates the latter preferably based on wheat proteins.
  • a non-ionic solubilizer from the group of surface-active compounds may be required.
  • Particularly suitable for this purpose are, for example, ethoxylated fatty acid glycerides, ethoxylated fatty acid sorbitan partial esters or fatty acid partial esters of glycerol or sorbitan ethoxylates.
  • Solubilizers from the group of ethoxylated Fettkladreglyceride include especially addition products of 20 to 60 moles of ethylene oxide with mono- and diglycerides of linear fatty acids having 12 to 18 carbon atoms or triglycerides of hydroxy fatty acids such as oxystearic acid or ricinoleic acid.
  • Further suitable solubilizers are ethoxylated fatty acid sorbitan partial esters; these are preferably addition products of 20 to 60 moles of ethylene oxide with sorbitan monoesters and sorbitan diesters of fatty acids with 12 to 18 carbon atoms.
  • solubilizers are fatty acid partial esters of glycerol or sorbitan ethoxylates; the preferred are mono- and diesters of C 12 -C 8 fatty acids and addition products of 20 to 60 moles of ethylene oxide with 1 mole of glycerol or with 1 mol of sorbitol.
  • the oral, dental and / or dental prosthesis care agents according to the invention preferably contain as solubilizer for optionally contained aroma oils addition products of 20 to 60 moles of ethylene oxide to hardened or uncured castor oil (ie to Oxystearinklare- or ricinoleic acid triglyceride), to glycerol mono- and / or distearate or sorbitan mono- and / or distearate.
  • aroma oils addition products of 20 to 60 moles of ethylene oxide to hardened or uncured castor oil (ie to Oxystearinklare- or ricinoleic acid triglyceride), to glycerol mono- and / or distearate or sorbitan mono- and / or distearate.
  • customary additives for oral, dental and / or dental care medium are, for example, pigments, for example titanium dioxide, and / or dyes, pH adjusters and buffer substances, for example sodium bicarbonate, sodium citrate, sodium benzoate, citric acid, phosphoric acid or acidic salts, for example NaH 2 PO 4 wound-healing and anti-inflammatory substances such as allantoin, urea, panthenol, azulen or chamomile extract further anti-calculus substances such as organophosphonates, eg Hydroxyethandiphosphonate or Azacycloheptandiphosphonat preservatives such as sorbic acid salts, p-hydroxybenzoic acid esters.
  • Plaque inhibitors such as hexachlorophene, chlorhexidine, hexetidine, triclosan, bromochlorophene, phenylsalicylic acid ester.
  • the composition is a mouthwash, a mouthwash, a denture cleanser or a denture adhesive.
  • per-compounds such as, for example, peroxoborate, peroxomonosulfate or percarbonate are additionally suitable for prosthesis cleaners according to the invention, in particular prosthesis cleansing tablets and powders. They have the advantage that, in addition to the bleaching effect, they simultaneously have a deodorizing and / or disinfecting effect.
  • the use of such per-compounds in prosthesis cleaners is between 0.01 and 10 wt .-%, in particular between 0.5 and 5 wt .-%.
  • ingredients are also enzymes, e.g. Proteases and carbohydrase, suitable for the breakdown of proteins and carbohydrates.
  • the pH can be between pH 4 and pH 12, in particular between pH 5 and pH 11.
  • auxiliaries are additionally necessary, such as, for example, agents which give off a bubbling effect, for example CO 2 releasing substances such as sodium bicarbonate, fillers, for example sodium sulfate or dextrose, lubricants, for example magnesium stearate, flow regulators, for example colloidal silica and granulating agents, such as the already mentioned high molecular weight polyethylene glycols or polyvinylpyrrolidone.
  • Denture adhesives can be offered as powders, creams, foils or liquids and support the adhesion of the prostheses.
  • natural and synthetic swelling substances are suitable.
  • natural swelling agents besides alginates, plant gums, such as e.g. Gum arabic, tragacanth and karaya gum as well as natural rubber.
  • alginates and synthetic bulking agents e.g. Sodium carboxymethyl cellulose, high molecular weight ethylene oxide copolymers, salts of poly (vinyl ether-co-maleic acid) and polyacrylamides.
  • hydrophobic bases in particular hydrocarbons, such as white Vaseline (DAB) or paraffin oil.
  • DAB white Vaseline
  • paraffin oil paraffin oil
  • Another object of the invention is a signal reagent for generating a light emission in a chemiluminescent assay, comprising a choline oxidase according to the invention, a choline oxidase substrate and a chemiluminescent reagent.
  • the choline oxidase substrate is preferably choline.
  • Preferred is the chemiluminescent reagent luminol.
  • Chemiluminescent assays are of considerable importance in the field of medicine and the life sciences. Particularly important are immunoassays and DNA probe analyzes.
  • choline oxidases of the present invention which generate oxygen-containing free radicals (e.g., superoxide anion, hydroxyl radical) and peroxides (hydrogen peroxide), when reacted with chemiluminescent reagents such as lucigenin, luminol and its derivatives, provide long-lived chemiluminescent detectable products.
  • choline oxidase systems are of particular use as tracers for the detection of analytes in immunoassays, immunoblotting or nucleotide probe assays to provide long-lived light emitting moieties upon reaction with a chemiluminescent reagent.
  • Another object of the invention is the use of a choline oxidase according to the invention and in particular a choline oxidase according to the invention, for the production of betaine, for the production of food and / or food ingredients and for the production of animal feed and / or animal feed ingredients.
  • Betaine is important as a nourishing ingredient in shampoos, hair products and detergents. It is also used as a dietary supplement in animal feed because it has a protective effect on the liver.
  • Example 1 Cloning of the choline oxidase KC2s
  • Arthrobacter nicotianiae (KC2) (DSMZ-ID 96-878) is incubated in a Corynebacterium medium (casein peptone 10 g / l, yeast extract 5 g / l, glucose 5 g / l, sodium chloride 5 g / l) for 27 h cultured at 30 0 C and 120 rpm.
  • Corynebacterium medium casein peptone 10 g / l, yeast extract 5 g / l, glucose 5 g / l, sodium chloride 5 g / l
  • the genomic DNA is isolated and the KC2s gene amplified by PCR with the primers KC2spETNF and KC2pETHR.
  • the resulting PCR fragment is cloned into the ⁇ / cTel- / -Vc / 111 line of the vector pET 26 b + (Novagen, cat no 69862-3) and the resulting construct pET KC2s in competent E. coli BL21 Gold (DE3) (Stratagene, cat # 230132). From this, the strain E. coli pETKC2s is obtained after selection for kanamycin resistance.
  • KC2spETNF 5 '- TTCCATATGAACATTGAAAAGAAGGACTTCGACTACATTG - 3'
  • KC2pETHR 5 ' - CCCAAGCTTCTAGGCTTCGCTAACCAGTTCG - 3 '
  • the plasmid pET KC2s is isolated from E. coli pETKC2s cultures by standard methods (Sambrook et al.) And used as a double-stranded template in a site-directed mutagenesis using QuikChange Kit (Stratagene, cat no 200518). The table below gives the primers needed for mutagenesis.
  • Table 1 Name and sequence of primers used for mutagenesis. Each mutant requires a complementary primer pair on forward and reverse primers.
  • Lys394Arg Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly +
  • Lys394Arg Ala21Val + Gly62Asp + lle69Val + Ser348Leu, ThM161Ie + Lys128Met, Pro393Gln +
  • the induction of protein expression was carried out by adding IPTG to a final concentration of 100 ⁇ M. After a further 4 h incubation at 37 0 C and 250 rpm, the cells were harvested by centrifugation and digested with the BugBuster-Kit (Novagen, Kat.-No. 70750-3).
  • the specific activity is obtained as a quotient of the activity and the protein content.
  • the activity determination is based on the detection of hydrogen peroxide, which is formed during the Cholinoxidasekatalyse from the substrate and atmospheric oxygen.
  • the unit of one unit (U) denotes the amount of enzyme which produces one ⁇ mol of H 2 O 2 in one minute.
  • the catalytic activity concentration in mU / ⁇ l (corresponds to 1Cf 3 U / ⁇ l) is given as the activity per sample volume.
  • the protein concentration is determined by a commercially available test and expressed in mg / ml. The default curve is created with BSA.
  • Peroxide reagent 75 mM K 2 HPO 4 , 125 mM NaH 2 PO 4 , 12.5 mM chromotropic acid and 0.6 mM
  • Substrate solution 250 mM substrate in dist. H 2 O.
  • Substrates used choline chloride, bis (2-one)
  • DMDEA dimethylammonium chloride
  • TAA triethanolamine
  • Methyltriethanolammonium chloride MTEA
  • the activity is determined by comparison with a calibration curve made with a suitable dilution series of hydrogen peroxide in 20 mM phosphate buffer (pH 6.5) under the conditions described above. Given is the catalytic
  • Activity concentration in mU / ⁇ l (corresponds to 10 "3 U / ⁇ l) as activity per sample volume.
  • the amount of protein per sample volume is determined by the BCA Protein Assay Kit (Pierce Biotech nology, cat # 23227) according to the protocol proposed by the manufacturer and expressed in mg / ml.
  • the specific activities of the mutants are related to the specific activities of the wild-type KC2s.
  • the relative specific activities are formed as the quotients of the specific activity of the mutant with respect to a substrate and the specific activity of the wild-type (KC2s) with respect to the same substrate.
  • the table below shows the relative specific activities (relspAkt).
  • the mean standard deviations are 16% for choline, 20% for DMDEA, 22% for TEA and 24% MTEA.
  • the specific activity of choline oxidase KC2s was 377.8 mU / mg, 21.4 mU / mg, 13.9 mU / mg, 2.3 mU / mg.
  • Ser530Gly 250% ndndnd It can be seen from the tables that the specific activity is particularly due to the mutations Gly62Asp, Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly + Val260Ile + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp, Glu4Gly + Gly62Asp and Ala21Val + Gly62Asp + lle69Val + Ser348Leu being affected.
  • the specific activity on DMDEA is influenced in particular by the mutations of lle69Val and Glu4Gly + Gly62Asp and on TEA by the mutations Phe351Tyr and Glu4Gly + Gly62Asp.
  • the washing tests were in a matrix of the composition
  • Nonionic surfactant (FAEO, APG, etc.) 24-28%
  • Test fabric (diameter 10 mm) were incubated in a 24 well microtiter plate in 1 ml of wash liquor for 30 min at 37 0 C with agitation at 100 rpm.
  • the wash contained 130 mM choline oxidase and 20 mM substrate.
  • air was passed through a cannula having an inside diameter of 0.5 to 1 mm into each trial.
  • Each experiment was carried out for each challenge as a duplicate against a duplicate control without choline oxidase.
  • the whiteness of the laundered fabrics was measured as compared to a white standard (d / 8, 0 8mm, SCI / SCE) normalized to 100%.
  • the measurement was carried out on a colorimeter (Minolta Cm508d) with an illumination setting of 107D65.
  • the results obtained are compiled as a percentage remission, ie as a percentage in comparison with the white standard together with the respective initial values in the following table.
  • the bleaching performance results as ⁇ L of the difference of the remission values of the basic detergent with choline oxidase and control without choline oxidase under the same experimental conditions on the respective stains.
  • the choline oxidases according to the invention under the given conditions have a bleaching effect on the relevant stains.
  • the bleaching performance correlates with the specific activities.
  • Seq. 1 Amino acid sequence of choline oxidase from Arthrobacter nicotinianae, KC2, DSMZ-ID 96-878, expression product of nucleic acid sequence KC2
  • Seq. 2 Amino acid sequence of KC2 in E. coli, expression product of nucleic acid sequence KC2 in E. coli.
  • Seq. 3 Amino acid sequence of KC2s (expression product of nucleic acid sequence KC2s)
  • Seq. 4 Amino acid sequence of KC2s in E. coli, expression product of nucleic acid sequence KC2s in E. coli.
  • Seq. 5 Amino acid sequence of chitin oxidase from Arthrobacter aurescens (ATCC13344), expression product of nucleic acid sequence Choline oxidase from Arthrobacter aurescens (ATCC13344)
  • Seq. 7 Amino acid sequence of chitin oxidase from Arthrobacter globiformis, expression product of nucleic acid sequence Choline oxidase from Arthrobacter globiformis (new sequence, defined prior art)
  • Seq. 8 Nucleic acid sequence, choline oxidase from A. nicotianiae (KC 2, DSMZ ID 96-878) as in DE-A-102 60 930.6-41.
  • Seq. 9 Nucleic acid sequence, cholinoxidase from A. nicotianiae (KC 2, DSMZ-ID 96-878) cloned in
  • nucleic acid sequence KC2s (master mold from KC2 derived) 1 ttgaacattg aaaagaagga cttcgactac attgtgatcg gcggcggttc tgccggcgct 61 gcggtggctt ctcgcctgag cgaggatcca tcggtgagtg ttgcactggt tgaagcaggt 121 cccgacgacc gcggctacga tgaagtgctg cagctggacc gctggatgga actgctggaa 181 tccggcttgg actgggacta cccgatcgaa ccgcaggaaacggcaactc gttcatgcgc 241 catgccccgtg ccaaggtcat ggggg gggact
  • Seq. Figure 12 Nucleic acid sequence, cholinoxidase from A. aurescens (ATCC 13344). 1 atgcacgtcg acaatattga gaacctcagc gagcgcgggt tcgattacat cgtcatcggc 61 ggaggatctg ccggggctgc cgtcgccc cggctgagcg aggaccccgc cgttaccgtt 121 gccctggtgg aagccggccc ggatgaccgg aacctcccgg aaatcctgca attggaccgg 181 tggatggaac tgctggaatc ggggtacgac tgggactacc cggtggaacc gcaggagaac 241 ggcaactcat tcatgcgcca cgcccgcggg
  • Seq. 13 Nucleic acid sequence hybrid gene. 1 atgcacgtcg acaatattga gaacctcagc gagcgcgggt tcgattacat cgtcatcggc 61 ggaggatctg ccggggctgc cgtcgccc cggctgagcg aggaccccgc cgttaccgtt 121 gccctggtgg aagccggccc ggatgaccgg aacctcccgg aaatcctgca attggaccgg 181 tggatggaac tgctggaatc ggggtacgac tgggactacc cggtggaacc gcaggagaac 241 ggcaactcat tcatgcgcca cgcccgcc aaggtcatgg gcggctgctc cag
  • GCTGGACCGC 181 TGGATGGAGC TGCTGGAATC GGGCTACGAC TGGGACTACC CGATCGAGCC
  • GCAGGAGAAC 241 GGCAACTCCT TCATGCGCCA TGCCCGTGCC AAGGTCATGG GCGGCTGCTC
  • CAGCCACAAC 301 TCCTGCATCG CCTTCTGGGC CCCGCGCGAG GACCTGGACG AGTGGGAGGC
  • CAAGTACGGC 361 GCCACCGGCT GGAACGCCGA GGCGGCCTGG CCGCTGTACA AGCGGCTGGA
  • GATCGTCGAG 661 CAGGAGAACT TCACCCTGCT AACCGGCCTG CGCGCCCGCC AGCTGGTGTT
  • GGTGGACTCC 901 CCCGGCGTGG GCGAGCACCT
  • GAACGTCACG 1141 CACGCCCGCT CCCGCGGCAC TGTCCGGCTG CGCAGCCGCG ACTTCCGCGA
  • Seq. 15 nucleic acid sequence, primer for cloning a choline oxidase
  • Seq. 16 nucleic acid sequence, primer for cloning a choline oxidase
  • Seq. 23 (mutagenesis primer) 5'-gactgggactacccggtcgaaccgcaggaaaac-3 '
  • Seq. 33 (mutagenesis primer) 5'-ccgatggttgaaaccttcacccagtggtgggaaatc-3 '

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dermatology (AREA)
  • Polymers & Plastics (AREA)
  • Genetics & Genomics (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Animal Husbandry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Textile Engineering (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Detergent Compositions (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Cosmetics (AREA)

Abstract

Die vorliegende Erfindung betrifft neue Cholinoxidasen mit veränderter Substratspezifität, Verfahren zu Ihrer Gewinnung, Körperpflegemittel, Haarpflegemittel, Haarwaschmittel, Mund-, Zahn- und Zahnprothesenpflegemittel, Kosmetika, Waschmittel, Reinigungsmittel, Nachspülmittel, Handwaschmittel, Handgeschirrspülmittel und Maschinengeschirrspülmittel, enthaltend neue Cholinoxidasen mit veränderter Substratspezifität sowie Verwendungen der neuen Cholinoxidasen mit veränderter Substratspezifität.

Description

Neue Cholinoxidasen mit veränderter Substratspezifität
Beschreibung:
Die vorliegende Erfindung betrifft neue Cholinoxidasen mit veränderter Substratspezifität, Verfahren zu Ihrer Gewinnung, Körperpflegemittel, Haarpflegemittel, Haarwaschmittel, Mund-, Zahn- und Zahnprothesenpflegemittel, Kosmetika, Waschmittel, Reinigungsmittel, Nachspülmittel, Handwaschmittel, Handgeschirrspülmittel und Maschinengeschirrspülmittel, enthaltend neue Cholinoxidasen mit veränderter Substratspezifität sowie Verwendungen der neuen Cholinoxidasen mit veränderter Substratspezifität.
Cholinoxidasen sind aus dem Stand der Technik bekannt (Ikuta, S., Imamura, S., Misaki, H., and Horiuti, Y. 1977. Purification and characterization of choline oxidase from Arthrobacter globiformis. J Biochem (Tokyo) 82: 1741-1749., Deshnium, P., Los, D.A., Hayashi, H., Mustardy, L., and Murata, N. 1995. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress. Plant Mol Biol 29: 897-907.). Bekannt ist auch, daß Oxidasen (Alkoholoxidasen, Aminosäureoxidasen) zusammen mit ihren Substraten für die Wasserstoff peroxidgenerierung zur Bleiche und Farbübertragungsinhibierung in Waschmitteln oder zur enzymatischen Haarfärbung und Bleiche in kosmetischen Mitteln eingesetzt werden können.
In der WO 97/21796 wird beschrieben, daß Oxidasen aus ihren entsprechenden Substraten unter technischen Bedingungen (z.B. einer Waschmittelmatrix) mit Hilfe von Luftsauerstoff Wasserstoffperoxid freisetzen und damit zur Bleiche eingesetzt werden können. Die Bildung von Wasserstoffperoxid erfolgt kontinuierlich wobei die Effizienz der Produktbildung durch die Temperatur- und pH-Stabilität, sowie die Toleranz gegenüber Substrat und Produkt bestimmt wird.
Für die herkömmliche chemische Bleiche werden anorganische, alkalische Wasserstoffperoxidlieferanten wie Percarbonat oder Perborat in Kombination mit Bleichboostern (TAED) eingesetzt. Die Bleichkomponente Wasserstoffperoxid entsteht durch spontanen Zerfall der Additionsverbindung und führt damit schnell aber kurzfristig zu hohen Konzentrationen. Eine schonende, Bleiche ist nicht möglich.
Für die Haarfärbung wird herkömmlich eine Bleiche zur Nivellierung von Grautönen vor der Färbung mit Wasserstoffperoxid und Ammoniaklösung durchgeführt. Die kurzfristig hohen Wasserstoffperoxidkonzentrationen in Kombination mit dem alkalischen pH führen zu einer deutlichen Haarschädigung.
In der deutschen Patentanmeldung 102 60 930.6-41 der Anmelderin wird dargelegt, daß und wie sich aus den Bakterien Arthrobacter nicotianiae und Arthrobacter aurescens Cholinoxidasen isolieren lassen, die unter weitgehender Vermeidung der dem einschlägigen Stand der Technik anhaftenden Nachteile in Bleichsystemen eingesetzt werden können.
Cholinoxidase setzt allerdings bevorzugt Cholin um. Ihre Spezifität nimmt von Cholin über Bis(2- hydroxyethyl) dimethylammoniumchlorid (Dimethyldiethanolammoniumchlorid, DMDEA) und Triethanolamin (TEA) nach Tris (2-hydroxyethyl) methylammoniumchlorid (MTEA) hin ab.
Generell ist die Verfügbarkeit von Enzymen mit unterschiedlicher Substratspezifität wünschenswert. Je nach Fragestellung kann so in einem Prozess auf das bevorzugte Substrat zurückgegriffen werden.
Der vorliegenden Erfindung liegt daher die Augabe zugrunde, Enzyme mit optimierter Spezifität gegenüber den Substraten Cholin, Bis(2-hydroxyethyl) dimethylammoniumchlorid (Dimethyldiethanolammoniumchlorid, DMDEA) und Triethanolamin (TEA) sowie Tris (2- hydroxyethyl) methylammoniumchlorid (MTEA) bereitzustellen.
Diese Aufgabe wurde erfindungsgemäß gelöst durch die Bereitstellung von Cholinoxidasen, die sich als Mutanten der Cholinoxidase KC2s aus dem Bakterium Arthrobacter nicotianiae (Sequenz 3) darstellen lassen und die dadurch gekennzeichnet sind, daß sie Mutationen in Molekülbereichen bzw. Domänen, bezogen auf die Cholinoxidase KC2s (Sequenz 3), aufweisen, die ausgewählt sind unter der Substratbindungsdomäne und der FAD-Bindungsdomäne.
DMDEA bzw. TEA und MTEA besitzen anstatt einer Alkoholfunktion derer zwei bzw. drei. Diese Alkoholgruppen können von der erfindungsgemäßen Cholinoxidase oxidiert werden und so zu einer Ausbeute von 4 bzw. 6 eq. Wasserstoffperoxid pro Molekül führen. Da die Molekularmasse nicht linear mit der Wasserstoffperoxidausbeute ansteigt, wird in einem technischen Prozess eine höhere Leistungsdichte erzielt.
Zudem sind die erfindungsgemäßen Mutanten mit veränderter Substratspezifität in Prozessen vorteilhaft, in denen aus bestimmten Gründen kein Cholin eingesetzt werden kann, sondern nur DMDEA, TEA oder MTEA eingesetzt werden können.
Gemäß der vorliegenden Erfindung ist eine Cholinoxidase bevorzugt, die eine oder mehrere Mutationen an Aminosäuresequenzpositionen aufweist, die ausgewählt sind unter den Positionen 4, 21 , 62, 69, 79, 116, 128, 166, 215, 243, 249, 260, 286, 321 , 348, 349, 351, 393, 394, 530 und 531 , wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Erfindungsgemäß besonders bevorzugt ist hierbei eine Cholinoxidase, die eine oder mehrere Mutationen aufweist, die ausgewählt sind aus Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, Thr116lle, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val.
In einer besonderen Ausführungsform weist eine erfindungsgemäße Cholinoxidase einen oder mehrere Aminosäureaustausche auf, die ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, He69Val, Met79Val, ThM 161Ie, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu in Kombination mit Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val, und die insbesondere ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu in Kombination mit Val349Leu, Phe351Tyr, Phe351 Leu, Lys394Arg und Glu531Val, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Ganz besonders bevorzugt ist eine Cholinoxidase, die eine oder mehrere der folgenden Kombinationen von Aminosäureaustauschen aufweist: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + Me69Val + Ser348Leu, ThM 161Ie + Lys128Met, Pro393Gln + Ser530Gly, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Ein weiterer Gegenstand der vorliegenden Erfindung sind ebenfalls Cholinoxidasen, die in Bezug auf Sequenz 3 die zuvor genannten Mutationen aufweisen, die jedoch daneben auch noch weitere Mutationen aufweisen, die also ausgehend von den zuvor genannten erfindungsgemäßen Cholinoxidasen durch ein- oder mehrfachen Aminosäureautausch, insbesondere durch ein- oder mehrfachen konservativen Aminosäureaustausch, erhältlich sind, und/oder solche, die ausgehend von den zuvor genannten erfindungsgemäßen Cholinoxidasen durch Derivatisierung, Fragmentierung, Inversionsmutation, Deletionsmutation oder Insertionsmutation erhältlich sind, wobei hierbei natürlich zwingend ist, dass die entsprechende Mutationsposition oder Kombination von Mutationspositionen in den so erhaltenen Cholinoxidasen erhalten bleibt.
Ein weiterer Gegenstand der vorliegenden Erfindung sind daher insbesondere auch solche Cholinoxidasen, die neben den zuvor genannten Mutationen und/oder Mutationskombinationen bis zu 50, 45 oder 40, insbesondere bis zu 35, 30, 25 oder 20, vor allem bis zu 15, 10, 5, 4, 3 oder 2 weitere Punkmutationen oder genau eine weitere Punktmutation aufweisen und/oder Deletionen und/oder Insertionen und/oder Inversionen von Sequenzen einer Länge von bis zu 60, 50 oder 40, insbesondere bis zu 30, 20 oder 10, vorzugsweise bis zu 5, 4, 3 oder 2 Aminosäuren, vor allem Deletionen und/oder Insertionen von genau einer Aminosäure aufweisen. Die erfindungsgemäßen Cholinoxidasen mit veränderter Substratspezifität weisen vorteilhafterweise eine hohe spezifische Wasserstoffbildungsrate auf.
Das pH-Profil der erfindungsgemäßen Enzyme ist kompatibel mit dem erforderlichen pH bei technischem Einsatz sowie mit typischen Produkten wie Wasch- und Reinigungsmitteln und Haarfärbungen.
Durch den Einsatz des Substrates Cholin und seiner Derivate sowie das sich bildende Nebenprodukt Betain als potentielle Wirksubstanz zur Avivage ergibt sich ein beträchtlicher Sekundärnutzen.
Als Substrate kommen beispielsweise DMDEA, TEA, MTEA sowie Cholin und Derivate von N- substituiertem Aminoethanol in Frage, mit den Strukturformeln 1 oder 2:
Figure imgf000005_0001
Für Strukturformel 1 gilt:
R1 = H1 R2 = 2-Hydroxyethyl
R1 = Methyl, R2 = Methyl
R1 = 2-Hydroxyethyl, R2 = 2-Hydroxyethyl
Diese Verbindungen sind als Substrate für die Cholinoxidase aus A. globiformis literaturbekannt.
Für Strukturformel 2 gilt: R1 = R2 = R3 = Methyl
Ein weiteres erfindungsgemäß geeignetes Substrat ist Betainaldehyd (OHC-CH2)N+(CH3)3
Von erheblichem Interesse ist auch die Zusatzwirkung des sich bildenden Betains für die Haarpflege.
Im folgenden bedeutet ein Ausdruck der Form „mindestens X %" „X % bis 100 % (einschließlich der Eckwerte X und 100 und aller ganzzahligen und nicht ganzzahligen Prozentwerte dazwischen)". Unter einem Protein ist im Sinne der vorliegenden Anmeldung ein aus den natürlichen Aminosäuren zusammengesetztes, weitgehend linear aufgebautes, zur Ausübung seiner Funktion zumeist dreidimensionale Struktur annehmendes Polymer zu verstehen. In der vorliegenden Anmeldung werden die proteinogenen, natürlich vorkommenden L-Aminosäuren mit den international gebräuchlichen 1- und 3-Buchstaben-Codes bezeichnet.
Unter einem Enzym ist im Sinne der vorliegenden Anmeldung ein Protein zu verstehen, das eine bestimmte biokatalytische Funktion ausübt.
Zahlreiche Proteine werden als sogenannte Präproteine, also zusammen mit einem Signalpeptid gebildet. Darunter ist dann der N-terminale Teil des Proteins zu verstehen, dessen Funktion zumeist darin besteht, die Ausschleusung des gebildeten Proteins aus der produzierenden Zelle in das Periplasma oder das umgebende Medium und/oder dessen korrekte Faltung zu gewährleisten. Anschließend wird das Signalpeptid unter natürlichen Bedigungen durch eine Signalpeptidase vom übrigen Protein abgespalten, so daß dieses seine eigentliche katalytische Aktivität ohne die zunächst vorhandenen N-terminalen Aminosäuren ausübt.
Für technische Anwendungen sind aufgrund ihrer enzymatischen Aktivität die maturen Peptide, das heißt die nach ihrer Herstellung prozessierten Enzyme gegenüber den Präproteinen bevorzugt.
Pro-Proteine sind inaktive Vorstufen von Proteinen. Deren Vorläufer mit Signalsequenz werden als Prä-Pro-Proteine bezeichnet.
Unter Nukleinsäuren sind im Sinne der vorliegenden Anmeldung die natürlicherweise aus Nukleotiden aufgebauten als Informationsträger dienenden Moleküle zu verstehen, die für die lineare Aminosäureabfolge in Proteinen oder Enzymen codieren. Sie können als Einzelstrang, als ein zu diesem Einzelstrang komplementärer Einzelstrang oder als Doppelstrang vorliegen. Als der natürlicherweise dauerhaftere Informationsträger ist die Nukleinsäure DNA für molekularbiologische Arbeiten bevorzugt. Demgegenüber wird für die Realisierung der Erfindung in natürlicher Umgebung, wie beispielsweise in einer exprimierenden Zelle, eine RNA gebildet, weshalb erfindungswesentliche RNA-Moleküle ebenfalls Ausführungsformen der vorliegenden Erfindung darstellen.
Bei DNA sind die Sequenzen beider komplementärer Stränge in jeweils allen drei möglichen Leserastern zu berücksichtigen. Ferner ist zu berücksichtigen, daß verschiedene Codon-Triplets für dieselben Aminosäuren codieren können, so daß eine bestimmte Aminosäure-Abfolge von mehreren unterschiedlichen und möglicherweise nur geringe Identität aufweisenden Nukleotidsequenzen abgeleitet werden kann (Degeneriertheit des genetischen Codes). Außerdem weisen verschiedene Organismen Unterschiede im Gebrauch dieser Codons auf. Aus diesen Gründen müssen sowohl Aminosäuresequenzen als auch Nukleotidsequenzen in die Betrachtung des Schutzbereichs einbezogen werden und angegebene Nukleotidsequenzen sind jeweils nur als eine beispielhafte Codierung für eine bestimmte Aminosäurefolge anzusehen.
Die einem Protein entsprechende Informationseinheit wird auch im Sinne der vorliegenden Anmeldung als Gen bezeichnet.
Die vorliegende Erfindung umfallt die Herstellung rekombinanter Proteine. Hierunter sind erfindungsgemäß alle gentechnischen oder mikrobiologischen Verfahren zu verstehen, die darauf beruhen, daß die Gene für die interessierenden Proteine in einen für die Produktion geeigneten Wirtsorganismus eingebracht und von diesem transkribiert und translatiert werden. Geeigneterweise erfolgt die Einschleusung der betreffenden Gene über Vektoren, insbesondere Expressionsvektoren; aber auch über solche, die bewirken, daß das interessierende Gen im Wirtsorganismus in ein bereits vorhandenes genetisches Element wie das Chromosom oder andere Vektoren eingefügt werden kann. Die funktionelle Einheit aus Gen und Promotor und eventuellen weiteren gegentischen Elementen wird erfindungsgemäß als Expressionskassette bezeichnet. Sie muß dafür jedoch nicht notwendigerweise auch als physische Einheit vorliegen.
Einem Fachmann ist es über heutzutage allgemein bekannte Methoden, wie beispielsweise die chemische Synthese oder die Polymerase-Kettenreaktion (PCR) in Verbindung mit molekularbiologischen und/oder proteinchemischen Standardmethoden möglich, anhand bekannter DNA- und/oder Aminosäuresequenzen die entsprechenden Nukleinsäuren bis hin zu vollständigen Genen herzustellen. Derartige Methoden sind beispielsweise aus Sambrook, J., Fritsch, E. F. and Maniatis, T. 2001. Molecular cloning: a laboratory manual, 3. Edition CoId Spring Laboratory Press, bekannt.
Änderungen der Nukleotidsequenz, wie sie beispielsweise durch an sich bekannte molekularbiologische Methoden herbeigeführt werden können, werden als Mutationen bezeichnet. Je nach Art der Änderung kennt man beispielsweise Deletions-, Insertions- oder Substitutionsmutationen oder solche, bei denen verschiedene Gene oder Teile von Genen miteinander fusioniert oder rekombiniert werden; dies sind Genmutationen. Die zugehörigen Organismen werden als Mutanten bezeichnet. Die von mutierten Nukleinsäuren abgeleiteten Proteine werden als Varianten bezeichnet. So führen beispielsweise Deletions-, Insertions- Substitutionsmutationen oder Fusionen zu deletions-, insertions- substitutionsmutierten oder Fusionsgenen und auf Proteinebene zu entsprechenden Deletions-, Insertions- oder Substitutionsvarianten, beziehungsweise Fusionsproteinen.
Unter Fragmenten werden alle Proteine oder Peptide verstanden, die kleiner sind als natürliche Proteine oder solche, die vollständig translatierten Genen entsprechen, und beispielsweise auch synthetisch erhalten werden können. Aufgrund ihrer Aminosäuresequenzen können sie den betreffenden vollständigen Proteinen zugeordnet werden. Sie können beispielsweise gleiche Strukturen annehmen oder proteolytische Aktivitäten oder Teilaktivitäten ausüben, wie beispielsweise die Komplexierung eines Substrats. Fragmente und Deletionsvarianten von Ausgangsproteinen sind prinzipiell gleichartig; während Fragmente eher kleinere Bruchstücke darstellen, fehlen den Deletionsmutanten eher nur kurze Bereiche, und damit nur einzelne Teilfunktionen.
Den Fragmenten entsprechen auf Nukleinsäure-Ebene die Teilsequenzen.
Unter Chimären oder hybriden Proteinen sind im Sinne der vorliegenden Anmeldung solche Proteine zu verstehen, die von Nukleinsäureketten kodiert werden, die natürlicherweise von verschiedenen oder aus demselben Organismus stammen. Dieses Vorgehen wird auch Rekombinationsmutagenese genannt. Der Sinn einer solchen Rekombination kann beispielsweise darin bestehen, mithilfe des heranfusionierten Proteinteils eine bestimmte enzymatische Funktion herbeizuführen oder zu modifizieren. Es ist dabei im Sinne der vorliegenden Erfindung unwesentlich, ob solch ein chimäres Protein aus einer einzelnen Polypeptidkette oder mehreren Untereinheiten besteht, auf weiche sich unterschiedliche Funktionen verteilen können.
Unter durch Insertionsmutation erhaltene Proteinen sind solche Varianten zu verstehen, die über an sich bekannte Methoden durch Einfügen eines Nukleinsäure-, beziehungsweise Proteinfragments in die Ausgangssequenzen erhalten worden sind. Sie sind ihrer prinzipiellen Gleichartigkeit wegen den Chimären Proteinen zuzuordnen. Sie unterscheiden sich von jenen lediglich im Größenverhältnis des unveränderten Proteinteils zur Größe des gesamten Proteins. In solchen insertionsmutierten Proteinen ist der Anteil an Fremdprotein geringer als in Chimären Proteinen.
Inversionsmutagenese, also eine partielle Sequenzumkehrung, kann als Sonderform sowohl der Deletion, als auch der Insertion angesehen werden. Dasselbe gilt für eine von der ursprünglichen Aminosäureabfolge abweichende Neugruppierung verschiedener Molekülteile. Sie kann sowohl als Deletionsvariante, als Insertionsvariante, als auch als Shuffling-Variante des ursprünglichen Proteins angesehen werden.
Unter Derivaten werden im Sinne der vorliegenden Anmeldung solche Proteine verstanden, deren reine Aminosäurekette chemisch modifiziert worden ist. Solche Derivatisierungen können beispielsweise biologisch im Zusammenhang mit der Protein biosynthese durch den Wirtsorganismus erfolgen. Hierfür können molekularbiologische Methoden eingesetzt werden. Sie können aber auch chemisch durchgeführt werden, etwa durch die chemische Umwandlung einer Seitenkette einer Aminosäure oder durch kovalente Bindung einer anderen Verbindung an das Protein. Bei solch einer Verbindung kann es sich beispielsweise auch um andere Proteine handeln, die beispielsweise über bifunktionelle chemische Verbindungen an erfindungsgemäße Proteine gebunden werden. Derartige Modifizierungen können beispielsweise die Substratspezifität oder die Bindungsstarke an das Substrat beeinflussen oder eine vorübergehende Blockierung der enzymatischen Aktivität herbeiführen, wenn es sich bei der angekoppelten Substanz um einen Inhibitor handelt. Dies kann beispielsweise für den Zeitraum der Lagerung sinnvoll sein. Ebenso ist unter Derivatisierung die kovalente Bindung an einen makromolekularen Trager zu verstehen.
Proteine können auch über die Reaktion mit einem Antiserum oder einem bestimmten Antikörper zu Gruppen immunologisch verwandter Proteine zusammengefaßt werden. Die Angehörigen einer Gruppe zeichnen sich dadurch aus, daß sie dieselbe, von einem Antikörper erkannte antigene Determinante aufweisen.
Im Sinne der vorliegenden Erfindung werden alle Enzyme, Proteine, Fragmente und Derivate, sofern sie nicht explizit als solche angesprochen zu werden brauchen, unter dem Oberbegriff Proteine zusammengefaßt.
Unter Vektoren werden im Sinne der vorliegenden Erfindung aus Nukleinsäuren bestehende Elemente verstanden, die als kennzeichnenden Nukleinsäurebereich ein interessierendes Gen enthalten. Sie vermögen dieses in einer Spezies oder einer Zellinie über mehrere Generationen oder Zellteilungen hinweg als stabiles genetisches Element zu etablieren. Vektoren sind insbesondere bei der Verwendung in Bakterien spezielle Plasmide, also zirkuläre genetische Elemente. Man unterscheidet in der Gentechnik einerseits zwischen solchen Vektoren, die der Lagerung und somit gewissermaßen auch der gentechnischen Arbeit dienen, den sogenannten Klonierungsvektoren, und andererseits denen, die die Funktion erfüllen, das interessierende Gen in der Wirtszelle zu realisieren, das heißt, die Expression des betreffenden Proteins zu ermöglichen. Diese Vektoren werden als Expressionsvektoren bezeichnet.
Durch Vergleich mit bekannten Enzymen, die beispielsweise in allgemein zugänglichen Datenbanken hinterlegt sind, läßt sich aus der Aminosäure- oder Nukleotid-Sequenz die enzymatische Aktivität eines betrachteten Enzyms folgern. Diese kann durch andere Bereiche des Proteins, die nicht an der eigentlichen Reaktion beteiligt sind, qualitativ oder quantitativ modifiziert werden. Dies könnte beispielsweise die Enzymstabilität, die Aktivität, die Reaktionsbedingungen oder die Substratspezifität betreffen.
Solch ein Vergleich geschieht dadurch, daß ähnliche Abfolgen in den Nukleotid- oder Aminosäuresequenzen der betrachteten Proteine einander zugeordnet werden. Dies nennt man Homologisierung. Eine tabellarische Zuordnung der betreffenden Positionen wird als Alignment bezeichnet. Bei der Analyse von Nukleotidsequenzen sind wiederum beide komplementären Stränge und jeweils allen drei möglichen Leserastern zu berücksichtigen; ebenso die Degeneriertheit des genetischen Codes und die organismenspezifische Codon-Usage. Inzwischen werden Alignments über Computerprogramme erstellt, wie beispielsweise durch die Algorithmen FASTA oder BLAST; dieses Vorgehen wird beispielsweise von D. J. Lipman und W. R. Pearson (1985) in Science, Band 227, S. 1435-1441 beschrieben.
Eine Zusammenstellung aller in den verglichenen Sequenzen übereinstimmenden Positionen wird als Konsensus-Sequenz bezeichnet.
Solch ein Vergleich erlaubt auch eine Aussage über die Ähnlichkeit oder Homologie der verglichenen Sequenzen zueinander. Diese wird in Prozent Identität, das heißt dem Anteil der identischen Nukleotide oder Aminosäurereste an denselben Positionen widergegeben. Ein weiter gefaßter Homologiebegriff bezieht die konservierten Aminosäure-Austausche in diesen Wert mit ein. Es ist dann von Prozent Ähnlichkeit die Rede. Solche Aussagen können über ganze Proteine oder Gene oder nur über einzelne Bereiche getroffen werden.
Die Erstellung eines Alignments ist der erste Schritt zur Definition eines Sequenzraums. Dieser hypothetische Raum umfaßt sämtliche durch Permutation in Einzelpositionen abzuleitenden Sequenzen, die sich unter Berücksichtigung aller in den betreffenden Einzelpositionen des Alignments auftretenden Variationen ergeben. Jedes hypothetisch mögliche Proteinmolekül bildet einen Punkt in diesem Sequenzraum. Beispielsweise begründen zwei Aminosäuresequenzen, die bei weitgehender Identität an lediglich zwei verschiedenen Stellen jeweils zwei verschiedene Aminosäuren aufweisen, somit einen Sequenzraum von vier verschiedenen Aminosäuresequenzen. Ein sehr großer Sequenzraum wird erhalten, wenn zu einzelnen Sequenzen eines Raums jeweils weitere homologe Sequenzen gefunden werden. Über solche, jeweils paarweise bestehenden hohen Homologien können auch sehr niedrig homologe Sequenzen als einem Sequenzraum zugehörig erkannt werden.
Homologe Bereiche von verschiedenen Proteinen sind durch Übereinstimmungen in der Aminosäuresequenz definiert. Diese können auch durch identische Funktion gekennzeichnet sein. Sie geht bis zu völligen Identitäten in kleinsten Bereichen, sogenannten Boxen, die nur wenige Aminosäuren umfassen und meist für die Gesamtaktivität essentielle Funktionen ausüben. Unter den Funktionen der homologen Bereiche sind kleinste Teilfunktionen der vom gesamten Protein ausgeübten Funktion zu verstehen, wie beispielsweise die Ausbildung einzelner Wasserstoffbrückenbindungen zur Komplexierung eines Substrats oder Übergangskomplexes.
Im Rahmen der vorliegenden Erfindung wird die Nukleinsäure geeigneterweise in einen Vektor kloniert. Die molekularbiologische Dimension der Erfindung besteht somit in Vektoren mit den Genen für die entsprechenden Proteine. Dazu können beispielsweise solche gehören, die sich von bakteriellen Plasmiden, von Viren oder von Bacteriophagen ableiten, oder überwiegend synthetische Vektoren oder Plasmide mit Elementen verschiedenster Herkunft. Mit den weiteren jeweils vorhandenen genetischen Elementen vermögen Vektoren, sich in den betreffenden Wirtszellen über mehrere Generationen hinweg als stabile Einheiten zu etablieren. Es ist dabei im Sinne der Erfindung unerheblich, ob sie sich extrachomosomal als eigene Einheiten etablieren oder in ein Chromosom integrieren. Welches der zahlreichen aus dem Stand der Technik bekannten Systeme gewählt wird, hängt vom Einzelfall ab. Ausschlaggebend können beispielsweise die erreichbare Kopienzahl, die zur Verfügung stehenden Selektionssysteme, darunter vor allem Antibiotikaresistenzen, oder die Kultivierbarkeit der zur Aufnahme der Vektoren befähigten Wirtszellen sein.
Die Vektoren bilden geeignete Ausgangspunkte für molekularbiologische und biochemische Untersuchungen des betreffenden Gens oder zugehörigen Proteins und für erfindungsgemäße Weiterentwicklungen und letztlich für die Amplifikation und Produktion erfindungsgemäßer Proteine. Sie stellen insofern Ausführungsformen der vorliegenden Erfindung dar, als die Sequenzen der enthaltenen erfindungsgemäßen Nukleinsäurebereiche jeweils innerhalb der oben näher bezeichneten Homologiebereiche liegen.
Bevorzugte Ausführungsformen der vorliegenden Erfindung sind Klonierungsvektoren. Diese eignen sich neben der Lagerung, der biologischen Amplifikation oder der Selektion des interessierenden Gens für die Charakterisierung des betreffenden Gens, etwa über das Erstellen einer Restriktionskarte oder die Sequenzierung. Klonierungsvektoren sind auch deshalb bevorzugte Ausführungsformen der vorliegenden Erfindung, weil sie eine transportierbare und lagerfähige Form der beanspruchten DNA darstellen. Sie sind auch bevorzugte Ausgangspunkte für molekularbiologische Techniken, die nicht an Zellen gebunden sind, wie beispielsweise die Polymerasekettenreaktion.
Expressionsvektoren sind chemisch den Klonierungsvektoren ähnlich, unterscheiden sich aber in jenen Teilsequenzen, die sie dazu befähigen, in den für die Produktion von Proteinen optimierten Wirtsorganismen zu replizieren und dort das enthaltene Gen zur Expression zu bringen. Bevorzugte Ausführungsformen sind Expressionsvektoren, die selbst die zur Expression notwendigen genetischen Elemente tragen. Die Expression wird beispielsweise von Promotoren beeinflußt, welche die Transkription des Gens regulieren. So kann die Expression durch den natürlichen, ursprünglich vor diesem Gen lokalisierten Promotor erfolgen, aber auch nach gentechnischer Fusion sowohl durch einen auf dem Expressionsvektor bereitgestellten Promotor der Wirtszelle als auch durch einen modifizierten oder einen völlig anderen Promotor eines anderen Organismus.
Bevorzugte Ausführungsformen sind solche Expressionsvektoren, die über Änderungen der Kulturbedingungen oder Zugabe von bestimmten Verbindungen, wie beispielsweise die Zelldichte oder spezielle Faktoren, regulierbar sind. Expressionsvektoren ermöglichen, daß das zugehörige Protein heterolog, also in einem anderen Organismus als dem, aus dem es natürlicherweise gewonnen werden kann, produziert wird. Auch eine homologe Proteingewinnung aus einem das Gen natürlicherweise exprimierenden Wirtsorganismus über einen passenden Vektor liegt innerhalb des Schutzbereichs der vorliegenden Erfindung. Diese kann den Vorteil aufweisen, daß natürliche, mit der Translation in einem Zusammenhang stehende Modifikationsreaktionen an dem entstehenden Protein genauso durchgeführt werden, wie sie auch natürlicherweise ablaufen würden.
Ausführungsformen der vorliegenden Erfindung können auch zellfreie Expressionssysteme sein, bei denen die Proteinbiosynthese in vitro nachvollzogen wird. Derartige Expressionssysteme sind im Stand der Technik ebenfalls etabliert.
Die In-vivo-Synthese eines erfindungsgemäßen Enzyms, also die durch lebende Zellen, erfordert den Transfer des zugehörigen Gens in eine Wirtszelle, deren sogenannte Transformation. Als Wirtszellen eignen sich prinzipiell alle Organismen, das heißt Prokaryonten oder Eukaryonten. Bevorzugt sind solche Wirtszellen, die sich genetisch gut handhaben lassen, was beispielsweise die Transformation mit dem Expressionsvektor und dessen stabile Etablierung angeht, beispielsweise einzellige Pilze oder Bakterien. Zudem zeichnen sich bevorzugte Wirtszellen durch eine gute mikrobiologische und biotechnologische Handhabbarkeit aus. Das betrifft beispielsweise leichte Kultivierbarkeit, hohe Wachstumsraten, geringe Anforderungen an Fermentationsmedien und gute Produktions- und Sekretionsraten für Fremdproteine. Häufig müssen aus der Fülle an verschiedenen nach dem Stand der Technik zur Verfügung stehenden Systeme die optimalen Expressionssysteme für den Einzelfall experimentell ermitteln werden. Jedes erfindungsgemäße Protein kann auf diese Weise aus einer Vielzahl von Wirtsorganismen gewonnen werden.
Bevorzugte Ausführungsformen stellen solche Wirtszellen dar, die aufgrund genetischer Regulationselemente, die beispielsweise auf dem Expressionsvektor zur Verfügung gestellt werden, aber auch von vornherein in diesen Zellen vorhanden sein können, in ihrer Aktivität regulierbar sind. Beispielsweise durch kontrollierte Zugabe von chemischen Verbindungen, die als Aktivatoren dienen, durch Änderung der Kultivierungsbedingungen oder bei Erreichen einer bestimmten Zelldichte können diese zur Expression angeregt werden. Dies ermöglicht eine sehr wirtschaftliche Produktion der interessierenden Proteine.
Bevorzugte Wirtszellen sind prokaryontische oder bakterielle Zellen. Bakterien zeichnen sich gegenüber Eukaryonten in der Regel durch kürzere Generationszeiten und geringere Ansprüche an die Kultivierungsbedingungen aus. Dadurch können kostengünstige Verfahren zur Gewinnung erfindungsgemäßer Proteine etabliert werden. Bei gram-negativen Bakterien, wie beispielsweise Escherichia coli (E. coli), werden eine Vielzahl von Proteinen in den periplasmatischen Raum sekretiert, also in das Kompartiment zwischen den beiden die Zellen einschließenden Membranen. Dies kann für spezielle Anwendungen vorteilhaft sein. Grampositive Bakterien, wie beispielsweise Bacilli oder Actinomyceten oder andere Vertreter der Actinomycetales, besitzen demgegenüber keine äußere Membran, so daß sekretierte Proteine sogleich in das die Zellen umgebende Nährmedium abgegeben werden, aus welchem sich nach einer anderen bevorzugten Ausführungsform die exprimierten erfindungsgemäßen Proteine direkt aufreinigen lassen.
Eine Variante dieses Versuchsprinzips stellen Expressionssysteme dar, bei denen zusätzliche Gene, beispielsweise solche, die auf anderen Vektoren zur Verfügung gestellt werden, die Produktion erfindungsgemäßer Proteine beeinflussen. Hierbei kann es sich um modifizierende Genprodukte handeln oder um solche, die mit dem erfindungsgemäßen Protein gemeinsam aufgereinigt werden sollen, etwa um dessen enzymatische Funktion zu beeinflussen. Dabei kann es sich beispielsweise um andere Proteine oder Enzyme, um Inhibitoren oder um solche Elemente handeln, die die Wechselwirkung mit verschiedenen Substraten beinflussen.
Aufgrund der weitreichenden Erfahrungen, die man beispielsweise hinsichtlich der molekularbiologischen Methoden und der Kultivierbarkeit mit coliformen Bakterien hat, stellen diese bevorzugte Ausführungsformen der vorliegenden Erfindung dar. Besonders bevorzugt sind solche der Gattungen Escherichia coli, insbesondere nichtpathogene, für die biotechnologische Produktion geeignete Stämme.
Repräsentative Vertreter dieser Gattungen sind die K12-Derivate und die B-Stämme von Escherichia coli. Stämme, die sich nach an sich bekannten genetischen und/oder mikrobiologischen Methoden von diesen ableiten lassen, und somit als deren Derivate angesehen werden können, besitzen für genetische und mikrobiologische Arbeiten die größte Bedeutung und werden vorzugsweise zur Entwicklung erfindungsgemäßer Verfahren eingesetzt. Solche Derivate können beispielsweise über Deletions- oder Insertionsmutagenese hinsichtlich ihrer Anforderungen an die Kulturbedingungen verändert sein, andere oder zusätzliche Selektionsmarker aufweisen oder andere oder zusätzliche Proteine exprimieren. Es kann sich insbesondere um solche Derivate handeln, die zusätzlich zu dem erfindungsgemäß hergestellten Protein weitere wirtschaftlich interessante Proteine exprimieren.
Auch solche Mikroorganismen sind bevorzugt, die dadurch gekennzeichnet sind, daß sie nach Transformation mit einem der oben beschriebenen Vektoren erhalten worden sind. Dabei kann es sich beispielsweise um Klonierungsvektoren handeln, die zur Lagerung und/oder Modifikation in einen beliebigen Bakterienstamm eingebracht worden sind. Solche Schritte sind in der Lagerung und in der Weiterentwicklung betreffender genetischer Elemente allgemein verbreitet. Da aus diesen Mikroorganismen die betreffenden genetischen Elemente in zur Expression geeignete gram-negative Bakterien unmittelbar übertragen werden können, handelt es sich auch bei den vorangegenagenen Transformationsprodukten um Verwirklichungen des betreffenden Erfindungsgegenstands.
Auch eukaryontische Zellen können sich zur Produktion erfindungsgemäßer Proteine eignen. Beispiele dafür sind Pilze wie Actinomyceten oder Hefen wie Saccharomyces oder Kluyveromyces. Dies kann beispielsweise dann besonders vorteilhaft sein, wenn die Proteine im Zusammenhang mit ihrer Synthese spezifische Modifikationen erfahren sollen, die derartige Systeme ermöglichen. Dazu gehören beispielsweise die Bindung niedermolekularer Verbindungen wie Membrananker oder Oligosaccaride.
Die Wirtszellen des erfindungsgemäßen Verfahrens werden in an sich bekannter Weise kultiviert und fermentiert, beispielsweise in diskontinuierlichen oder kontinuierlichen Systemen. Im ersten Fall wird ein geeignetes Nährmedium mit den Organismen beimpft und das Produkt nach einem experimentell zu ermittelnden Zeitraum aus dem Medium geerntet. Kontinuierliche Fermentationen zeichnen sich durch Erreichen eines Fließgleichgewichts aus, in dem über einen vergleichsweise langen Zeitraum Zellen teilweise absterben aber auch nachwachsen und gleichzeitig Produkt aus dem Medium entnommen werden kann.
Fermentationsverfahren sind an sich aus dem Stand der Technik wohlbekannt und stellen den eigentlichen großtechnischen Produktionsschritt dar; gefolgt von einer geeigneten
Aufreinigungsmethode.
Alle Fermentationsverfahren, die auf einem der oben ausgeführten Verfahren zur Herstellung der rekombinanten Proteine beruhen, stellen entsprechend bevorzugte Ausführungsformen dieses
Erfindungsgegenstandes dar.
Hierbei müssen die für die eingesetzten Herstellungsverfahren, für die Wirtszellen und/oder die herzustellenden Proteine jeweils optimalen Bedingungen anhand der zuvor optimierten Kulturbedingungen der betreffenden Stämme nach dem Wissen des Fachmanns, beispielsweise hinsichlich Fermentationsvolumen, Medienzusammensetzung, Sauerstoffversorgung oder Rührergeschwindigkeit experimentell ermittelt werden.
Fermentationsverfahren, die dadurch gekennzeichnet sind, daß die Fermentation über eine Zulaufstrategie durchgeführt wird, kommen ebenfalls in Betracht. Hierbei werden die Medienbestandteile, die durch die fortlaufende Kultivierung verbraucht werden, zugefüttert; man spricht auch von einer Zufütterungsstrategie. Hierdurch können beträchtliche Steigerungen sowohl in der Zelldichte, als auch in der Biotrockenmasse und/oder vor allem der Aktivität des interessierenden Proteins erreicht werden.
Analog dazu kann die Fermentation auch so gestaltet werden, daß unerwünschte Stoffwechselprodukte herausgefiltert oder durch Zugabe von Puffer oder jeweils passende Gegenionen neutralisiert werden.
Das hergestellte Protein kann nachträglich aus dem Fermentationsmedium geerntet werden. Dieses Fermentationsverfahren ist gegenüber der Produktaufbereitung aus der Trockenmasse bevorzugt, erfodert jedoch die Zurverfügungstellung geeigneter Sekretionsmarker und
Transportsysteme.
Ohne Sekretion ist u.U. die Aufreinigung des Proteins aus der Zellmasse erforderlich, auch dazu sind verschiedene Verfahren bekannt, wie Fällung z.B durch Ammoniumsulfat oder Ethanol, oder die chromatographische Reinigung, wenn erforderlich bis zur Homogenitat. Die Mehrzahl der beschriebenen technischen Verfahren dürfte jedoch mit einer angereicherten, stabilisierten
Präparation auskommen.
Alle bereits oben ausgeführten Elemente können zu Verfahren kombiniert werden, um erfindungsgemäße Proteine herzustellen. Es ist dabei für jedes erfindungsgemäße Protein eine Vielzahl von Kombinationsmöglichkeiten an Verfahrensschritten denkbar. Das optimale Verfahren muß für jeden konkreten Einzelfall experimentell ermittelt werden.
Durch Expression oder Klonierung können die erfindungsgemäßen Cholinoxidasen in der für den technischen Einsatz erforderlichen Menge zur Verfügung gestellt werden.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher eine Nukleinsäure, die für eine Cholinoxidase kodiert, die sich als Mutante der Cholinoxidase KC2s aus dem Bakterium Arthrobacter nicotianiae (Sequenz 3) darstellen lässt und die dadurch gekennzeichnet ist, daß sie eine Mutation oder mehrere Mutationen in Molekülbereichen bzw. Domänen, bezogen auf die Cholinoxidase KC2s (Sequenz 3), aufweist, die ausgewählt sind unter der Substratbindungsdomäne und der FAD-Bindungsdomäne
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die für eine Cholinoxidase kodiert, die eine oder mehrere Mutationen an Aminosäuresequenzpositionen aufweist, die ausgewählt sind unter den Positionen 4, 21 , 62, 69, 79, 116, 128, 166, 215, 243, 249, 260, 286, 321 , 348, 349, 351 , 393, 394, 530 und 531, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die einen oder mehrere Codonaustausche an Sequenzpositionen aufweist, die ausgewählt sind unter Glu4 (bp 10-12), Ala21 (bp 61-63), Gly62 (bp 184-186), Ile69 (bp 205-207), Met79 (bp 235-237), ThM 16 (bp 346- 348), Lys128 (bp 382-384), Asp166 (bp 496-498), Arg215 (bp 643-645), Val243 (bp 727-729), Arg249 (bp 745-747), Val260 (bp 778-780), Val286 (bp 856-858), Ser321 (bp 961-963), Ser348 (bp 1042-1044), Val349 (bp 1045-1047), Phe351 (bp 1051-1053), Pro393 (bp 1177-1179), Lys394 (bp 1180-1182), Ser530 (bp 1588-1590) und Glu531 (bp 1591-1593), wobei die Nummerierung der Aminosäure-Sequenzpositionen auf Sequenz 3 und die Nummerierung der Nukleinsäure- Sequenzpositionen auf Sequenz 10 bezogen ist. Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die für eine Cholinoxidase kodiert, die einen oder mehrere der Aminosäureaustausche aufweist, die ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, ThM 161Ie1 Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die für eine Cholinoxidase kodiert, die eine oder mehrere der folgenden Kombinationen von Aminosäureaustauschen aufweist: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321 Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + lle69Val + Ser348Leu, Thr116lle + Lys128Met, Pro393Gln, Ser530Gly, Pro393Gln + Ser530Gly, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die eine Mutation oder mehrere Mutationen an Basensequenzpositionen aufweist, die ausgewählt sind unter den Positionen 11, 62, 185, 205, 235, 347, 383, 497, 746, 778, 962, 1043, 1052, 1178, 1181 und 1588, wobei die Nummerierung der Sequenzpositionen auf Sequenz 10 bezogen ist.
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, die einen Basenaustausch oder mehrere Basenaustausche aufweist, der bzw. die ausgewählt sind unter A11G, C62T, G185A, A205G, A235G, C347T, A383T, A497G, G746A, G778A, C962T, C1043T, T1052A, C1178A, A1181 G und A1588G, wobei die Nummerierung der Sequenzpositionen auf Sequenz 10 bezogen ist.
Die erfindungsgemäßen Cholinoxidasen weisen ein pH-Optimum vorzugsweise im fast neutralen bis schwach alkalischen Bereich von etwa pH 6 bis pH 10, besonders bevorzugt pH 7 bis pH 9 auf. Die Aktivität solcher Enzyme wird üblicherweise in U ausgedrückt, wobei die Einheit ("Unit") derjenigen Enzymmenge entspricht, die 1 μmol an Wasserstoffperoxid (H2O2) bei einem festgelegten pH und einer festgelegten Temperatur in 1 Minute generiert. Für die erfindungsgemäßen Cholinoxidasen bezieht sich dies auf einen pH von 9,5 und eine Temperatur von 30 0C in dem unter Beispiel 6 angegebenen Verfahren.
Das Temperatur-Optimum der erfindungsgemäßen Cholinoxidasen liegt etwa im Bereich von 20 bis 6O0C, insbesondere bei etwa 300C.
Eine erfindungsgemäße Cholinoxidase weist vorzugsweise eine spezifische Aktivität auf Cholin von 0,1-100000 U/g, insbesondere von 0,1-1000 U/g; eine spezifische Aktivität auf DMDEA von 0,1- 100000 U/g, insbesondere von 0,9 - 1000 U/g; eine spezifische Aktivität auf TEΞA von 0,1-100000 U/g, insbesondere von 0,9 - 1000 U/g und eine spezifische Aktivität auf MTEA von 0,1-100000 U/g, insbesondere von 0,9 - 100 U/g auf.
Die Menge des im erfindungsgemäßen Waschmittel enthaltenen Substrats für die Oxidase richtet sich nach der zum Erzielen des gewünschten Bleichergebnisses erforderlichen Wasserstoffperoxid menge. Hier kann als Anhaltspunkt dienen, daß bei Enzym-Substrat-Systemen, die pro Mol umgesetztem Substrat bis zu zwei Mol Wasserstoffperoxid freisetzen, die Anwesenheit von etwa 0,05 Gew.-% bis 1 Gew.-% des Substrats in der Wasch-, Bleich- oder Reinigungsflotte in der Regel zur Erzielung eines guten Bleichergebnisses genügt.
Anhand der bekannten Sequenz der Cholinoxidase KC2s (Sequenz 3 bzw. Sequenz 10) wurden neue PCR-Primer (Seq. 15 und 16) sowie Mutagenisierungsprimer (Seq. 17 bis 40) konstruiert.
Weitere Gegenstände der vorliegenden Erfindung sind somit Oligonukleotide, insbesondere PCR- Primer, mit einer der in Seq. 15 bis 40 angegebenen Sequenzen, sowie Oligonukleotide, deren Nukleotidsequenzen mit einer der in Seq. 15 bis 40 angegebenen Nukleotidsequenz zu mindestens 85 %, insbesondere mindestens 90 %, besonders bevorzugt mindestens 95 % und ganz besonders bevorzugt zu 100 % übereinstimmen. .
Die erfindungsgemäßen Oligonukleotide oder Nukleinsäuren sind zur Identifizierung und/oder Gewinnung einer neuen Cholinoxidase verwendbar.
Weitere Gegenstände der vorliegenden Erfindung sind:
Ein Vektor, der einen erfindungsgemäßen Nukleinsäurebereich enthält und der beispielsweise ein Klonierungsvektor oder ein Expressionsvektor sein kann.
Außerdem eine Wirtszelle, die eines der erfindungsgemäßen Proteine oder Derivate exprimiert oder zu dessen Expression angeregt werden kann, vorzugsweise unter Einsatz eines erfindungsgemäßen Expressionsvektors. Bevorzugtermaßen ist die Wirtszelle ein Bakterium, insbesondere eines, das das gebildete Protein oder Derivat ins umgebende Medium sezerniert. Die erfindungsgemäße Wirtszelle kann der Gattung Escherichia, insbesondere der Species Escherichia coli oder der Gattung Bacillus, vorzugsweise der Species Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis oder Bacillus alcalophilus oder besonders bevorzugt der Gattung Arthrobacter und innerhalb dieser Gattung der Spezies oxidans angehören. Die Wirtszelle kann aber auch eine eukaryontische Zelle sein, insbesondere eine, die das gebildete Protein posttranslational modifiziert.
Ein weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung einer erfindungsgemäßen Cholinoxidase als Wasserstoffperoxid in situ erzeugendes Agens. Eine bevorzugte Ausführungsform der erfindungsgemäßen Verwendung ist die Verwendung zur Bleiche, zur Farbübertragungsinhibierung und zur Desinfektion.
Die erfindungsgemäßen Cholinoxidasen und die erfindungsgemäß verwendbaren Cholinoxidasen können vorteilhaft in Körperpflegemittel, Haarwaschmittel, Haarpflegemittel, Haarfärbe- oder Bleichmittel, Mund-, Zahn- oder Zahnprothesenpflegemittel, Kosmetika, Waschmittel, Reinigungsmittel, Nachspülmittel, Handwaschmittel, Handgeschirrspülmittel,
Maschinengeschirrspülmittel, Desinfektionsmittel und Mittel zur bleichenden oder desinfizierenden Behandlung von Filtermedien, Textilien, Pelzen, Papier, Fellen oder Leder eingebracht werden.
Erfindungsgemäß bevorzugt ist ein Wasch-, oder Bleichmittel, enthaltend ein Bleichsystem, das in der Lage ist, unter Anwendungsbedingungen des Mittels Wasserstoffperoxid zu erzeugen, und gegebenenfalls synthetisches Tensid, organischen und/oder anorganischen Builder sowie sonstige übliche Bleich- oder Waschmittelbestandteile, dadurch gekennzeichnet, daß das Bleichsystem aus einer erfindungsgemäßen Cholinoxidase und einem Substrat für die Cholinoxidase besteht. Das Substrat ist vorzugsweise Cholin oder ein Cholinderivat, wie oben beschrieben.
Das erfindungsgemäße Wasch-, oder Bleichmittel weist vorzugsweise eine Oxidase-Aktivität von 1 U/g bis 20 000 U/g auf; es liegt bevorzugtermaßen als rieselfähiges Pulver mit einem Schüttgewicht von 300 g/l bis 1200 g/l, insbesondere 500 g/l bis 900 g/l, vor. Alternativ kann es aber auch in Form eines pastenförmigen oder flüssigen Waschmittels vorliegen, insbesondere in Form eines nicht-wäßrigen Flüssigwaschmittels oder einer nicht-wäßrigen Paste oder in Form eines wäßrigen Flüssigwaschmittels oder einer wasserhaltigen Paste.
Das erfindungsgemäße Wasch-, oder Bleichmittel kann in einem luftundurchlässigen Behältnis verpackt sein, aus dem es kurz vor Gebrauch oder während des Waschvorgangs freigesetzt wird, insbesondere kann die Cholinoxidase und/oder das Substrat für dieses Enzym mit einer bei Raumtemperatur oder bei Abwesenheit von Wasser für das Enzym und/oder dessen Substrat undurchlässigen Substanz umhüllt sein, welche unter Anwendungsbedingungen des Mittels durchlässig für das Enzym und/oder dessen Substrat wird.
Das erfindungsgemäße Wasch-, oder Bleichmittel enthält vorzugsweise zusätzlich zum Bleichsystem
• 5 Gew.-% bis 70 Gew.-%, insbesondere 10 Gew.-% bis 50 Gew.-% Tensid,
• 10 Gew.-% bis 65 Gew.-%, insbesondere 12 Gew.-% bis 60 Gew. -% wasserlösliches, wasserdispergierbares anorganisches Buildermaterial,
• 1 Gew.-% bis 10 Gew.-%, insbesondere 2 Gew.-% bis 8 Gew.-%, wasserlösliche organische Buildersubstanzen, • nicht über 15 Gew.-% feste anorganische und/oder organische Säuren beziehungsweise saure Salze,
• nicht über 5 Gew.-% Komplexbildner für Schwermetalle,
• nicht über 5 Gew.-% Vergrauungsinhibitor,
• nicht über 5 Gew. -% Farbübertragungsinhibitor und
• nicht über 5 Gew.-% Schauminhibitor.
Aufgrund ihrer großen technischen Bedeutung werden nun in Ergänzung zu den bisher dargestelllten besonders bevorzugten Ausführungsformen detailliert die verschiedenen Aspekte und sonstigen Inhaltsstoffe erfindungsgemäßer, d.h. durch die oben beschriebenen Cholinoxidasen gekennzeichneter Wasch- und Reinigungsmittel beschrieben.
Hierbei wird global nach dem Waschgut zwischen Textilien und festen Oberflächen unterschieden. Die hierfür zu wählenden, insbesondere über die sonstigen Inhaltsstoffe zu steuernden Bedingungen, wie beispielsweise Temperatur, pH-Wert, lonenstärke, Redox-Verhältnisse oder mechanische Einflüsse sollten für das jeweilige Reinigungsproblem optimiert sein. So liegen übliche Temperaturen für Wasch- und Reinigungsmittel in Bereichen von 100C bei manuellen Mitteln über 40°C und 6O0C bis hin zu 95° bei maschinellen Mitteln oder bei technischen Anwendungen. Da bei modernen Wasch- und Spülmaschinen die Temperatur meist stufenlos einstellbar ist, sind auch alle Zwischenstufen der Temperatur eingeschlossen. Vorzugsweise werden die Inhaltsstoffe der betreffenden Mittel aufeinander abgestimmt. Bevorzugt sind Synergien hinsichtlich der Reinigungsleistung.
Eine erfindungsgemäße Cholinoxidase kann sowohl in Mitteln für Großverbraucher oder technische Anwender als auch in Produkten für den Privatverbraucher Anwendung finden, wobei alle im Stand der Technik etablierten Reinigungsmittelarten auch Ausführungsformen der vorliegenden Erfindung darstellen. Dazu gehören beispielsweise Konzentrate und unverdünnt anzuwendende Mittel; zum Einsatz im kommerziellen Maßstab, in der Waschmaschine oder bei der Hand-Wäsche, beziehungsweise -Reinigung. Dazu gehören beispielsweise Waschmittel für Textilien, Teppiche, oder Naturfasern, für die nach der vorliegenden Erfindung die Bezeichnung Waschmittel verwendet wird. Dazu gehören beispielsweise auch Geschirrspülmittel für Geschirrspülmaschinen oder manuelle Geschirrspülmittel oder Reiniger für harte Oberflächen wie Metall, Glas, Porzellan, Keramik, Kacheln, Stein, lackierte Oberflächen, Kunststoffe, Holz oder Leder; für solche wird nach der vorliegenden Erfindung die Bezeichnung Reinigungsmittel verwendet.
Ausführungsformen der vorliegenden Erfindung umfassen alle etablierten und/oder alle zweckmäßigen Darreichungsformen. Dazu zählen beispielsweise feste, pulverförmige, flüssige, gelförmige oder pastöse Mittel, gegebenenfalls auch aus mehreren Phasen, komprimiert oder nicht komprimiert; ferner gehören beispielsweise dazu: Extrudate, Granulate, Tabletten oder Pouches, sowohl in Großgebinden als auch portionsweise abgepackt.
Die erfindungsgemäßen Cholinoxidasen werden in erfindungsgemäßen Mitteln beispielsweise mit einzelnen oder mehreren der folgenden Inhaltsstoffe kombiniert: nichtionische, anionische und/oder kationische Tenside, (gegebenenfalls weitere) Bleichmittel, Bleichaktivatoren, Bleichkatalysatoren, Builder und/oder Cobuilder, Lösungsmittel, Verdicker, Sequestrierungsmittel, Elektrolyte, optische Aufheller, Vergrauungsinhibitoren, Korrosionsinhibitoren, insbesondere Silberschutzmittel, Soil-Release-Wirkstoffe, Farbtransfer(oder -Übertragungs) -Inhibitoren, Schauminhibitoren, Abrasivstoffe, Farbstoffe, Duftstoffe, antimikrobielle Wirkstoffe, UV- Schutzmittel, Enzyme wie beispielsweise Proteasen, Amylasen, Lipasen, Cellulasen, Hemicellulasen oder Oxidasen, Stabilisatoren, insbesondere Enzymstabilisatoren, und andere Komponenten, die aus dem Stand der Technik bekannt sind.
Als nichtionische Tenside werden vorzugsweise alkoxylierte, vorteilhafterweise ethoxylierte, insbesondere primäre Alkohole mit vorzugsweise 8 bis 18 C-Atomen und durchschnittlich 1 bis 12 Mol Ethylenoxid (EO) pro Mol Alkohol eingesetzt, in denen der Alkoholrest linear oder bevorzugt in 2-Stellung methylverzweigt sein kann, beziehungsweise lineare und methylverzweigte Reste im Gemisch enthalten kann, so wie sie üblicherweise in Oxoalkoholresten vorliegen. Insbesondere sind jedoch Alkoholethoxylate mit linearen Resten aus Alkoholen nativen Ursprungs mit 12 bis 18 C-Atomen, zum Beispiel aus Kokos-, Palm-, Taigfett- oder Oleylalkohol, und durchschnittlich 2 bis 8 EO pro Mol Alkohol bevorzugt. Zu den bevorzugten ethoxylierten Alkoholen gehören beispielsweise C12-14-Alkohole mit 3 EO oder 4 EO, C9-H-AIkOhOl mit 7 EO, C13-15-Alkohole mit 3 EO, 5 EO, 7 EO oder 8 EO, C12-18-Alkohole mit 3 EO, 5 EO oder 7 EO und Mischungen aus diesen, wie Mischungen aus Ci2-i4-Alkohol mit 3 EO und Ci2-i8-Alkohol mit 5 EO. Die angegebenen Ethoxylierungsgrade stellen statistische Mittelwerte dar, die für ein spezielles Produkt eine ganze oder eine gebrochene Zahl sein können. Bevorzugte Alkoholethoxylate weisen eine eingeengte Homologenverteilung auf (narrow ränge ethoxylates, NRE). Zusätzlich zu diesen nichtionischen Tensiden können auch Fettalkohole mit mehr als 12 EO eingesetzt werden. Beispiele hierfür sind Taigfettalkohol mit 14 EO, 25 EO, 30 EO oder 40 EO.
Eine weitere Klasse bevorzugt eingesetzter nichtionischer Tenside, die entweder als alleiniges nichtionisches Tensid oder in Kombination mit anderen nichtionischen Tensiden eingesetzt werden, sind alkoxylierte, vorzugsweise ethoxylierte oder ethoxylierte und propoxylierte Fettsäurealkylester, vorzugsweise mit 1 bis 4 Kohlenstoffatomen in der Alkylkette, insbesondere Fettsäuremethylester.
Eine weitere Klasse von nichtionischen Tensiden, die vorteilhafterweise eingesetzt werden können, sind die Alkylpolyglycoside (APG). Einsetzbare Alkypolyglycoside genügen der allgemeinen Formel RO(G)Z, in der R für einen linearen oder verzweigten, insbesondere in 2-Stellung methylver- zweigten, gesättigten oder ungesättigten, aliphatischen Rest mit 8 bis 22, vorzugsweise 12 bis 18 C-Atomen bedeutet und G das Symbol ist, das für eine Glykoseeinheit mit 5 oder 6 C-Atomen, vorzugsweise für Glucose, steht. Der Glycosylierungsgrad z liegt dabei zwischen 1 ,0 und 4,0, vorzugsweise zwischen 1 ,0 und 2,0 und insbesondere zwischen 1 ,1 und 1 ,4. Bevorzugt eingesetzt werden lineare Alkylpolyglucoside, also Alkylpolyglycoside, in denen der Polyglycosylrest ein Glucoserest und der Alkylrest ein n-Alkylrest ist.
Auch nichtionische Tenside vom Typ der Aminoxide, beispielsweise N-Kokosalkyl-N,N- dimethylaminoxid und N-Talgalkyl-N.N-dihydroxyethylaminoxid, und der Fettsäurealkanolamide können geeignet sein. Der Anteil dieser nichtionischen Tenside liegt vorzugsweise nicht über dem der ethoxylierten Fettalkohole, insbesondere bei nicht mehr als der Hälfte davon.
Als anionische Tenside werden beispielsweise solche vom Typ der Sulfonate und Sulfate eingesetzt. Als Tenside vom Sulfonat-Typ kommen dabei vorzugsweise Cg.13-Alkylbenzolsulfonate, Olefinsulfonate, d.h. Gemische aus Alken- und Hydroxyalkansulfonaten sowie Disulfonaten, wie man sie beispielsweise aus C12-i8-Monoolefinen mit end- oder innenständiger Doppelbindung durch Sulfonieren mit gasförmigem Schwefeltrioxid und anschließende alkalische oder saure Hydrolyse der Sulfonierungsprodukte erhält, in Betracht. Geeignet sind auch Alkansulfonate, die aus C12-18- Alkanen beispielsweise durch Sulfochlorierung oder Sulfoxidation mit anschließender Hydrolyse beziehungsweise Neutralisation gewonnen werden. Ebenso sind auch die Ester von α- Sulfofettsäuren (Estersulfonate), zum Beispiel die α-sulfonierten Methylester der hydrierten Kokos-, Palmkern- oder Taigfettsäuren geeignet.
Weitere geeignete Aniontenside sind sulfierte Fettsäureglycerinester. Unter Fettsäureglycerin- estern sind die Mono-, Di- und Triester sowie deren Gemische zu verstehen, wie sie bei der Herstellung durch Veresterung von einem Monoglycerin mit 1 bis 3 Mol Fettsäure oder bei der Um- esterung von Triglyceriden mit 0,3 bis 2 Mol Glycerin erhalten werden. Bevorzugte sulfierte Fettsäureglycerinester sind dabei die Sulfierprodukte von gesättigten Fettsäuren mit 6 bis 22 Kohlenstoffatomen, beispielsweise der Capronsäure, Caprylsäure, Caprinsäure, Myristinsäure, Laurinsäure, Palmitinsäure, Stearinsäure oder Behensäure.
Als Alk(en)ylsulfate werden die Alkali- und insbesondere die Natriumsalze der Schwefelsäurehalbester der Ci2-C18-Fettalkohole, beispielsweise aus Kokosfettalkohol, Taigfettalkohol, Lauryl-, Myristyl-, Cetyl- oder Stearylalkohol oder der Cio-C2o-Oxoalkohole und diejenigen Halbester sekundärer Alkohole dieser Kettenlängen bevorzugt. Weiterhin bevorzugt sind Alk(en)ylsulfate der genannten Kettenlänge, welche einen synthetischen, auf petrochemischer Basis hergestellten geradkettigen Alkylrest enthalten, die ein analoges Abbauverhalten besitzen wie die adäquaten Verbindungen auf der Basis von fettchemischen Rohstoffen. Aus waschtechnischem Interesse sind die Ci2-C16-Alkylsulfate und C12-Ci5-Alkylsulfate sowie Ci4-C15-Alkylsulfate bevorzugt. Auch 2,3- Alkylsulfate sind geeignete Aniontenside. Auch die Schwefelsäuremonoester der mit 1 bis 6 Mol Ethylenoxid ethoxylierten geradkettigen oder verzweigten C7.2i-Alkohole, wie 2-Methyl-verzweigte C9-11-AIkOhOIe mit im Durchschnitt 3,5 Mol Ethylenoxid (EO) oder Ci2-i8-Fettalkohole mit 1 bis 4 EO, sind geeignet. Sie werden in Reinigungsmitteln aufgrund ihres hohen Schaumverhaltens nur in relativ geringen Mengen, beispielsweise in Mengen bis 5 Gew.-%, üblicherweise von 1 bis 5 Gew.-%, eingesetzt.
Weitere geeignete Aniontenside sind auch die Salze der Alkylsulfobernsteinsäure, die auch als Sulfosuccinate oder als Sulfobernsteinsäureester bezeichnet werden und die Monoester und/oder Diester der Sulfobernsteinsäure mit Alkoholen, vorzugsweise Fettalkoholen und insbesondere ethoxylierten Fettalkoholen darstellen. Bevorzugte Sulfosuccinate enthalten C8-i8-Fettalkoholreste oder Mischungen aus diesen. Insbesondere bevorzugte Sulfosuccinate enthalten einen Fettalkoholrest, der sich von ethoxylierten Fettalkoholen ableitet, die für sich betrachtet nichtionische Tenside darstellen (Beschreibung siehe unten). Dabei sind wiederum Sulfosuccinate, deren Fettalkohol-Reste sich von ethoxylierten Fettalkoholen mit eingeengter Homologenverteilung ableiten, besonders bevorzugt. Ebenso ist es auch möglich, Alk(en)ylbernsteinsäure mit vorzugsweise 8 bis 18 Kohlenstoffatomen in der Alk(en)ylkette oder deren Salze einzusetzen.
Als weitere anionische Tenside kommen insbesondere Seifen in Betracht. Geeignet sind gesättigte Fettsäureseifen, wie die Salze der Laurinsäure, Myristinsäure, Palmitinsäure, Stearinsäure, hydrierte Erucasäure und Behensäure sowie insbesondere aus natürlichen Fettsäuren, zum Beispiel Kokos-, Palmkern- oder Taigfettsäuren, abgeleitete Seifengemische.
Die anionischen Tenside einschließlich der Seifen können in Form ihrer Natrium-, Kalium- oder Ammoniumsalze sowie als lösliche Salze organischer Basen, wie Mono-, Di- oder Triethanolamin, vorliegen. Vorzugsweise liegen die anionischen Tenside in Form ihrer Natrium- oder Kaliumsalze, insbesondere in Form der Natriumsalze vor.
Die Tenside können in den erfindungsgemäßen Reinigungs- oder Waschmitteln insgesamt in einer Menge von vorzugsweise 5 Gew.-% bis 50 Gew.-%, insbesondere von 8 Gew.-% bis 30 Gew.-%, bezogen auf das fertige Mittel, enthalten sein.
Erfindungsgemäße Mittel können weitere Bleichmittel enthalten. Unter den als Bleichmittel dienenden, in Wasser H2O2 liefernden Verbindungen haben das Natriumpercarbonat, das Natriumperborattetrahydrat und das Natriumperboratmonohydrat besondere Bedeutung. Weitere brauchbare Bleichmittel sind beispielsweise Peroxopyrophosphate, Citratperhydrate sowie H2O2 liefernde persaure Salze oder Persäuren, wie Persulfate beziehungsweise Perschwefelsäure. Brauchbar ist auch das Harnstoffperoxohydrat Percarbamid, das durch die Formel H2N-CO- NH2 H2O2 beschrieben werden kann. Insbesondere beim Einsatz der Mittel für das Reinigen harter Oberflächen, zum Beispiel beim maschinellen Geschirrspülen, können sie gewünschtenfalls auch Bleichmittel aus der Gruppe der organischen Bleichmittel enthalten, obwohl deren Einsatz prinzipiell auch bei Mitteln für die Textilwäsche möglich ist. Typische organische Bleichmittel sind die Diacylperoxide, wie zum Beispiel Dibenzoylperoxid. Weitere typische organische Bleichmittel sind die Peroxysäuren, wobei als Beispiele besonders die Alkylperoxysäuren und die Arylperoxysäuren genannt werden. Bevorzugte Vertreter sind die Peroxybenzoesäure und ihre ringsubstituierten Derivate, wie Alkylperoxybenzoesäuren, aber auch Peroxy-α-Naphthoesäure und Magnesium-monoperphthalat, die aliphatischen oder substituiert aliphatischen Peroxysäuren, wie Peroxylaurinsäure, Peroxystearinsäure, ε-Phthalimidoperoxycapronsäure (Phthalimidoperoxy- hexansäure, PAP), o-Carboxybenzamidoperoxycapronsäure, N-Nonenylamidoperadipinsäure und N-Nonenylamidopersuccinate, und aliphatische und araliphatische Peroxydicarbonsäuren, wie 1 ,12-Diperoxycarbonsäure, 1 ,9-Diperoxyazelainsäure, Diperoxysebacinsäure, Diperoxybrassyl- säure, die Diperoxyphthalsäuren, 2-Decyldiperoxybutan-1 ,4-disäure, N,N-Terephthaloyl-di(6- aminopercapronsäure) können eingesetzt werden.
Der Gehalt der Mittel an Bleichmittel kann 1 bis 40 Gew.-% und insbesondere 10 bis 20 Gew.-%, betragen, wobei vorteilhafterweise Perboratmonohydrat oder Percarbonat eingesetzt wird. Eine synergistische Verwendung von Amylase mit Percarbonat oder von Amylase mit Percarbonsäure wird mit den Anmeldungen WO 99/63036, beziehungsweise WO 99/63037 offenbart.
Um beim Waschen bei Temperaturen von 600C und darunter, und insbesondere bei der Wäschevorbehandlung eine verbesserte Bleichwirkung zu erreichen, können die Mittel auch Bleichaktivatoren enthalten. Als Bleichaktivatoren können Verbindungen, die unter Perhydrolyse- bedingungen aliphatische Peroxocarbonsäuren mit vorzugsweise 1 bis 10 C-Atomen, insbesondere 2 bis 4 C-Atomen, und/oder gegebenenfalls substituierte Perbenzoesäure ergeben, eingesetzt werden. Geeignet sind Substanzen, die O- und/oder N-Acylgruppen der genannten C- Atomzahl und/oder gegebenenfalls substituierte Benzoylgruppen tragen. Bevorzugt sind mehrfach acylierte Alkylendiamine, insbesondere Tetraacetylethylendiamin (TAED), acylierte Triazinderivate, insbesondere 1 ,5-Diacetyl-2,4-dioxohexahydro-1 ,3,5-triazin (DADHT), acylierte Glycolurile, insbesondere 1 ,3,4,6-Tetraacetylglycoluril (TAGU), N-Acylimide, insbesondere N-Nonanoylsuccinimid (NOSI), acylierte Phenolsulfonate, insbesondere n-Nonanoyl- oder Isononanoyloxybenzolsulfonat (n- beziehungsweise iso-NOBS), acylierte Hydroxycarbonsäuren, wie Triethyl-O-acetylcitrat (TEOC), Carbonsäureanhydride, insbesondere Phthalsäureanhydrid, lsatosäureanhydrid und/oder Bernsteinsäureanhydrid, Carbonsäureamide, wie N-Methyldiacetamid, Glycolid, acylierte mehrwertige Alkohole, insbesondere Triacetin, Ethylenglycoldiacetat, Isopropenylacetat, 2,5- Diacetoxy-2,5-dihydrofuran und die aus den deutschen Patentanmeldungen DE 196 16 693 und DE 196 16 767 bekannten Enolester sowie acetyliertes Sorbitol und Mannitol beziehungsweise deren in der europäischen Patentanmeldung EP 0 525 239 beschriebene Mischungen (SORMAN), acylierte Zuckerderivate, insbesondere Pentaacetylglucose (PAG), Pentaacetylfructose, Tetraacetylxylose und Octaacetyllactose sowie acetyliertes, gegebenenfalls N-alkyliertes Glucamin beziehungsweise Gluconolacton, Triazol beziehungsweise Triazolderivate und/oder teilchenförmige Caprolactame und/oder Caprolactamderivate, bevorzugt N-acylierte Lactame, beispielsweise N-Benzoylcaprolactam und N-Acetylcaprolactam, die aus den internationalen Patentanmeldungen WO 94/27970, WO 94/28102, WO 94/28103, WO 95/00626, WO 95/14759 und WO 95/17498 bekannt sind. Die aus der deutschen Patentanmeldung DE 196 16 769 bekannten hydrophil substituierten Acylacetale und die in der deutschen Patentanmeldung DE 196 16 770 sowie der internationalen Patentanmeldung WO 95/14075 beschriebenen Acyllactame werden ebenfalls bevorzugt eingesetzt. Auch die aus der deutschen Patentanmeldung DE 44 43 177 bekannten Kombinationen konventioneller Bleichaktivatoren können eingesetzt werden. Ebenso können Nitrilderivate wie Cyanopyridine, Nitrilquats, zum Beispiel N- Alkylammoniumacetonitrile, und/oder Cyanamidderivate eingesetzt werden. Bevorzugte Bleichaktivatoren sind Natrium-4-(octanoyloxy)-benzolsulfonat, n-Nonanoyl- oder Isononanoyloxybenzolsulfonat (n- beziehungsweise iso-NOBS), Undecenoyloxybenzolsulfonat (UDOBS), Natriumdodecanoyloxybenzolsulfonat (DOBS)1 Decanoyloxybenzoesäure (DOBA, OBC 10) und/oder Dodecanoyloxybenzolsulfonat (OBS 12), sowie N-Methylmorpholinum-acetonitril (MMA). Derartige Bleichaktivatoren können im üblichen Mengenbereich von 0,01 bis 20 Gew.-%, vorzugsweise in Mengen von 0,1 bis 15 Gew.-%, insbesondere 1 Gew.-% bis 10 Gew.-%, bezogen auf die gesamte Zusammensetzung, enthalten sein.
Zusatzlich zu den konventionellen Bleichaktivatoren oder an deren Stelle können auch sogenannte Bleichkatalysatoren enthalten sein. Bei diesen Stoffen handelt es sich um bleichverstärkende Übergangsmetallsalze beziehungsweise Übergangsmetallkomplexe wie beispielsweise Mn-, Fe-, Co-, Ru - oder Mo-Salenkomplexe oder -carbonylkomplexe. Auch Mn-, Fe-, Co-, Ru-, Mo-, Ti-, V- und Cu-Komplexe mit N-haltigen Tripod-Liganden sowie Co-, Fe-, Cu- und Ru-Aminkomplexe sind als Bleichkatalysatoren geeignet, wobei solche Verbindungen bevorzugt eingesetzt werden, die in der DE 197 09 284 A1 beschrieben sind. Gemäß WO 99/63038 vermögen auch Acetonitril- Derivate und gemäß WO 99/63041 bleichaktivierende Übergangsmetallkomplexverbindungen in Kombination mit Amylasen eine bleichaktivierende Wirkung zu entfalten.
Erfindungsgemäße Mittel enthalten in der Regel einen oder mehrere Builder, insbesondere Zeolithe, Silikate, Carbonate, organische Cobuilder und - wo keine ökologischen Gründe gegen ihren Einsatz sprechen - auch die Phosphate. Letztere sind insbesondere in Reinigungsmitteln für das maschinelle Geschirrspülen bevorzugt einzusetzende Gerüststoffe.
Zu nennen sind hier kristalline, schichtförmige Natriumsilikate der allgemeinen Formel
NaMSixO2x+I yH2O, wobei M Natrium oder Wasserstoff bedeutet, x eine Zahl von 1 ,6 bis 4, vorzugsweise 1 ,9 bis 4,0 und y eine Zahl von 0 bis 20 ist und bevorzugte Werte für x 2, 3 oder 4 sind. Derartige kristalline Schichtsilicate werden beispielsweise in der europäischen Patentanmeldung EP 0 164 514 beschrieben. Bevorzugte kristalline Schichtsilicate der angegebenen Formel sind solche, in denen M für Natrium steht und x die Werte 2 oder 3 annimmt.
Insbesondere sind sowohl ß- als auch δ-Natriumdisilicate Na2Si2O5 ^yH2O bevorzugt. Im Handel befinden sich derartige Verbindungen beispielsweise unter der Bezeichnung SKS® (Fa. Clariant). So handelt es sich bei SKS-6® vorwiegend um ein δ-Natriumdisilicat mit der Formel
Na2Si2OS yH2O, bei SKS-7® vorwiegend um das ß-Natriumdisilicat. Durch Reaktion mit Säuren (zum Beispiel Citronensäure oder Kohlensäure) entsteht aus dem δ-Natriumdisilicat Kanemit
NaHSi2O5-VH2O, im Handel unter den Bezeichnungen SKS-9® beziehungsweise SKS-10® (Fa. Clariant). Von Vorteil kann es auch sein, chemische Modifikationen dieser Schichtsilicate einzusetzen. So kann beispielsweise die Alkalität der Schichtsilicate geeignet beeinflußt werden. Mit Phosphat beziehungsweise mit Carbonat dotierte Schichtsilicate weisen im Vergleich zu dem δ- Natriumdisilicat veränderte Kristallmorphologien auf, lösen sich schneller und zeigen im Vergleich zu δ-Natriumdisilicat ein erhöhtes Calciumbindevermögen. So sind Schichtsilicate der allgemeinen Summenformel x Na2O • y SiO2 • z P2O5, in der das Verhältnis x zu y einer Zahl 0,35 bis 0,6, das Verhältnis x zu z einer Zahl von 1 ,75 bis 1200 und das Verhältnis y zu z einer Zahl von 4 bis 2800 entsprechen, in der Patentanmeldung DE 196 01 063 beschrieben. Die Löslichkeit der Schichtsilicate kann auch erhöht werden, indem besonders feinteilige Schichtsilicate eingesetzt werden. Auch Compounds aus den kristallinen Schichtsilicaten mit anderen Inhaltsstoffen können eingesetzt werden. Dabei sind insbesondere Compounds mit Cellulosederivaten, die Vorteile in der desintegrierenden Wirkung aufweisen und insbesondere in Waschmitteltabletten eingesetzt werden, sowie Compounds mit Polycarboxylaten, zum Beispiel Citronensäure, beziehungsweise polymeren Polycarboxylaten, zum Beispiel Copolymeren der Acrylsäure, zu nennen.
Einsetzbar sind auch amorphe Natriumsilikate mit einem Modul Na2O : SiO2 von 1 :2 bis 1 :3,3, vorzugsweise von 1 :2 bis 1:2,8 und insbesondere von 1:2 bis 1 :2,6, welche löseverzögert sind und Sekundärwascheigenschaften aufweisen. Die Löseverzögerung gegenüber herkömmlichen amorphen Natriumsilikaten kann dabei auf verschiedene Weise, beispielsweise durch Oberflächenbehandlung, Compoundierung, Kompaktierung/ Verdichtung oder durch Übertrocknung hervorgerufen worden sein. Im Rahmen dieser Erfindung wird unter dem Begriff "amorph" auch "röntgenamorph" verstanden. Dies heißt, daß die Silikate bei Röntgenbeugungsexperimenten keine scharfen Röntgenreflexe liefern, wie sie für kristalline Substanzen typisch sind, sondern allenfalls ein oder mehrere Maxima der gestreuten Röntgenstrahlung, die eine Breite von mehreren Gradeinheiten des Beugungswinkels aufweisen. Es kann jedoch sehr wohl sogar zu besonders guten Buildereigenschaften führen, wenn die Silikatpartikel bei Elektronenbeugungsexperimenten verwaschene oder sogar scharfe Beugungsmaxima liefern. Dies ist so zu interpretieren, daß die Produkte mikrokristalline Bereiche der Größe 10 bis einige Hundert nm aufweisen, wobei Werte bis max. 50 nm und insbesondere bis max. 20 nm bevorzugt sind. Insbesondere bevorzugt sind verdichtete/kompaktierte amorphe Silikate, compoundierte amorphe Silikate und übertrocknete röntgenamorphe Silikate.
Ein gegebenenfalls einsetzbarer, feinkristalliner, synthetischer und gebundenes Wasser enthaltender Zeolith ist vorzugsweise Zeolith A und/oder P. Als Zeolith P wird Zeolith MAP® (Handelsprodukt der Firma Crosfield) besonders bevorzugt. Geeignet sind jedoch auch Zeolith X sowie Mischungen aus A, X und/oder P. Kommerziell erhältlich und im Rahmen der vorliegenden Erfindung bevorzugt einsetzbar ist beispielsweise auch ein Co-Kristallisat aus Zeolith X und Zeolith A (ca. 80 Gew.-% Zeolith X), das von der Firma CONDEA Augusta S.p.A. unter dem Markennamen VEGOBOND AX® vertrieben wird und durch die Formel
nNa2O ' (1-n)K2O ' AI2O3 ' (2 - 2,5)SiO2 (3,5 - 5,5) H2O
beschrieben werden kann. Geeignete Zeolithe weisen eine mittlere Teilchengröße von weniger als 10 μm (Volumenverteilung; Meßmethode: Coulter Counter) auf und enthalten vorzugsweise 18 bis 22 Gew.-%, insbesondere 20 bis 22 Gew.-% an gebundenem Wasser.
Selbstverständlich ist auch ein Einsatz der allgemein bekannten Phosphate als Buildersubstanzen möglich, sofern ein derartiger Einsatz nicht aus ökologischen Gründen vermieden werden sollte. Unter der Vielzahl der kommerziell erhältlichen Phosphate haben die Alkalimetallphosphate unter besonderer Bevorzugung von Pentanatrium- beziehungsweise Pentakaliumtriphosphat (Natriumbeziehungsweise Kaliumtripolyphosphat) in der Wasch- und Reinigungsmittel-Industrie die größte Bedeutung.
Alkalimetallphosphate ist dabei die summarische Bezeichnung für die Alkalimetall- (insbesondere Natrium- und Kalium-) -Salze der verschiedenen Phosphorsäuren, bei denen man Metaphosphorsäuren (HPO3)n und Orthophosphorsäure H3PO4 neben höhermolekularen Vertretern unterscheiden kann. Die Phosphate vereinen dabei mehrere Vorteile in sich: Sie wirken als Alkaliträger, verhindern Kalkbeläge auf Maschinenteilen beziehungsweise Kalkinkrustationen in Geweben und tragen überdies zur Reinigungsleistung bei.
Natriumdihydrogenphosphat, NaH2PO4, existiert als Dihydrat (Dichte 1 ,91 gern"3, Schmelzpunkt 60°) und als Monohydrat (Dichte 2,04 gern'3). Beide Salze sind weiße, in Wasser sehr leicht lösliche Pulver, die beim Erhitzen das Kristallwasser verlieren und bei 2000C in das schwach saure Diphosphat (Dinatriumhydrogendiphosphat, Na2H2P2O7), bei höherer Temperatur in Natiumtrimetaphosphat (Na3P3O9) und Maddrellsches Salz (siehe unten), übergehen. NaH2PO4 reagiert sauer; es entsteht, wenn Phosphorsäure mit Natronlauge auf einen pH-Wert von 4,5 eingestellt und die Maische versprüht wird. Kaliumdihydrogenphosphat (primäres oder einbasiges Kaliumphosphat, Kaliumbiphosphat, KDP), KH2PO4, ist ein weißes Salz der Dichte 2,33 gern'3, hat einen Schmelzpunkt 253° [Zersetzung unter Bildung von Kaliumpolyphosphat (KPO3)J und ist leicht löslich in Wasser.
Dinatriumhydrogenphosphat (sekundäres Natriumphosphat), Na2HPO4, ist ein farbloses, sehr leicht wasserlösliches kristallines Salz. Es existiert wasserfrei und mit 2 Mol. (Dichte 2,066 gern"3, Wasserverlust bei 95°), 7 Mol. (Dichte 1 ,68 gern'3, Schmelzpunkt 48° unter Verlust von 5 H2O) und 12 Mol. Wasser (Dichte 1 ,52 gern"3, Schmelzpunkt 35° unter Verlust von 5 H2O), wird bei 100° wasserfrei und geht bei stärkerem Erhitzen in das Diphosphat Na4P2O7 über. Dinatriumhydrogenphosphat wird durch Neutralisation von Phosphorsäure mit Sodalösung unter Verwendung von Phenolphthalein als Indikator hergestellt. Dikaliumhydrogenphosphat (sekundäres od. zweibasiges Kaliumphosphat), K2HPO4, ist ein amorphes, weißes Salz, das in Wasser leicht löslich ist.
Trinatriumphosphat, tertiäres Natriumphosphat, Na3PO4, sind farblose Kristalle, die als Dodecahydrat eine Dichte von 1 ,62 gern'3 und einen Schmelzpunkt von 73-760C (Zersetzung), als Decahydrat (entsprechend 19-20% P2O5) einen Schmelzpunkt von 1000C und in wasserfreier Form (entsprechend 39-40% P2O5) eine Dichte von 2,536 gern"3 aufweisen. Trinatriumphosphat ist in Wasser unter alkalischer Reaktion leicht löslich und wird durch Eindampfen einer Lösung aus genau 1 Mol Dinatriumphosphat und 1 Mol NaOH hergestellt. Trikaliumphosphat (tertiäres oder dreibasiges Kaliumphosphat), K3PO4, ist ein weißes, zerfließliches, körniges Pulver der Dichte 2,56 gern'3, hat einen Schmelzpunkt von 1340° und ist in Wasser mit alkalischer Reaktion leicht löslich. Es entsteht zum Beispiel beim Erhitzen von Thomasschlacke mit Kohle und Kaliumsulfat. Trotz des höheren Preises werden in der Reinigungsmittel-Industrie die leichter löslichen, daher hochwirksamen, Kaliumphosphate gegenüber entsprechenden Natrium-Verbindungen vielfach bevorzugt.
Tetranatriumdiphosphat (Natriumpyrophosphat), Na4P2O7, existiert in wasserfreier Form (Dichte 2,534 gern"3, Schmelzpunkt 988°, auch 880° angegeben) und als Decahydrat (Dichte 1 ,815-1 ,836 gern'3, Schmelzpunkt 94° unter Wasserverlust). Beide Substanzen sind farblose, in Wasser mit alkalischer Reaktion lösliche Kristalle. Na4P2O7 entsteht beim Erhitzen von Dinatriumphosphat auf >200°C oder indem man Phosphorsäure mit Soda im stöchiometrischem Verhältnis umsetzt und die Lösung durch Versprühen entwässert. Das Decahydrat komplexiert Schwermetall-Salze und Härtebildner und verringert daher die Härte des Wassers. Kaliumdiphosphat (Kaliumpyrophosphat), K4P2O7, existiert in Form des Trihydrats und stellt ein farbloses, hygroskopisches Pulver mit der Dichte 2,33 gern*3 dar, das in Wasser löslich ist, wobei der pH-Wert der 1%igen Lösung bei 25° 10,4 beträgt.
Durch Kondensation des NaH2PO4 beziehungsweise des KH2PO4 entstehen höhermolekulare Natrium- und Kaliumphosphate, bei denen man cyclische Vertreter, die Natrium- beziehungsweise Kaliummetaphosphate und kettenförmige Typen, die Natrium- beziehungsweise Kaliumpolyphosphate, unterscheiden kann. Insbesondere für letztere sind eine Vielzahl von Bezeichnungen in Gebrauch: Schmelz- oder Glühphosphate, Grahamsches Salz, Kurrolsches und Maddrellsches Salz. Alle höheren Natrium- und Kaliumphosphate werden gemeinsam als kondensierte Phosphate bezeichnet.
Das technisch wichtige Pentanatriumtriphosphat, Na5P3O10 (Natriumtripolyphosphat), ist ein wasserfrei oder mit 6 H2O kristallisierendes, nicht hygroskopisches, weißes, wasserlösliches Salz der allgemeinen Formel NaO-[P(O)(ONa)-O]n-Na mit n=3. In 10O g Wasser lösen sich bei Zimmertemperatur etwa 17 g, bei 60° ca. 20 g, bei 100° rund 32 g des kristallwasserfreien Salzes; nach zweistündigem Erhitzen der Lösung auf 100° entstehen durch Hydrolyse etwa 8% Orthophosphat und 15% Diphosphat. Bei der Herstellung von Pentanatriumtriphosphat wird Phosphorsaure mit Sodalösung oder Natronlauge im stöchiometrischen Verhältnis zur Reaktion gebracht und die Lösung durch Versprühen entwässert. Ähnlich wie Grahamsches Salz und Natriumdiphosphat löst Pentanatriumtriphosphat viele unlösliche Metall-Verbindungen (auch Kalkseifen usw.). Pentakaliumtriphosphat, K5P3Oi0 (Kaliumtripolyphosphat), kommt beispielsweise in Form einer 50 Gew.-%-igen Lösung (> 23% P2O5, 25% K2O) in den Handel. Die Kaliumpolyphosphate finden in der Wasch- und Reinigungsmittel-Industrie breite Verwendung. Weiter existieren auch Natriumkaliumtripolyphosphate, welche ebenfalls im Rahmen der vorliegenden Erfindung einsetzbar sind. Diese entstehen beispielsweise, wenn man Natriumtrimetaphosphat mit KOH hydrolysiert:
(NaPO3J3 + 2 KOH -» Na3K2P3O10 + H2O
Diese sind erfindungsgemäß genau wie Natriumtripolyphosphat, Kaliumtripolyphosphat oder Mischungen aus diesen beiden einsetzbar; auch Mischungen aus Natriumtripolyphosphat und Natriumkaliumtripolyphosphat oder Mischungen aus Kaliumtripolyphosphat und Natriumkaliumtripolyphosphat oder Gemische aus Natriumtripolyphosphat und Kaliumtripolyphosphat und Natriumkaliumtripolyphosphat sind erfindungsgemäß einsetzbar.
Als organische Cobuilder können in den erfindungsgemäßen Wasch- und Reinigungsmitteln insbesondere Polycarboxylate oder Polycarbonsäuren, polymere Polycarboxylate, Polyasparaginsäure, Polyacetale, gegebenenfalls oxidierte Dextrine, weitere organische Cobuilder (siehe unten) sowie Phosphonate eingesetzt werden. Diese Stoffklassen werden nachfolgend beschrieben.
Brauchbare organische Gerüstsubstanzen sind beispielsweise die in Form ihrer Natriumsalze einsetzbaren Polycarbonsäuren, wobei unter Polycarbonsäuren solche Carbonsäuren verstanden werden, die mehr als eine Säurefunktion tragen. Beispielsweise sind dies Citronensäure, Adipinsäure, Bernsteinsäure, Glutarsäure, Äpfelsäure, Weinsäure, Maleinsäure, Fumarsäure, Zuckersäuren, Aminocarbonsäuren, Nitrilotriessigsäure (NTA), sofern ein derartiger Einsatz aus ökologischen Gründen nicht zu vermeiden ist, sowie Mischungen aus diesen. Bevorzugte Salze sind die Salze der Polycarbonsäuren wie Citronensäure, Adipinsäure, Bernsteinsäure, Glutarsäure, Weinsäure, Zuckersäuren und Mischungen aus diesen.
Auch die Säuren an sich können eingesetzt werden. Sie besitzen neben ihrer Builderwirkung typischerweise auch die Eigenschaft einer Säuerungskomponente und dienen somit auch zur Einstellung eines niedrigeren und milderen pH-Wertes von Wasch- oder Reinigungsmitteln, sofern nicht der sich durch die Mischung der übrigen Komponenten ergebende pH-Wert gewünscht ist. Insbesondere sind hierbei System- unbd umweltvertragliche Säuren wie Citronensäure, Essigsaure, Weinsäure, Äpfelsäure, Milchsäure, Glykolsäure, Bernsteinsäure, Glutarsäure, Adipinsäure, Gluconsäure und beliebige Mischungen aus diesen zu nennen. Aber auch Mineralsauren, insbesondere Schwefelsäure oder Basen, insbesondere Ammonium- oder Alkalihydroxide können als pH-Regulatoren dienen. Derartige Regulatoren sind in den erfindungemäßen Mitteln in Mengen von vorzugsweise nicht über 20 Gew.-%, insbesondere von 1 ,2 Gew.-% bis 17 Gew.-%, enthalten.
Als Builder sind weiter polymere Polycarboxylate geeignet, dies sind beispielsweise die Alkalimetallsalze der Polyacrylsäure oder der Polymethacrylsäure, beispielsweise solche mit einer relativen Molekülmasse von 500 bis 70 000 g/mol.
Bei den für polymere Polycarboxylate angegebenen Molmassen handelt es sich im Sinne dieser Schrift um gewichtsmittlere Molmassen Mw der jeweiligen Säureform, die grundsätzlich mittels Gelpermeationschromatographie (GPC) bestimmt wurden, wobei ein UV-Detektor eingesetzt wurde. Die Messung erfolgte dabei gegen einen externen Polyacrylsäure-Standard, der aufgrund seiner strukturellen Verwandtschaft mit den untersuchten Polymeren realistische Molgewichtswerte liefert. Diese Angaben weichen deutlich von den Molgewichtsangaben ab, bei denen Polystyrolsulfonsäuren als Standard eingesetzt werden. Die gegen Polystyrolsulfonsäuren gemessenen Molmassen sind in der Regel deutlich höher als die in dieser Schrift angegebenen Molmassen.
Geeignete Polymere sind insbesondere Polyacrylate, die bevorzugt eine Molekülmasse von 2 000 bis 20 000 g/mol aufweisen. Aufgrund ihrer überlegenen Löslichkeit können aus dieser Gruppe wiederum die kurzkettigen Polyacrylate, die Molmassen von 2 000 bis 10 000 g/mol, und besonders bevorzugt von 3 000 bis 5 000 g/mol, aufweisen, bevorzugt sein.
Geeignet sind weiterhin copolymere Polycarboxylate, insbesondere solche der Acrylsäure mit Methacrylsäure und der Acrylsäure oder Methacrylsäure mit Maleinsäure. Als besonders geeignet haben sich Copolymere der Acrylsäure mit Maleinsäure erwiesen, die 50 bis 90 Gew.-% Acrylsäure und 50 bis 10 Gew.-% Maleinsäure enthalten. Ihre relative Molekülmasse, bezogen auf freie Säuren, beträgt im allgemeinen 2 000 bis 70 000 g/mol, vorzugsweise 20 000 bis 50 000 g/mol und insbesondere 30 000 bis 40 000 g/mol. Die (co-) polymeren Polycarboxylate können entweder als Pulver oder als wässerige Lösung eingesetzt werden. Der Gehalt der Mittel an (co-)polymeren Polycarboxylaten kann von 0,5 bis 20 Gew.-%, insbesondere 1 bis 10 Gew.-%, betragen.
Zur Verbesserung der Wasserlöslichkeit können die Polymere auch Allylsulfonsäuren, wie beispielsweise Allyloxybenzolsulfonsäure und Methallylsulfonsäure, als Monomer enthalten. Insbesondere bevorzugt sind auch biologisch abbaubare Polymere aus mehr als zwei verschiedenen Monomereinheiten, beispielsweise solche, die als Monomere Salze der Acrylsäure und der Maleinsäure sowie Vinylalkohol beziehungsweise Vinylalkohol-Derivate oder die als Monomere Salze der Acrylsäure und der 2-Alkylallylsulfonsäure sowie Zucker-Derivate enthalten.
Weitere bevorzugte Copolymere sind solche, die als Monomere vorzugsweise Acrolein und Acrylsäure/Acrylsäuresalze beziehungsweise Acrolein und Vinylacetat aufweisen.
Ebenso sind als weitere bevorzugte Buildersubstanzen polymere Aminodicarbonsäuren, deren Salze oder deren Vorläufersubstanzen zu nennen. Besonders bevorzugt sind Polyasparaginsäuren beziehungsweise deren Salze und Derivate.
Weitere geeignete Buildersubstanzen sind Polyacetale, welche durch Umsetzung von Dialdehyden mit Polyolcarbonsäuren, welche 5 bis 7 C-Atome und mindestens 3 Hydroxylgruppen aufweisen, erhalten werden können. Bevorzugte Polyacetale werden aus Dialdehyden wie Glyoxal, Glutaraldehyd, Terephthalaldehyd sowie deren Gemischen und aus Polyolcarbonsäuren wie Gluconsäure und/oder Glucoheptonsäure erhalten.
Weitere geeignete organische Buildersubstanzen sind Dextrine, beispielsweise Oligomere beziehungsweise Polymere von Kohlenhydraten, die durch partielle Hydrolyse von Stärken erhalten werden können. Die Hydrolyse kann nach üblichen, beispielsweise säure- oder enzymkatalysierten Verfahren durchgeführt werden. Vorzugsweise handelt es sich um Hydrolyseprodukte mit mittleren Molmassen im Bereich von 400 bis 500 000 g/mol. Dabei ist ein Polysaccharid mit einem Dextrose-Äquivalent (DE) im Bereich von 0,5 bis 40, insbesondere von 2 bis 30 bevorzugt, wobei DE ein gebräuchliches Maß für die reduzierende Wirkung eines Polysaccharids im Vergleich zu Dextrose ist, welche ein DE von 100 besitzt. Brauchbar sind sowohl Maltodextrine mit einem DE zwischen 3 und 20 und Trockenglucosesirupe mit einem DE zwischen 20 und 37 als auch sogenannte Gelbdextrine und Weißdextrine mit höheren Molmassen im Bereich von 2 000 bis 30 000 g/mol.
Bei den oxidierten Derivaten derartiger Dextrine handelt es sich um deren Umsetzungsprodukte mit Oxidationsmitteln, welche in der Lage sind, mindestens eine Alkoholfunktion des Saccharidrings zur Carbonsäurefunktion zu oxidieren. Besonders bevorzugte organische Builder für erfindungsgemäße Mittel sind oxidierte Stärken, beziehungsweise deren Derivate aus den Anmeldungen EP 472 042, WO 97/25399, und EP 755 944.
Auch Oxydisuccinate und andere Derivate von Disuccinaten, vorzugsweise Ethylendiamindisuccinat, sind weitere geeignete Cobuilder. Dabei wird Ethylendiamin-N,N'- disuccinat (EDDS) bevorzugt in Form seiner Natrium- oder Magnesiumsalze verwendet. Weiterhin bevorzugt sind in diesem Zusammenhang auch Glycerindisuccinate und Glycerintrisuccinate. Geeignete Einsatzmengen liegen in zeolithhaltigen und/oder silicathaltigen Formulierungen zwischen 3 und 15 Gew.-%.
Weitere brauchbare organische Cobuilder sind beispielsweise acetylierte Hydroxycarbonsäuren beziehungsweise deren Salze, welche gegebenenfalls auch in Lactonform vorliegen können und welche mindestens 4 Kohlenstoffatome und mindestens eine Hydroxygruppe sowie maximal zwei Säuregruppen enthalten.
Eine weitere Substanzklasse mit Cobuildereigenschaften stellen die Phosphonate dar. Dabei handelt es sich insbesondere um Hydroxyalkan- beziehungsweise Aminoalkanphosphonate. Unter den Hydroxyalkanphosphonaten ist das 1-Hydroxyethan-1 ,1-diphosphonat (HEDP) von besonderer Bedeutung als Cobuilder. Es wird vorzugsweise als Natriumsalz eingesetzt, wobei das Dinatriumsalz neutral und das Tetranatriumsalz alkalisch (pH 9) reagiert. Als Aminoalkanphosphonate kommen vorzugsweise Ethylendiamintetramethylenphosphonat (EDTMP), Diethylentriaminpentamethylenphosphonat (DTPMP) sowie deren höhere Homologe in Frage. Sie werden vorzugsweise in Form der neutral reagierenden Natriumsalze, zum Beispiel als Hexanatriumsalz der EDTMP beziehungsweise als Hepta- und Octa-Natriumsalz der DTPMP, eingesetzt. Als Builder wird dabei aus der Klasse der Phosphonate bevorzugt HEDP verwendet. Die Aminoalkanphosphonate besitzen zudem ein ausgeprägtes Schwermetallbindevermögen. Dementsprechend kann es, insbesondere wenn die Mittel auch Bleiche enthalten, bevorzugt sein, Aminoalkanphosphonate, insbesondere DTPMP, einzusetzen, oder Mischungen aus den genannten Phosphonaten zu verwenden.
Darüberhinaus können alle Verbindungen, die in der Lage sind, Komplexe mit Erdalkaliionen auszubilden, als Cobuilder eingesetzt werden.
Buildersubstanzen können in den erfindungsgemäßen Mitteln gegebenenfalls in Mengen bis zu 90 Gew.-% enthalten sein. Sie sind vorzugsweise in Mengen bis zu 75 Gew.-% enthalten. Erfindungsgemäße Waschmittel weisen Buildergehalte von insbesondere 5 Gew.-% bis 50 Gew.-% auf. In erfindungsgemäßen Mitteln für die Reinigung harter Oberflächen, insbesondere zur maschinellen Reinigung von Geschirr, beträgt der Gehalt an Buildersubstanzen insbesondere 5 Gew.-% bis 88 Gew.-%, wobei in derartigen Mitteln vorzugsweise keine wasserunlöslichen Buildermaterialien eingesetzt werden. In einer bevorzugten Ausführungsform erfindungsgemäßer Mittel zur insbesondere maschinellen Reinigung von Geschirr sind 20 Gew.-% bis 40 Gew.-% wasserlöslicher organischer Builder, insbesondere Alkalicitrat, 5 Gew.-% bis 15 Gew.-% Alkalicarbonat und 20 Gew.-% bis 40 Gew.-% Alkalidisilikat enthalten.
Lösungsmittel, die in den flüssigen bis gelförmigen Zusammensetzungen von Wasch- und Reinigungsmitteln eingesetzt werden können, stammen beispielsweise aus der Gruppe ein- oder mehrwertigen Alkohole, Alkanolamine oder Glycolether, sofern sie im angegebenen Konzentrationsbereich mit Wasser mischbar sind. Vorzugsweise werden die Lösungsmittel ausgewählt aus Ethanol, n- oder i-Propanol, Butanolen, Ethylenglykolmethylether, Ethylenglykolethylether, Ethylenglykolpropylether, Ethylenglykolmono-n-butylether, Diethylenglykol- methylether, Diethylenglykolethylether, Propylenglykolmethyl-, -ethyl- oder -propyl-ether, Dipropylenglykolmonomethyl-, oder -ethylether, Di-isopropylenglykolmonomethyl-, oder -ethylether, Methoxy-, Ethoxy- oder Butoxytriglykol, 1-Butoxyethoxy-2-propanol, 3-Methyl-3-methoxybutanol, Propylen-glykol-t-buty lether sowie Mischungen dieser Lösungsmittel.
Lösungsmittel können in den erfindungsgemäßen flüssigen bis gelförmigen Wasch- und Reinigungsmitteln in Mengen zwischen 0,1 und 20 Gew.-%, bevorzugt aber unter 15 Gew.-% und insbesondere unterhalb von 10 Gew.-% eingesetzt werden.
Zur Einstellung der Viskosität können erfindungsgemäßen Zusammensetzungen ein oder mehrere Verdicker, beziehungsweise Verdickungssysteme zugesetzt werden. Diese hochmolekularen Stoffe, die auch Quell(ungs)mittel genannt werden, saugen meist die Flüssigkeiten auf und quellen dabei auf, um schließlich in zähflüssige echte oder kolloide Lösungen überzugehen.
Geeignete Verdicker sind anorganische oder polymere organische Verbindungen. Zu den anorganischen Verdickern zählen beispielsweise Polykieselsäuren, Tonmineralien wie Montmorillonite, Zeolithe, Kieselsäuern und Bentonite. Die organischen Verdicker stammen aus den Gruppen der natürlichen Polymere, der abgewandelten natürlichen Polymere und der vollsynthetischen Polymere. Solche aus der Natur stammenden Polymere sind beispielsweise Agar-Agar, Carrageen, Tragant, Gummi arabicum, Alginate, Pektine, Polyosen, Guar-Mehl, Johannisbrotbaumkernmehl, Stärke, Dextrine, Gelatine und Casein. Abgewandelte Naturstoffe, die als Verdicker verwendet werden, stammen vor allem aus der Gruppe der modifizierten Stärken und Cellulosen. Beispielhaft seien hier Carboxymethylcellulose und andere Celluloseether, Hydroxyethyl- und -propylcellulose sowie Kernmehlether genannt. Vollsynthetische Verdicker sind Polymere wie Polyacryl- und Polymethacryl-Verbindungen, Vinylpolymere, Polycarbonsäuren, Polyether, Polyimine, Polyamide und Polyurethane.
Die Verdicker können in einer Menge bis zu 5 Gew.-%, vorzugsweise von 0,05 bis 2 Gew.-%, und besonders bevorzugt von 0,1 bis 1,5 Gew.-%, bezogen auf die fertige Zusammensetzung, enthalten sein.
Das erfindungsgemäße Wasch- oder Reinigungsmittel kann gegebenenfalls als weitere übliche Inhaltsstoffe Sequestrierungsmittel, Elektrolyte und weitere Hilfsstoffe enthalten.
Erfindungsgemäße Textilwaschmittel können als optische Aufheller Derivate der Diaminostilbendisulfonsäure beziehungsweise deren Alkalimetallsalze enthalten. Geeignet sind zum Beispiel Salze der 4,4'-Bis(2-anilino-4-morpholino-1 ,3,5-triazinyl-6-amino)stilben-2,2'- disulfonsäure oder gleichartig aufgebaute Verbindungen, die anstelle der Morpholino-Gruppe eine Diethanolaminogruppe, eine Methylaminogruppe, eine Anilinogruppe oder eine 2- Methoxyethylaminogruppe tragen. Weiterhin können Aufheller vom Typ der substituierten Diphenylstyryle anwesend sein, zum Beispiel die Alkalisalze des 4,4'-Bis(2-sulfostyryl)-diphenyls, 4,4'-Bis(4-chlor-3-sulfostyryl)-diphenyls, oder 4-(4-Chlorstyryl)-4'-(2-sulfostyryl)-diphenyls. Auch Gemische der vorgenannten optischen Aufheller können verwendet werden.
Vergrauungsinhibitoren haben die Aufgabe, den von der Textilfaser abgelösten Schmutz in der Flotte suspendiert zu halten. Hierzu sind wasserlösliche Kolloide meist organischer Natur geeignet, beispielsweise Stärke, Leim, Gelatine, Salze von Ethercarbonsäuren oder Ethersulfonsäuren der Stärke oder der Cellulose oder Salze von sauren Schwefelsäureestern der Cellulose oder der Stärke. Auch wasserlösliche, saure Gruppen enthaltende Polyamide sind für diesen Zweck geeignet. Weiterhin lassen sich andere als die obengenannten Stärkederivate verwenden, zum Beispiel Aldehydstärken. Bevorzugt werden Celluloseether, wie Carboxymethylcellulose (Na-SaIz), Methylcellulose, Hydroxyalkylcellulose und Mischether, wie Methylhydroxyethylcellulose, Methyl- hydroxypropylcellulose, Methylcarboxymethylcellulose und deren Gemische, beispielsweise in Mengen von 0,1 bis 5 Gew.-%, bezogen auf die Mittel, eingesetzt.
Um einen Silberkorrosionsschutz zu bewirken, können in erfindungsgemäßen Reinigungsmitteln für Geschirr Silberkorrosionsinhibitoren eingesetzt werden. Solche sind aus dem Stand der Technik bekannt, beispielsweise Benzotriazole, Eisen(lll)-chlorid oder CoSO4. Wie beispielsweise aus der europäischen Patentschrift EP 0 736 084 B1 bekannt ist, sind für die gemeinsame Verwendung mit Enzymen besonders geeignete Silberkorrosionsinhibitoren Mangan-, Titan-, Zirkonium-, Hafnium-, Vanadium-, Cobalt- oder Cersalze und/oder -komplexe, in denen die genannten Metalle in einer der Oxidationsstufen II, III, IV, V oder VI vorliegen. Beispiele für derartige Verbindungen sind MnSO4, V2O5, V2O4, VO2, TiOSO4, K2TiF6, K2ZrF6, Co(N03)2, Co(NO3)3l sowie deren Gemische.
"Soil-Release"-Wirkstoffe oder "Soil-Repellents" sind zumeist Polymere, die bei der Verwendung in einem Waschmittel der Wäschefaser schmutzabstoßende Eigenschaften verleihen und/oder das Schmutzablösevermögen der übrigen Waschmittelbestandteile unterstützen. Ein vergleichbarer Effekt kann auch bei deren Einsatz in Reinigungsmitteln für harte Oberflächen beobachtet werden.
Besonders wirksame und seit langer Zeit bekannte Soil-Release-Wirkstoffe sind Copolyester mit Dicarbonsäure-, Alkylenglykol- und Polyalkylenglykoleinheiten. Beispiele dafür sind Copolymere oder Mischpolymere aus Polyethylenterephthalat und Polyoxyethylenglykol (DT 16 17 141 , beziehungsweise DT 22 OO 911 ). In der deutschen Offenlegungsschrift DT 22 53 063 sind saure Mittel genannt, die unter anderem ein Copolymer aus einer dibasigen Carbonsäure und einem Alkylen- oder Cycloalkylenpolyglykol enthalten. Polymere aus Ethylenterephthalat und Polyethylenoxid-terephthalat und deren Einsatz in Waschmitteln sind in den deutschen Schriften DE 28 57 292 und DE 33 24 258 und der Europäischen Patentschrift EP O 253 567 beschrieben. Das europäische Patent EP 066 944 betrifft Mittel, die einen Copolyester aus Ethylenglykol, Polyethylenglykol, aromatischer Dicarbonsäure und sulfonierter aromatischer Dicarbonsäure in bestimmten Molverhältnissen enthalten. Aus dem europäischen Patent EP 0 185 427 sind Methyloder Ethylgruppen-endverschlossene Polyester mit Ethylen- und/oder Propylen-terephthalat- und Polyethylenoxid-terephthalat-Einheiten und Waschmitel, die derartiges Soil-release-Polymer enthalten, bekannt. Das europäische Patent EP 0 241 984 betrifft einen Polyester, der neben Oxyethylen-Gruppen und Terephthalsäureeinheiten auch substituierte Ethyleneinheiten sowie Glycerineinheiten enthält. Aus dem europäischen Patent EP 0 241 985 sind Polyester bekannt, die neben Oxyethylen-Gruppen und Terephthalsäureeinheiten 1 ,2-Propylen-, 1 ,2-Butylen- und/oder 3- Methoxy-1 ,2-propylengruppen sowie Glycerineinheiten enthalten und mit C1- bis C4-Alkylgruppen endgruppenverschlossen sind. Aus der europäischen Patentanmeldung EP 0 272 033 sind zumindest anteilig durch C^-Alkyl- oder Acylreste endgruppenverschlossene Polyester mit PoIy- propylenterephthalat- und Polyoxyethylenterephthalat-Einheiten bekannt. Das europäische Patent EP 0 274 907 beschreibt sulfoethyl-endgruppenverschlossene terephthalathaltige Soil-release- Polyester. Gemäß der europäischen Patentanmeldung EP 0 357 280 werden durch Sulfonierung ungesättigter Endgruppen Soil-Release-Polyester mit Terephthalat-, Alkylenglykol- und PoIy-C2-4- Glykol-Einheiten hergestellt. Die internationale Patentanmeldung WO 95/32232 betrifft saure, aromatische schmutzablösevermögende Polyester. Aus der internationalen Patentanmeldung WO 97/31085 sind nicht polymere soil-repellent-Wirkstoffe für Materialien aus Baumwolle mit mehreren funktionellen Einheiten bekannt: Eine erste Einheit, die beispielsweise kationisch sein kann, ist zur Adsorption auf die Baumwolloberfläche durch elektrostatische Wechselwirkung befähigt, und eine zweite Einheit, die hydrophob ausgebildet ist, ist verantwortlich für das Verbleiben des Wirkstoffs an der Wasser/ Baumwolle-Grenzfläche.
Zu den für den Einsatz in erfindungsgemäßen Textilwaschmitteln in Frage kommenden Farb- übertragungsinhibitoren gehören insbesondere Polyvinylpyrrolidone, Polyvinylimidazole, polymere N-Oxide wie Poly-(vinylpyridin-N-oxid) und Copolymere von Vinylpyrrolidon mit Vinylimidazol.
Beim Einsatz in maschinellen Reinigungsverfahren kann es von Vorteil sein, den Mitteln Schauminhibitoren zuzusetzen. Als Schauminhibitoren eignen sich beispielsweise Seifen natürlicher oder synthetischer Herkunft, die einen hohen Anteil an Ci8-C24-Fettsäuren aufweisen. Geeignete nichttensidartige Schauminhibitoren sind beispielsweise Organopolysiloxane und deren Gemische mit mikrofeiner, gegebenenfalls signierter Kieselsäure sowie Paraffine, Wachse, Mikrokristallinwachse und deren Gemische mit silanierter Kieselsäure oder Bistearylethylendiamid. Mit Vorteilen werden auch Gemische aus verschiedenen Schauminhibitoren verwendet, zum Beispiel solche aus Silikonen, Paraffinen oder Wachsen. Vorzugsweise sind die Schauminhibitoren, insbesondere Silikon- und/oder Paraffin-haltige Schauminhibitoren, an eine granuläre, in Wasser lösliche, beziehungsweise dispergierbare Trägersubstanz gebunden. Insbesondere sind dabei Mischungen aus Paraffinen und Bistearylethylendiamiden bevorzugt. Ein erfindungsgemäßes Reinigungsmittel für harte Oberflächen kann darüber hinaus abrasiv wirkende Bestandteile, insbesondere aus der Gruppe umfassend Quarzmehle, Holzmehle, Kunststoffmehle, Kreiden und Mikroglaskugeln sowie deren Gemische, enthalten. Abrasivstoffe sind in den erfindungsgemäßen Reinigungsmitteln vorzugsweise nicht über 20 Gew.-%, insbesondere von 5 Gew.-% bis 15 Gew.-%, enthalten.
Färb- und Duftstoffe werden Wasch- und Reinigungsmitteln zugesetzt, um den ästhetischen Eindruck der Produkte zu verbessern und dem Verbraucher neben der Wasch- und Reinigungsleistung ein visuell und sensorisch "typisches und unverwechselbares" Produkt zur Verfügung zu stellen. Als Parfümöle beziehungsweise Duftstoffe können einzelne Riechstoffverbindungen, zum Beispiel die synthetischen Produkte vom Typ der Ester, Ether, Aldehyde, Ketone, Alkohole und Kohlenwasserstoffe verwendet werden. Riechstoffverbindungen vom Typ der Ester sind zum Beispiel Benzylacetat, Phenoxyethylisobutyrat, p-tert- Butylcyclohexylacetat, Linalylacetat, Dimethylbenzyl-carbinylacetat, Phenylethylacetat, Linalylbenzoat, Benzylformiat, Ethylmethylphenyl-glycinat, Allylcyclohexylpropionat, Styrallylpropionat und Benzylsalicylat. Zu den Ethern zählen beispielsweise Benzylethylether, zu den Aldehyden zum Beispiel die linearen Alkanale mit 8-18 C-Atomen, Citral, Citronellal, Citronellyloxyacetaldehyd, Cyclamenaldehyd, Hydroxycitronellal, Lilial und Bourgeonal, zu den Ketonen zum Beispiel die Jonone, α-lsomethylionon und Methyl-cedrylketon, zu den Alkoholen Anethol, Citronellol, Eugenol, Geraniol, Linalool, Phenylethylalkohol und Terpineol, zu den Kohlenwasserstoffen gehören hauptsächlich die Terpene wie Limonen und Pinen. Bevorzugt werden jedoch Mischungen verschiedener Riechstoffe verwendet, die gemeinsam eine ansprechende Duftnote erzeugen. Solche Parfümöle können auch natürliche Riechstoffgemische enthalten, wie sie aus pflanzlichen Quellen zugänglich sind, zum Beispiel Pine-, Citrus-, Jasmin-, Patchouly-, Rosen- oder Ylang-Ylang-Öl. Ebenfalls geeignet sind Muskateller, Salbeiöl, Kamillenöl, Nelkenöl, Melissenöl, Minzöl, Zimtblätteröl, Lindenblütenöl, Wacholderbeeröl, Vetiveröl, Olibanumöl, Galbanumöl und Labdanumöl sowie Orangenblütenöl, Neroliol, Orangenschalenöl und Sandelholzöl. Üblicherweise liegt der Gehalt von Wasch- und Reinigungsmitteln an Farbstoffen unter 0,01 Gew.-%, während Duftstoffe bis zu 2 Gew.-% der gesamten Formulierung ausmachen können.
Die Duftstoffe können direkt in die Wasch- und Reinigungsmittel eingearbeitet werden, es kann aber auch vorteilhaft sein, die Duftstoffe auf Träger aufzubringen, die die Haftung des Parfüms auf dem Reinigungsgut verstärken und durch eine langsamere Duftfreisetzung für langanhaltenden Duft, insbesondere von behandelten Textilien sorgen. Als solche Trägermaterialien haben sich beispielsweise Cyclodextrine bewährt, wobei die Cyclodextrin-Parfüm-Komplexe zusätzlich noch mit weiteren Hilfsstoffen beschichtet werden können. Ein weiter bevorzugter Träger für Duftstoffe ist der beschriebene Zeolith X, der anstelle von oder in Mischung mit Tensiden auch Duftstoffe aufnehmen kann. Bevorzugt sind daher Wasch- und Reinigungsmittel, die den beschriebenen Zeolith X und Duftstoffe, die vorzugsweise zumindest teilweise an dem Zeolithen absorbiert sind, enthalten.
Bevorzugte Farbstoffe, deren Auswahl dem Fachmann keinerlei Schwierigkeit bereitet, besitzen eine hohe Lagerstabilität und Unempfindlichkeit gegenüber den übrigen Inhaltsstoffen der Mittel und gegen Licht sowie keine ausgeprägte Substantivität gegenüber Textilfasern, um diese nicht anzufärben.
Zur Bekämpfung von Mikroorganismen können Wasch- oder Reinigungsmittel antimikrobielle Wirkstoffe enthalten. Hierbei unterscheidet man je nach antimikrobiellem Spektrum und Wirkungsmechanismus zwischen Bakteriostatika und Bakteriziden, Fungistatika und Fungiziden usw. Wichtige Stoffe aus diesen Gruppen sind beispielsweise Benzalkoniumchloride, Alkylarylsulfonate, Halogenphenole und Phenolmercuriacetat. Die Begriffe antimikrobielle Wirkung und antimikrobieller Wirkstoff haben im Rahmen der erfindungsgemäßen Lehre die fachübliche Bedeutung, die beispielsweise von K. H. Wallhäußer in „Praxis der Sterilisation, Desinfektion - Konservierung : Keimidentifizierung - Betriebshygiene" (5. Aufl. - Stuttgart; New York : Thieme, 1995) wiedergegeben wird, wobei alle dort beschriebenen Substanzen mit antimikrobieller Wirkung eingesetzt werden können. Geeignete antimikrobielle Wirkstoffe sind vorzugsweise ausgewählt aus den Gruppen der Alkohole, Amine, Aldehyde, antimikrobiellen Säuren beziehungsweise deren Salze, Carbonsäureester, Säureamide, Phenole, Phenolderivate, Diphenyle, Diphenylalkane, Harnstoffderivate, Sauerstoff-, Stickstoff-acetale sowie -formale, Benzamidine, Isothiazoline, Phthalimidderivate, Pyridinderivate, antimikrobiellen oberflächenaktiven Verbindungen, Guanidine, antimikrobiellen amphoteren Verbindungen, Chinoline, 1 ,2-Dibrom-2,4-dicyanobutan, lodo-2- propyl-butyl-carbamat, lod, lodophore, Peroxoverbindungen, Halogenverbindungen sowie beliebigen Gemischen der voranstehenden.
Der antimikrobielle Wirkstoff kann dabei ausgewählt sein aus Ethanol, n-Propanol, i-Propanol, 1 ,3- Butandiol, Phenoxyethanol, 1 ,2-Propylenglykol, Glycerin, Undecylensäure, Benzoesäure, Salicylsäure, Dihydracetsäure, o-Phenylphenol, N-Methylmorpholin-acetonitril (MMA), 2-Benzyl-4- chlorphenol, 2,2'-Methylen-bis-(6-brom-4-chlorphenol), 4,4'-Dichlor-2'-hydroxydiphenylether (Dichlosan), 2,4,4'-Trichlor-2'-hydroxydiphenylether (Trichlosan), Chlorhexidin, N-(4-Chlorphenyl)- N-(3,4-dichlorphenyl)-harnstoff, N,N'-(1 ,10-decan-diyldi-1-pyridinyl-4-yliden)-bis-(1-octanamin)- dihydrochlorid, N.N'-Bis-^-chlorphenyO-S.IΣ-diimino^AI I .IS-tetraaza-tetradecandiimidamid, Glucoprotaminen, antimikrobiellen oberflächenaktiven quaternären Verbindungen, Guanidinen einschl. den Bi- und Polyguanidinen, wie beispielsweise 1 ,6-Bis-(2-ethylhexyl-biguanido-hexan)- dihydrochlorid, 1 , 6-Di-(N1, N^-phenyldiguanido-Ns.Ns'Hiexan-tetrahydochlorid, 1 ,6-Di-(N11N1'-
Figure imgf000036_0001
chlorophenyldiguanido- N5,N5')-hexan-dihydrochlorid, 1 ,6-Di-(N1, NV^.δ-dichlorophenyldiguanido- N5,N5')hexan-dihydrochlorid, 1 ,6-Di-[N1, N^-beta-fp-methoxyphenyl) diguanido-N5,N5']-hexane- dihydrochlorid, 1 , 6-Di-(N1, N^-alpha-methyl-.beta.-phenyldiguanido-Ns.Ns^-hexan-dihydrochlorid, 1 , 6-Di-(N1, N^-p-nitrophenyldiguanido-Ns.Ns^hexan-dihydrochlorid, omega:omega-Di-( N11N1'- phenyldiguanido-N5,N5')-di-n-propylether-dihydrochlorid, omegaiomega'-DKNLNi'-p- chlorophenyldiguanido-N5,N5')-di-n-propylether-tetrahydrochlorid, 1 , 6-Di-(N1, N^-2,4- dichlorophenyldiguanido-Ns,N5')hexan-tetrahydrochlorid, 1 , 6-Di-(N1, N^-p-methylphenyldiguanido- N5,N5')hexan-dihydrochlorid, 1 ,6-Di-(N11N1'^, 4, 5-trichlorophenyldiguanido-N5,N5')hexan- tetrahydrochlorid, 1 , 6-Di-[N1, N^-alpha-φ-chlorophenyl) ethyldiguanido-N5,N5'] hexan- dihydrochlorid, omegaOmega-DKN^NT'-p-chlorophenyldiguanido-Ns.Ns'Jm-xylene-dihydrochlorid, 1 , 12-Di-(N1, N^-p-chlorophenyldiguanido-Ns.Ns') dodecan-dihydrochlorid, 1 ,10-Di-(N11N1'- phenyldiguanido- N5,N5')-decan-tetrahydrochlorid, 1 , 12-Di-(N1, N^-phenyldiguanido- N51N5') dodecan-tetrahydrochlorid, 1 ,6-Di-(N1, N^-o-chlorophenyldiguanido- N51N5') hexan-dihydrochlorid, 1 , 6-Di-(N1, N^-o-chlorophenyldiguanido- N51N5') hexan-tetrahydrochlorid, Ethylen-bis-(1 -tolyl biguanid), Ethylen-bis-(p-tolyl biguanide), Ethylen-bis-(3,5-dimethylphenylbiguanid), Ethylen-bis-(p- tert-amylphenylbiguanid), Ethylen-bis-(nonylphenylbiguanid), Ethylen-bis-(phenylbiguanid), Ethylen-bis-(N-butylphenylbiguanid), Ethylen-bis (2,5-diethoxyphenylbiguanid), Ethylen-bis (2,4- dimethylphenyl biguanid), Ethylen-bis (o-diphenylbiguanid), Ethylen-bis (mixed amyl naphthylbiguanid), N-Butyl-ethylen-bis-(phenylbiguanid), Trimethylen bis (o-tolylbiguanid), N-Butyl- trimethyle- bis-(phenyl biguanide) und die entsprechenden Salze wie Acetate, Gluconate, Hydrochloride, Hydrobromide, Citrate, Bisulfite, Fluoride, Polymaleate, N-Cocosalkylsarcosinate, Phosphite, Hypophosphite, Perfluorooctanoate, Silicate, Sorbate, Salicylate, Maleate, Tartrate, Fumarate, Ethylendiamintetraacetate, Iminodiacetate, Cinnamate, Thiocyanate, Arginate, Pyromellitate, Tetracarboxybutyrate, Benzoate, Glutarate, Monofluorphosphate, Perfluorpropionate sowie beliebige Mischungen davon. Weiterhin eignen sich halogenierte XyIoI- und Kresolderivate, wie p-Chlormetakresol oder p-Chlor-meta-xylol, sowie natürliche antimikrobielle Wirkstoffe pflanzlicher Herkunft (zum Beispiel aus Gewürzen oder Kräutern), tierischer sowie mikrobieller Herkunft. Vorzugsweise können antimikrobiell wirkende oberflächenaktive quaternäre Verbindungen, ein natürlicher antimikrobieller Wirkstoff pflanzlicher Herkunft und/oder ein natürlicher antimikrobieller Wirkstoff tierischer Herkunft, äußerst bevorzugt mindestens ein natürlicher antimikrobieller Wirkstoff pflanzlicher Herkunft aus der Gruppe, umfassend Coffein, Theobromin und Theophyllin sowie etherische öle wie Eugenol, Thymol und Geraniol, und/oder mindestens ein natürlicher antimikrobieller Wirkstoff tierischer Herkunft aus der Gruppe, umfassend Enzyme wie Eiweiß aus Milch, Lysozym und Lactoperoxidase, und/oder mindestens eine antimikrobiell wirkende oberflächenaktive quaternäre Verbindung mit einer Ammonium-, Sulfonium-, Phosphonium-, lodonium- oder Arsoniumgruppe, Peroxoverbindungen und Chlorverbindungen eingesetzt werden. Auch Stoffe mikrobieller Herkunft, sogenannte Bakteriozine, können eingesetzt werden.
Die als antimikrobielle Wirkstoffe geeigneten quaternären Ammoniumverbindungen (QAV) weisen die allgemeine Formel (R1)(R2)(R3)(R4) N+ X" auf, in der R1 bis R4 gleiche oder verschiedene C1- C22-Alkylreste, C7-C28-Aralkylreste oder heterozyklische Reste, wobei zwei oder im Falle einer aromatischen Einbindung wie im Pyridin sogar drei Reste gemeinsam mit dem Stickstoffatom den Heterozyklus, zum Beispiel eine Pyridinium- oder Imidazoliniumverbindung, bilden, darstellen und X" Halogenidionen, Sulfationen, Hydroxidionen oder ähnliche Anionen sind. Für eine optimale antimikrobielle Wirkung weist vorzugsweise wenigstens einer der Reste eine Kettenlänge von 8 bis 18, insbesondere12 bis 16, C-Atomen auf.
QAV sind durch Umsetzung tertiärer Amine mit Alkylierungsmitteln, wie zum Beispiel Methylchlorid, Benzylchlorid, Dimethylsulfat, Dodecylbromid, aber auch Ethylenoxid herstellbar. Die Alkylierung von tertiären Aminen mit einem langen Alkyl-Rest und zwei Methyl-Gruppen gelingt besonders leicht, auch die Quaternierung von tertiären Aminen mit zwei langen Resten und einer Methyl- Gruppe kann mit Hilfe von Methylchlorid unter milden Bedingungen durchgeführt werden. Amine, die über drei lange Alkyl-Reste oder Hydroxy-substituierte Alkyl-Reste verfügen, sind wenig reaktiv und werden bevorzugt mit Dimethylsulfat quaterniert.
Geeignete QAV sind beispielweise Benzalkoniumchlorid (N-Alkyl-N,N-dimethyl-benzyl-am- moniumchlorid, CAS No. 8001-54-5), Benzalkon B (m,p-Dichlorbenzyl-dimethyl-C12-alkyl- ammoniumchlorid, CAS No. 58390-78-6), Benzoxoniumchlorid (Benzyl-dodecyl-bis-(2-hy- droxyethyl)-ammonium-chlorid), Cetrimoniumbromid (N-Hexadecyl-N,N-trimethyl-ammonium- bromid, CAS No. 57-09-0), Benzetoniumchlorid (N,N-Dimethyl-N-[2-[2-[p-(1 ,1 ,3,3-tetramethylbutyl)- pheno-xy]ethoxy]ethyl]-benzylammoniumchlorid, CAS No. 121-54-0), Dialkyldimethylammonium- chloride wie Di-n-decyl-dimethyl-ammoniumchlorid (CAS No. 7173-51-5-5), Didecyldi- methylammoniumbromid (CAS No. 2390-68-3), Dioctyl-dimethyl-ammoniumchloric, 1- Cetylpyridiniumchlorid (CAS No. 123-03-5) und Thiazoliniodid (CAS No. 15764-48-1) sowie deren Mischungen. Besonders bevorzugte QAV sind die Benzalkoniumchloride mit C8-C18-Alkylresten, insbesondere C^-C^-Aklyl-benzyl-dimethyl-ammoniumchlorid.
Benzalkoniumhalogenide und/oder substituierte Benzalkoniumhalogenide sind beispielsweise kommerziell erhältlich als Barquat® ex Lonza, Marquat® ex Mason, Variquat® ex Witco/ Sherex und Hyamine® ex Lonza, sowie Bardac® ex Lonza. Weitere kommerziell erhältliche antimikrobielle Wirkstoffe sind N-(3-Chlorallyl)-hexaminiumchlorid wie Dowicide® und Dowicil® ex Dow, Benzethoniumchlorid wie Hyamine® 1622 ex Rohm & Haas, Methylbenzethoniumchlorid wie Hyamine® 1OX ex Rohm & Haas, Cetylpyridiniumchlorid wie Cepacolchlorid ex Merrell Labs.
Die antimikrobiellen Wirkstoffe werden in Mengen von 0,0001 Gew.-% bis 1 Gew.-%, bevorzugt von 0,001 Gew.-% bis 0,8 Gew.-%, besonders bevorzugt von 0,005 Gew.-% bis 0,3 Gew.-% und insbesondere von 0,01 bis 0,2 Gew.-% eingesetzt.
Die Mittel können UV-Absorbenzien (UV-Absorber) enthalten, die auf die behandelten Textilien aufziehen und die Lichtbeständigkeit der Fasern und/oder die Lichtbeständigkeit sonstiger Rezepturbestandteile verbessern. Unter UV-Absorber sind organische Substanzen (Lichtschutzfilter) zu verstehen, die in der Lage sind, ultraviolette Strahlen zu absorbieren und die aufgenommene Energie in Form langerwelliger Strahlung, zum Beispiel Wärme wieder abzugeben.
Verbindungen, die diese gewünschten Eigenschaften aufweisen, sind beispielsweise die durch strahlungslose Desaktivierung wirksamen Verbindungen und Derivate des Benzophenons mit Substituenten in 2- und/oder 4-Stellung. Weiterhin sind auch substituierte Benzotriazole, in 3- Stellung Phenylsubstituierte Acrylate (Zimtsäurederivate, gegebenenfalls mit Cyanogruppen in 2- Stellung), Salicylate, organische Ni-Komplexe sowie Naturstoffe wie Umbelliferon und die körpereigene Urocansäure geeignet. Besondere Bedeutung haben Biphenyl- und vor allem Stilbenderivate wie sie beispielsweise in der EP 0728749 A beschrieben werden und kommerziell als Tinosorb® FD oder Tinosorb® FR ex Ciba erhältlich sind. Als UV-B-Absorber sind zu nennen: 3- Benzylidencampher beziehungsweise 3-Benzylidennorcampher und dessen Derivate, zum Beispiel 3-(4-Methylbenzyliden)campher, wie in der EP 0693471 B1 beschrieben; 4- Aminobenzoesäurederivate, vorzugsweise 4-(Dimethylamino)benzoesäure-2-ethylhexylester, 4- (Dimethylamino)benzoesäure-2-octylester und 4-(Dimethylamino)benzoesäureamylester; Ester der Zimtsäure, vorzugsweise 4-Methoxyzimtsäure-2-ethylhexylester, 4-Methoxyzimtsäurepropylester, 4-Methoxyzimtsäureisoamylester, 2-Cyano-3,3-phenylzimtsäure-2-ethylhexylester (Octocrylene); Ester der Salicylsäure, vorzugsweise Salicylsäure-2-ethylhexylester, Salicylsäure-4-isopropylben- zylester, Salicylsäurehomomenthylester; Derivate des Benzophenons, vorzugsweise 2-Hydroxy-4- methoxybenzophenon, 2-Hydroxy-4-methoxy-4'-methylbenzophenon, 2,2'-Dihydroxy-4- methoxybenzophenon; Ester der Benzalmalonsäure, vorzugsweise 4-Methoxybenzmalonsäuredi- 2-ethylhexylester; Triazinderivate, wie zum Beispiel 2,4,6-Trianilino-(p-carbo-2'-ethyl-1 '-hexyloxy)- 1 ,3,5-triazin und Octyl Triazon, wie in der EP 0818450 A1 beschrieben oder Dioctyl Butamido Triazone (Uvasorb® HEB); Propan-1 ,3-dione, wie zum Beispiel 1-(4-tert.Butylphenyl)-3- (4'methoxyphenyl)propan-1 ,3-dion; Ketotricyclo(5.2.1.0)decan-Derivate, wie in der EP 0694521 B1 beschrieben. Weiterhin geeignet sind 2-Phenylbenzimidazol-5-sulfonsäure und deren Alkali-, Erdalkali-, Ammonium-, Alkylammonium-, Alkanolammonium- und Glucammoniumsalze; Sulfonsäurederivate von Benzophenonen, vorzugsweise 2-Hydroxy-4-methoxybenzophenon-5- sulfonsäure und ihre Salze; Sulfonsäurederivate des 3-Benzylidencamphers, wie zum Beispiel 4- (2-Oxo-3-bornylidenmethyl)benzol-sulfonsäure und 2-Methyl-5-(2-oxo-3-bornyliden)sulfonsäure und deren Salze.
Als typische UV-A-Filter kommen insbesondere Derivate des Benzoylmethans in Frage, wie beispielsweise 1-(4'-tert.Butylphenyl)-3-(4'-methoxyphenyl)propan-1 ,3-dion, 4-tert.-Butyl-4'- methoxydibenzoylmethan (Parsol 1789), 1-Phenyl-3-(4'-isopropylphenyl)-propan-1 ,3-dion sowie Enaminverbindungen, wie beschrieben in der DE 19712033 A1 (BASF). Die UV-A und UV-B-Filter können selbstverständlich auch in Mischungen eingesetzt werden. Neben den genannten löslichen Stoffen kommen für diesen Zweck auch unlösliche Lichtschutzpigmente, nämlich feindisperse, vorzugsweise nanoisierte Metalloxide beziehungsweise Salze in Frage. Beispiele für geeignete Metalloxide sind insbesondere Zinkoxid und Titandioxid und daneben Oxide des Eisens, Zirkoniums, Siliciums, Mangans, Aluminiums und Cers sowie deren Gemische. Als Salze können Silicate (Talk), Bariumsulfat oder Zinkstearat eingesetzt werden. Die Oxide und Salze werden in Form der Pigmente bereits für hautpflegende und hautschützende Emulsionen und dekorative Kosmetik verwendet. Die Partikel sollten dabei einen mittleren Durchmesser von weniger als 100 nm, vorzugsweise zwischen 5 und 50 nm und insbesondere zwischen 15 und 30 nm aufweisen. Sie können eine sphärische Form aufweisen, es können jedoch auch solche Partikel zum Einsatz kommen, die eine ellipsoide oder in sonstiger Weise von der sphärischen Gestalt abweichende Form besitzen. Die Pigmente können auch oberflächenbehandelt, d.h. hydrophilisiert oder hydrophobiert vorliegen. Typische Beispiele sind ummantelte Titandioxide, wie zum Beispiel Titandioxid T 805 (Degussa) oder Eusolex® T2000 (Merck; als hydrophobe Coatingmittel kommen dafür bevorzugt Silicone und besonders bevorzugt Trialkoxyoctylsilane oder Simethicone in Frage. Vorzugsweise wird mikronisiertes Zinkoxid verwendet. Weitere geeignete UV-Lichtschutzfilter sind der Übersicht von P. Finkel in SÖFW-Journal, Band 122 (1996), S. 543 zu entnehmen.
Die UV-Absorbenzien werden üblicherweise in Mengen von 0,01 Gew.-% bis 5 Gew.-%, vorzugsweise von 0,03 Gew.-% bis 1 Gew.-%, eingesetzt.
Erfindungsgemäße Mittel können zur Steigerung der Wasch-, beziehungsweise Reinigungsleistung zusätzlich zu den erfindungsgemäßen Enzymen weitere Enzyme enthalten, wobei prinzipiell alle im Stand der Technik für diese Zwecke etablierten Enzyme einsetzbar sind. Hierzu gehören insbesondere Proteasen, Amylasen, Lipasen, Hemicellulasen, Cellulasen oder Oxidoreduktasen, sowie vorzugsweise deren Gemische. Diese Enzyme sind im Prinzip natürlichen Ursprungs; ausgehend von den natürlichen Molekülen stehen für den Einsatz in Wasch- und Reinigungsmitteln verbesserte Varianten zur Verfügung, die entsprechend bevorzugt eingesetzt werden. Erfindungsgemäße Mittel enthalten Enzyme vorzugsweise in Gesamtmengen von 1 x 10"6 bis 5 Gewichts-Prozent bezogen auf aktives Protein. Die Proteinkonzentration kann mit Hilfe bekannter Methoden, zum Beispiel dem BCA-Verfahren (Bicinchoninsäure; 2,2'-Bichinolyl-4,4'-dicarbonsäure) oder dem Biuret-Verfahren (A. G. Gornall, C. S. Bardawill und M.M. David, J. BbI. Chem., 177 (1948), S. 751-766) bestimmt werden.
Unter den Proteasen sind solche vom Subtilisin-Typ bevorzugt. Beispiele hierfür sind die Subtilisine BPN' und Carlsberg, die Protease PB92, die Subtilisine 147 und 309, die Alkalische Protease aus Bacillus lentus, Subtilisin DY und die den Subtilasen, nicht mehr jedoch den Subtilisinen im engeren Sinne zuzuordnenden Enzyme Thermitase, Proteinase K und die Proteasen TW3 und TW7. Subtilisin Carlsberg ist in weiterentwickelter Form unter dem Handelsnamen Alcalase® von der Firma Novozymes A/S, Bagsvaerd, Dänemark, erhältlich. Die Subtilisine 147 und 309 werden unter den Handelsnamen Esperase®, beziehungsweise Savinase® von der Firma Novozymes vertrieben. Von der Protease aus Bacillus lentus DSM 5483 (WO 91/02792 A1) leiten sich die unter der Bezeichnung BLAP® geführten Varianten ab, die insbesondere in WO 92/21760 A1 , WO 95/23221 A1 , WO 02/088340 A2 und WO 03/038082 A2 beschrieben werden. Weitere verwendbare Proteasen aus verschiedenen Bacillus sp. und B. gibsonii gehen aus den Patentanmeldungen WO 03/054185 A1 , WO 03/056017 A2, WO 03/055974 A2 und WO 03/054184 A1 hervor.
Weitere brauchbare Proteasen sind beispielsweise die unter den Handelsnamen Durazym®, Relase®, Everlase®, Nafizym, Natalase®, Kannase® und Ovozymes® von der Firma Novozymes, die unter den Handelsnamen, Purafect®, Purafect®OxP und Properase® von der Firma Genencor, das unter dem Handelsnamen Protosol® von der Firma Advanced Biochemicals Ltd., Thane, Indien, das unter dem Handelsnamen Wuxi® von der Firma Wuxi Snyder Bioproducts Ltd., China, die unter den Handelsnamen Proleather® und Protease P® von der Firma Amano Pharmaceuticals Ltd., Nagoya, Japan, und das unter der Bezeichnung Proteinase K-16 von der Firma Kao Corp., Tokyo, Japan, erhältlichen Enzyme.
Beispiele für erfindungsgemäß einsetzbare Amylasen sind die α-Amylasen aus Bacillus licheniformis, aus B. amyloliquefaciens oder aus B. stearothermophilus sowie deren für den Einsatz in Wasch- und Reinigungsmitteln verbesserte Weiterentwicklungen. Das Enzym aus B. licheniformis ist von der Firma Novozymes unter dem Namen Termamyl® und von der Firma Genencor unter dem Namen Purastar®ST erhältlich. Weiterentwicklungsprodukte dieser α- Amylase sind von der Firma Novozymes unter den Handelsnamen Duramyl® und Termamyl®ultra, von der Firma Genencor unter dem Namen Purastar®OxAm und von der Firma Daiwa Seiko Inc., Tokyo, Japan, als Keistase® erhältlich. Die α-Amylase von S. amyloliquefaciens wird von der Firma Novozymes unter dem Namen BAN® vertrieben, und abgeleitete Varianten von der α-Amylase aus B. stearothermophilus unter den Namen BSG® und Novamyl®, ebenfalls von der Firma Novozymes.
Desweiteren sind für diesen Zweck die in der Anmeldung WO 02/10356 A2 offenbarte α-Amylase aus Bacillus sp. A 7-7 (DSM 12368) und die in der Anmeldung WO 02/44350 A2 beschriebene Cyclodextrin-Glucanotransferase (CGTase) aus B. agaradherens (DSM 9948) hervorzuheben. Ferner sind die amylolytischen Enzyme einsetzbar, die dem Sequenzraum von α-Amylasen angehören, der in der Anmeldung WO 03/002711 A2 definiert wird, und die, die in der Anmeldung WO 03/054177 A2 beschrieben werden. Ebenso sind Fusionsprodukte der genannten Moleküle einsetzbar, beispielsweise die aus der Anmeldung DE 10138753 A1.
Darüber hinaus sind die unter den Handelsnamen Fungamyl® von der Firma Novozymes erhältlichen Weiterentwicklungen der α-Amylase aus Aspergillus niger und A. oryzae geeignet. Ein weiteres Handelsprodukt ist beispielsweise die Amylase-LT®.
Erfindungsgemäße Mittel können Lipasen oder Cutinasen, insbesondere wegen ihrer Triglycerid- spaltenden Aktivitäten enthalten, aber auch, um in Ergänzung der vorliegenden Erfindung aus geeigneten Vorstufen in situ Persäuren zu erzeugen. Hierzu gehören beispielsweise die ursprünglich aus Humicola lanuginosa (Thermomyces lanuginosus) erhältlichen, beziehungsweise weiterentwickelten Lipasen, insbesondere solche mit dem Aminosäureaustausch D96L. Sie werden beispielsweise von der Firma Novozymes unter den Handelsnamen Lipolase®, Lipolase®Ultra, LipoPrime®, Lipozyme® und Lipex® vertrieben. Desweiteren sind beispielsweise die Cutinasen einsetzbar, die ursprünglich aus Fusarium solani pisi und Humicola insolens isoliert worden sind. Ebenso brauchbare Lipasen sind von der Firma Amano unter den Bezeichnungen Lipase CE®, Lipase P®, Lipase B®, beziehungsweise Lipase CES®, Lipase AKG®, Bacillis sp. Lipase®, Lipase AP®, Lipase M-AP® und Lipase AML® erhältlich. Von der Firma Genencor sind beispielsweise die Lipasen, beziehungsweise Cutinasen einsetzbar, deren Ausgangsenzyme ursprünglich aus Pseudomonas mendocina und Fusarium solanii isoliert worden sind. Als weitere wichtige Handelsprodukte sind die ursprünglich von der Firma Gist-Brocades vertriebenen Präparationen M1 Lipase® und Lipomax® und die von der Firma Meito Sangyo KK, Japan, unter den Namen Lipase MY-30®, Lipase OF® und Lipase PL® vertriebenen Enzyme zu erwähnen, ferner das Produkt Lumafast® von der Firma Genencor.
Erfindungsgemäße Mittel können, insbesondere wenn sie für die Behandlung von Textilien gedacht sind, Cellulasen enthalten, je nach Zweck als reine Enzyme, als Enzympräparationen oder in Form von Mischungen, in denen sich die einzelnen Komponenten vorteilhafterweise hinsichtlich ihrer verschiedenen Leistungsaspekte ergänzen. Zu diesen Leistungsaspekten zählen insbesondere Beiträge zur Primärwaschleistung, zur Sekundärwaschleistung des Mittels (Antiredepositionswirkung oder Vergrauungsinhibition) und Avivage (Gewebewirkung), bis hin zum Ausüben eines „stone washed"-Effekts.
Eine brauchbare pilzliche, Endoglucanase(EG)-reiche Cellulase-Präparation, beziehungsweise deren Weiterentwicklungen werden von der Firma Novozymes unter dem Handelsnamen Celluzyme® angeboten. Die ebenfalls von der Firma Novozymes erhältlichen Produkte Endolase® und Carezyme® basieren auf der 50 kD-EG, beziehungsweise der 43 kD-EG aus H. insolens DSM 1800. Weitere einsetzbare Handelsprodukte dieser Firma sind Cellusoft® und Renozyme®. Letzteres basiert auf der Anmeldung WO 96/29397 A1. Leistungsverbesserte Cellulase-Varianten gehen beispielsweise aus der Anmeldung WO 98/12307 A1 hervor. Ebenso sind die in der Anmeldung WO 97/14804 A1 offenbarten Cellulasen einsetzbar; beispielsweise die darin offenbarte 20 kD-EG aus Melanocarpus, die von der Firma AB Enzymes, Finnland, unter den Handelsnamen Ecostone® und Biotouch® erhältlich ist. Weitere Handelprodukte der Firma AB Enzymes sind Econase® und Ecopulp®. Weitere geeignete Cellulasen aus Bacillus sp. CBS 670.93 und CBS 669.93 werden in WO 96/34092 A2 offenbart, wobei die aus Bacillus sp. CBS 670.93 von der Firma Genencor unter dem Handelsnamen Puradax® erhältlich ist. Weitere Handelsprodukte der Firma Genencor sind „Genencor detergent cellulase L" und lndiAge®Neutra. Erfindungsgemäße Mittel können insbesondere zur Entfernung bestimmter Problemanschmutzungen weitere Enzyme enthalten, die unter dem Begriff Hemicellulasen zusammengefaßt werden. Hierzu gehören beispielsweise Mannanasen, Xanthanlyasen, Pektinlyasen (=Pektinasen), Pektinesterasen, Pektatlyasen, Xyloglucanasen (=Xylanasen), Pullulanasen und ß-Glucanasen. Geeignete Mannanasen sind beispielsweise unter den Namen Gamanase® und Pektinex AR® von der Firma Novozymes, unter dem Namen Rohapec® B1 L von der Firma AB Enzymes und unter dem Namen Pyrolase® von der Firma Diversa Corp., San Diego, CA1 USA erhältlich. Eine geeignete ß-Glucanase aus einem S. alcalophilus geht beispielsweise aus der Anmeldung WO 99/06573 A1 hervor. Die aus B. subtilis gewonnene ß-Glucanase ist unter dem Namen Cereflo® von der Firma Novozymes erhältlich.
Zur Erhöhung der bleichenden Wirkung können erfindungsgemäße Wasch- und Reinigungsmittel Oxidoreduktasen, beispielsweise Oxidasen, Oxygenasen, Katalasen, Peroxidasen, wie HaIo-, Chloro-, Bromo-, Lignin-, Glucose- oder Mangan-peroxidasen, Dioxygenasen oder Laccasen (Phenoloxidasen, Polyphenoloxidasen) enthalten. Als geeignete Handelsprodukte sind Denilite® 1 und 2 der Firma Novozymes zu nennen. Vorteilhafterweise werden zusätzlich vorzugsweise organische, besonders bevorzugt aromatische, mit den Enzymen wechselwirkende Verbindungen zugegeben, um die Aktivität der betreffenden Oxidoreduktasen zu verstärken (Enhancer) oder um bei stark unterschiedlichen Redoxpotentialen zwischen den oxidierenden Enzymen und den Anschmutzungen den Elektronenfluß zu gewährleisten (Mediatoren).
Die in erfindungsgemäßen Mitteln eingesetzten Enzyme stammen entweder ursprünglich aus Mikroorganismen, etwa der Gattungen Bacillus, Streptomyces, Humicola, oder Pseudomonas, und/oder werden nach an sich bekannten biotechnologischen Verfahren durch geeignete Mikroorganismen produziert, etwa durch transgene Expressionswirte der Gattungen Bacillus oder filamentöse Fungi.
Die Aufreinigung der betreffenden Enzyme erfolgt günstigerweise über an sich etablierte Verfahren, beispielsweise über Ausfällung, Sedimentation, Konzentrierung, Filtration der flüssigen Phasen, Mikrofiltration, Ultrafiltration, Einwirken von Chemikalien, Desodorierung oder geeignete Kombinationen dieser Schritte.
Erfindungsgemäßen Mitteln können die Enzyme in jeder nach dem Stand der Technik etablierten Form zugesetzt werden. Hierzu gehören beispielsweise die durch Granulation, Extrusion oder Lyophilisierung erhaltenen festen Präparationen oder, insbesondere bei flüssigen oder gelförmigen Mitteln, Lösungen der Enzyme, vorteilhafterweise möglichst konzentriert, wasserarm und/oder mit Stabilisatoren versetzt.
Alternativ können die Enzyme sowohl für die feste als auch für die flüssige Darreichungsform verkapselt werden, beispielsweise durch Sprühtrocknung oder Extrusion der Enzymlösung zusammen mit einem, vorzugsweise natürlichen Polymer oder in Form von Kapseln, beispielsweise solchen, bei denen die Enzyme wie in einem erstarrten Gel eingeschlossen sind oder in solchen vom Kern-Schale-Typ, bei dem ein enzymhaltiger Kern mit einer Wasser-, Luft- und/oder Chemikalien-undurchlässigen Schutzschicht überzogen ist. In aufgelagerten Schichten können zusatzlich weitere Wirkstoffe, beispielsweise Stabilisatoren, Emulgatoren, Pigmente, Bleich- oder Farbstoffe aufgebracht werden. Derartige Kapseln werden nach an sich bekannten Methoden, beispielsweise durch Schüttel- oder Rollgranulation oder in Fluid-bed-Prozessen aufgebracht. Vorteilhafterweise sind derartige Granulate, beispielsweise durch Aufbringen polymerer Filmbildner, staubarm und aufgrund der Beschichtung lagerstabil.
Weiterhin ist es möglich, zwei oder mehrere Enzyme zusammen zu konfektionieren, so daß ein einzelnes Granulat mehrere Enzymaktivitäten aufweist.
Die, auf die enthaltenen Enzyme, insbesondere auf die enthaltenen Cholinoxidasen zurückzuführende Proteinkonzentration kann mit Hilfe bekannter Methoden, zum Beispiel dem BCA-Verfahren (Bicinchoninsäure; 2,2'-Bichinolyl-4,4'-dicarbonsäure) oder dem Biuret-Verfahren (A. G. Gornall, C. S. Bardawill und M.M. David, J. BbI. Chem. 177 (1948), S. 751-766) bestimmt werden.
Ein in einem erfindungsgemäßen Mittel enthaltenes Protein und/oder Enzym kann besonders während der Lagerung gegen Schädigungen wie beispielsweise Inaktivierung, Denaturierung oder Zerfall etwa durch physikalische Einflüsse, Oxidation oder proteolytische Spaltung geschützt werden. Bei mikrobieller Gewinnung der Proteine und/oder Enzyme ist eine Inhibierung der Proteolyse besonders bevorzugt, insbesondere wenn auch die Mittel Proteasen enthalten. Bevorzugte erfindungsgemäße Mittel enthalten zu diesem Zweck Stabilisatoren.
Eine Gruppe von Stabilisatoren sind reversible Proteaseinhibitoren. Häufig werden hierfür Benzamidin-Hydrochlorid, Borax, Borsäuren, Boronsäuren oder deren Salze oder Ester eingesetzt, darunter vor allem Derivate mit aromatischen Gruppen, etwa Ortho-, meta- oder para-substituierte Phenylboronsäuren, insbesondere 4-Formylphenyl-Boronsäure, beziehungsweise die Salze oder Ester der genannten Verbindungen. Auch Peptidaldehyde, das heißt Oligopeptide mit reduziertem C-Terminus, insbesondere solche aus 2 bis 50 Monomeren werden zu diesem Zweck eingesetzt. Zu den peptidischen reversiblen Proteaseinhibitoren gehören unter anderem Ovomucoid und Leupeptin. Auch spezifische, reversible Peptid-Inhibitoren für die Protease Subtilisin sowie Fusionsproteine aus Proteasen und spezifischen Peptid-Inhibitoren sind hierfür geeignet.
Weitere Enzymstabilisatoren sind Aminoalkohole wie Mono-, Di-, Triethanol- und -Propanolamin und deren Mischungen, aliphatische Carbonsäuren bis zu C12, wie beispielsweise Bernsteinsäure, andere Dicarbonsäuren oder Salze der genannten Säuren. Auch endgruppenverschlossene Fettsäureamidalkoxylate sind für diesen Zweck geeignet. Bestimmte als Builder eingesetzte organische Säuren vermögen, wie in WO 97/18287 offenbart, zusätzlich ein enthaltenes Enzym zu stabilisieren.
Niedere aliphatische Alkohole, vor allem aber Polyole, wie beispielsweise Glycerin, Ethylenglykol, Propylenglykol oder Sorbit sind weitere häufig eingesetzte Enzymstabilisatoren. Auch Di- Glycerinphosphat schützt gegen Denaturierung durch physikalische Einflüsse. Ebenso werden Calcium- und/oder Magnesiumsalze eingesetzt, wie beispielsweise Calciumacetat oder Calcium- Formiat.
Polyamid-Oligomere oder polymere Verbindungen wie Lignin, wasserlösliche Vinyl-Copolymere oder Cellulose-Ether, Acryl-Polymere und/oder Polyamide stabilisieren die Enzym-Präparation unter anderem gegenüber physikalischen Einflüssen oder pH-Wert-Schwankungen. Polyamin-N- Oxid-enthaltende Polymere wirken gleichzeitig als Enzymstabilisatoren und als Farbübertragungsinhibitoren. Andere polymere Stabilisatoren sind lineare C8-C18 Polyoxyalkylene. Auch Alkylpolyglycoside können die enzymatischen Komponenten des erfindungsgemäßen Mittels stabilisieren und vermögen vorzugsweise, diese zusätzlich in ihrer Leistung zu steigern. Vernetzte N-haltige Verbindungen erfüllen vorzugsweise eine Doppelfunktion als Soil-release-Agentien und als Enzym-Stabilisatoren. Hydrophobes, nichtionisches Polymer stabilisiert insbesondere eine gegebenenfalls enthaltene Cellulase.
Reduktionsmittel und Antioxidantien erhöhen die Stabilität der Enzyme gegenüber oxidativem Zerfall; hierfür sind beispielsweise schwefelhaltige Reduktionsmittel geläuFigur Andere Beispiele sind Natrium-Sulfit und reduzierende Zucker.
Besonders bevorzugt werden Kombinatonen von Stabilisatoren eingesetzt, beispielsweise aus Polyolen, Borsäure und/oder Borax, die Kombination von Borsäure oder Borat, reduzierenden Salzen und Bernsteinsäure oder anderen Dicarbonsäuren oder die Kombination von Borsäure oder Borat mit Polyolen oder Polyaminoverbindungen und mit reduzierenden Salzen. Die Wirkung von Peptid-Aldehyd-Stabilisatoren wird günstigerweise durch die Kombination mit Borsäure und/oder Borsäurederivaten und Polyolen gesteigert und noch weiter durch die zusätzliche Wirkung von zweiwertigen Kationen, wie zum Beispiel Calcium-Ionen.
Erfindungsgemäße Mittel sind in einer bevorzugten Ausführungsform dadurch gekennzeichnet, daß sie, beispielsweise um die enthaltenen Wirkstoffe zeitlich oder räumlich voneinander getrennt freizusetzen, aus mehr als einer Phase bestehen. Dabei kann es sich um Phasen in verschiedenen, insbesondere aber um Phasen in denselben Aggregatzuständen handeln.
Erfindungsgemäße Mittel, die aus mehr als einer festen Komponente zusammengesetzt sind, können auf einfache Weise dadurch hergestellt werden, daß verschiedene feste Komponenten, insbesondere Pulver, Granulate oder Extrudate mit verschiedenen Inhaltsstoffen und/oder unterschiedlichem Freisetzungsverhalten in insgesamt loser Form miteinander vermischt werden. Die Herstellung erfindungsgemäßer fester Mittel aus einer oder mehreren Phasen kann auf bekannte Weise, zum Beispiel durch Sprühtrocknen oder Granulation erfolgen, wobei die Enzyme und eventuelle weitere thermisch empfindliche Inhaltsstoffe wie zum Beispiel Bleichmittel gegebenenfalls später separat zugesetzt werden. Zur Herstellung erfindungsgemäßer Mittel mit erhöhtem Schüttgewicht, insbesondere im Bereich von 650 g/l bis 950 g/l, ist ein aus der europäischen Patentschrift EP 0 486 592 bekanntes, einen Extrusionschritt aufweisendes Verfahren bevorzugt. Eine weitere bevorzugte Herstellung mit Hilfe eines Granulationsverfahrens ist in der europäischen Patentschrift EP 0 642 576 beschrieben.
Proteine können für feste Mittel beispielsweise in getrockneter, granulierter, verkapselter oder verkapselter und zusätzlich getrockneter Form eingesetzt werden. Sie können separat, das heißt als eigene Phase, oder mit anderen Bestandteilen zusammen in derselben Phase, mit oder ohne Kompaktierung zugesetzt werden. Sollen mikroverkapselte Enzyme in fester Form verarbeitet werden, so kann das Wasser mit aus dem Stand der Technik bekannten Verfahren aus den sich aus der Aufarbeitung ergebenden wäßrigen Lösungen entfernt werden, wie Sprühtrocknung, Abzentrifugieren oder durch Umsolubilisieren. Die auf diese Weise erhaltenen Teilchen haben üblicherweise eine Teilchengröße zwischen 50 und 200 μm.
Die verkapselte Form bietet sich an, um wie oben bereits diskutiert, auch die Enzyme vor anderen Bestandteilen, wie beispielsweise Bleichmitteln, zu schützen oder um eine kontrollierte Freisetzung (controlled release) zu ermöglichen. Je nach der Größe dieser Kapseln wird nach MiIIi-, Mikro- und Nanokapseln unterschieden, wobei Mikrokapseln für Enzyme besonders bevorzugt sind. Solche Kapseln werden beispielsweise mit den Patentanmeldungen WO 97/24177 und DE 199 18 267 offenbart. Eine weitere mögliche Verkapselungsmethode besteht darin, daß die für die Verwendung in Wasch- oder Reinigungsmitteln geeigneten Enzyme, ausgehend von einer Mischung der Enzymlösung mit einer Lösung oder Suspension von Stärke oder einem Stärkederivat, in Stärke, beziehungsweise dem Stärkederivat verkapselt werden. Ein solches Verkapselungsverfahren wird mit der deutschen Anmeldung DE 199 56 382 beschrieben.
Es können auch mindestens zwei feste Phasen miteinander verbunden vorliegen. So besteht eine Möglichkeit, ein festes erfindungsgemäßes Mittel zur Verfügung zu stellen, in dem Verpressen oder Kompaktieren zu Tabletten. Solche Tabletten können ein- oder mehrphasig sein. Damit bietet auch diese Darreichungsform die Möglichkeit, ein festes erfindungsgemäßes Mittel mit zwei festen Phasen vorzulegen. Zur Herstellung von erfindungsgemäßen Mitteln in Tablettenform, die einphasig oder mehrphasig, einfarbig oder mehrfarbig sein können und/oder aus einer mehreren Schichten bestehen können, werden vorzugsweise alle Bestandteile - gegebenenfalls je einer Schicht - in einem Mischer miteinander vermischt und das Gemisch mittels herkömmlicher Tablettenpressen, beispielsweise Exzenterpressen oder Rundläuferpressen, mit Preßkräften im Bereich von etwa 50 bis 100 kN/cm2, vorzugsweise bei 60 bis 70 kN/cm2 verpreßt. Insbesondere bei mehrschichtigen Tabletten kann es von Vorteil sein, wenn mindestens eine Schicht vorverpreßt wird. Dies wird vorzugsweise bei Preßkräften zwischen 5 und 20 kN/cm2, insbesondere bei 10 bis 15 kN/cm2 durchgeführt. Vorzugsweise weist eine derart hergestellte Tablette ein Gewicht von 10 g bis 50 g, insbesondere von 15 g bis 40 g auf. Die Raumform der Tabletten ist beliebig und kann rund, oval oder eckig sein, wobei auch Zwischenformen möglich sind.
Besonders vorteilhaft ist es, wenn in mehrphasigen Mitteln wenigstens eine der Phasen ein Amylase-sensitives Material, insbesondere Starke enthalt oder von diesem zumindest teilweise umgeben oder beschichtet ist. Auf diese Weise wird diese Phase mechanisch stabilisiert und/oder gegen Einflüsse von außen geschützt und gleichzeitig über eine in der Waschflotte wirksame Amylase angegriffen, so daß die Freisetzung der Inhaltsstoffe erleichtert wird.
Ebenfalls bevorzugte erfindungsgemäße Mittel sind dadurch gekennzeichnet, daß sie insgesamt flüssig, gelförmig oder pastös vorliegen. Die enthaltenen Proteine, vorzugsweise ein erfindungsgemäßes Protein, werden solchen Mitteln bevorzugt ausgehend von einer nach dem Stand der Technik durchgeführten Proteingewinnung und Präparation in konzentrierter wäßriger oder nichtwäßriger Lösung, beispielsweise in flüssiger Form, etwa als Lösung, Suspension oder Emulsion, aber auch in Gelform oder verkapselt oder als getrocknetes Pulver zugesetzt. Derartige erfindungsgemäße Wasch- oder Reinigungsmittel in Form von Lösungen in üblichen Lösungsmitteln werden in der Regel durch einfaches Mischen der Inhaltsstoffe hergestellt, die in Substanz oder als Lösung in einen automatischen Mischer gegeben werden können.
Eine Ausführungsform der vorliegenden Erfindung sind solche flüssigen, gelförmigen oder pastösen Mittel, denen ein erfindungswesentliches Protein und/oder eines der anderen enthaltenen Proteine und/oder einer der anderen enthaltenene Inhaltsstoffe verkapselt, vorzugsweise in Form von Mikrokapseln zugesetzt worden ist. Besonders bevorzugt sind darunter solche mit Kapseln aus amylasesensitivem Material. Solch eine gemeinsame Verwendung von Amylase-sensitiven Materialien und einem amylolytischen Enzym in einem Wasch- oder Reinigungsmittel kann Synergieeffekte zeigen, etwa dergestalt daß das stärkespaltende Enzym die Spaltung der Mikrokapseln unterstützt und somit den Freisetzungsprozeß der verkapselten Inhaltsstoffe steuert, so daß deren Freisetzung nicht während der Lagerung und/oder nicht zu Beginn des Reinigungsvorgangs, sondern erst zu einem bestimmten Zeitpunkt erfolgt. Auf diesem Mechanismus können komplexe Wasch- und Reinigungsmittelsysteme mit verschiedensten Inhaltsstoffen und verschiedensten Kapseltypen beruhen, die besonders bevorzugte Ausführungsformen der vorliegenden Erfindung darstellen.
Ein vergleichbarer Effekt ist dann gegeben, wenn sich die Inhaltsstoffe des Wasch- oder Reinigungsmittels auf mindestens zwei unterschiedliche Phasen verteilen, beispielsweise zwei oder mehr feste, miteinander verbundene Phasen eines tablettenförmigen Wasch- oder Reinigungsmittels, oder verschiedene Granulate innerhalb desselben pulverförmigen Mittels. Zwei- oder Mehrphasenreiniger sind für die Anwendung sowohl in maschinellen Geschirrspülern als auch in Waschmitteln Stand der Technik. Die Aktivität eines amylolytischen Enzyms in einer früher aktivierten Phase ist Voraussetzung für die Aktivierung einer späteren Phase, wenn diese von einer Amylase-sensitiven Hülle oder Beschichtung umgeben ist oder das Amylase-sensitive Material einen integralen Bestandteil der festen Phase darstellt, bei dessen teilweiser oder vollständiger Hydrolyse die betreffende Phase desintegriert.
Die Inhaltsstoffe von Wasch- und Reinigungsmitteln vermögen sich geeigneterweise gegenseitig in ihrer Leistung zu unterstützen. So ist auch aus der Anmeldung WO 98/45396 bekannt, daß Polymere, die gleichzeitig als Cobuilder eingesetzt werden können, wie beispielsweise Alkyl-Poly- Glykoside, die Aktivität und die Stabilität von enthaltenen Enzymen stabilisieren und steigern können. Somit ist es bevorzugt, wenn eine erfindungsgemäße Carlsberg-Variante durch einen der übrigen, oben aufgeführten Bestandteile modifiziert, insbesondere stabilisiert und/oder in seinem Beitrag zur Wasch-, beziehungsweise Reinigungsleistung des Mittels gesteigert wird.
Einen weiteren Erfindungsgegenstand stellen Verfahren zur Reinigung von Textilien oder von harten Oberflächen dar, die dadurch gekennzeichnet sind, daß in wenigstens einem der Verfahrensschritte eine oben beschriebene erfindungsgemäße Cholinoxidase-Variante aktiv wird.
Denn in dieser Ausführungsform wird die Erfindung dadurch realisiert, daß die erfindungsgemäß verbesserten enzymatischen Eigenschaften hinsichtlich einer Verbesserung prinzipiell jeden Reinigungsverfahrens ausgenutzt werden. Jedes Reinigungsverfahren wird um die betreffende Aktivität bereichert, wenn sie in wenigstens einem Verfahrensschritt zugesetzt wird. Derartige Verfahren werden beispielsweise mit Maschinen wie gängigen Haushaltsgeschirrspülmaschinen oder Haushaltswaschmaschinen verwirklicht. Bevorzugte Verfahren werden entsprechend den oben gemachten Angaben bevorzugt. Weiter bevorzugt sind derartige Verfahren, die dadurch gekennzeichnet sind, daß die Cholinoxidase-Variante über ein oben beschriebenes Mittel eingesetzt wird.
Ein weiterer Gegenstand der Erfindung ist ein Haarwasch- und/oder Haarpflegemittel, enthaltend erfindungsgemäße Cholinoxidasen.
Die Haarwasch- und/oder Haarpflegemittel sowie Schaumbäder, Duschbäder, Cremes, Gele, Lotionen, alkoholische und wäßrig/alkoholische Lösungen, Emulsionen, Wachs/ Fett-Massen, Stiftpräparate, Puder oder Salben, die erfindungsgemäß verwendbare Cholinoxidasen und insbesondere erfindungsgemäße Cholinoxidasen umfassen, können als Hilfs- und Zusatzstoffe milde Tenside, ölkörper, Emulgatoren, Überfettungsmittel, Perlglanzwachse, Konsistenzgeber, Verdickungsmittel, Polymere, Siliconverbindungen, Fette, Wachse, Stabilisatoren, biogene Wirkstoffe, Deodorantien, Antitranspirantien, Antischuppenmittel, Filmbildner, Quellmittel, UV-Licht- Schutzfaktoren, Antioxidantien, Hydrotrope, Konservierungsmittel, Insektenrepellentien, Selbstbrauner, Solubilisatoren, Parfümöle, Farbstoffe und dergleichen enthalten.
Typische Beispiele für geeignete milde, d.h. besonders hautverträgliche Tenside sind Fettalkoholpolyglycolethersulfate, Monoglyceridsulfate, Mono- und/oder Dialkylsulfosuccinate, Fettsäureisethionate, Fettsäuresarcosinate, Fettsäuretauride, Fettsäureglutamate, D- Olefinsulfonate, Ethercarbonsauren, Alkyloligoglucoside, Fettsäureglucamide, Alkylamidobetaine und/oder Proteinfettsäurekondensate, letztere vorzugsweise auf Basis von Weizenproteinen.
Als ölkörper kommen beispielsweise Guerbetalkohole auf Basis von Fettalkoholen mit 6 bis 18, vorzugsweise 8 bis 10 Kohlenstoffatomen, Ester von linearen C6-C22-Fettsäuren mit linearen C6- C22-Fettalkoholen, Ester von verzweigten C6-Ci3-Carbonsäuren mit linearen C6-C22-Fettalkoholen, wie z.B. Myristylmyristat, Myristylpalmitat, Myristylstearat, Myristylisostearat, Myristyloleat, Myristylbehenat, Myristylerucat, Cetylmyristat, Cetylpalmitat, Cetylstearat, Cetylisostearat, Cetyloleat, Cetylbehenat, Cetylerucat, Stearylmyristat, Stearylpalmitat, Stearylstearat, Stearylisostearat, Stearyloleat, Stearylbehenat, Stearylerucat, Isostearylmyristat, Isostearylpalmitat, Isostearylstearat, Isostearylisostearat, Isostearyloleat, Isostearylbehenat, Isostearyloleat, Oleylmyristat, Oleylpalmitat, Oleylstearat, Oleylisostearat, Oleyloleat, Oleylbehenat, Oleylerucat, Behenylmyristat, Behenylpalmitat, Behenylstearat, Behenylisostearat, Behenyloleat, Behenylbehenat, Behenylerucat, Erucylmyristat, Erucylpalmitat, Erucylstearat, Erucylisostearat, Erucyloleat, Erucylbehenat und Erucylerucat. Daneben eignen sich Ester von linearen C6-C22- Fettsäuren mit verzweigten Alkoholen, insbesondere 2-Ethylhexanol, Ester von Hy- droxycarbonsäuren mit linearen oder verzweigten C6-C22-Fettalkoholen, insbesondere Dioctyl Malate, Ester von linearen und/oder verzweigten Fettsäuren mit mehrwertigen Alkoholen (wie z.B. Propylenglycol, Dimerdiol oder Trimertriol) und/oder Guerbetalkoholen, Triglyceride auf Basis C6- C10-Fettsäuren, flüssige Mono-/Di-/Triglyceridmischungen auf Basis von C6-C18-Fettsäuren, Ester von C6-C22-Fettalkoholen und/oder Guerbetalkoholen mit aromatischen Carbonsäuren, insbesondere Benzoesäure, Ester von CrC^-Dicarbonsäuren mit linearen oder verzweigten Alkoholen mit 1 bis 22 Kohlenstoffatomen oder Polyolen mit 2 bis 10 Kohlenstoffatomen und 2 bis 6 Hydroxylgruppen, pflanzliche öle, verzweigte primäre Alkohole, substituierte Cyclohexane, lineare und verzweigte
Figure imgf000049_0001
Guerbetcarbonate, Ester der Benzoesäure mit linearen und/oder verzweigten C6-C22-Alkoholen (z.B. Finsolv® TN), lineare oder verzweigte, symmetrische oder unsymmetrische Dialkylether mit 6 bis 22 Kohlenstoffatomen pro Alkylgruppe, Ringöffnungsprodukte von epoxidierten Fettsäureestern mit Polyolen, Siliconöle und/oder aliphatische bzw. naphthenische Kohlenwasserstoffe, wie z.B. wie Squalan, Squalen oder Dialkylcyclohexane in Betracht.
Als Emulgatoren kommen beispielsweise nichtionogene Tenside aus mindestens einer der folgenden Gruppen in Frage: (1) Anlagerungsprodukte von 2 bis 30 Mol Ethylenoxid und/ oder 0 bis 5 Mol Propylenoxid an lineare Fettalkohole mit 8 bis 22 C-Atomen, an Fettsäuren mit 12 bis 22 C-Atomen, an Alkyl- phenole mit 8 bis 15 C-Atomen in der Alkylgruppe sowie Alkylamine mit 8 bis 22 Kohlenstoffatomen im Alkylrest;
(2) C12/i8-Fettsäuremono- und -diester von Anlagerungsprodukten von 1 bis 30 Mol Ethylenoxid an Glycerin;
(3) Glycerinmono- und -diester und Sorbitanmono- und -diester von gesättigten und ungesättigten Fettsäuren mit 6 bis 22 Kohlenstoffatomen und deren Ethylenoxidanlagerungsprodukte;
(4) Alkyl- und/oder Alkenylmono- und -oligoglycoside mit 8 bis 22 Kohlenstoffatomen im Alk(en)ylrest und deren ethoxylierte Analoga;
(5) Anlagerungsprodukte von 15 bis 60 Mol Ethylenoxid an Ricinusöl und/oder gehärtetes Ricinusöl;
(6) Polyol- und insbesondere Polyglycerinester;
(7) Anlagerungsprodukte von 2 bis 15 Mol Ethylenoxid an Ricinusöl und/oder gehärtetes Ricinusöl;
(8) Partialester auf Basis linearer, verzweigter, ungesättigter bzw. gesättigter C6/22-Fettsäuren, Ricinolsäure sowie 12-Hydroxystearinsäure und Glycerin, Polyglycerin, Pentaerythrit, Dipentaerythrit, Zuckeralkohole (z.B. Sorbit), Alkylglucoside (z.B. Methylglucosid, Butylglucosid, Laurylglucosid) sowie Polyglucoside (z.B. Cellulose);
(9) Mono-, Di- und Trialkylphosphate sowie Mono-, Di- und/oder Tri-PEG-alkylphosphate und deren Salze;
(10) Wollwachsalkohole;
(11) Polysiloxan-Polyalkyl-Polyether-Copolymere bzw. entsprechende Derivate;
(12) Mischester aus Pentaerythrit, Fettsäuren, Citronensäure und Fettalkohol gemäß DE 1165574 PS und/oder Mischester von Fettsäuren mit 6 bis 22 Kohlenstoffatomen, Methylglucose und Polyolen, vorzugsweise Glycerin oder Polyglycerin,
(13) Polyalkylenglycole sowie
(14) Glycerincarbonat.
Die Anlagerungsprodukte von Ethylenoxid und/oder von Propylenoxid an Fettalkohole, Fettsäuren, Alkylphenole, Glycerinmono- und -diester sowie Sorbitanmono- und -diester von Fettsäuren oder an Ricinusöl stellen bekannte, im Handel erhältliche Produkte dar. Es handelt sich dabei um Homologengemische, deren mittlerer Alkoxylierungsgrad dem Verhältnis der Stoffmengen von Ethylenoxid und/ oder Propylenoxid und Substrat, mit denen die Anlagerungsreaktion durchgeführt wird, entspricht. Ci2/iβ-Fettsäuremono- und -diester von Anlagerungsprodukten von Ethylenoxid an Glycerin sind aus DE 2024051 PS als Rückfettungsmittel für kosmetische Zubereitungen bekannt.
Alkyl- und/oder Alkenylmono- und -oligoglycoside, ihre Herstellung und ihre Verwendung sind aus dem Stand der Technik bekannt. Ihre Herstellung erfolgt insbesondere durch Umsetzung von GIu- cose oder Oligosacchariden mit primären Alkoholen mit 8 bis 18 C-Atomen. Bezüglich des Glycosidrestes gilt, daß sowohl Monoglycoside, bei denen ein cyclischer Zuckerrest glycosidisch an den Fettalkohol gebunden ist, als auch oligomere Glycoside mit einem Oligomerisationsgrad bis vorzugsweise etwa 8 geeignet sind. Der Oligomerisierungsgrad ist dabei ein statistischer Mittelwert, dem eine für solche technischen Produkte übliche Homologenverteilung zugrunde liegt.
Typische Beispiele für geeignete Polyglycerinester sind Polyglyceryl-2 Dipolyhydroxystearate (Dehymuls® PGPH), Polyglycerin-3-Diisostearate (Lameform® TGI)1 Polyglyceryl-4 Isostearate (Isolan® Gl 34), Polyglyceryl-3 Oleate, Diisostearoyl Polyglyceryl-3 Diisostearate (Isolan® PDI), Polyglyceryl-3 Methylglucose Distearate (Tego Care® 450), Polyglyceryl-3 Beeswax (Cera Bellina®), Polyglyceryl-4 Caprate (Polyglycerol Caprate T2010/90), Polyglyceryl-3 Cetyl Ether (Chimexane® NL)1 Polyglyceryl-3 Distearate (Cremophor® GS 32) und Polyglyceryl Polyricinoleate (Admul® WOL 1403) Polyglyceryl Dimerate Isostearate sowie deren Gemische.
Weiterhin können als Emulgatoren zwitterionische Tenside verwendet werden. Als zwitterionische Tenside werden solche oberflächenaktiven Verbindungen bezeichnet, die im Molekül mindestens eine quartäre Ammoniumgruppe und mindestens eine Carboxylat- und eine Sulfonatgruppe tragen. Besonders geeignete zwitterionische Tenside sind die sogenannten Betaine wie die N-Alkyl-N,N- dimethylammoniumglycinate, beispielsweise das Kokosalkyldimethylammoniumglycinat, N-Acyl- aminopropyl-N.N-dimethylammoniumglycinate, beispielsweise das Kokosacyl- aminopropyldimethylammoniumglycinat, und 2-Alkyl-3-carboxylmethyl-3-hydroxyethylimidazoline mit jeweils 8 bis 18 C-Atomen in der Alkyl- oder Acylgruppe sowie das Kokosacylaminoethyl- hydroxyethylcarboxymethylglycinat. Besonders bevorzugt ist das unter der CTFA-Bezeichnung Cocamidopropyl Betaine bekannte Fettsäureamid-Derivat. Ebenfalls geeignete Emulgatoren sind ampholytische Tenside. Unter ampholytischen Tensiden werden solche oberflächenaktiven Verbindungen verstanden, die außer einer C8/iβ-Alkyl- oder -Acylgruppe im Molekül mindestens eine freie Aminogruppe und mindestens eine -COOH- oder -SO3H-Gruppe enthalten und zur Ausbildung innerer Salze befähigt sind. Beispiele für geeignete ampholytische Tenside sind N- Alkylglycine, N-Alkylpropionsäuren, N-Alkylaminobuttersäuren, N-Alkyliminodipropionsäuren, N-Hy- droxyethyl-N-alkylamidopropylglycine, N-Alkyltaurine, N-Alkylsarcosine, 2-Alkylaminopropion- säuren und Alkylaminoessigsäuren mit jeweils etwa 8 bis 18 C-Atomen in der Alkylgruppe. Besonders bevorzugte ampholytische Tenside sind das N-Kokosalkylaminopropionat, das Kokosacylaminoethylaminopropionat und das C12/iβ-Acylsarcosin. Neben den ampholytischen kommen auch quartäre Emulgatoren in Betracht, wobei solche vom Typ der Esterquats, vorzugsweise methylquaternierte Difettsäuretriethanolaminester-Salze, besonders bevorzugt sind.
Als Überfettungsmittel können Substanzen wie beispielsweise Lanolin und Lecithin sowie polyethoxylierte oder acylierte Lanolin- und Lecithinderivate, Polyolfettsäureester, Monoglyceride und Fettsäurealkanolamide verwendet werden, wobei die letzteren gleichzeitig als Schaumstabilisatoren dienen. Als Perlglanzwachse kommen beispielsweise in Frage: Alkylenglycolester, speziell Ethylenglycoldi- stearat; Fettsäurealkanolamide, speziell Kokosfettsäurediethanolamid; Partialglyceride, speziell Stearinsäuremonoglycerid; Ester von mehrwertigen, gegebenenfalls hydroxysubstituierte Carbonsäuren mit Fettalkoholen mit 6 bis 22 Kohlenstoffatomen, speziell langkettige Ester der Weinsaure; Fettstoffe, wie beispielsweise Fettalkohole, Fettketone, Fettaldehyde, Fettether und Fettcarbonate, die in Summe mindestens 24 Kohlenstoffatome aufweisen, speziell Lauron und Distearylether; Fettsäuren wie Stearinsäure, Hydroxystearinsäure oder Behensäure, Ringöffnungsprodukte von Olefinepoxiden mit 12 bis 22 Kohlenstoffatomen mit Fettalkoholen mit 12 bis 22 Kohlenstoffatomen und/oder Polyolen mit 2 bis 15 Kohlenstoffatomen und 2 bis 10 Hydroxylgruppen sowie deren Mischungen.
Als Konsistenzgeber kommen in erster Linie Fettalkohole oder Hydroxyfettalkohole mit 12 bis 22 und vorzugsweise 16 bis 18 Kohlenstoffatomen und daneben Partialglyceride, Fettsäuren oder Hydroxyfettsäuren in Betracht. Bevorzugt ist eine Kombination dieser Stoffe mit Alkyloligoglucosiden und/oder Fettsäure-N-methylglucamiden gleicher Kettenlänge und/oder Polyglycerinpoly-12-hydroxystearaten.
Geeignete Verdickungsmittel sind beispielsweise Aerosil-Typen (hydrophile Kieselsäuren), Polysaccharide, insbesondere Xanthan-Gum, Guar-Guar, Agar-Agar, Alginate und Tylosen, Carboxymethylcellulose und Hydroxyethylcellulose, ferner höhermolekulare
Polyethylenglycolmono- und -diester von Fettsäuren, Polyacrylate, (z.B. Carbopole® von Goodrich oder Synthalene® von Sigma), Polyacrylamide, Polyvinylalkohol und Polyvinylpyrrolidon, Tenside wie beispielsweise ethoxylierte Fettsäureglyceride, Ester von Fettsäuren mit Polyolen wie beispielsweise Pentaerythrit oder Trimethylolpropan, Fettalkoholethoxylate mit eingeengter Homologenverteilung oder Alkyloligoglucoside sowie Elektrolyte wie Kochsalz und Ammoniumchlorid.
Geeignete kationische Polymere sind beispielsweise kationische Cellulosederivate, wie z.B. eine quaternierte Hydroxyethylcellulose, die unter der Bezeichnung Polymer JR 400® von Amerchol erhältlich ist, kationische Stärke, Copolymere von Diallylammoniumsalzen und Acrylamiden, quaternierte Vinylpyrrolidon/Vinylimidazol-Polymere, wie z.B. Luviquat® (BASF), Kondensationsprodukte von Polyglycolen und Aminen, quaternierte Kollagenpolypeptide, wie beispielsweise Lauryldimonium hydroxypropyl hydrolyzed collagen (Lamequat®L/Grünau), quaternierte Weizenpolypeptide, Polyethylenimin, kationische Siliconpolymere, wie z.B. Amidomethicone, Copolymere der Adipinsäure und Dimethylaminohydroxypropyldiethylentriamin (Cartaretine®/Sandoz), Copolymere der Acrylsäure mit Dimethyldiallylammoniumchlorid (Merquat® 550/Chemviron), Polyaminopolyamide, wie z.B. beschrieben in der FR 2252840 A sowie deren vernetzte wasserlöslichen Polymere, kationische Chitinderivate wie beispielsweise quaterniertes Chitosan, gegebenenfalls mikrokristallin verteilt, Kondensationsprodukte aus Dihalogenalkylen, wie z.B. Dibrombutan mit Bisdialkylaminen, wie z.B. Bis-Dimethylamino-1 ,3-pro- pan, kationischer Guar-Gum, wie z.B. Jaguar® CBS1 Jaguar® C-17, Jaguar® C-16 der Firma Celanese, quaternierte Ammoniumsalz-Polymere, wie z.B. Mirapol® A-15, Mirapol® AD-1 , Mirapol® AZ-1 der Firma Miranol.
Als anionische, zwitterionische, amphotere und nichtionische Polymere kommen beispielsweise Vinylacetat/Crotonsäure-Copolymere, Vinylpyrrolidon/Vinylacrylat-Copolymere,
Vinylacetat/Butylmaleat/ Isobornylacrylat-Copolymere, Methylvinylether/Maleinsäureanhydrid- Copolymere und deren Ester, unvernetzte und mit Polyolen vernetzte Polyacrylsäuren, Acrylamido- propyltrimethylammoniumchlorid/Acrylat-Copolymere, Octylacrylamid/Methylmethacry- lat/tert.Butylaminoethylmethacryla^-Hydroxyproyl-methacrylat-Copolymere, Polyvinylpyrrolidon, Vinylpyrrolidon/Vinylacetat-Copolymere, Vinylpyrrolidon/ Dimethylaminoethylmethacrylat/Vinyl- caprolactam-Terpolymere sowie gegebenenfalls derivatisierte Celluloseether und Silicone in Frage.
Geeignete Siliconverbindungen sind beispielsweise Dimethylpolysiloxane,
Methylphenylpolysiloxane, cyclische Silicone sowie amino-, fettsäure-, alkohol-, polyether-, epoxy-, fluor-, glykosid- und/oder alkylmodifizierte Siliconverbindungen, die bei Raumtemperatur sowohl flüssig als auch harzförmig vorliegen können. Weiterhin geeignet sind Simethicone, bei denen es sich um Mischungen aus Dimethiconen mit einer durchschnittlichen Kettenlange von 200 bis 300 Dimethylsiloxan-Einheiten und hydrierten Silicaten handelt. Eine detaillierte Übersicht über geeignete flüchtige Silicone findet sich zudem von Todd et al. in Cosm.Toil. 91., 27 (1976).
Typische Beispiele für Fette sind Glyceride, als Wachse kommen u.a. natürliche Wachse, wie z.B. Candelillawachs, Carnaubawachs, Japanwachs, Espartograswachs, Korkwachs, Guarumawachs, Reis-keimölwachs, Zuckerrohrwachs, Ouricurywachs, Montanwachs, Bienenwachs, Schellackwachs, Walrat, Lanolin (Wollwachs), Bürzelfett, Ceresin, Ozokerit (Erdwachs), Petrolatum, Paraffinwachse, Mikrowachse; chemisch modifizierte Wachse (Hartwachse), wie z.B. Montanesterwachse, Sasolwachse, hydrierte Jojobawachse sowie synthetische Wachse, wie z.B. Polyalkylenwachse und Polyethylenglycolwachse in Frage.
Als Stabilisatoren können Metallsalze von Fettsäuren, wie z.B. Magnesium-, Aluminium- und/oder Zinkstearat bzw. -ricinoleat eingesetzt werden.
Unter biogenen Wirkstoffen sind beispielsweise Tocopherol, Tocopherolacetat, Tocopherolpalmitat, Ascorbinsäure, Desoxyribonucleinsäure, Retinol, Bisabolol, Allantoin, Phytantriol, Panthenol, AHA- Säuren, Aminosäuren, Ceramide, Pseudoceramide, essentielle Öle, Pflanzenextrakte und Vitaminkomplexe zu verstehen.
Kosmetische Deodorantien (Desodorantien) wirken Körpergerüchen entgegen, überdecken oder beseitigen sie. Körpergerüche entstehen durch die Einwirkung von Hautbakterien auf apokrinen Schweiß, wobei unangenehm riechende Abbauprodukte gebildet werden. Dementsprechend enthalten Deodorantien Wirkstoffe, die als keimhemmende Mittel, Enzyminhibitoren, Geruchsabsorber oder Geruchsüberdecker fungieren.
Als keimhemmende Mittel, die gegebenenfalls den erfindungsgemäßen Kosmetika zugesetzt werden können, sind grundsätzlich alle gegen grampositive Bakterien wirksamen Stoffe geeignet, wie z. B. 4-Hydroxybenzoesäure und ihre Salze und Ester, N-(4-Chlorphenyl)-N'-(3,4 dichlor- phenyl)harnstoff, 2,4,4'-Trichlor-2'-hydroxydiphenylether (Triclosan), 4-Chlor-3,5-dimethylphenol, 2,2'-Methylen-bis(6-brom-4-chlorphenol), 3-Methyl-4-(1 -methylethyl)phenol, 2-Benzyl-4- chlorphenol, 3-(4-Chlorphenoxy)-1 ,2-propandiol, 3-lod-2-propinylbutylcarbamat, Chlorhexidin, 3,4,4'-Trichlorcarbanilid (TTC), antibakterielle Riechstoffe, Menthol, Minzöl, Phenoxyethanol, Glycerinmonolaurat (GML), Diglycerinmonocaprinat (DMC), Salicylsäure-N-alkylamide wie z. B. Salicylsäure-n-octylamid oder Salicylsäure-n-decylamid.
Enzyminhibitoren können den erfindungsgemäßen Kosmetika ebenfalls zugesetzt werden. Beispielsweise sind Esteraseinhibitoren möglicherweise geeignete Enzyminhibitoren. Hierbei handelt es sich vorzugsweise um Trialkylcitrate wie Trimethylcitrat, Tripropylcitrat, Triisopropylcitrat, Tributylcitrat und insbesondere Triethylcitrat (Hydagen® CAT, Henkel KGaA, Düsseldorf/FRG). Die Stoffe inhibieren die Enzymaktivität und reduzieren dadurch die Geruchsbildung. Weitere Stoffe, die als Esteraseinhibitoren in Betracht kommen, sind Sterolsulfate oder -phosphate, wie beispielsweise Lanosterin-, Cholesterin-, Campesterin-, Stigmasterin- und Sitosterinsulfat bzw - phosphat, Dicarbonsäuren und deren Ester, wie beispielsweise Glutarsäure, Glut- arsäuremonoethylester, Glutarsäurediethylester, Adipinsäure, Adipinsäuremonoethylester, Adipinsäurediethylester, Malonsäure und Malonsäurediethylester, Hydroxycarbnonsäuren und deren Ester wie beispielsweise Citronensäure, Äpfelsäure, Weinsäure oder Weinsäurediethylester, sowie Zinkglycinat.
Als Geruchsabsorber eignen sich Stoffe, die geruchsbildende Verbindungen aufnehmen und weitgehend festhalten können. Sie senken den Partialdruck der einzelnen Komponenten und verringern so auch ihre Ausbreitungsgeschwindigkeit. Wichtig ist, daß dabei Parfüms unbeeinträchtigt bleiben müssen. Geruchsabsorber haben keine Wirksamkeit gegen Bakterien. Sie enthalten beispielsweise als Hauptbestandteil ein komplexes Zinksalz der Ricinolsäure oder spezielle, weitgehend geruchsneutrale Duftstoffe, die dem Fachmann als "Fixateure" bekannt sind, wie z. B. Extrakte von Labdanum bzw. Styrax oder bestimmte Abietinsäurederivate. Als Geruchsüberdecker fungieren Riechstoffe oder Parfümöle, die zusätzlich zu ihrer Funktion als Geruchsüberdecker den Deodorantien ihre jeweilige Duftnote verleihen. Als Parfümöle seien beispielsweise genannt Gemische aus natürlichen und synthetischen Riechstoffen. Natürliche Riechstoffe sind Extrakte von Blüten, Stengeln und Blättern, Früchten, Fruchtschalen, Wurzeln, Hölzern, Kräutern und Gräsern, Nadeln und Zweigen sowie Harzen und Balsamen. Weiterhin kommen tierische Rohstoffe in Frage, wie beispielsweise Zibet und Castoreum. Typische synthetische Riechstoffverbindungen sind Produkte vom Typ der Ester, Ether, Aldehyde, Ketone, Alkohole und Kohlenwasserstoffe.
Antitranspirantien (Antiperspirantien) reduzieren durch Beeinflussung der Aktivität der ekkrinen Schweißdrüsen die Schweißbildung, und wirken somit Achselnässe und Körpergeruch entgegen. Wässrige oder wasserfreie Formulierungen von Antitranspirantien enthalten typischerweise folgende Inhaltsstoffe:
(a) adstringierende Wirkstoffe,
(b) ölkomponenten,
(c) nichtionische Emulgatoren,
(d) Coemulgatoren,
(e) Konsistenzgeber,
(f) Hilfsstoffe wie z. B. Verdicker oder Komplexierungsmittel und/oder
(g) nichtwässrige Lösungsmittel wie z. B. Ethanol, Propylenglykol und/oder Glycerin.
Als adstringierende Antitranspirant-Wirkstoffe eignen sich vor allem Salze des Aluminiums, Zirkoniums oder des Zinks. Solche geeigneten antihydrotisch wirksamen Wirkstoffe sind z.B. Aluminiumchlorid, Aluminiumchlorhydrat, Aluminiumdichlorhydrat, Aluminiumsesquichlorhydrat und deren Komplexverbindungen z. B. mit Propylenglycol-1 ,2. Aluminiumhydroxyallantoinat, Aluminiumchloridtartrat, Aluminium-Zirkonium-Trichlorohydrat, Aluminium-Zirkonium-tetrachlorohy- drat, Aluminium-Zirkonium-pentachlorohydrat und deren Komplexverbindungen z. B. mit Aminosäuren wie Glycin.
Daneben können in Antitranspirantien übliche öllösliche und wasserlösliche Hilfsmittel in geringeren Mengen enthalten sein. Solche öllöslichen Hilfsmittel können z.B. sein:
• entzündungshemmende, hautschützende oder wohlriechende ätherische öle,
• synthetische hautschützende Wirkstoffe und/oder
• öllösliche Parfümöle.
Übliche wasserlösliche Zusätze sind z.B. Konservierungsmittel, wasserlösliche Duftstoffe, pH-Wert- Stellmittel, z.B. Puffergemische, wasserlösliche Verdickungsmittel, z.B. wasserlösliche natürliche oder synthetische Polymere wie z.B. Xanthan-Gum, Hydroxyethylcellulose, Polyvinylpyrrolidon oder hochmolekulare Polyethylenoxide.
Als Antischuppenmittel können Climbazol, Octopirox und Zinkpyrethion eingesetzt werden.
Gebräuchliche Filmbildner sind beispielsweise Chitosan, mikrokristallines Chitosan, quaterniertes Chitosan, Polyvinylpyrrolidon, Vinylpyrrolidon-Vinylacetat-Copolymerisate, Polymere der Acrylsäurereihe, quaternäre Cellulose-Derivate, Kollagen, Hyaluronsäure bzw. deren Salze und ähnliche Verbindungen.
Als Quellmittel für wäßrige Phasen können Montmorillonite, Clay Mineralstoffe, Pemulen sowie alkylmodifizierte Carbopoltypen (Goodrich) dienen. Weitere geeignete Polymere bzw. Quellmittel können der Übersicht von R.Lochhead in Cosm.Toil. 108. 95 (1993) entnommen werden.
Unter UV-Lichtschutzfaktoren sind beispielsweise bei Raumtemperatur flüssig oder kristallin vorliegende organische Substanzen (Lichtschutzfilter) zu verstehen, die in der Lage sind, ultraviolette Strahlen zu absorbieren und die aufgenommene Energie in Form längerwelliger Strahlung, z.B. Wärme wieder abzugeben. UVB-Filter können öllöslich oder wasserlöslich sein. Als öllösliche Substanzen sind z.B. zu nennen:
• 3-Benzylidencampher bzw. 3-Benzylidennorcampher und dessen Derivate, z.B. 3-(4- Methylbenzyliden)campher wie in der EP 0693471 B1 beschrieben;
• 4-Aminobenzoesäurederivate, vorzugsweise 4-Dimethylamino)benzoesäure-2-ethylhexylester, 4-(Dimethylamino)benzoesäure-2-octylester und 4-(Dimethylamino)benzoesäureamylester;
• Ester der Zimtsäure, vorzugsweise 4-Methoxyzimtsäure-2-ethylhexylester, 4- Methoxyzimtsäurepropylester, 4-Methoxyzimtsäureisoamylester 2-Cyano-3,3-phenylzimtsäure- 2-ethylhexylester (Octocrylene);
• Ester der Salicylsäure, vorzugsweise Salicylsäure-2-ethylhexylester, Salicylsäure-4- isopropylbenzylester, Salicylsäurehomomenthylester;
• Derivate des Benzophenons, vorzugsweise 2-Hydroxy-4-methoxybenzophenon, 2-Hydroxy-4- methoxy-4'-methylbenzophenon, 2,2'-Dihydroxy-4-methoxybenzophenon;
• Ester der Benzalmalonsäure, vorzugsweise 4-Methoxybenzmalonsäuredi-2-ethylhexylester;
• Triazinderivate, wie z.B. 2,4,6-Trianilino-(p-carbo-2'-ethyl-1'-hexyloxy)-1 ,3,5-triazin und Octyl Triazon, wie in der EP 0818450 A1 beschrieben oder Dioctyl Butamido Triazone (Uvasorb® HEB);
• Propan-1 ,3-dione, wie z.B. 1-(4-tert.Butylphenyl)-3-4'methoxyphenyl)propan-1 ,3-dion;
• Ketotricyclo(5.2.1.0)decan-Derivate, wie in der EP 0694521 B1 beschrieben.
Als wasserlösliche Substanzen kommen in Frage:
• 2-Phenylbenzimidazol-5-sulfonsäure und deren Alkali-, Erdalkali-, Ammonium-, Alkylammonium-, Alkanolammonium- und Glucammoniumsalze;
• Sulfonsäurederivate von Benzophenonen, vorzugsweise 2-Hydroxy-4-methoxybenzophenon-5- sulfonsäure und ihre Salze;
• Sulfonsäurederivate des 3-Benzylidencamphers, wie z.B. 4-(2-Oxo-3-bornylidenme- thyl)benzolsulfonsäure und 2-Methyl-5-(2-oxo-3-bomyliden)sulfonsäure und deren Salze. Als typische UV-A-Filter kommen insbesondere Derivate des Benzoylmethans in Frage, wie beispielsweise 1-(4'-tert.Butylphenyl)-3-(4'-methoxyphenyl)propan-1 ,3-dion, 4-tert.-Butyl-4'- methoxydibenzoylmethan (Parsol 1789), 1-Phenyl-3-(4'-isopropylphenyl)-propan-1 ,3-dion sowie Enaminverbindungen, wie beschrieben in der DE 19712033 A1 (BASF). Die UV-A und UV-B-Filter können selbstverständlich auch in Mischungen eingesetzt werden. Neben den genannten löslichen Stoffen kommen für diesen Zweck auch unlösliche Lichtschutzpigmente, nämlich feindisperse Metalloxide bzw. Salze in Frage. Beispiele für geeignete Metalloxide sind insbesondere Zinkoxid und Titandioxid und daneben Oxide des Eisens, Zirkoniums, Siliciums, Mangans, Aluminiums und Cers sowie deren Gemische. Als Salze können Silicate (Talk), Bariumsulfat oder Zinkstearat eingesetzt werden. Die Oxide und Salze werden in Form der Pigmente für hautpflegende und hautschützende Emulsionen und dekorative Kosmetik verwendet. Die Partikel sollten dabei einen mittleren Durchmesser von weniger als 100 nm, vorzugsweise zwischen 5 und 50 nm und insbesondere zwischen 15 und 30 nm aufweisen. Sie können eine sphärische Form aufweisen, es können jedoch auch solche Partikel zum Einsatz kommen, die eine ellipsoide oder in sonstiger Weise von der sphärischen Gestalt abweichende Form besitzen. Die Pigmente können auch oberflächenbehandelt, d.h. hydrophilisiert oder hydrophobiert vorliegen. Typische Beispiele sind gecoatete Titandioxide, wie z.B. Titandioxid T 805 (Degussa) oder Eusolex® T2000 (Merck). Als hydrophobe Coatingmittel kommen dabei vor allem Silicone und dabei speziell Trialkoxyoctylsilane oder Simethicone in Frage. In Sonnenschutzmitteln werden bevorzugt sogenannte Mikro- oder Nanopigmente eingesetzt. Vorzugsweise wird mikronisiertes Zinkoxid verwendet. Weitere geeignete UV-Lichtschutzfilter sind der Übersicht von P.Finkel in SÖFW-Journal 122, 543 (1996) zu entnehmen.
Neben den beiden vorgenannten Gruppen primärer Lichtschutzstoffe können auch sekundäre Lichtschutzmittel vom Typ der Antioxidantien eingesetzt werden, die die photochemische Reaktionskette unterbrechen, welche ausgelöst wird, wenn UV-Strahlung in die Haut eindringt. Typische Beispiele hierfür sind Aminosäuren (z.B. Glycin, Histidin, Tyrosin, Tryptophan) und deren Derivate, Imidazole (z.B. Urocaninsäure) und deren Derivate, Peptide wie D,L-Carnosin, D- Carnosin, L-Carnosin und deren Derivate (z.B. Anserin), Carotinoide, Carotine (z.B. α-Carotin, ß- Carotin, Lycopin) und deren Derivate, Chlorogensäure und deren Derivate, Liponsäure und deren Derivate (z.B. Dihydroliponsäure), Aurothioglucose, Propylthiouracil und andere Thiole (z.B. Thioredoxin, Glutathion, Cystein, Cystin, Cystamin und deren Glycosyl-, N-Acetyl-, Methyl-, Ethyl-, Propyl-, Amyl-, Butyl- und Lauryl-, Palmitoyl-, Oleyl-, γ-Linoleyl-, Cholesteryl- und Glycerylester) sowie deren Salze, Dilaurylthiodipropionat, Distearylthiodipropionat, Thiodipropionsäure und deren Derivate (Ester, Ether, Peptide, Lipide, Nukleotide, Nukleoside und Salze) sowie Sulfoximinverbindungen (z.B. Buthioninsulfoximine, Homocysteinsulfoximin, Butioninsulfone, Penta-, Hexa-, Heptathioninsulfoximin) in sehr geringen verträglichen Dosierungen (z.B. pmol bis μmol/kg), ferner (Metall)-Chelatoren (z.B. α-Hydroxyfettsäuren, Palmitinsäure, Phytinsäure, Lactoferrin), α-Hydroxysäuren (z.B. Citronensäure, Milchsäure, Äpfelsäure), Huminsäure, Gallensäure, Gallenextrakte, Bilirubin, Biliverdin, EDTA, EGTA und deren Derivate, ungesättigte Fett- sauren und deren Derivate (z.B. γ-Linolensäure, Linolsäure, Ölsäure), Folsäure und deren Derivate, Ubichinon und Ubichinol und deren Derivate, Vitamin C und Derivate (z.B. Ascorbylpalmitat, Mg-Ascorbylphosphat, Ascorbylacetat), Tocopherole und Derivate (z.B. Vitamin- E-acetat), Vitamin A und Derivate (Vitamin-A-palmitat) sowie Koniferylbenzoat des Benzoeharzes, Rutinsäure und deren Derivate, α-Glycosylrutin, Ferulasäure, Furfurylidenglucitol, Carnosin, Butylhydroxytoluol, Butylhydroxyanisol, Nordihydroguajakharzsäure, Nordihydroguajaretsäure, Trihydroxybutyrophenon, Harnsäure und deren Derivate, Mannose und deren Derivate, Superoxid- Dismutase, Zink und dessen Derivate (z.B. ZnO, ZnSO4) Selen und dessen Derivate (z.B. Selen- Methionin), Stilbene und deren Derivate (z.B. Stilbenoxid, trans-Stilbenoxid) und die erfindungsgemäß geeigneten Derivate (Salze, Ester, Ether, Zucker, Nukleotide, Nukleoside, Peptide und Lipide) dieser genannten Wirkstoffe.
Zur Verbesserung des Fließverhaltens können ferner Hydrotrope, wie beispielsweise Ethanol, Isopropylalkohol, oder Polyole eingesetzt werden. Polyole, die hier in Betracht kommen, besitzen vorzugsweise 2 bis 15 Kohlenstoffatome und mindestens zwei Hydroxylgruppen. Die Polyole können noch weitere funktionelle Gruppen, insbesondere Aminogruppen, enthalten bzw. mit Stickstoff modifiziert sein. Typische Beispiele sind
• Glycerin;
• Alkylenglycole, wie beispielsweise Ethylenglycol, Diethylenglycol, Propylenglycol, Butylenglycol, Hexylenglycol sowie Polyethylenglycole mit einem durchschnittlichen Molekulargewicht von 100 bis 1.000 Dalton;
• technische Oligoglyceringemische mit einem Eigenkondensationsgrad von 1 ,5 bis 10 wie etwa technische Diglyceringemische mit einem Diglyceringehalt von 40 bis 50 Gew.-%;
• Methyolverbindungen, wie insbesondere Trimethylolethan, Trimethylolpropan, Trimethylolbutan, Pentaerythrit und Dipentaerythrit;
• Niedrigalkylglucoside, insbesondere solche mit 1 bis 8 Kohlenstoffen im Alkylrest, wie beispielsweise Methyl- und Butylglucosid;
• Zuckeralkohole mit 5 bis 12 Kohlenstoffatomen, wie beispielsweise Sorbit oder Mannit,
• Zucker mit 5 bis 12 Kohlenstoffatomen, wie beispielsweise Glucose oder Saccharose;
• Aminozucker, wie beispielsweise Glucamin;
• Dialkoholamine, wie Diethanolamin oder 2-Amino-1 ,3-propandiol.
Als Konservierungsmittel eignen sich beispielsweise Phenoxyethanol, Formaldehydlösung, Parabene, Pentandiol oder Sorbinsäure sowie die in Anlage 6, Teil A und B der Kosmetikverordnung aufgeführten weiteren Stoffklassen. Als Insekten-Repellentien kommen N,N-Diethyl-m-toluamid, 1,2-Pentandiol oder Ethyl Butylacetylaminopropionate in Frage, als Selbstbräuner eignet sich Dihydroxyaceton. Als Parfümöle seien genannt Gemische aus natürlichen und synthetischen Riechstoffen. Natürliche Riechstoffe sind Extrakte von Blüten (Lilie, Lavendel, Rosen, Jasmin, Neroli, Ylang-Ylang), Stengeln und Blattern (Geranium, Patchouli, Petitgrain), Früchten (Anis, Koriander, Kümmel, Wacholder), Fruchtschalen (Bergamotte, Zitrone, Orangen), Wurzeln (Macis, Angelica, Sellerie, Kardamon, Costus, Iris, Calmus), Hölzern (Pinien-, Sandel-, Guajak-, Zedern-, Rosenholz), Kräutern und Gräsern (Estragon, Lemongras, Salbei, Thymian), Nadeln und Zweigen (Fichte, Tanne, Kiefer, Latschen), Harzen und Balsamen (Galbanum, Elemi, Benzoe, Myrrhe, Olibanum, Opoponax). Weiterhin kommen tierische Rohstoffe in Frage, wie beispielsweise Zibet und Castoreum. Typische synthetische Riechstoffverbindungen sind Produkte vom Typ der Ester, Ether, Aldehyde, Ketone, Alkohole und Kohlenwasserstoffe.
Als Farbstoffe können die für kosmetische Zwecke geeigneten und zugelassenen Substanzen verwendet werden, wie sie beispielsweise in der Publikation "Kosmetische Färbemittel" der Farbstoffkommission der Deutschen Forschungsgemeinschaft, Verlag Chemie, Weinheim, 1984, S.81-106 zusammengestellt sind. Diese Farbstoffe werden üblicherweise in Konzentrationen von 0,001 bis 0,1 Gew.-%, bezogen auf die gesamte Mischung, eingesetzt.
Der Gesamtanteil der Hilfs- und Zusatzstoffe kann 1 bis 50, vorzugsweise 5 bis 40 Gew.-% - bezogen auf die Mittel - betragen. Die Herstellung der Mittel kann durch übliche Kalt - oder Heißprozesse erfolgen; vorzugsweise arbeitet man nach der Phaseninversionstemperatur- Methode.
Ein weiterer Gegenstand der Erfindung ist ein Oxidationsfärbemittel zum Färben von Keratinfasern, enthaltend erfindungsgemäß verwendbare Cholinoxidasen und insbesondere erfindungsgemäße Cholinoxidasen. Als Keratinfasern sind dabei Wolle, Federn, Pelze und insbesondere menschliche Haare zu verstehen.
Zur Herstellung der erfindungsgemäßen Oxidationsmittel werden die Oxidationsfarbstoffvorprodukte sowie die Cholinoxidasen in einen geeigneten wäßrigen Träger unter Ausschluss von Luftsauerstoff eingearbeitet. Solche Träger sind z. B. verdickte wäßrige Lösungen, Cremes (Emulsionen), Gele oder tensidhaltige schäumende Zubereitungen, z. B. Shampoos oder Schaumaerosole oder andere Zubereitungen, die für die Anwendung auf dem Haar geeignet sind.
Grundsätzlich sind auch wasserfreie Pulver als Träger geeignet; in diesem Falle werden die Oxidationsfärbemittel unmittelbar vor der Anwendung in Wasser gelöst oder dispergiert. Als Trägerkomponenten werden bevorzugt
Netz- und Emulgiermittel
Verdickungsmittel
Reduktionsmittel (Antioxidantien) haarpflegende Zusätze Duftstoffe und
Lösungsmittel wie z. B. Wasser, Glycole oder niedere Alkohole eingesetzt.
Als Netz- und Emulgiermittel eignen sich z. B. anionische, zwitterionische, ampholytische und nichtionische Tenside. Auch kationische Tenside können zur Erzielung bestimmter Effekte eingesetzt werden.
Als Verdickungsmittel eignen sich die wasserlöslichen hochmolekularen Polysaccharid-Derivate oder Polypep-tide, z. B. Cellulose- oder Stärkeether, Gelatine, Pflanzengumme, Biopolymere (Xanthan-Gum) oder wasserlösliche synthetische Polymere wie z. B. Polyvinylpyrrolidon, Polyvinylalkohol, Polyethylenoxide, Polyacrylamide, Polyurethane, Polyacrylate und andere.
Weiterhin kann man tensidhaltige Zubereitungen auch durch Solubilisierung oder Emulgierung von polaren Lipiden verdicken. Solche Lipide sind z. B. Fettalkohole mit 12-18 C-Atomen, (freie) Fettsäuren mit 12-18 C-Atomen, Fettsäurepartialglyceride, Sorbitanfettsäureester, Fettsäurealkanolamide, niedrig oxethylierte Fettsäuren oder Fettalkohole, Lecithine, Sterine. Schließlich kann man gelförmige Träger auch auf Basis wässriger Seifengele, z. B. von Ammo- nium-Oleat, erzeugen.
Reduktionsmittel (Antioxidantien), die dem Träger zugesetzt werden, um eine vorzeitige oxidative Entwicklung des Farbstoffs vor der Anwendung auf dem Haar zu verhindern, sind z. B. Natriumsulfit oder Natriumascorbat.
Haarpflegende Zusätze können z.B. Fette, öle oder Wachse in emulgierter Form, strukturgebende Additive wie z. B. Glucose oder Pyridoxin, avivierende Komponenten wie z. B. wasserlösliche Proteine, Proteinabbauprodukte, Aminosäuren, wasserlösliche kationische Polymere, Silicone, Vitamine, Panthenol oder Pflanzenextrakte sein.
Schließlich können Duftstoffe und Lösungsmittel wie z. B. Glycole wie 1 ,2-Propylenglycole, Glycerin, Glycolether wie z. B. Butylglycol, Ethyldiglycol oder niedere einwertige Alkohole wie Ethanol oder Isopropanol enthalten sein.
Zusätzlich können noch weitere Hilfsmittel enthalten sein, die die Stabilität und Anwendungseigenschaften der Oxdationsfärbemittel verbessern, z. B. Komplexbildner wie EDTA, NTA oder Organophosphonate, Quell- und Penetrationsmittel wie z. B. Harnstoff, Guanidin, Hydrogencarbonate, Puffersalze wie z. B. Ammoniumchlorid, Ammoniumeitrat, Ammoniumsulfat oder Alkanolammoniumsalze und gegebenenfalls Treibgase. Ein weiterer Gegenstand der Erfindung ist ein Mittel zur Mund-, Zahn- oder Zahnprothesenpflege, insbesondere Prothesenreiniger, enthaltend erfindungsgemäße Cholinoxidasen zur Bleiche oder zur Desinfektion.
Bei Teilprothesen bzw. Gebissen eignet sich sowohl die Darreichung als Gebissreinigungstabletten, als auch als Mundspülung bzw. Mundwasser oder als Zahnpasta.
Die erfindungsgemäßen Mund-, Zahn- und/oder Zahnprothesenpflegemittel können beispielsweise als Mundwasser, Gel, flüssige Zahnputzlotion, steife Zahnpaste, Gebissreiniger oder Prothesenhaftcreme vorliegen.
Hierzu ist es erforderlich, die erfindungsgemäßen Cholinoxidasen in einen geeigneten Träger einzuarbeiten.
Als Träger können z.B. auch pulverförmige Zubereitungen oder wässrig-alkoholische Lösungen dienen, die als Mundwässer 0 bis 15 Gew.-% Ethanol, 1 bis 1 ,5 Gew.-% Aromaöle und 0,01 bis 0,5 Gew.-% Süßstoffe oder als Mundwasser-Konzentrate 15 bis 60 Gew.-% Ethanol, 0,05 bis 5 Gew.- % Aromaöle, 0,1 bis 3 Gew.-% Süßstoffe sowie ggf. weitere Hilfsstoffe enthalten können und vor Gebrauch mit Wasser verdünnt werden. Die Konzentration der Komponenten muss dabei so hoch gewählt werden, dass nach Verdünnung die genannten Konzentrationsuntergrenzen bei der Anwendung nicht unterschritten werden.
Als Träger können aber auch Gele sowie mehr oder weniger fließfähige Pasten dienen, die aus flexiblen Kunststoffbehältern oder Tuben ausgedrückt und mit Hilfe einer Zahnbürste auf die Zähne aufgetragen werden. Solche Produkte enthalten höhere Mengen an Feuchthaltemitteln und Bindemitteln oder Konsistenzreglern und Polierkomponenten. Darüber hinaus sind auch in diesen Zubereitungen Aromaöle, Süßstoffe und Wasser enthalten.
Als Feuchthaltemittel können dabei z.B. Glycerin, Sorbit, XyNt, Propylenglykole, Polyethenylenglycole oder Gemische dieser Polyole, insbesondere solche Polyethenylenglycole mit Molekulargewichten von 200 bis 800 (von 400 - 2000 ) verwendet werden enthalten sein. Bevorzugt ist als Feuchthaltemittel Sorbit in einer Menge von 25 - 40 Gew.-% enthalten.
Als Antizahnstein-Wirkstoffe und als Demineralisierungs-Inhibitoren können kondensierten Phosphate in Form ihrer Alkalisalze, bevorzugt in Form ihrer Natrium- oder Kaliumsalze enthalten sein. Die wäßrigen Lösungen dieser Phosphate reagieren aufgrund hydrolytischer Effekte alkalisch. Durch Säurezusatz wird der pH-Wert der erfindungsgemäßen Mund-, Zahn- und/oder Zahnprothesenpflegemittel auf die bevorzugten Werte von 7,5 - 9 eingestellt. Es können auch Gemische verschiedener kondensierter Phosphate oder auch hydratisierte Salze der kondensierten Phosphate eingesetzt werden. Die spezifizierten Mengen von 2 - 12 Gew.-% beziehen sich jedoch auf die wasserfreien Salze. Bevorzugt ist als kondensiertes Phosphat ein Natrium- oder Kalium-tripolyphosphat in einer Menge von 5 - 10 Gew.-% der Zusammensetzung enthalten.
Ein bevorzugt enthaltener Wirkstoff ist eine karieshemmende Fluorverbindung, bevorzugt aus der Gruppe der Fluoride oder Monofluorophosphate in einer Menge von 0,1 - 0,5 Gew.-% Fluor. Geeignete Fluorverbindungen sind z.B. Natriummonofluorophosphat (Na2PO3F), Kaliummonofluorophosphat, Natrium- oder Kaliumfluorid, Zinnfluorid oder das Fluorid einer organischen Aminoverbindung.
Als Bindemittel und Konsistenzregler dienen z.B. natürliche und synthetische wasserlösliche Polymere wie Carragheen, Traganth, Guar, Stärke und deren nichtionogene Derivate wie z.B. Hydroxypropylguar, Hydroxyethylstärke, Celluloseether wie z.B. Hydroxyethylcellulose oder Methylhydroxypropylcellulose. Auch Agar-Agar, Xanthan-Gum, Pektine, wasserlösliche Carboxyvinylpolymere (z.B. Carbopol®-Typen), Polyvinylalkohol, Polyvinylpyrrolidon, höhermolekulare Polyethylenglykole (Molekulargewicht 103 bis 106 D). Weitere Stoffe, die sich zur Viskositätskontrolle eignen, sind Schichtsilikare wie z.B. Montmorillonit-Tone, kolloidale Verdickungskieselsäuren, z.B. Aerogel-Kieselsäure oder pyrogene Kieselsäuren.
Als Polierkomponenten können alle hierfür bekannten Poliermittel, bevorzugt aber Fällungs- und Gelkieselsäuren, Aluminiumhydroxid, Aluminiumsilicat, Aluminiumoxid, Aluminiumoxidtrihydrat, unlösliches Natriummetaphosphat, Calciumpyrophosphat, Calciumhydrogenphosphat, Dicalciumphosphat, Kreide, Hydroxylapatit, Hydrotalcite, Talkum, Magnesiumaluminiumsilicat (Veegum®), Calciumsulfat, Magnesiumcarbonat, Magnesiumoxid, Natriumaluminiumsilikate, z.B. Zeolith A oder organische Polymere, z.B. Polymethacrylat, eingesetzt werden. Die Poliermittel werden vorzugsweise in kleineren Mengen von z.B. 1 - 10 Gew.-% verwendet.
Die erfindungsgemäßen Zahn- und/oder Mundpflegeprodukte können durch Zugabe von Aromaölen und Süßungsmitteln in ihren organoleptischen Eigenschaften verbessert werden. Als Aromaöle kommen alle für Mund-, Zahn- und/oder Zahnprothesenpflegemittel gebräuchlichen natürlichen und synthetischen Aromen in Frage. Natürliche Aromen können sowohl in Form der aus den Drogen isolierten etherischen Öle als auch der aus diesen isolierten Einzelkomponenten verwendet werden. Bevorzugt sollte wenigstens ein Aromaöl aus der Gruppe Pfefferminzöl, Krauseminzöl, Anisöl, Kümmelöl, Eukalyptusöl, Fenchelöl, Zimtöl, Geraniumöl, Salbeiöl, Thymianöl, Majoranöl, Basilikumöl, Citrusöl, Gaultheriaöl oder eine oder mehrere daraus isolierte synthetisch erzeugten Komponenten dieser öle enthalten sein. Die wichtigsten Komponenten der genannten öle sind z.B. Menthol, Carvon, Anethol, Cineol, Eugenol, Zimtaldehyd, Geraniol, Citronellol, Linalool, Salven, Thymol, Terpinen, Terpinol, Methylchavicol und Methylsalicylat. Weitere geeignete Aromen sind z.B. Menthylacetat, Vanillin, Jonone, Linalylacetat, Rhodinol und Piperiton. Als Süßungsmittel eignen sich entweder natürliche Zucker wie Sucrose, Maltose, Lactose und Fructose oder synthetische Süßstoffe wie z.B. Saccharin-Natriumsalz, Na- triumcyclamat oder Aspartam.
Als Tenside sind dabei insbesondere Alkyl- und/oder Alkenyl-(oligo)-glycoside einsetzbar. Ihre Herstellung und Verwendung als oberflächenaktive Stoffe sind beispielsweise aus US-A-3 839 318, US-A-3 707 535, US-A-3 547 828 DE-A- 19 43 689, DE-A-20 36 472 und DE-A-30 01 064 sowie EP-A-77 167 bekannt. Bezüglich des Glycosidrestes gilt, daß sowohl Monoglycoside (x = 1), bei denen ein Pentose- oder Hexoserest glycosidisch an einen primären Alkohol mit 4 bis 16 C- Atomen gebunden ist, als auch oligomere Glycoside mit einem Oligomerisationsgrad x bis 10 geeignet sind. Der Oligomerisationsgrad ist dabei ein statistischer Mittelwert, dem eine für solche technischen Produkte übliche Homologenverteilung zugrunde liegt.
Bevorzugt eignet sich als Alkyl- und/oder Alkenyl-(oligo)-glycosid ein Alkyl- und/oder Alkenyl- (oligo)-glucosid der Formel RO(C6H10O)x-H, in der R eine Alkyl- und/oder Alkenyl-gruppe mit 8 bis 14 C-Atomen ist und x einen Mittelwert von 1 bis 4 hat. Besonders bevorzugt sind Alkyloligo- glucoside auf Basis von gehärtetem C12/i4-Kokosalkohol mit einem DP von 1 bis 3. Das Alkyl- und/oder Alkenyl-glycosid-Tensid kann sehr sparsam verwendet werden, wobei bereits Mengen von 0,005 bis 1 Gew.-% ausreichend sind.
Außer den genannten Alkylglucosid-Tensiden können auch andere nichtionische, ampholytische und kationische Tenside enthalten sein, als da beispielsweise sind: Fettalkoholpolyglycol- ethersulfate, Monoglyceridsulfate, Monoglyceridethersulfate, Mono- und/oder Dialkylsulfosuccinate, Fettsäureisethionate, Fettsäuresarcosinate, Fettsäuretauride, Fettsäureglutamate,
Ethercarbonsäuren, Fettsäureglucamide, Alkylamido-betaine und/oder Proteinfettsäurekondensate, letztere vorzugsweise auf Basis von Weizenproteinen. Insbesondere zur Solubilisierung der meist wasserunlöslichen Aromaöle kann ein nichtionogener Lösungsvermittler aus der Gruppe der oberflächenaktiven Verbindungen erforderlich sein. Besonders geeignet für diesen Zweck sind z.B. oxethylierte Fettsäureglyceride, oxethylierte Fettsäuresorbitanpartialester oder Fettsäurepartialester von Glycerin- oder Sorbitan-Oxethylaten. Lösungsvermittler aus der Gruppe der oxethylierten Fettsäureglyceride umfassen vor allem Anlagerungsprodukte von 20 bis 60 Mol Ethylenoxid an Mono- und Diglyceride von linearen Fettsäuren mit 12 bis 18 C-Atomen oder an Triglyceride von Hydroxyfettsäuren wie Oxystearinsäure oder Ricinolsäure. Weitere geeignete Lösungsvermittler sind oxethylierte Fettsäuresorbitanpartialester; das sind bevorzugt Anlagerungsprodukte von 20 bis 60 Mol Ethylenoxid an Sorbitanmonoester und Sorbitandiester von Fettsäuren mit 12 bis 18 C-Atomen. Ebenfalls geeignete Lösungsvermittler sind Fettsäurepartialester von Glycerin- oder Sorbitan-Oxethylaten; das sind bevorzugt Mono- und Diester von C12-Ci8-Fettsäuren und Anlagerungsprodukten von 20 bis 60 Mol Ethylenoxid an 1 Mol Glycerin oder an 1 Mol Sorbit. Die erfindungsgemäßen Mund-, Zahn- und/oder Zahnprothesenpflegemittel enthalten bevorzugt als Lösungsvermittler für gegebenenfalls enthaltene Aromaöle Anlagerungsprodukte von 20 bis 60 Mol Ethylenoxid an gehärtetes oder ungehärtetes Rizinusöl (d.h. an Oxystearinsäure- oder Ricinolsäure-triglycerid), an Glyzerin-mono- und/oder -distearat oder an Sorbitanmono- und/oder - distearat.
Weitere übliche Zusätze für die Mund-, Zahn- und/oder Zahnprothesenpflege mittel sind z.B. Pigmente, z.B. Titandioxid, und/oder Farbstoffe pH-Stellmittel und Puffersubstanzen wie z.B. Natriumbicarbonat, Natriumeitrat, Natriumbenzoat, Zitronensäure, Phosphorsäure oder saure Salze, z.B. NaH2PO4 wundheilende und entzündungshemmende Stoffe wie z.B. Allantoin, Harnstoff, Panthenol, Azulen bzw. Kamillenextrakt weitere gegen Zahnstein wirksame Stoffe wie z.B. Organophosphonate, z.B. Hydroxyethandiphosphonate oder Azacycloheptandiphosphonat Konservierungsstoffe wie z.B. Sorbinsäure-Salze, p-Hydroxybenzoesäure-Ester. Plaque-Inhibitoren wie z.B. Hexachlorophen, Chlorhexidin, Hexetidin, Triclosan, Bromchlorophen, Phenylsalicylsäureester.
In einer besonderen Ausführungsform ist die Zusammensetzung eine Mundspülung, ein Mundwasser, ein Prothesenreiniger oder ein Prothesenhaftmittel.
Für erfindungsgemäß bevorzugte Prothesenreiniger, insbesondere Prothesenreinigungstabletten und -pulver, eignen sich neben den schon genannten Inhaltsstoffen für die Mund-, Zahn- und/oder Zahnprothesenpflege zusätzlich noch Per-Verbindungen wie beispielsweise Peroxoborat, Peroxomonosulfat oder Percarbonat. Sie haben den Vorteil, dass sie neben der Bleichwirkung gleichzeitig auch desodorierend und/oder desinfizierend wirken. Der Einsatz solcher PerVerbindungen in Prothesenreinigern beträgt zwischen 0,01 und 10 Gew.-%, insbesondere zwischen 0,5 und 5 Gew.-%.
Als weitere Inhaltsstoffe sind auch Enzyme, wie z.B. Proteasen und Carbohydrase, zum Abbau von Proteinen und Kohlenhydraten geeignet. Der pH-Wert kann zwischen pH 4 und pH 12, insbesondere zwischen pH 5 und pH 11 liegen.
Für die Prothesenreinigungstabletten sind zusätzlich noch weitere Hilfsstoffe notwendig, wie beispielsweise Mittel, die einen sprudelnden Effekt hervorrufen, wie z.B. CO2 freisetzende Stoffe wie Natriumhydrogencarbonat, Füllstoffe, z.B. Natriumsulfat oder Dextrose, Gleitmittel, z.B. Magnesiumstearat, Fließregulierungsmittel, wie beispielsweise kolloidales Siliziumdioxid und Granuliermittel, wie die bereits erwähnten hochmolekularen Polyethylenglykole oder Polyvinylpyrrolidon. Prothesenhaftmittel können als Pulver, Cremes, Folien oder Flüssigkeiten angeboten werden und unterstützen die Haftung der Prothesen.
Als Wirkstoffe sind natürliche und synthetische Quellstoffe geeignet. Als natürliche Quellstoffe sind neben Alginaten auch Pflanzengummen, wie z.B. Gummi arabicum, Traganth und Karaya-Gummi sowie natürlicher Kautschuk aufzufassen. Insbesondere haben sich Alginate und synthetische Quellstoffe, wie z.B. Natriumcarboxymethylcellulose, hochmolekulare Ethylenoxid-Copolymere, Salze der Poly(vinyl-ether-co-maleinsäure) und Polyacrylamide.
Als Hilfsstoffe für pastöse und flüssige Produkte eignen sich besonders hydrophobe Grundlagen, insbesondere Kohlenwasserstoffe, wie beispielsweise Weißes Vaselin (DAB) oder Paraffinöl.
Ein weiterer Gegenstand der Erfindung ist ein Signal-Reagenz zur Erzeugung einer Lichtemission in einem Chemilumineszenz-Assay, umfassend eine erfindungsgemäße Cholinoxidase, ein Cholinoxidase-Substrat und ein Chemilumineszenz-Reagens. Das Cholinoxidase-Substrat ist vorzugsweise Cholin. Bevorzugtermaßen ist das Chemilumineszenz-Reagens Luminol.
Chemilumineszenz-Tests sind von erheblicher Bedeutung im Bereich der Medizin und der Biowissenschaften. Besonders wichtig sind Immunotests (Immunoassays) und DNA-Sonden- Analysen. Vorteilhafterweise liefern erfindungsgemäße Cholinoxidasen, die Sauerstoff enthaltende freie Radikale (z.B. Superoxid-Anion, Hydroxyl-Radikal) und Peroxide (Hydrogenperoxid) erzeugen, bei der Reaktion mit Chemilumineszenz-Reagentien wie Lucigenin, Luminol und dessen Derivaten langlebige chemilumineszierende nachweisbare Produkte. Diese Cholinoxidase- Systeme sind von besonderem Nutzen als Tracer für den Nachweis von Analyten bei Immunoassays, Immunoblotting oder Nucleotid-Sonden-Analysen zur Bereitstellung langlebiger, Licht emittierender Einheiten nach der Reaktion mit einem Chemilumineszenz-Reagens.
Ein weiterer Gegenstand der Erfindung ist die Verwendung einer erfindungsgemäß verwendbaren Cholinoxidase und insbesondere einer erfindungsgemäßen Cholinoxidase, zur Herstellung von Betain, zur Herstellung von Lebensmitteln und/oder Lebensmittelbestandteilen sowie zur Herstellung von Tierfutter und/oder Tierfutterbestandteilen.
Betain ist als pflegender Bestandteil in Shampoos und Haarpflegemitteln sowie in Waschmitteln von Bedeutung. Außerdem wird es als Nahrungsergänzungsmittel in Tierfutter eingesetzt, da es eine protektive Wirkung auf die Leber entfaltet.
Die folgenden Beispiele erläutern die Erfindung, ohne sie jedoch darauf einzuschränken: Beispiel 1 : Klonierung der Cholinoxidase KC2s
Soweit nicht anders vermerkt werden die Teilschritte nach den in Sambrook, J., Fritsch, E. F. and Maniatis, T. 2001. Molecular cloning: a laboratory manual, 3. Edition CoId Spring Laboratory Press, beschriebenen Standardmethoden durchgeführt.
Arthrobacter nicotianiae (KC2) (DSMZ-ID 96-878) wird in einem Corynebakterium-Medium (Casein-Pepton 10 g/l, Hefe Extrakt 5 g/l, Glucose 5 g/l, Natriumchlorid 5 g/l) für 27 h bei 30 0C und 120 rpm kultiviert. Die genomische DNA wird isoliert und das KC2s-Gen durch eine PCR mit den Primern KC2spETNF und KC2pETHR amplifiziert. Das resultierende PCR-Fragment wird in die Λ/cTel -/-//V?c/111 -S ite des Vektors pET 26 b+ (Novagen, Kat.-Nr. 69862-3) mittels kloniert und das entstandene Konstrukt pET KC2s in kompetente E. coli BL21 Gold (DE3) (Stratagene, Kat.-Nr. 230132) transformiert. Daraus wird der Stamm E. coli pETKC2s nach Selektion auf Kanamycin- Resistenz erhalten.
Sequenzen der verwendeten Primer:
KC2spETNF: 5' - TTCCATATGAACATTGAAAAGAAGGACTTCGACTACATTG - 3'
KC2pETHR: 5' - CCCAAGCTTCTAGGCTTCGCTAACCAGTTCG - 3'
Beispiel 2: Erzeugung der Mutanten
Das Plasmid pET KC2s wird aus E. coli pETKC2s-Kulturen nach Standardmethoden (Sambrook et al.) isoliert und als doppelsträngiges Template in einer ortsgerichteten Mutagenese mittels QuikChange Kit (Stratagene, Kat.-Nr. 200518) eingesetzt. Die untenstehende Tabelle gibt die zur Mutagenese benötigten Primer an.
Tabelle 1 : Name und Sequenz der zur Mutagenese verwendeten Primer. Für jede Mutante wird ein komplementäres Primerpaar auf Forward- und Reverse-Primer benötigt.
Mutante Primer Name Primer Sequenz
Glu4Gly Glu4Gly_Forward 5'-gagatatacatatgaacattggaaagaaggacttcg-3'
Glu4Gly_Reverse 5'-cgaagtccttctttccaatgttcatatgtatatctc-3'
Ala21Val Ala21Val_Forward 5'-gcggttctgccggcgctgtggtggcttctcgcctgag-3'
Ala21Val_Reverse 5'-ctcaggcgagaagccaccacagcgccggcagaaccgc-3'
Gly62Asp Gly62Asp_Forward 5'-gaactgctggaatccgacttggactgggactacc-3'
Gly62Asp_Reverse 5'-ggtagtcccagtccaagtcggattccagcagttc-3' lle69Val lle69Val_Forward 5'-gactgggactacccggtcgaaccgcaggaaaac-3' lle69Val_Reverse 5'-gttttcctgcggttcgaccgggtagtcccagtc-3'
Met79Val Met79Val Forward 5'-gaaaacggcaactcgttcgtgcgccatgcccgtgc-3' Met79Val_Reverse 5'-gcacgggcatggcgcacgaacgagttgccgttttc-3'
Asp166Gly Asp166Gly_Forward 5'-cggcgtggcaatcctgggcgccgccgagcaggcagg-3' Asp166Gly_Reverse 5'-cctgcctgctcggcggcgcccaggattgccacgccg-3'
Arg249His Arg249His_Forward 5'-gacggggccttcggccacaccgtgacgctgaacg-3' Arg249His_Reverse 5'-cgttcagcgtcacggtgtggccgaaggccccgtc-3'
Val260lle Val260lle_Forward 5'-cgcccgcgaggtcatcgtctccgccggcgc-3' Val260lle_Reverse 5'-gcgccggcggagacgatgacctcgcgggcg -3'
Ser321 Phe Ser321 Phe_Forward 5'-ccgatggttgaaaccttcacccagtggtgggaaatc-3' Ser321 Phe_Reverse 5'-gatttcccaccactgggtgaaggtttcaaccatcgg-3'
Ser348Leu Ser348Leu Forward 5'-gatctgatgatgcactacggtttggtgcccttcgacatgcacac-3'
5'-gtgtgcatgtcgaagggcaccaaaccgtagtgcatcatcagatc-
Ser348Leu_Reverse 3' Phe351Tyr Phe351Tyr_Forward 5'-cactacggtttggtgccctacgacatgcacaccctg-3'
Phe351Tyr_Reverse 5'-cagggtgtgcatgtcgtagggcaccaaaccgtagtg-3' Lys394Arg Lys394Arg_Forward 5'-gacttccgcgacaagccgagggtcgaccctcgctacttcac-3'
Lys394Arg_Reverse 5'-gtgaagtagcgagggtcgaccctcggcttgtcgcggaagtc-3'
Kombinationen von Mutationen wurden durch schrittweise Mutation mit dem QuikChange Kit erhalten.
Folgende Mutanten wurden erhalten:
Ala21Val, Gly62Asp, lle69Val, Met79Val, Phe351Tyr, Ala21Val + Gly62Asp, Ala21Val +
Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321 Phe + Phe351Tyr, Asp166Gly +
Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr +
Lys394Arg, Ala21Val + Gly62Asp + lle69Val + Ser348Leu, ThM 161Ie + Lys128Met, Pro393Gln +
Ser530Gly, Pro393Gln, Ser530Gly
Beispiel 3: Isolierung der Cholinoxidase KC2s und Mutanten
E. coli pETKC2s oder ein Stamm, der das Gen einer Mutante trägt wurden in 10-25 ml LB-Medium (10 g/l Trypton, 5 g/l Hefeextrakt, 10 g/l Natriumchlorid, pH 7) mit Kanamycin als Selektionsagens bei 37 0C und 250 rpm inkubiert bis eine OD (λ=600 nm) von 0,8 erreicht war. Die Induktion der Proteinexpression erfolgte durch Zugabe von IPTG bis zu einer Endkonzentration von 100 μM. Nach weiteren 4 h Inkubation bei 37 0C und 250 rpm wurden die Zellen durch Zentrifugation geerntet und mit dem BugBuster-Kit (Novagen, Kat.-No. 70750-3) aufgeschlossen. Der erhaltene Rohextrakt wurde über PD-10 Säulen (Amersham Pharmacia Biotech, Kat-Nr. 17-0851-01) in 20 mM Tris-HCI-Puffer, pH = 8 nach dem vom Hersteller empfohlenen Protokoll umgepuffert und anschließend über Vivapure Maxi Q (Vivascience, Kat.-Nr. IX20QH08) nach dem vom Hersteller angegebenen Protokoll aufgereinigt (Lade- und Equlibrierungspuffer 20 mM Tris-HCI, pH 8, Elutionspuffer 20 mM Tris-HCI, pH 8 mit 1 M NaCI). Die Entsalzung erfolgte wie bereits angegeben über PD-10-Säulen.
Beispiel 4: Bestimmung der Spezifischen Aktivität
Berechnung und Definition:
Die spezifische Aktivität wird als Quotient aus der Aktivität und dem Proteingehalt erhalten. Die Aktivitätsbestimmung beruht auf dem Nachweis von Wasserstoffperoxid, das während der Cholinoxidasekatalyse aus dem Substrat und Luftsauerstoff gebildet wird. Hierbei bezeichnet die Einheit ein Unit (U) die Menge an Enzym, die in einer Minute ein μmol H2O2 produziert. Angegeben wird die katalytische Aktivitätskonzentration in mU/μl (entspricht 1Cf3 U/μl) als Aktivität pro Probenvolumen. Der Proteinkonzentration wird mit einem kommerziell erhältlichen Test bestimmt und in mg/ml angegeben. Die Standardkurve wird mit BSA erstellt.
1. Lösungen
Zur Bestimmung der Cholinoxidase-Aktivität werden folgende Lösungen benötigt:
Peroxidreagenz: 75 mM K2HPO4, 125 mM NaH2PO4, 12,5 mM Chromotropsäure und 0,6 mM 4-
Aminoantipyrin
200 mM Phosphatpuffer pH=6,5: 75 mM K2HPO4, 125 mM NaH2PO4
Peroxidaselösung: 52 U/mL Peroxidase aus Meerrettich in Phosphatpuffer
Davis-Puffer: 25 mM Citronensäure x 1 H2O1 25 mM NaB4O7 x 1 H2O, 25 mM KCl, 25 mM KH2PO4,
25 mM Tris-(hydroxymethyl)-aminomethan, pH 9,5
20 mM NaN3 in Davis-Puffer pH=9,5
Substratlösung: 250 mM Substrat in dest. H2O. Verwendete Substrate: Cholinchlorid, Bis (2-
Hydroxyethyl) dimethylammoniumchlorid (DMDEA), Triethanolamin (TEA),
Methyltriethanolammoniumchlorid (MTEA)
2. Durchführung:
Zu 150 μl Cholinoxidase-haltiger Lösung (ggf. entsprechend mit dest. H2O verdünnt) werden 30 μL
20 mM NaN3-Lösung, 45 μL Davis-Puffer pH=9,5 und 150 μL Substratlösung gegeben und der
Ansatz nach Mischen für 30 min bei 800 rpm und 37°C inkubiert. Anschließend werden 525 μL
Peroxidreagenz und 75 μL Peroxidaselösung zugegeben und bei Raumtemperatur für 5 min inkubiert. Schließlich wird die Absorption der Lösung bei einer Wellenlänge von λ=600 nm bestimmt.
Die Bestimmung der Aktivität erfolgt durch den Vergleich mit einer Kalibrationskurve, die mit einer geeigneten Verdünnungsreihe von Wasserstoffperoxid in 20 mM Phosphatpuffer (pH 6,5) unter den oben beschriebenen Bedingungen erstellt wurde. Angegeben wird die katalytische
Aktivitätskonzentration in mU/μl (entspricht 10"3 U/μl) als Aktivität pro Probenvolumen. Die Proteinmenge pro Probenvolumen wird mit dem BCA Protein Assay Kit (Pierce Biotech nology, Kat.-Nr. 23227) nach dem von Hersteller vorgeschlagenen Protokoll bestimmt und in mg/ml angegeben. Die spezifische Aktivität bezeichnet die Aktivität pro mg Protein und wird angegeben in U/mg bzw. mU/mg = 10'3 U/mg.
Zum Vergleich werden die spezifischen Aktivitäten der Mutanten auf die spezifischen Aktivitäten des Wildtyps KC2s bezogen. Hierzu werden die relativen spezifischen Aktivitäten als die Quotienten aus der spezifischen Aktivität der Mutante bezüglich eines Substrats und der spezifischen Aktivität des Wildtyps (KC2s) bezüglich des gleichen Substrats gebildet. Die untenstehende Tabelle gibt die relativen spezifischen Aktivitäten (relspAkt) an.
Die mittleren Standardabweichungen betragen 16% für Cholin, 20% für DMDEA, 22% für TEA und 24% MTEA.. Die spezifischen Aktivität der Cholinoxidase KC2s betrug 377,8 mU/mg, 21 ,4 mU/mg, 13,9 mU/mg, 2,3 mU/mg.
relspAkt relspAkt relspAkt
Mutante (Cholin) (DMDEA) relspAkt (TEA) (MTEA)
KC2s 100% 100% 100% 100%
Gly62Asp 321% n.d. n.d. 178%
11 e69 Va I 114% 122% 116% 109%
Met79Val 107% n.d. n.d. 74%
Phe351Tyr 34% 114% 75% 164%
Ala21Val + Gly62Asp 579% n.d. n.d. 140%
Glu4Gly + Gly62Asp 129% 151% 147% 148%
Gly62Asp + Phe351Tyr 108% n.d. n.d. 266%
Ser321 Phe + Phe351Tyr 0% n.d. n.d. 21%
Asp166Gly + Val260lle +
Phe351Tyr 16% n.d. n.d. 228%
Gly62Asp + Arg249His +
Phe351Tyr 88% n.d. n.d. 266%
Gly62Asp + Phe351Tyr +
Lys394Arg 79% n.d. n.d. 214%
Ala21Val + Gly62Asp + lle69Val +
Ser348Leu 154% n.d. n.d. 226%
Thr116lle + Lys128Met 250% n.d. n.d. n.d.
Pro393Gln + Ser530Gly 350% n.d. n.d. n.d.
Pro393Gln 315% n.d. n.d. n.d.
Ser530Gly 250% n.d. n.d. n.d. Aus den Tabellen ist zu erkennen, dass die spezifische Aktivität insbesondere durch die Mutationen Gly62Asp, Phe351Tyr, Ser321Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp, Glu4Gly + Gly62Asp und Ala21Val + Gly62Asp + lle69Val + Ser348Leu beeinflusst wird. Die spezifische Aktivität auf DMDEA wird insbesondere durch die Mutationen lle69Val und Glu4Gly + Gly62Asp bzw. auf TEA durch die Mutationen Phe351Tyr und Glu4Gly + Gly62Asp beeinflusst. Durch die Mutationen Gly62Asp, Met79Val, Phe351Tyr, Ala21Val + Gly62Asp, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321 Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + Me69Val + Ser348Leu wird insbesondere die spezifische Aktivität auf MTEA verändert.
Beispiel 5: Waschversuche
Die Waschversuche wurden in einer Matrix der Zusammensetzung
Chem. Name Gehalt (% Reinsubstanz)
Xanthan Gu m 0,3- 0,5%
Antifoaming agent 0,2-0,4%
Glycerin 6-7%
Ethanol 0,3-0,5%
FAEOS 4-7%
Nonionic Surfactant (FAEO, APG, u.a.) 24-28%
Boric acid 1 %
Sodium citrat x 2H2O 1 -2%
Caustic soda 2-4%
Coconut fatty acid 14-16%
HEDP 0,5%
PVP 0-0,4%
Optical brightener 0-0,05%
Dye 0-0,001%
Perfume 0-2%
TAED 0,03%
H2O, demin. Rest durchgeführt.
Dosage: 4,4 g/l, Zeit: 30 min, pH während des Vorgangs: 9 (12 mM Asparagin-NaOH
Endkonzentration)
Anschmutzung: Tee auf Baumwolle, z. B. Anschmutzung 020 J Co von wfk Testgewebe GmbH
(Brüggen-Bracht, Deutschland), E-167 von EMPA Testmaterialien AG (St. Gallen, Schweiz).
Auswertung: Bestimmung des L-Wertes Durchführung:
Testgewebe (Durchmesser 10 mm) wurden in einer 24 well Mikrotiterplatte in 1 ml_ Waschlauge für 30 min bei 37 0C und einer Schüttelfrequenz von 100 rpm inkubiert. Die Waschlauge enthielt 130 mU Cholinoxidase und 20 mM Substrat. Während der Inkubation wurde Luft durch eine Kanüle mit einem Innendurchmesser von 0,5 bis 1 mm in jeden Versuchansatz eingeleitet. Jeder Versuch wurde für jede Anschmutzung als Doppelbestimmung gegen eine doppelt bestimmte Kontrolle ohne Cholinoxidase durchgeführt.
Nach dem Waschen wurde der Weißheitsgrad der gewaschenen Textilien im Vergleich zu einem Weißstandard (d/8, 0 8mm, SCI/SCE) gemessen, der auf 100% normiert worden war. Die Messung erfolgte an einem Farbmessgerät (Minolta Cm508d) mit einer Lichtarteinstellung von 107D65. Die erhaltenen Ergebnisse werden als Prozent Remission, das heißt als Prozentangabe im Vergleich zum Weißstandard zusammen mit den jeweiligen Anfangswerten in folgender Tabelle zusammengestellt. Die Bleichleistung ergibt sich als ΔL der Differenz der Remissionswerte von Basiswaschmittel mit Cholinoxidase und Kontrolle ohne Cholinoxidase unter gleichen Versuchsbedingungen an den jeweiligen Anschmutzungen.
Vergleich enzymatischer Bleiche and verschiedenen Anschmutzungen:
Figure imgf000071_0001
Man erkennt, dass die erfindungsgemäßen Cholinoxidasen unter den angegebenen Bedingungen einen bleichenden Effekt auf die relevanten Anschmutzungen haben. Zudem erkennt man, dass die Bleichleistungen mit den spezifischen Aktivitäten korrelieren.
Sequenzen:
Seq. 1 : Aminosäuresequenz von Cholinoxidase aus Arthrobacter nicotinianae, KC2, DSMZ-ID 96- 878, Expressionsprodukt von Nukleinsäuresequenz KC2
1 TRKGEKLNIE KKDFDYIVIG GGSAGAAVAS RLSEDPSVSV ALVEAGPDDR GYDEVLQLDR
61 WMELLESGLD WDYPIEPQEN GNSFMRHARA KVMGGCSSHN SCIAFWAPRE DLDEWESKFG
121 ATGWNSEMAY RLYKKLETNE DAGPDAPHHG DSGPVKLMNV PPVDPCGVAI LDAAEQAGIP
181 RAKFNNNETV INGANFFQIN RLPDGTRASS SVSYIHPIEG RENFFLLTGL QARKLNFDAD
241 KRCTGVDWD GAFGRTVTLN AAREVWSAG AIDSPKLLML SGIGPAEHLK EVGVEVLVDA
301 PGVGEHLQDH PEGVIQWEAK KPMVETSTQW WEIGIFAPTQ EGLDRPDLMM HYGSVPFDMH
361 TLRWGYPTSE NTFCLTPNVT HAKSRGTVRL RSCDFRDKPK VDPRYFTDPE
GHDARVMTFG
421 IRKAREIVAQ SPMAEWAGEE QFPGKDVQTD EEIFDYLRRC HNTVYHPAGS
VRMGAEDDVM
481 SPLDPQLRVK GVSGLRVADA SVMPELVTVN PNITVMMIGE RCAELIQENP
VEARQSELVS
541 EA*
Seq. 2: Aminosäuresequenz von KC2 in E. coli, Expressionsprodukt von Nukleinsäuresequenz KC2 in E. coli.
1 MAKGEKLNIE KKDFDYIVIG GGSAGAAVAS RLSEDPSVSV ALVEAGPDDR GYDEVLQLDR
61 WMELLESGLD WDYPIEPQEN GNSFMRHARA KVMGGCSSHN SCIAFWAPRE DLDEWESKFG
121 ATGWNSEMAY RLYKKLETNE DAGPDAPHHG DSGPVKLMNV PPVDPCGVAI LDAAEQAGIP
181 RAKFNNNETV INGANFFQIN RLPDGTRASS SVSYIHPIEG RENFFLLTGL QARKLNFDAD
241 KRCTGVDWD GAFGRTVTLN AAREVWSAG AIDSPKLLML SGIGPAEHLK EVGVEVLVDA
301 PGVGEHLQDH PEGVIQWEAK KPMVETSTQW WEIGIFAPTQ EGLDRPDLMM HYGSVPFDMH 361 TLRWGYPTSE NTFCLTPNVT HAKSRGTVRL RSCDFSDKPK VDPRYFTDPE GHDARVMTFG
421 IRKAREIVAQ SPMAEWAGEE QFPGKDVQTD EEIFDYLRRC HNTVYHPAGS
VRMGAEDDVM
481 SPLDPQLRVK GVSGLRVADA SVMPELVTVN PNITVMMIGE RCAELIQENP VEARQSELVS
541 EA*
Seq. 3: Aminosäuresequenz von KC2s (Expressionsprodukt von Nukleinsäuresequenz KC2s)
1 MNIEKKDFDY IVIGGGSAGA AVASRLSEDP SVSVALVEAG PDDRGYDEVL QLDRWMELLE
61 SGLDWDYPIE PQENGNSFMR HARAKVMGGC SSHNSCIAFW APREDLDEWE
SKFGATGWNS
121 EMAYRLYKKL ETNEDAGPDA PHHGDSGPVK LMNVPPVDPC GVAILDAAEQ AGIPRAKFNN
181 NETVINGANF FQINRLPDGT RASSSVSYIH PIEGRENFFL LTGLQARKLN FDADKRCTGV
241 DWDGAFGRT VTLNAAREW VSAGAIDSPK LLMLSGIGPA EHLKEVGVEV LVDAPGVGEH
301 LQDHPEGVIQ WEAKKPMVET STQWWEIGIF APTQEGLDRP DLMMHYGSVP
FDMHTLRWGY
361 PTSENTFCLT PNVTHAKSRG TVRLRSCDFS DKPKVDPRYF TDPEGHDARV MTFGIRKARE
421 IVAQSPMAEW AGEEQFPGKD VQTDEEIFDY LRRCHNTVYH PAGSVRMGAE
DDVMSPLDPQ
481 LRVKGVSGLR VADASVMPEL VTVNPNITVM MIGERCAELI QENPVEARQS ELVSEA*
Seq. 4: Aminosäuresequenz von KC2s in E. coli, Expressionsprodukt von Nukleinsäuresequenz KC2s in E. coli.
1 MNIEKKDFDY IVIGGGSAGA AVASRLSEDP SVSVALVEAG PDDRGYDEVL QLDRWMELLE
61 SGLDWDYPIE PQENGNSFMR HARAKVMGGC SSHNSCIAFW APREDLDEWE SKFGATGWNS
121 EMAYRLYKKL ETNEDAGPDA PHHGDSGPVK LMNVPPVDPC GVAILDAAEQ AGIPRAKFNN
181 NETVINGANF FQINRLPDGT RASSSVSYIH PIEGRENFFL LTGLQARKLN FDADKRCTGV 241 DWDGAFGRT VTLNAAREW VSAGAIDSPK LLMLSGIGPA EHLKEVGVEV LVDAPGVGEH
301 LQDHPEGVIQ WEAKKPMVET STQWWEIGIF APTQEGLDRP DLMMHYGSVP FDMHTLRWGY
361 PTSENTFCLT PNVTHAKSRG TVRLRSCDFS DKPKVDPRYF TDPEGHDARV
MTFGIRKARE
421 IVAQSPMAEW AGEEQFPGKD VQTDEEIFDY LRRCHNTVYH PAGSVRMGAE DDVMSPLDPQ
481 LRVKGVSGLR VADASVMPEL VTVNPNITVM MIGERCAELI QENPVEARQS ELVSEA*
Seq. 5: Aminosäuresequenz von Cholinoxidase aus Arthrobacter aurescens (ATCC13344), Expressionsprodukt von Nukleinsäuresequenz Cholinoxidase aus Arthrobacter aurescens (ATCC13344)
1 MHVDNIENLS ERGFDYIVIG GGSAGAAVAA RLSEDPAVTV ALVEAGPDDR NLPEILQLDR
61 WMELLESGYD WDYPVEPQEN GNSFMRHARA KVMGGCSSHN SCIAFWAPRE DLDEWESKYG
121 ATGWNAAAAW PLYQRLESNE DAGPDAPHHG HDGPVHLMNV PPNDPAGVAL LDACEQSGIP
181 RAKFNDGTTV INGANFFQIN RRSDGTRSSS SVSYIHPIMA RENFTLLTGL RARQLVFDAD
241 KRCTGVDWD SAFGRTHRLT AQREVILSTG AIDSPKLLML SGIGPAEHLA QHGIEVWDS
301 PGVGEHLQDH PEGWQFEAK QPMVQSSTQW WEIGIFTPTE EGLDRPDLMM HYGSVPFDMN
361 TLRYGYPTTE NGFSLTPNVT HARSRGTVRL RSRDFRDKPM VDPRYFTDPE
GHDMRVMVAG
421 IRKAREIAAQ PAMAEWTGRE LSPGIEAQTD EELQDYIRKT HNTVYHPVGT
VRMGPVEDPM
481 SPLDPELRVK GVSGLRVADA SVMPEHVTVN PNITVMMIGE RCADLIKARL
GASRVEETTT 541 TEADFSLSHA
Seq. 6: Aminosäuresequenz von Hybridgen, Expressionsprodukt von Nukleinsäuresequenz
Hybridgen
1 MHVDNIENLS ERGFDYIVIG GGSAGAAVAA RLSEDPAVTV ALVEAGPDDR NLPEILQLDR 61 WMELLESGYD WDYPVEPQEN GNSFMRHARA KVMGGCSSHN SCIAFWAPRE
DLDEWESKFG 121 ATGWNSEMAY RLYKKLETNE DAGPDAPHHG DSGPVKLMNV PPVDPCGVAI LDAAEQAGIP
181 RAKFNNNETV INGANFFQIN RLPDGTRASS SVSYIHPIEG RENFFLLTGL QARKLNFDAD
241 KRCTGVDWD GAFGRTVTLN AAREVWSAG AIDSPKLLML SGIGPAEHLK EVGVEVLVDA
301 PGVGEHLQDH PEGVIQWEAK KPMVETSTQW WEIGIFAPTQ EGLDRPDLMM HYGSVPFDMH
361 TLRWGYPTSE NTFCLTPNVT HAKSRGTVRL RSRDFRDKPM VDPRYFTDPE
GHDMRVMVAG
421 IRKAREIAAQ PAMAEWTGRE LSPGIEAQTD EELQDYIRKT HNTVYHPVGT VRMGPVEDPM
481 SPLDPELRVK GVSGLRVADA SVMPEHVTVN PNITVMMIGE RCADLIKARL
GASRVEETTT 541 TEADFSLSHA
Seq. 7: Aminosäuresequenz von Cholinoxidase aus Arthrobacter globiformis, Expressionsprodukt von Nukleinsäuresequenz Cholinoxidase aus Arthrobacter globiformis (neue Sequenz, definiert Stand der Technik)
1 MHIDNIENLS DREFDYIWG GGSAGAAVAA RLSEDPAVSV ALVEAGPDDR
GVPEVLQLDR
61 WMELLESGYD WDYPIEPQEN GNSFMRHARA KVMGGCSSHN SCIAFWAPRE
DLDEWEAKYG
121 ATGWNAEAAW PLYKRLETNE DAGPDAPHHG DSGPVHLMNV PPKDPTGVAL LDACEQAGIP
181 RAKFNTGTTV VNGANFFQIN RRADGTRSSS SVSYIHPIVE QENFTLLTGL RARQLVFDAD
241 RRCTGVDIVD SAFGHTHRLT ARNEWLSTG AIDTPKLLML SGIGPAAHLA EHGIEVLVDS
301 PGVGEHLQDH PEGWQFEAK QPMVAESTQW WEIGIFTPTE DGLDRPDLMM HYGSVPFDMN
361 TLRHGYPTTE NGFSLTPNVT HARSRGTVRL RSRDFRDKPM VDPRYFTDPE GHDMRVMVAG
421 IRKAREIAAQ PAMAEWTGRE LSPGVEAQTD EELQDYIRKT HNTVYHPVGT VRMGAVEDEM
481 SPLDPELRVK GVTGLRVADA SVMPEHVTVN PNITVMMIGE RCADLIRSAR AGETTTADAE
541 LSAALA DNA-Sequenzen
Seq. 8: Nukleinsäuresequenz, Cholinoxidase aus aus A. nicotianiae (KC 2, DSMZ-ID 96-878) wie in DE-A-102 60 930.6-41.
1 acgagaaagg gcgaaaaatt gaacattgaa aagaaggact tcgactacat tgtgatcggc 61 ggcggttctg ccggcgctgc ggtggcttct cgcctgagcg aggatccatc ggtgagtgtt 121 gcactggttg aagcaggtcc cgacgaccgc ggctacgatg aagtgctgca gctggaccgc 181 tggatggaac tgctggaatc cggcttggac tgggactacc cgatcgaacc gcaggaaaac 241 ggcaactcgt tcatgcgcca tgcccgtgcc aaggtcatgg gcggctgctc cagccacaac 301 tcctgcatcg ccttctgggc gccgcgtgag gaccttgacg agtgggagtc gaagttcggc 361 gccaccggct ggaactccga gatggcctac cgcctgtaca agaagctgga aaccaatgag 421 gacgccggac cggatgcacc gcaccacggc gactcgggcc cggtcaagct gatgaacgtg 481 ccgccggtgg acccctgcgg cgtggcaatc ctggacgccg ccgagcaggc aggcatcccg 541 cgcgccaagt tcaacaacaa cgagacggtc atcaacggcg cgaacttctt ccagatcaac 601 cgcctgccgg acggcacccg tgcctcctcc tcggtctcct acatccaccc gatcgaggga 661 cgcgagaact tcttcctgct caccggactg caggcgcgca agctgaactt cgacgccgac 721 aagcgctgca ccggcgtgga cgtggtggac ggggccttcg gccgcaccgt gacgctgaac 781 gccgcccgcg aggtcgtcgt ctccgccggc gccattgact cgccgaagct gctgatgctc 841 tccggcatcg gacctgccga acacctcaag gaggtcggcg tcgaggtgct tgtcgacgct 901 ccaggcgtgg gcgaacacct gcaggaccac ccggaaggcg tgatccagtg ggaggctaag 961 aagccgatgg ttgaaacctc cacccagtgg tgggaaatcg gcatcttcgc accgacccag "^ "~~
1021 gaaggcctcg accgtccgga tctgatgatg cactacggtt cggtgccctt cgacatgcac 1081 accctgcgtt ggggttaccc gaccagcgag aacaccttct gcctgacccc gaatgtcacc 1141 catgcgaagt cgcgcggcac cgtgcgcctg cgcagctgcg acttccgcga caagccgaag 1201 gtcgaccctc gctacttcac cgatccagag ggccacgacg cccgggtcat gaccttcggc 1261 atccgcaagg cccgcgagat cgtcgcccag tcgccgatgg cagagtgggc tggcgaggag 1321 cagttcccgg gcaaggacgt gcagactgac gaagagatct tcgactacct gcgccgctgc 1381 cacaacactg tctaccaccc ggctggttcg gtgcgcatgg gcgccgagga cgatgtgatg 1441 agcccgctgg atccgcagct gcgggtcaag ggagtctcgg gcctgcgcgt ggccgacgct 1501 tcggtgatgc cggagctggt caccgtgaac ccgaacatca cggtgatgat gatcggtgaa 1561 cgctgcgccg agctgattca ggaaaaccct gtggaagccc gccagagcga actggttagc 1621 gaagcctag
Seq. 9: Nukleinsäuresequenz, Cholinoxidase aus A. nicotianiae (KC 2, DSMZ-ID 96-878) kloniert in
E. coli.
1 atggcaaagg gcgaaaaatt gaacattgaa aagaaggact tcgactacat tgtgatcggc 61 ggcggttctg ccggcgctgc ggtggcttct cgcctgagcg aggatccatc ggtgagtgtt 121 gcactggttg aagcaggtcc cgacgaccgc ggctacgatg aagtgctgca gctggaccgc 181 tggatggaac tgctggaatc cggcttggac tgggactacc cgatcgaacc gcaggaaaac 241 ggcaactcgt tcatgcgcca tgcccgtgcc aaggtcatgg gcggctgctc cagccacaac 301 tcctgcatcg ccttctgggc gccgcgtgag gaccttgacg agtgggagtc gaagttcggc 361 gccaccggct ggaactccga gatggcctac cgcctgtaca agaagctgga aaccaatgag 421 gacgccggac cggatgcacc gcaccacggc gactcgggcc cggtcaagct gatgaacgtg 481 ccgccggtgg acccctgcgg cgtggcaatc ctggacgccg ccgagcaggc aggcatcccg 541 cgcgccaagt tcaacaacaa cgagacggtc atcaacggcg cgaacttctt ccagatcaac 601 cgcctgccgg acggcacccg tgcctcctcc tcggtctcct acatccaccc gatcgaggga 661 cgcgagaact tcttcctgct caccggactg caggcgcgca agctgaactt cgacgccgac 721 aagcgctgca ccggcgtgga cgtggtggac ggggccttcg gccgcaccgt gacgctgaac 781 gccgcccgcg aggtcgtcgt ctccgccggc gccattgact cgccgaagct gctgatgctc 841 tccggcatcg gacctgccga acacctcaag gaggtcggcg tcgaggtgct tgtcgacgct 901 ccaggcgtgg gcgaacacct gcaggaccac ccggaaggcg tgatccagtg ggaggctaag 961 aagccgatgg ttgaaacctc cacccagtgg tgggaaatcg gcatcttcgc accgacccag 1021 gaaggcctcg accgtccgga tctgatgatg cactacggtt cggtgccctt cgacatgcac 1081 accctgcgtt ggggttaccc gaccagcgag aacaccttct gcctgacccc gaatgtcacc 1141 catgcgaagt cgcgcggcac cgtgcgcctg cgcagctgcg acttcagcga caagccgaag 1201 gtcgaccctc gctacttcac cgatccagag ggccacgacg cccgggtcat gaccttcggc 1261 atccgcaagg cccgcgagat cgtcgcccag tcgccgatgg cagagtgggc tggcgaggag 1321 cagttcccgg gcaaggacgt gcagactgac gaagagatct tcgactacct gcgccgctgc 1381 cacaacactg tctaccaccc ggctggttcg gtgcgcatgg gcgccgagga cgatgtgatg 1441 agcccgctgg atccgcagct gcgggtcaag ggagtctcgg gcctgcgcgt ggccgacgct 1501 tcggtgatgc cggagctggt caccgtgaac ccgaacatca cggtgatgat gatcggtgaa 1561 cgctgcgccg agctgattca ggaaaaccct gtggaagccc gccagagcga actggttagc 1621 gaagcctag
Seq. 10: Nukleinsäuresequenz, KC2s (Urform aus KC2 abgeleitet) 1 ttgaacattg aaaagaagga cttcgactac attgtgatcg gcggcggttc tgccggcgct 61 gcggtggctt ctcgcctgag cgaggatcca tcggtgagtg ttgcactggt tgaagcaggt 121 cccgacgacc gcggctacga tgaagtgctg cagctggacc gctggatgga actgctggaa 181 tccggcttgg actgggacta cccgatcgaa ccgcaggaaa acggcaactc gttcatgcgc 241 catgcccgtg ccaaggtcat gggcggctgc tccagccaca actcctgcat cgccttctgg 301 gcgccgcgtg aggaccttga cgagtgggag tcgaagttcg gcgccaccgg ctggaactcc 361 gagatggcct accgcctgta caagaagctg gaaaccaatg aggacgccgg accggatgca 421 ccgcaccacg gcgactcggg cccggtcaag ctgatgaacg tgccgccggt ggacccctgc 481 ggcgtggcaa tcctggacgc cgccgagcag gcaggcatcc cgcgcgccaa gttcaacaac 541 aacgagacgg tcatcaacgg cgcgaacttc ttccagatca accgcctgcc ggacggcacc 601 cgtgcctcct cctcggtctc ctacatccac ccgatcgagg gacgcgagaa cttcttcctg 661 ctcaccggac tgcaggcgcg caagctgaac ttcgacgccg acaagcgctg caccggcgtg 721 gacgtggtgg acggggcctt cggccgcacc gtgacgctga acgccgcccg cgaggtcgtc 781 gtctccgccg gcgccattga ctcgccgaag ctgctgatgc tctccggcat cggacctgcc 841 gaacacctca aggaggtcgg cgtcgaggtg cttgtcgacg ctccaggcgt gggcgaacac 901 ctgcaggacc acccggaagg cgtgatccag tgggaggcta agaagccgat ggttgaaacc 961 tccacccagt ggtgggaaat cggcatcttc gcaccgaccc aggaaggcct cgaccgtccg 1021 gatctgatga tgcactacgg ttcggtgccc ttcgacatgc acaccctgcg ttggggttac 1081 ccgaccagcg agaacacctt ctgcctgacc ccgaatgtca cccatgcgaa gtcgcgcggc 1141 accgtgcgcc tgcgcagctg cgacttcagc gacaagccga aggtcgaccc tcgctacttc 1201 accgatccag agggccacga cgcccgggtc atgaccttcg gcatccgcaa ggcccgcgag 1261 atcgtcgccc agtcgccgat ggcagagtgg gctggcgagg agcagttccc gggcaaggac 1321 gtgcagactg acgaagagat cttcgactac ctgcgccgct gccacaacac tgtctaccac 1381 ccggctggtt cggtgcgcat gggcgccgag gacgatgtga tgagcccgct ggatccgcag 1441 ctgcgggtca agggagtctc gggcctgcgc gtggccgacg cttcggtgat gccggagctg 1501 gtcaccgtga acccgaacat cacggtgatg atgatcggtg aacgctgcgc cgagctgatt 1561 caggaaaacc ctgtggaagc ccgccagagc gaactggtta gcgaagccta g
Seq. 11 : KC2s (Kloniert in E. coli)
1 atgaacattg aaaagaagga cttcgactac attgtgatcg gcggcggttc tgccggcgct 61 gcggtggctt ctcgcctgag cgaggatcca tcggtgagtg ttgcactggt tgaagcaggt 121 cccgacgacc gcggctacga tgaagtgctg cagctggacc gctggatgga actgctggaa 181 tccggcttgg actgggacta cccgatcgaa ccgcaggaaa acggcaactc gttcatgcgc 241 catgcccgtg ccaaggtcat gggcggctgc tccagccaca actcctgcat cgccttctgg 301 gcgccgcgtg aggaccttga cgagtgggag tcgaagttcg gcgccaccgg ctggaactcc 361 gagatggcct accgcctgta caagaagctg gaaaccaatg aggacgccgg accggatgca 421 ccgcaccacg gcgactcggg cccggtcaag ctgatgaacg tgccgccggt ggacccctgc 481 ggcgtggcaa tcctggacgc cgccgagcag gcaggcatcc cgcgcgccaa gttcaacaac 541 aacgagacgg tcatcaacgg cgcgaacttc ttccagatca accgcctgcc ggacggcacc 601 cgtgcctcct cctcggtctc ctacatccac ccgatcgagg gacgcgagaa cttcttcctg 661 ctcaccggac tgcaggcgcg caagctgaac ttcgacgccg acaagcgctg caccggcgtg 721 gacgtggtgg acggggcctt cggccgcacc gtgacgctga acgccgcccg cgaggtcgtc 781 gtctccgccg gcgccattga ctcgccgaag ctgctgatgc tctccggcat cggacctgcc 841 gaacacctca aggaggtcgg cgtcgaggtg cttgtcgacg ctccaggcgt gggcgaacac 901 ctgcaggacc acccggaagg cgtgatccag tgggaggcta agaagccgat ggttgaaacc 961 tccacccagt ggtgggaaat cggcatcttc gcaccgaccc aggaaggcct cgaccgtccg 1021 gatctgatga tgcactacgg ttcggtgccc ttcgacatgc acaccctgcg ttggggttac 1081 ccgaccagcg agaacacctt ctgcctgacc ccgaatgtca cccatgcgaa gtcgcgcggc 1141 accgtgcgcc tgcgcagctg cgacttcagc gacaagccga aggtcgaccc tcgctacttc 1201 accgatccag agggccacga cgcccgggtc atgaccttcg gcatccgcaa ggcccgcgag 1261 atcgtcgccc agtcgccgat ggcagagtgg gctggcgagg agcagttccc gggcaaggac 1321 gtgcagactg acgaagagat cttcgactac ctgcgccgct gccacaacac tgtctaccac 1381 ccggctggtt cggtgcgcat gggcgccgag gacgatgtga tgagcccgct ggatccgcag 1441 ctgcgggtca agggagtctc gggcctgcgc gtggccgacg cttcggtgat gccggagctg 1501 gtcaccgtga acccgaacat cacggtgatg atgatcggtg aacgctgcgc cgagctgatt 1561 caggaaaacc ctgtggaagc ccgccagagc gaactggtta gcgaagccta g
Seq. 12: Nukleinsäuresequenz, Cholinoxidase aus A. aurescens (ATCC 13344). 1 atgcacgtcg acaatattga gaacctcagc gagcgcgggt tcgattacat cgtcatcggc 61 ggaggatctg ccggggctgc cgtcgccgcc cggctgagcg aggaccccgc cgttaccgtt 121 gccctggtgg aagccggccc ggatgaccgg aacctcccgg aaatcctgca attggaccgg 181 tggatggaac tgctggaatc ggggtacgac tgggactacc cggtggaacc gcaggagaac 241 ggcaactcat tcatgcgcca cgcccgcgcc aaggtgatgg gcggctgttc cagccacaat 301 tcctgcatcg ctttctgggc tccccgggag gacctggatg agtgggagtc caagtacggt 361 gccaccggtt ggaacgctgc cgcggcctgg cctttgtatc agcgcttgga aagcaacgag 421 gacgctggcc cggatgcccc acatcacggc catgatggtc cggtgcacct gatgaacgtt 481 cctccgaatg atccggccgg ggttgcgctc ctggacgcct gtgagcagag cggcattccc 541 cgggcaaagt tcaacgacgg caccacagtg atcaacggcg ctaatttctt ccagatcaac 601 cgccgttcgg acggtacgcg ttcctccagt tctgtttcct acattcaccc catcatggct 661 cgcgaaaact tcacgctgtt gaccggcctg cgtgcccgcc aactggtgtt cgacgcggac 721 aagcgttgca ccggcgtcga cgtcgttgac tctgccttcg gcaggacaca caggctcacc 781 gcgcagcgcg aggtcatcct ctccacgggc gccattgatt cccccaagct gctcatgctt 841 tccggaatcg gcccggccga gcacctggct caacatggca tcgaggtggt ggtggactcc 901 cccggtgttg gcgagcatct gcaggaccac ccggagggcg tggtgcagtt cgaggccaag 961 cagcccatgg ttcagtcgtc cacccaatgg tgggagatcg gcatcttcac tcccaccgag 1021 gagggactgg accgcccgga cctgatgatg cactacggct ccgtgccgtt cgacatgaac 1081 accctccgct acggttaccc caccacggag aacggcttca gccttacccc gaacgtcacg 1141 cacgcccgtt cccgcgggac cgtccgtttg cgcagcaggg acttccgcga caagcccatg 1201 gtggacccgc ggtacttcac cgatcccgag gggcacgaca tgcgcgtcat ggtggccggc 1261 atccgcaagg cccgggaaat cgcggctcag ccggccatgg ccgagtggac cggacgggag 1321 ctctcccccg gaatcgaggc ccagactgat gaggagcttc aggactacat ccgcaaaacc 1381 cacaacaccg tctaccaccc cgtcggtacc gtccgcatgg gcccggtgga ggaccccatg 1441 tctcccttgg atccggagct gcgtgtcaaa ggcgtcagcg gcctacgggt ggcagacgcc 1501 tccgtgatgc ccgaacacgt cacagtgaac cccaacatca ccgtgatgat gatcggcgag 1561 cgctgtgctg atctcatcaa agcccggctg ggtgccagcc gggtggagga aaccacgacg 1621 acggaggcgg acttcagctt gtcccacgcc
Seq. 13: Nukleinsäuresequenz Hybridgen. 1 atgcacgtcg acaatattga gaacctcagc gagcgcgggt tcgattacat cgtcatcggc 61 ggaggatctg ccggggctgc cgtcgccgcc cggctgagcg aggaccccgc cgttaccgtt 121 gccctggtgg aagccggccc ggatgaccgg aacctcccgg aaatcctgca attggaccgg 181 tggatggaac tgctggaatc ggggtacgac tgggactacc cggtggaacc gcaggagaac 241 ggcaactcat tcatgcgcca cgcccgcgcc aaggtcatgg gcggctgctc cagccacaac 301 tcctgcatcg ccttctgggc gccgcgtgag gaccttgacg agtgggagtc gaagttcggc 361 gccaccggct ggaactccga gatggcctac cgcctgtaca agaagctgga aaccaatgag 421 gacgccggac cggatgcacc gcaccacggc gactcgggcc cggtcaagct gatgaacgtg 481 ccgccggtgg acccctgcgg cgtggcaatc ctggacgccg ccgagcaggc aggcatcccg 541 cgcgccaagt tcaacaacaa cgagacggtc atcaacggcg cgaacttctt ccagatcaac 601 cgcctgccgg acggcacccg tgcctcctcc tcggtctcct acatccaccc gatcgaggga 661 cgcgagaact tcttcctgct caccggactg caggcgcgca agctgaactt cgacgccgac 721 aagcgctgca ccggcgtgga cgtggtggac ggggccttcg gccgcaccgt gacgctgaac 781 gccgcccgcg aggtcgtcgt ctccgccggc gccattgact cgccgaagct gctgatgctc 841 tccggcatcg gacctgccga acacctcaag gaggtcggcg tcgaggtgct tgtcgacgct 901 ccaggcgtgg gcgaacacct gcaggaccac ccggaaggcg tgatccagtg ggaggctaag 961 aagccgatgg ttgaaacctc cacccagtgg tgggaaatcg gcatcttcgc accgacccag 1021 gaaggcctcg accgtccgga tctgatgatg cactacggtt cggtgccctt cgacatgcac 1081 accctgcgtt ggggttaccc gaccagcgag aacaccttct gcctgacccc gaatgtcacc 1141 catgcgaagt cgcgcggcac cgtgcgcctg cgcagcaggg acttccgcga caagcccatg 1201 gtggacccgc ggtacttcac cgatcccgag gggcacgaca tgcgcgtcat ggtggccggc 1261 atccgcaagg cccgggaaat cgcggctcag ccggccatgg ccgagtggac cggacgggag 1321 ctctcccccg gaatcgaggc ccagactgat gaggagcttc aggactacat ccgcaaaacc 1381 cacaacaccg tctaccaccc cgtcggtacc gtccgcatgg gcccggtgga ggaccccatg 1441 tctcccttgg atccggagct gcgtgtcaaa ggcgtcagcg gcctacgggt ggcagacgcc 1501 tccgtgatgc ccgaacacgt cacagtgaac cccaacatca ccgtgatgat gatcggcgag 1561 cgctgtgctg atctcatcaa agcccggctg ggtgccagcc gggtggagga aaccacgacg 1621 acggaggcgg acttcagctt gtcccacgcc
Seq. 14: Nukleinsäuresequenz, Cholinoxidase aus Arthrobacter globiformis (Neue Sequenz, Stand der Technik). 1 ATGCACATCG ACAACATCGA GAACCTGAGC GACAGGGAGT TCGACTACAT
CGTCGTCGGC 61 GGCGGGTCCG CCGGGGCCGC CGTCGCCGCC CGGCTGAGCG AGGATCCCGC
AGTGAGCGTG 121 GCGCTGGTGG AGGCCGGCCC GGATGACCGC GGCGTGCCCG AGGTGCTGCA
GCTGGACCGC 181 TGGATGGAGC TGCTGGAATC GGGCTACGAC TGGGACTACC CGATCGAGCC
GCAGGAGAAC 241 GGCAACTCCT TCATGCGCCA TGCCCGTGCC AAGGTCATGG GCGGCTGCTC
CAGCCACAAC 301 TCCTGCATCG CCTTCTGGGC CCCGCGCGAG GACCTGGACG AGTGGGAGGC
CAAGTACGGC 361 GCCACCGGCT GGAACGCCGA GGCGGCCTGG CCGCTGTACA AGCGGCTGGA
AACCAACGAG 421 GACGCGGGCC CGGACGCGCC GCACCACGGG GACTCCGGCC CCGTGCACCT
GATGAACGTG 481 CCCCCGAAGG ACCCGACCGG CGTCGCGCTC CTGGACGCCT GCGAGCAGGC
CGGCATCCCG 541 CGCGCGAAGT TCAACACCGG CACCACCGTG GTCAACGGCG CCAACTTCTT
CCAGATCAAC 601 CGGCGCGCGG ACGGCACCCG CTCCTCCAGC TCGGTCTCCT ACATCCACCC
GATCGTCGAG 661 CAGGAGAACT TCACCCTGCT AACCGGCCTG CGCGCCCGCC AGCTGGTGTT
CGACGCGGAC 721 AGGCGCTGCA CCGGCGTCGA CATCGTGGAC TCCGCCTTCG GCCACACCCA
TCGGCTGACG 781 GCGCGCAATG AAGTCGTGCT CTCCACCGGC GCGATCGATA CGCCGAAGCT
GCTGATGCTC 841 TCCGGCATCG GCCCCGCCGC CCACCTCGCC GAGCACGGCA TCGAGGTCCT
GGTGGACTCC 901 CCCGGCGTGG GCGAGCACCT GCAGGACCAC CCGGAAGGCG TGGTGCAGTT
CGAGGCCAAG 961 CAGCCCATGG TCGCCGAGTC CACGCAGTGG TGGGAGATCG GCATCTTCAC
CCCCACCGAG 1021 GACGGCCTGG ACCGCCCCGA CCTGATGATG CACTACGGCT CCGTGCCGTT
CGACATGAAC 1081 ACCCTGCGGC ACGGCTACCC CACCACGGAG AACGGCTTCA GCCTCACCCC
GAACGTCACG 1141 CACGCCCGCT CCCGCGGCAC TGTCCGGCTG CGCAGCCGCG ACTTCCGCGA
TAAGCCCATG 1201 GTCGACCCGC GCTACTTCAC CGACCCAGAG GGCCATGACA TGCGCGTCAT
GGTCGCCGGC 1261 ATCCGCAAGG CCCGCGAAAT CGCCGCCCAG CCCGCCATGG CGGAATGGAC
CGGCCGCGAG 1321 CTCTCCCCCG GCGTCGAGGC GCAGACCGAC GAGGAGCTGC AGGACTACAT
CCGCAAGACG 1381 CACAACACCG TCTACCACCC CGTGGGCACC GTGCGCATGG GCGCGGTCGA
GGACGAGATG 1441 TCCCCGCTCG ACCCCGAGCT GCGGGTCAAG GGCGTCACCG GTCTGCGCGT
CGCCGACGCC 1501 TCGGTCATGC CCGAGCACGT GACCGTCAAC CCCAACATCA CCGTCATGAT
GATCGGCGAG 1561 CGCTGCGCGG ACCTTATCCG CTCCGCCCGC GCCGGTGAAA CAACGACGGC
GGACGCCGAG 1621 CTGAGCGCGG CCCTCGCCTA A
Seq. 15 (Nukleinsäuresequenz, Primer zur Klonierung einer Cholinoxidase)
5' - TTCCATATGAACATTGAAAAGAAGGACTTCGACTACATTG - 3
Seq. 16 (Nukleinsäuresequenz, Primer zur Klonierung einer Cholinoxidase)
5' - CCCAAGCTTCTAGGCTTCGCTAACCAGTTCG - 3'
Seq. 17 (Mutageneseprimer)
5'-gagatatacatatgaacattggaaagaaggacttcg-3'
Seq. 18 (Mutageneseprimer)
5'-cgaagtccttctttccaatgttcatatgtatatctc-3'
Seq. 19 (Mutageneseprimer)
5'-gcggttctgccggcgctgtggtggcttctcgcctgag-3'
Seq. 20 (Mutageneseprimer)
5'-ctcaggcgagaagccaccacagcgccggcagaaccgc-3'
Seq. 21 (Mutageneseprimer)
5'-gaactgctggaatccgacttggactgggactacc-3'
Seq. 22 (Mutageneseprimer)
5'-ggtagtcccagtccaagtcggattccagcagttc-3'
Seq. 23 (Mutageneseprimer) 5'-gactgggactacccggtcgaaccgcaggaaaac-3'
Seq. 24 (Mutageneseprimer)
5'-gttttcctgcggttcgaccgggtagtcccagtc-3'
Seq. 25 (Mutageneseprimer)
5'-gaaaacggcaactcgttcgtgcgccatgcccgtgc-3'
Seq. 26 (Mutageneseprimer)
5'-gcacgggcatggcgcacgaacgagttgccgttttc-3'
Seq. 27 (Mutageneseprimer)
5'-cggcgtggcaatcctgggcgccgccgagcaggcagg-3'
Seq. 28 (Mutageneseprimer)
5'-cctgcctgctcggcggcgcccaggattgccacgccg-3'
Seq. 29 (Mutageneseprimer)
5'-gacggggccttcggccacaccgtgacgctgaacg-3'
Seq. 30 (Mutageneseprimer)
5'-cgttcagcgtcacggtgtggccgaaggccccgtc-3'
Seq. 31 (Mutageneseprimer)
5'-cgcccgcgaggtcatcgtctccgccggcgc-3'
Seq. 32 (Mutageneseprimer)
5'-gcgccggcggagacgatgacctcgcgggcg -3'
Seq. 33 (Mutageneseprimer) 5'-ccgatggttgaaaccttcacccagtggtgggaaatc-3'
Seq. 34 (Mutageneseprimer)
5'-gatttcccaccactgggtgaaggtttcaaccatcgg-3'
Seq. 35 (Mutageneseprimer)
5'-gatctgatgatgcactacggtttggtgcccttcgacatgcacac-3'
Seq. 36 (Mutageneseprimer)
5'-gtgtgcatgtcgaagggcaccaaaccgtagtgcatcatcagatc-3'
Seq. 37 (Mutageneseprimer)
5'-cactacggtttggtgccctacgacatgcacaccctg-3'
Seq. 38 (Mutageneseprimer)
5'-cagggtgtgcatgtcgtagggcaccaaaccgtagtg-3'
Seq. 39 (Mutageneseprimer)
5'-gacttccgcgacaagccgagggtcgaccctcgctacttcac-3'
Seq. 40 (Mutageneseprimer)
5'-gtgaagtagcgagggtcgaccctcggcttgtcgcggaagtc-3'

Claims

Patentansprüche:
1. Cholinoxidase mit veränderter Substratspezifität, die, bezogen auf die Cholinoxidase mit der Sequenz 3, Mutationen in Molekülbereichen bzw. Domänen aufweist, die ausgewählt sind unter der Substratbindungsdomäne und der FAD-Bindungsdomäne.
2. Cholinoxidase nach Anspruch 1 , die eine oder mehrere Mutationen an Aminosäuresequenzpositionen aufweist, die ausgewählt sind unter den Positionen 4, 21 , 62, 69, 79, 116, 128, 166, 215, 243, 249, 260, 286, 321, 348, 349, 351 , 393, 394, 530 und 531 , wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
3. Cholinoxidase nach Anspruch 2, dadurch gekennzeichnet, dass die Mutationen ausgewählt sind aus Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, Thr116lle, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val.
4. Cholinoxidase nach Anspruch 3, die einen oder mehrere der Aminosäureaustausche aufweist, die ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, Thr116lle, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu in Kombination mit Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val.
5. Cholinoxidase nach Anspruch 4, die einen oder mehrere der Aminosäureaustausche aufweist, die ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, lle69Val, Met79Val, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu in Kombination mit Val349Leu, Phe351Tyr, Phe351 Leu, Lys394Arg und Glu531Val.
6. Cholinoxidase nach einem der Ansprüche 1 bis 5, die eine oder mehrere der folgenden Kombinationen von Aminosäureaustauschen aufweist: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321 Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + Me69Val + Ser348Leu, ThM 161Ie + Lys128Met, Pro393Gln + Ser530Gly wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
7. Cholinoxidase, die durch ein- oder mehrfachen Aminosäurenaustausch, insbesondere konservativen Aminosäurenaustausch, und/oder durch Derivatisierung, Fragmentierung, Deletionsmutation oder Insertionsmutation ausgehend von einer Cholinoxidase nach einem der Ansprüche 1 bis 6 erhältlich ist.
8. Nukleinsäure, kodierend für eine Cholinoxidase, die, bezogen auf die Cholinoxidase mit der Sequenz 3, eine Mutation oder mehrere Mutationen in Molekülbereichen bzw. Domänen aufweist, die ausgewählt sind unter der Substratbindungsdomäne und der FAD-Bindungsdomäne
9. Nukleinsäure, kodierend für eine Cholinoxidase, die eine oder mehrere Mutationen an Aminosäuresequenzpositionen aufweist, die ausgewählt sind unter den Positionen 4, 21 , 62, 69, 79, 116, 128, 166, 215, 243, 249, 260, 286, 321, 348, 349, 351, 393, 394, 530 und 531, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
10. Für eine Cholinoxidase kodierende Nukleinsäure, die einen oder mehrere Codonaustausche an Sequenzpositionen aufweist, die ausgewählt sind unter Glu4 (bp 10-12), Ala21 (bp 61-63), Gly62 (bp 184-186), Ile69 (bp 205-207), Met79 (bp 235-237), ThM 16 (bp 346-348), Lys128 (bp 382-384), Asp166 (bp 496-498), Arg215 (bp 643-645), Val243 (bp 727-729), Arg249 (bp 745- 747), Val260 (bp 778-780), Val286 (bp 856-858), Ser321 (bp 961-963), Ser348 (bp 1042- 1044), Val349 (bp 1045-1047), Phe351 (bp 1051-1053), Pro393 (bp 1177-1179), Lys394 (bp 1180-1182), Ser530 (bp 1588-1590) und Glu531 (bp 1591-1593) wobei die Nummerierung der Aminosäure-Sequenzpositionen auf Sequenz 3 und die Nummerierung der Nukleinsäure- Sequenzpositionen auf Sequenz 10 bezogen ist.
11. Nukleinsäure, kodierend für eine Cholinoxidase, die einen oder mehrere Aminosäureaustausche aufweist, die ausgewählt sind unter Glu4Gly, Ala21Val, Gly62Asp, Me69Val, Met79Val, ThM 161Ie, Lys128Met, Asp166Gly, Arg215His, Val243Leu, Arg249His, Val260lle, Val286lle, Ser321 Phe, Ser321Gly, Ser321Val, Ser321Gln, Ser348Gly, Ser348Leu, Ser348Ala, Ser348Val, Ser348Cys, Ser348Leu, Val349Leu, Phe351Tyr, Phe351 Leu, Pro393Gln, Lys394Arg, Ser530Gly und Glu531Val, wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
12. Nukleinsäure, kodierend für eine Cholinoxidase, die eine oder mehrere der folgenden Kombinationen von Aminosäureaustauschen aufweist: Ala21Val + Gly62Asp, Ala21Val + Lys394Arg, Glu4Gly + Gly62Asp, Gly62Asp + Phe351Tyr, Ser321 Phe + Phe351Tyr, Asp166Gly + Val260lle + Phe351Tyr, Gly62Asp + Arg249His + Phe351Tyr, Gly62Asp + Phe351Tyr + Lys394Arg, Ala21Val + Gly62Asp + lle69Val + Ser348Leu, ThM 161Ie + Lys128Met, Pro393Gln, Ser530Gly, Pro393Gln + Ser530Gly wobei die Nummerierung der Sequenzpositionen auf Sequenz 3 bezogen ist.
13. Für eine Cholinoxidase kodierende Nukleinsäure, die eine Mutation oder mehrere Mutationen an Basensequenzpositionen aufweist, die ausgewählt sind unter den Positionen 11 , 62, 185, 205, 235, 347, 383, 497, 746, 778, 962, 1043, 1052, 1178, 1181 und 1588, wobei die Nummerierung der Sequenzpositionen auf Sequenz 10 bezogen ist.
14. Für eine Cholinoxidase kodierende Nukleinsäure, die einen Basenaustausch oder mehrere Basenaustausche aufweist, der bzw. die ausgewählt sind unter A11G, C62T, G185A, A205G, A235G, C347T, A383T, A497G, G746A, G778A, C962T, C1043T, T1052A, C1178A, A1181G und A1588G, wobei die Nummerierung der Sequenzpositionen auf Sequenz 10 bezogen ist.
15. Oligonukleotid, dessen Nukleotidsequenz mit einer der in Seq. 15 bis Seq. 40 angegebenen Nukleotidsequenzen zu mindestens 85 %, insbesondere mindestens 90 %, besonders bevorzugt mindestens 95 % und ganz besonders bevorzugt zu 100 % übereinstimmt.
16. Cholinoxidase, die eine spezifische Aktivität auf Cholin von 0,1-100000 U/g, insbesondere von 0,1-1000 U/g; eine spezifische Aktivität auf DMDEA von 0,1-100000 U/g, insbesondere von 0,9 - 1000 U/g; eine spezifische Aktivität auf TEA von 0,1-100000 U/g, insbesondere von 0,9 - 1000 U/g und eine spezifische Aktivität auf MTEA von 0,1-100000 U/g, insbesondere von 0,9 - 100 U/g aufweist.
17. Vektor, enthaltend eine in den Ansprüchen 8 bis 16 bezeichnete Nukleinsäure.
18. Vektor nach Anspruch 17, dadurch gekennzeichnet, dass es sich um einen Klonierungsvektor oder Expressionsvektor handelt.
19. Wirtszelle, die eines der in den Ansprüchen 1 bis 7 oder 16 bezeichneten Proteine oder Derivate exprimiert oder zu dessen Expression angeregt werden kann, vorzugsweise unter Einsatz eines Expressionsvektors gemäß Anspruch 18.
20. Wirtszelle gemäß Anspruch 19, dadurch gekennzeichnet, daß sie ein Bakterium ist, insbesondere eines, das das gebildete Protein oder Derivat ins umgebende Medium sezemiert.
21. Wirtszelle gemäß Anspruch 20, dadurch gekennzeichnet, daß sie der Gattung Escherichia, insbesondere der Species Escherichia coli angehört
22. Wirtszelle gemäß Anspruch 20, dadurch gekennzeichnet, daß sie der Gattung Bacillus, vorzugsweise der Species Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis oder Bacillus alcalophilus angehört.
23. Wirtszelle gemäß Anspruch 20, dadurch gekennzeichnet, daß sie besonders bevorzugt der Gattung Arthrobacter und innerhalb dieser Gattung der Spezies oxidans angehört.
24. Wirtszelle gemäß Anspruch 19, dadurch gekennzeichnet, daß sie eine eukaryontische Zelle ist, insbesondere eine, die das gebildete Protein posttranslational modifiziert.
25. Verwendung einer Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16 als Wasserstoffperoxid in situ erzeugendes Agens.
26. Verwendung einer Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16 zur Bleiche, zur Farbübertragungsinhibierung und zur Desinfektion.
27. Körperpflegemittel, Haarwaschmittel, Haarpflegemittel, Mund-, Zahn- oder Zahnprothesenpflegemittel, Kosmetika, Waschmittel, Reinigungsmittel, Nachspülmittel, Handwaschmittel, Handgeschirrspülmittel, Maschinengeschirrspülmittel, Desinfektionsmittel und Mittel zur bleichenden oder desinfizierenden Behandlung von Filtermedien, Textilien, Pelzen, Papier, Fellen oder Leder, enthaltend eine Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16.
28. Wasch-, oder Bleichmittel, enthaltend ein Bleichsystem, das in der Lage ist, unter Anwendungsbedingungen des Mittels Wasserstoffperoxid zu erzeugen, und gegebenenfalls synthetisches Tensid, organischen und/oder anorganischen Builder sowie sonstige übliche Bleich- oder Waschmittelbestandteile, insbesondere Bleichaktivatoren, vorzugsweise TEAD, dadurch gekennzeichnet, daß das Bleichsystem aus einer Cholinoxidase gemäß einem der Ansprüche 1 bis 7 oder 16 und einem Substrat für die Cholinoxidase besteht.
29. Mittel nach Anspruch 28, dadurch gekennzeichnet, daß das Substrat DMDEA, TEA, MTEA, Cholin, Betainaldehyd oder ein Cholinderivat ist.
30. Mittel nach einem der Ansprüche 28 oder 29, dadurch gekennzeichnet, daß es als rieselfähiges Pulver mit einem Schüttgewicht von 300 g/l bis 1200 g/l, insbesondere 500 g/l bis 900 g/l, vorliegt.
31. Mittel nach einem der Ansprüche 28 oder 29, dadurch gekennzeichnet, daß es in Form eines pastenförmigen oder flüssigen Waschmittels vorliegt.
32. Mittel nach einem der Ansprüche 28, 29 oder 31 , dadurch gekennzeichnet, daß es in Form eines nicht-wäßrigen Flüssigwaschmittels oder einer nicht-wäßrigen Paste vorliegt.
33. Mittel nach einem der Ansprüche 28, 29, 31 oder 32, dadurch gekennzeichnet, daß es in Form eines wäßrigen Flüssigwaschmittels oder einer wasserhaltigen Paste vorliegt und in einem luftundurchlässigen Behältnis verpackt ist, aus dem es kurz vor Gebrauch oder während des Waschvorgangs freigesetzt wird.
34. Mittel nach einem der Ansprüche 28 bis 33, dadurch gekennzeichnet, daß die Cholinoxidase und/oder das Substrat für dieses Enzym mit einer bei Raumtemperatur oder bei Abwesenheit von Wasser für das Enzym und/oder dessen Substrat undurchlässigen Substanz umhüllt ist, welche unter Anwendungsbedingungen des Mittels durchlässig für das Enzym und/oder dessen Substrat wird.
35. Mittel nach einem der Ansprüche 28 bis 34, dadurch gekennzeichnet, daß es zusätzlich zum Bleichsystem
• 5 Gew.-% bis 70 Gew.-%, insbesondere 10 Gew.-% bis 50 Gew.-% Tensid,
• 10 Gew.-% bis 65 Gew.-%, insbesondere 12 Gew.-% bis 60 Gew. -% wasserlösliches, wasserdispergierbares anorganisches Buildermaterial,
• 1 Gew.-% bis 10 Gew.-%, insbesondere 2 Gew.-% bis 8 Gew.-%, wasserlösliche organische Buildersubstanzen,
• nicht über 15 Gew.-% feste anorganische und/oder organische Säuren beziehungsweise saure Salze,
• nicht über 5 Gew.-% Komplexbildner für Schwermetalle,
• nicht über 5 Gew.-% Vergrauungsinhibitor,
• nicht über 5 Gew. -% Farbübertragungsinhibitor und
• nicht über 5 Gew.-% Schauminhibitor enthält.
36. Haarwasch- und/oder Haarpflegemittel, enthaltend Cholinoxidasen gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16.
37. Oxidationsfärbemittel zum Färben von Keratinfasern, insbesondere von Haaren, enthaltend Cholinoxidasen gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16.
38. Mittel zur Zahnprothesenpflege, insbesondere Prothesenreiniger, enthaltend Cholinoxidasen gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16.
39. Signal-Reagenz zur Erzeugung einer Lichtemission in einem Chemilumineszenz-Assay, umfassend eine Cholinoxidase gemäß einem der Ansprüche 1 bis 7 oder 16, ein Cholinoxidase-Substrat und ein Chemilumineszenz-Reagens.
40. Signal-Reagenz nach Anspruch 39, worin das Cholinoxidase-Substrat ausgewählt ist unter Cholin, Cholinderivaten und Betainaldehyd.
41. Signal-Reagenz nach Anspruch 39 oder 40, worin das Chemilumineszenz-Reagens Luminol ist.
42. Verwendung einer Cholinoxidase, insbesondere einer Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16 zur Herstellung von Betain.
43. Verwendung einer Cholinoxidase, insbesondere einer Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16 zur Herstellung von Lebensmitteln und/oder Lebensmittelbestandteilen.
44. Verwendung einer Cholinoxidase, insbesondere einer Cholinoxidase gemäß der Definition in einem der Ansprüche 1 bis 7 oder 16 zur Herstellung von Tierfutter und/oder Tierfutterbestandteilen.
PCT/EP2006/009890 2005-10-17 2006-10-13 Neue cholinoxidasen mit veränderter substratspezifität WO2007045398A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005049908A DE102005049908A1 (de) 2005-10-17 2005-10-17 Neue Cholinoxidasen mit veränderter Substratspezifität
DE102005049908.2 2005-10-17

Publications (2)

Publication Number Publication Date
WO2007045398A2 true WO2007045398A2 (de) 2007-04-26
WO2007045398A3 WO2007045398A3 (de) 2007-11-22

Family

ID=37806873

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/009890 WO2007045398A2 (de) 2005-10-17 2006-10-13 Neue cholinoxidasen mit veränderter substratspezifität

Country Status (2)

Country Link
DE (1) DE102005049908A1 (de)
WO (1) WO2007045398A2 (de)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008089860A2 (de) * 2007-01-26 2008-07-31 Henkel Ag & Co. Kgaa Verfahren zur enzymatischen herstellung von wasserstoffperoxid
WO2018148933A1 (en) * 2017-02-17 2018-08-23 L'oreal Cosmetic mask and process
CN114231507A (zh) * 2021-12-27 2022-03-25 无锡阿科力科技股份有限公司 一种胆分节杆菌胆碱氧化酶突变体及其应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024079306A1 (de) * 2022-10-14 2024-04-18 Rudolf Gmbh Biostoning

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004058955A2 (de) * 2002-12-20 2004-07-15 Henkel Kommanditgesellschaft Auf Aktien Cholinoxidasen

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004058955A2 (de) * 2002-12-20 2004-07-15 Henkel Kommanditgesellschaft Auf Aktien Cholinoxidasen

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RAND THOMAS ET AL: "Structural characterization and mapping of the covalently linked FAD cofactor in choline oxidase from Arthrobacter globiformis." BIOCHEMISTRY, Bd. 42, Nr. 23, 17. Juni 2003 (2003-06-17), Seiten 7188-7194, XP002424507 ISSN: 0006-2960 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008089860A2 (de) * 2007-01-26 2008-07-31 Henkel Ag & Co. Kgaa Verfahren zur enzymatischen herstellung von wasserstoffperoxid
DE102007005053A1 (de) 2007-01-26 2008-07-31 Henkel Ag & Co. Kgaa Verfahren zur enzymatischen Herstellung von Wasserstoffperoxid
WO2008089860A3 (de) * 2007-01-26 2008-10-09 Henkel Ag & Co Kgaa Verfahren zur enzymatischen herstellung von wasserstoffperoxid
WO2018148933A1 (en) * 2017-02-17 2018-08-23 L'oreal Cosmetic mask and process
CN114231507A (zh) * 2021-12-27 2022-03-25 无锡阿科力科技股份有限公司 一种胆分节杆菌胆碱氧化酶突变体及其应用
CN114231507B (zh) * 2021-12-27 2023-11-14 无锡阿科力科技股份有限公司 一种胆分节杆菌胆碱氧化酶突变体及其应用

Also Published As

Publication number Publication date
WO2007045398A3 (de) 2007-11-22
DE102005049908A1 (de) 2007-05-16

Similar Documents

Publication Publication Date Title
EP1945784B1 (de) System zur enzymatischen generierung von wasserstoffperoxid
DE102004029475A1 (de) Neues enzymatisches Bleichsystem
WO2004058955A2 (de) Cholinoxidasen
EP1572997A1 (de) Subtilisin-varianten, bei denen die perhydrolase-aktivität erhöht wurde
EP1385943B1 (de) Alkalische protease-varianten und wasch- und reinigungsmittel enthaltend diese alkalischen protease-varianten
DE102006021401A1 (de) Amadoriasen in Wasch- und Reinigungsmitteln
DE10064983A1 (de) Neue Alkalische Protease aus Bacillus alcalophilus (DSM 11233)
WO2007131657A2 (de) Neue alkalische protease aus bacillus gibsonii und wasch- und reinigungsmittel enthaltend diese neue alkalische protease
EP2016175A1 (de) Subtilisin aus bacillus pumilus und wasch- und reinigungsmittel enthaltend dieses neue subtilisin
WO2008086916A1 (de) Neue alkalische protease aus bacillus gibsonii und wasch- und reinigungsmittel enthaltend diese neue alkalische protease
EP1456366A1 (de) Neue alkalische protease aus bacillus gibsonii (dsm 14393) und wasch- und reinigungsmittel enthaltend diese neue alkalische protease
WO2003054185A1 (de) Neue alkalische protease aus bacillus gibsonii (dsm 14391) und wasch- und reinigungsmittel enthaltend diese neue alkalische protease
EP1456384A2 (de) Alkalische protease aus bacillus sp. (dsm 14390) und wasch- und reinigungsmttel enhaltend diese alkalische protease
DE10163884A1 (de) Neue Alkalische Protease aus Bacillus sp. (DSM 14392) und Wasch- und Reinigungsmittel enthaltend diese neue Alkalische Protease
EP1789546A2 (de) Leistungsverbesserte alkalische protease-varianten vom subtilisin-typ aus bacillus lentus und solche varianten enthaltende wasch- und reinigungsmittel
WO2007045398A2 (de) Neue cholinoxidasen mit veränderter substratspezifität
WO2007009618A1 (de) Alkalimetallhalogenide als tracer
WO2009053157A1 (de) Subtilisin aus bacillus pumilus und wasch- und reinigungsmittel enthaltend dieses subtilisin

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06828812

Country of ref document: EP

Kind code of ref document: A2