WO2007028631A1 - Facteur de risque genetique de troubles neurodeveloppementaux et leurs complications - Google Patents

Facteur de risque genetique de troubles neurodeveloppementaux et leurs complications Download PDF

Info

Publication number
WO2007028631A1
WO2007028631A1 PCT/EP2006/008777 EP2006008777W WO2007028631A1 WO 2007028631 A1 WO2007028631 A1 WO 2007028631A1 EP 2006008777 W EP2006008777 W EP 2006008777W WO 2007028631 A1 WO2007028631 A1 WO 2007028631A1
Authority
WO
WIPO (PCT)
Prior art keywords
aph
nucleic acid
amino acid
seq
snp651
Prior art date
Application number
PCT/EP2006/008777
Other languages
English (en)
Inventor
Karen Miriam Johanna Van Loo
Gerardus Johannes Maria Martens
Original Assignee
H. Lundbeck A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by H. Lundbeck A/S filed Critical H. Lundbeck A/S
Publication of WO2007028631A1 publication Critical patent/WO2007028631A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to an isolated nucleic acid molecule that has been found to be implicated in the susceptibility of an individual to neurodevelopmental disorders, in particular psychiatric-neurodevelopmental disorders, such as schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, and specifically schizophrenia, autism,.
  • psychiatric-neurodevelopmental disorders such as schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, and specifically schizophrenia, autism,.
  • ADHD Attention-deficit hyperactivity disorder
  • dyslexia as well as in the susceptibility of an individual to complications of neurodevelopmental disorders, in particular depression and epilepsy.
  • the invention also relates to the protein encoded by the nucleic acid and to methods for diagnosing the susceptibility of an individual to such disorders and complications, to probes, primers and kits for use in this method and to cell lines harboring this nucleic acid molecule and their use in drug screening.
  • a neurodevelopmental disorder is a medical disorder that affects the neurological system, and has its origin during the period of a person's life in which they are experiencing rapid neurological development from the point of conception to early adulthood. It can be caused by genetic, environmental, or unspecified reasons, many of which are not yet known.
  • neurodevelopmental disorders include difficulties with motor development, sensory integration difficulties, speech and language delays and a range of cognitive difficulties including learning disabilities, poor organizational skills, poor self regulation and behavioural difficulties.
  • Complications or consequences of the neurodevelopmental disorder include cognitive impairment, neuromotor dysfunction, seizure, abnormal impulsive behaviour, sensory impairment (as in blindness or deafness) .
  • a combination of genetic factors and stressful early-life events may determine the vulnerability of an individual to develop a complex neurodevelopmental disorder.
  • These disorders are characterized by many abnormalities, often also outside the brain, and are generally thought to be caused by multiple affected genes.
  • Schizophrenia is a severe mental disorder, maybe the most severe of the mental illnesses, with about 1% lifetime prevalence and whose course is characterized by the onset of clinical symptoms after puberty. The etiology and pathophysiology of schizophrenia remain elusive. Much interest has centered on the molecular and cellular mechanisms of schizophrenia, including searches for neurotransmitter receptor abnormalities (number or affinity) and neuropathological alterations at the microscopic level (e.g., cell loss or reduced neuronal density in the limbic structures ) .
  • schizophrenia is a neurodevelopmental disorder, whereby a temporolimbic abnormality is inherited or sustained early in life but is not fully expressed until late adolescence/early adulthood.
  • a genome-scan meta-analysis of linkage studies has identified regions that may increase susceptibility to schizophrenia in diverse populations in many chromosomes, especially 2q, but also 5q, 3p, Hq, 6p, Iq, 22q, 8p, 2Oq, 14p, 16q, 18q, 1Op, 15q, 6q and 17q.
  • Schizophrenia is thus an aetiologically heterogeneous syndrome that usually becomes overtly manifest in adolescence and early adulthood, but in many cases subtle impairments in neurointegrative function are present from birth; hence it is considered to be a disorder with a neurodevelopmental component .
  • the strongest risk factor that has been identified so far is familial risk with genetic loading. Nevertheless, 85% of individuals with schizophrenia have no first-degree relative with the illness.
  • Autism is a pervasive developmental disorder with onset by 3 years of age and is defined by the presence of a triad of social and communication impairments with • restricted, repetitive or stereotyped behaviors. Autism is the result of a neurological disorder that affects the normal functioning of the brain, impacting development in the areas of social interaction and communication skills. Both children and adults with autism typically show difficulties in verbal and non-verbal communication, social interactions, and leisure or play activities.
  • the first report of a full genome linkage screen for autism identified three chromosomal regions showing evidence suggestive of linkage. The most significant of these was on the long arm of chromosome 7. Another locus was found on chromosome 2. No clear genetic risk factors were .identified yet .
  • Dyslexia is a specific learning disability that is neurological in origin. It is characterized by difficulties with accurate and/or fluent word recognition and by poor spelling and decoding abilities. These difficulties typically result from a deficit in the phonological component of language that is often unexpected in relation to other cognitive abilities and the provision of effective classroom instruction. Secondary consequences may include problems in reading comprehension and reduced reading experience that can impede the growth of vocabulary and background knowledge.
  • the disorder is common, occurring in at least 2-5% of children, affecting boys 2-3 times more frequently than girls, and is one of the major causes of childhood behavioral problems. Hyperactivity is known to aggregate within families and twin studies have consistently shown it to be among the most highly heritable behaviors in childhood. Like in the other neurodevelopmental disorders described above it is not yet possible to predict susceptibility for the disorder based on a genetic risk factor.
  • Neurodevelopmental disorders may be associated with certain complications that are not in themselves classified as neurodevelopmental disorder but may occur in individuals suffering from these disorders. Examples of such complications are epilepsy and depression.
  • Epilepsy is a disorder that occurs when there is a sudden, brief change in how the brain works. When brain cells are not working properly, a person's consciousness, movement or actions may be altered for a short time. These physical changes are called epileptic seizures. Epilepsy is therefore sometimes called a seizure disorder. As indicated above seizure is one of the consequences of a neurodevelopmental disorder.
  • CHRNA4 and CHRNB encode subunits of the neuronal nicotinic acetylcholine ion-channel receptor. Since the discovery of CHRNA4 mutations several ion channel genes, mostly causing primarily generalized epilepsy, have been identified. Defects in the voltage-gated potassium channels potassium voltage-gated channel, subfamily Q, member 2 (KCNQ2) and KCNQ3 have recently been identified in benign familial neonatal convulsions.
  • Mutations affecting the voltage-gated sodium channel subunits SCNlB and- -SCNI-A or the gamma 2-subunit of the GABA(A) receptor can cause generalized epilepsy with febrile seizures plus severe myoclonic epilepsy of infancy. Chloride and calcium channel mutations are also found in rare families with the common syndromes childhood absence epilepsy and juvenile myoclonic epilepsy.
  • LGIl glioma inactivated 1
  • Depressive disorders represent a prevalent (1 to 2%) and major illness characterized by episodes of dysphoria that are associated with somatic symptoms.
  • a major depressive episode is characterized by at least 2 weeks during which there is a new onset or clear worsening of either depressed mood or apathy or ahedonism in nearly all activities.
  • changes in appetite, weight, sleep, and psychomotor activity; decreased energy; feelings of worthlessness or guilt; difficulty thinking, concentrating, or making decisions; or recurrent thoughts of death or suicidal ideation, plans, or attempts occur.
  • the episode is accompanied by distress or impairment in social-, occupational, or other important areas of functioning.
  • Depressive disorders may have a manic-depressive (bipolar) or purely depressive (unipolar) course. If untreated, manic-depressive illness is associated with a suicide rate of approximately 20%.
  • Depressed patients have decreased activity in the prefrontal cortex, corresponding to a reduction in cortical volume. This region had previously been implicated in the mediation of emotional and autonomic responses to socially significant or provocative stimuli, and in the modulation of the neurotransmitter systems targeted by antidepressant drugs .
  • MMDl major depressive disorder
  • MDD2 major depressive disorder
  • SSTRPs simple sequence tandem repeat polymorphisms
  • TPH2 tryptophan 15 hydroxylase-2
  • a polymorphism in the HTR2A gene which encodes the serotonin 2A receptor, has been associated with citalopram treatment outcome in major depressive disorder.
  • Polymorphism in the FKBP5 gene which plays a role in the stress hormone-regulating hypothalamic-pituitary-adrenal axis, has been found to be related to a faster response to antidepressant drug treatment and to increased recurrence of depressive episodes.
  • a single-nucleotide polymorphism (SNP) in the human gene Aph-lb is associated with the susceptibility of an individual for neurodevelopmental disorders, in- -particular psychiatric-neurodevelopmental disorders, including schizophrenia, autism, ADHD and dyslexia, and complications of neurodevelopmental disorders, in particular epilepsy and depression.
  • Aph-lb is known as a component of the gamma-secretase complex. Subtle alterations in gamma-secretase subunit composition may lead to a variety of affected
  • the present invention thus provides an isolated nucleic acid molecule comprising a variant of the human Aph-lb gene as depicted in Fig. 1 (SEQ ID NO:1) that causes the amino acid residue in position 217 of the encoded Aph-lb to be an aliphatic amino acid, in particular a leucine.
  • the variant Aph-lb gene has the nucleotide sequence as depicted in any one of the Figs. 2A-F (SEQ ID NOS:3-8), or a fragment thereof that comprises the codon encoding amino acid residue 217 of the encoded component Aph-lb.
  • the isolated nucleic acid of the invention is in a further embodiment a nucleic acid encoding a polypeptide having the amino acid sequence as depicted in Fig.. 4 (SEQ ID NO: 9) . Due to the degeneracy of the genetic code one amino acid sequence can be encoded by various nucleic acid sequences .
  • the isolated nucleic acid molecule which hybridizes under high stringency conditions to a nucleotide sequence selected from the group consisting of the sequences as shown in Fig. 2A-F (SEQ ID NOS: 2-7) and the complement of the sequence as shown in Fig. 2A-F (SEQ ID NOS:2-7), with the proviso that the nucleic acid has a codon selected from TTA, TTG, CTT, CTC, CTA, CTG in the position encoding the amino acid residue in position 217 of the encoded Aph-lb.-
  • the codon in the position encoding the amino acid residue in position 217 of the encoded Aph-lb is TTG.
  • High stringency conditions for the different hybridisation techniques that are generally available.
  • stringency is determined by various factors, among which the temperature, the solvent (i.e. aqueous or with formamide) , the volume of the hybridisation solution and length of hybridisation and the salt concentration.
  • High stringency is usually a temperature above 50 0 C and a salt concentration of at least 2x SSC.
  • the invention further relates to an isolated nucleic acid molecule comprising the complement of a sequence described above.
  • the invention provides a vector comprising the isolated nucleic acid molecule, operatively linked to a regulatory sequence, and a recombinant host cell comprising the vector.
  • the invention according to another aspect thereof relates to a method for producing a polypeptide encoded by the isolated nucleic acid molecule as described above, comprising culturing the recombinant host cell under conditions suitable for expression of said nucleic acid molecule .
  • the invention provides an isolated polypeptide encoded by the nucleic acid molecule, or a fragment of said polypeptide, which polypeptide or fragment comprises an aliphatic amino acid, in particular a leucine, in the position that corresponds with position 217 in human Aph-lb as depicted in Fig. 3 (SEQ ID NO: 8) .
  • the isolated polypeptide has -the amino acid sequence of Fig. 4 (SEQ ID NO: 9) or is an isolated polypeptide comprising an amino acid sequence which is more than about 90 percent identical to the amino acid sequence of Fig. 3 (SEQ ID NO : 8 ) and which has an aliphatic amino acid, in particular a leucine, in the position that corresponds with position 217 in human Aph-lb.
  • the invention also relates to a fusion protein comprising the isolated polypeptide and to an antibody, or an antigen-binding fragment thereof, which selectively binds to the polypeptide, in particular to a part that comprises the amino acid in position 217 of Aph-lb.
  • the variant gene of the invention and the encoded polypeptide and products derived therefrom can be suitably used in the diagnosis of neurodevelopmental disorders, such as autism, ADHD, dyslexia and schizophrenia, and in complications of these disorders, such as epilepsy or depression.
  • primers and probes can be derived from the variant gene.
  • Probes or “primers” are oligonucleotides that hybridize in a base-specific manner to a complementary strand of nucleic acid molecules.
  • the term “primer” in particular refers to a single-stranded oligonucleotide which acts as a point of initiation of template-directed nucleic acid synthesis using well-known methods (e.g., PCR, LCR, NASBA, etc.) including, but not limited to those described herein.
  • a probe or primer comprises a region of nucleotide sequence that hybridizes to at least about 15, typically about 20-25, and more typically about 40-75, like 40, 50 or 75, consecutive nucleotides of a nucleic acid molecule comprising a contiguous nucleotide sequence selected from the sequences shown in Figs. 2A-F (SEQ ID NOS: 2-7), the complement of the sequences shown in Figs. 2A-F (SEQ ID NOS: 2-7), or a sequence encoding the amino acid sequence as shown in Fig. 4 (SEQ ID NO: 9).
  • a probe or primer comprises 100 or fewer nucleotides, preferably from 6 to 50 nucleotides, preferably from 12 to 30 nucleotides.
  • the probe or primer is at least 70% identical to the above nucleotide sequence or to the complement of the above nucleotide sequence, preferably at least 80% identical, more preferably at least 90% identical, even more preferably at least 95% identical, or even capable of selectively hybridizing to the contiguous nucleotide sequence or to the complement of the contiguous nucleotide sequence.
  • the probe or primer further comprises a label, e.g., radioisotope, fluorescent compound, enzyme, or enzyme co-factor.
  • the probe or primer of the invention should contain a nucleotide that is the complement of position 651 of either the known or the variant Aph-lb gene.
  • T-primer forward primer 5'- AATAAACCTGGCGTCAGCATTT -3 I reversed primer 5' - AGTCGGCTTTACACTGTCCCA -3 I
  • G-primer forward primer 5'- AATAAACCTGGCGTCAGCATTG -3 I reversed primer 5' - AGTCGGCTTTACACTGTCCCA -3 I
  • nucleic acid molecules of the invention can be identified and isolated using standard molecular biology techniques and the sequence information provided in Figs. 1 and 2A-F (SEQ ID NOS: 1-7).
  • nucleic acid molecules can be amplified and isolated by the polymerase chain reaction using synthetic oligonucleotide primers designed based on one or more of the sequences provided in Figs. 1 and 2A-F (SEQ ID NOS: 1-7) and/or the complement thereof, or designed based on sequences encoding the amino acid sequence provided in Fig. 4 (SEQ ID NO: 9). See generally PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, N.
  • the nucleic acid molecules can be amplified using cDNA, mRNA or genomic DNA as a template, cloned into an appropriate vector and characterized by DNA sequence analysis.
  • LCR ligase chain reaction
  • NASBA nucleic acid based sequence amplification
  • the latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.
  • the amplified DNA can be radiolabelled ' or p ' rovided with another suitable label, such as a fluorescent label, and used as a probe. Such probe can be used for detecting another amplified nucleic acid molecule or for screening.
  • Antisense nucleic acid molecules of the invention can be designed using the nucleotide sequences of Figs. 1 and 2A- F (SEQ ID NOS: 1-7) and/or the complement and/or a portion thereof, and/or a sequence encoding the amino acid sequence of Fig. 4 (SEQ ID NO: 9), or encoding a portion thereof, and constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid molecule e.g., an antisense oligonucleotide
  • an antisense nucleic acid molecule can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • the antisense nucleic acid molecule can be produced biologically using an expression vector into which a nucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid molecule will be of an antisense orientation to a target nucleic acid of interest).
  • an antisense orientation i.e., RNA transcribed from the inserted nucleic acid molecule will be of an antisense orientation to a target nucleic acid of interest.
  • a further approach can include an RNA interference approach by expressing double stranded RNA or si-RNA.
  • the invention further relates to a method of diagnosing neurodevelopmental disorders or a susceptibility to neurodevelopmental disorders in an individual, comprising screening for the presence of SNP651 (SEQ ID NO: 10) in the gene encoding the human Aph-lb, which SNP651 is more frequently present in a population of individuals suffering from or susceptible to neurodevelopmental disorders than in the general population, and wherein the presence" of SNP651 is indicative of the existence of neurodevelopmental disorders or susceptibility to neurodevelopmental disorders or complications thereof.
  • SNP651 SEQ ID NO: 10
  • the SNP651 is more frequently present when there is a significant increase in its occurrence as compared to the normal population.
  • the normal population and the patient are Caucasian.
  • the subjects may have been previously diagnosed as having a neurodevelopmental disorder or the screening may be used in conjunction with the diagnostic efforts.
  • the method comprises determining the presence of SNP651 in the genotype of the subject.
  • the genotype that is detected indicates that the subject is likely to have the phenotypic response associated with that genotype.
  • SNP651 is a single nucleotide polymorphism in which the T in position 651 of the coding part of the gene (wherein the start codon ATG represent positions 1-3) is changed into G.
  • the method of diagnosis according to the invention is suitable for neurodevelopmental disorders, preferably psychiatric-neurodevelopmental disorders.
  • This method is particular suitable for neurodevelopmental disorders selected from schizophrenia, autism, ADHD, dyslexia, Rett's disorder and Asperger's, preferably selected from schizophrenia, autism, ADHD and dyslexia.
  • the above method of diagnosis is also suitable for diagnosing complications of neurodevelopmental disorders, in particular depression and epilepsy.
  • neurodevelopmental disorders the disorders schizophrenia, autism, ADHD and dyslexia are particularly intended to be disclosed also alone or in combination.
  • disorders schizophrenia, autism, ADHD and dyslexia are particularly intended to be disclosed also alone or in combination.
  • complications epilepsy and depression are " in particular intended to be disclosed, either alone or in combination .
  • Diagnosis of a susceptibility to neurodevelopmental disorders such as schizophrenia is thus made by detecting the SNP651 polymorphism in the Aph-lb gene.
  • the polymorphism is the change of one nucleotide, resulting in a change in the encoded amino acid.
  • hybridization methods such as Southern analysis, Northern analysis, or in situ hybridizations are used. These techniques are well known in the art and are for example disclosed in Current Protocols in Molecular Biology, Ausubel, F. et al., eds . , John Wiley & Sons, including all supplements.
  • test sample a biological sample from a test subject (a "test sample") of genomic DNA, RNA, or cDNA, is obtained from an individual suspected of having, being susceptible to or predisposed for, or carrying a defect for, a neurodevelopmental disorder or complication thereof (the test sample)
  • test individual The individual can be an adult, child, or fetus.
  • the test sample can be from any source which contains genomic DNA, such as a blood sample, sample of amniotic fluid, sample of cerebrospinal fluid, or tissue sample from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract a or other organs.
  • a test sample of DNA from fetal cells or tissue can be obtained by appropriate methods, such as by amniocentesis or chorionic villus sampling.
  • nucleic acid probe can be a DNA probe or an RNA probe; the nucleic acid probe contains the SNP651 polymorphism in Aph-lb.
  • the probe can be any of the nucleic acid molecules described above (e.g., the gene, a fragment, a vector comprising the gene, a probe or primer, etc. )
  • a hybridization sample is formed by contacting the test sample containing the Aph-lb gene, with at least one nucleic acid probe.
  • a preferred probe for detecting mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic DNA sequences described herein.
  • the nucleic acid probe can be, for example, a full-length nucleic acid molecule, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to appropriate mRNA or genomic DNA.
  • the nucleic acid probe can be all or a portion of the sequence shown in Figs. 2A-F (SEQ ID NOS: 2-7), or the complement thereof, or a portion thereof, or can be a nucleic acid encoding all or a portion of the amino acid sequence shown in Fig. 4 (SEQ ID NO: 9).
  • Suitable probes for use in the diagnostic assays of the invention comprise a nucleotide that is complementary to position 651 of the Aph- lb gene or variant thereof.
  • the hybridization sample is maintained under conditions which are sufficient to allow specific hybridization of the nucleic acid probe to the Aph-lb gene.
  • Specific hybridization indicates exact hybridization (e.g., with no mismatches).
  • Specific hybridization can be performed under high stringency conditions or moderate stringency conditions. In a particularly preferred embodiment, the hybridization conditions for specific hybridization are high stringency.
  • Specific hybridization if present, is then detected using standard methods. If specific hybridization occurs between the nucleic acid probe and the Aph-lb gene in the test sample, then the Aph-lb gene has the polymorphism, that is present in the nucleic acid probe. Specific hybridization of the nucleic acid probe is indicative of a polymorphism in the Aph-lb gene, and is therefore diagnostic for a susceptibility to a neurodevelopmental disorder such as schizophrenia .
  • RNA from the individual is indicative of the SNP651 polymorphism in the Aph-lb gene, and is therefore diagnostic for a susceptibility to schizophrenia or another neurodevelopmental disorder or complication thereof.
  • a peptide nucleic acid (PNA) probe can be used instead of a nucleic acid probe in the hybridization methods described above.
  • PNA is a DNA mimic having a peptide-like, inorganic backbone, such as N- (2-aminoethyl) glycine units, with an organic base (A, G, C, T or U) attached to the glycine nitrogen via a methylene carbonyl linker (see, for example, Nielsen, P. E. et al., Bioconjugate Chemistry, 1994, 5, American Chemical Society, p. 1- (1994) .
  • the PNA probe can be designed to specifically hybridize to the Aph-lb gene having the SNP651 polymorphism associated with a susceptibility to schizophrenia. Hybridization of such PNA probe to the Aph-lb gene is diagnostic for a susceptibility to a neurodevelopmental disorder, such as schizophrenia, or complication thereof.
  • Sequence analysis can also be used to detect the SNP651 polymorphism in the Aph-lb gene.
  • a test sample of DNA or RNA is obtained from the test individual. PCR or other appropriate methods can be used to amplify the gene, and/or its flanking sequences, if desired.
  • the sequence of the Aph- lb gene, or a fragment of the gene, or cDNA, or fragment of the cDNA, or mRNA, or fragment of the mRNA is determined, using standard methods.
  • the sequence of the gene, gene fragment, cDNA, cDNA fragment, mRNA, or mRNA fragment is compared with the known nucleic acid sequence of the gene, cDNA (e.g., Fig.
  • Allele-specific oligonucleotides can also be used to detect the presence of the SNP651 polymorphism in Aph-lb, through the use of dot-blot hybridization of amplified oligonucleotides with allele-specific oligonucleotide (ASO) probes (see, for example, Saiki, R. et al., (1986), Nature (London) 324:163-166).
  • ASO allele-specific oligonucleotide
  • an “allele-specific oligonucleotide” (also referred to herein as an “allele-specific oligonucleotide probe”) is an oligonucleotide ⁇ f ⁇ approximately 10-50 base pairs, preferably approximately 15-30 base pairs, that specifically hybridizes to Aph-lb, and that contains a polymorphism associated with a susceptibility to schizophrenia or another neurodevelopmental disorder or complication thereof.
  • An allele-specific oligonucleotide probe that is specific for the SNP651 polymorphism in Aph-lb can be prepared, using standard methods (see Current Protocols in Molecular Biology, supra) .
  • a test sample of DNA is obtained from the individual.
  • PCR can be used to amplify all or a fragment of Aph-lb, and its flanking sequences.
  • the DNA containing the amplified Aph-lb (or fragment of the gene) is dot-blotted, using standard methods (see Current Protocols in Molecular Biology, supra) , and the blot is contacted with the oligonucleotide probe. The presence of specific hybridization of the probe to the amplified Aph-lb is then detected.
  • an allele-specific oligonucleotide probe to DNA from the individual is indicative of the SNP651 polymorphism in Aph-lb, and is therefore indicative of a susceptibility to schizophrenia or another neurodevelopmental disorder or complication thereof.
  • arrays of oligonucleotide probes that are complementary to target nucleic acid sequence segments from an individual can be used to identify the SNP651 polymorphism in Aph-lb.
  • an oligonucleotide array can be used.
  • Oligonucleotide arrays typically comprise a plurality of different oligonucleotide probes that are coupled to a surface of a substrate in different known locations.
  • One such oligonucleotide probe could be used to detect the presence of SNP651 in the target nucleic acid sequence segments- from an individual.
  • These oligonucleotide arrays also described as "GenechipsTM, " have been generally described in the art, for example, U.S. Pat. No. 5,143,854 and PCT patent publication Nos. WO 90/15070 and 92/10092. These arrays can generally be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis methods.
  • a nucleic acid of interest is hybridized with the array and scanned for polymorphisms.
  • Hybridization and scanning are generally carried out by methods described in, e.g., Published PCT
  • a target nucleic acid sequence which includes one or more previously identified polymorphic markers is amplified by well known amplification techniques, e.g., PCR. Typically, this involves the use of primer sequences that are complementary to the two strands of the target sequence both upstream and downstream from the polymorphism. Asymmetric PCR techniques may also be used. Amplified target, generally incorporating a label, is then hybridized with the array under appropriate conditions.
  • the array Upon completion of hybridization and washing of the array, the array is scanned to determine the position on the array to which the target sequence hybridizes.
  • the hybridization data obtained from the scan is typically in the form of fluorescence intensities as a function of location on the array.
  • Other methods of nucleic acid analysis can be used to detect the SNP651 polymorphism in Aph-lb. Representative methods include direct manual sequencing (Church and Gilbert,
  • the screening for the presence of SNP651 (SEQ ID NO: 10) in the gene encoding the human Aph-lb comprises the steps of: a) provision of nucleic acid from the individual to be tested; b) amplification of part of the nucleic acid of the individual to be tested with a primer comprising a contiguous nucleotide sequence, which is at least partially complementary to a part of the nucleotide sequence of said Aph-lb nucleic acid and which is capable of acting as a primer for said Aph-lb nucleic acid when maintained under conditions for primer extension; c) determining whether the amplification product is formed.
  • This embodiment is particularly advantageous, when the primer is complementary to a stretch of nucleic acid located immediately upstream from the position of SNP651, and ends with an A or a C.
  • the primer with the 3' A (A- primer) will result in primer extension, whereas the primer with the C at the end (C-primer) will not be extended.
  • the PCR reaction on the nucleic acid sample of an individual having T/T at position 651 will not produce an amplification product with the C-primer but will result in an amplification product with the A-primer.
  • An individual having the SNP651 mutation at both alleles will produce a product with the C-primer but not with the A- primer.
  • the sample of a heterozygous individual will show a product with both primers.
  • PCR' s with the two primers has the additional advantage of obtaining information about the homozygosity or heterozygosity of the individual, one PCR with one primer will also give the indication whether or not the individual has the genetic risk factor.
  • any other amplification technique such as NASBA or LCR, can be used.
  • nucleic acids, probes, primers, polypeptides and antibodies described herein can be used in methods of diagnosis of a susceptibility to neurodevelopmental disorders, such as schizophrenia, or complications of such disorders, as well as in kits useful for diagno-sis -of a susceptibility to these disorders or their complications.
  • the invention also relates to a reagent and a kit for diagnosing an individual for susceptibility to a neurodevelopmental disorder, such as schizophrenia, autism, ADHD or dyslexia, or complications thereof, such as depression and epilepsy.
  • a neurodevelopmental disorder such as schizophrenia, autism, ADHD or dyslexia, or complications thereof, such as depression and epilepsy.
  • a reagent of the invention is for assaying a sample for the presence of a variant Aph-lb nucleic acid, said reagent comprising a nucleic acid comprising a contiguous nucleotide sequence which is at least partially identical to the complement of a part of the nucleotide sequence of said variant Aph-lb nucleic acid and comprises the codon encoding amino acid 217 in the Aph-lb protein.
  • the reagent is suitably a probe or primer.
  • the probe or primer comprises a contiguous nucleotide sequence which is completely identical to the complement of a part of the nucleotide sequence of said Aph- lb nucleic acid.
  • a reagent kit of the invention is for assaying a sample for the presence of a Aph-lb nucleic acid, comprising, in particular in separate containers: a) one or more labeled nucleic acids comprising a contiguous nucleotide sequence which is at least partially identical to the complement of a part of the nucleotide sequence of said Aph-lb nucleic acid and comprises the codon encoding amino acid 217 in the Aph-lb protein, and b) reagents for detection of said label.
  • the labeled nucleic acid comprises a contiguous nucleotide sequences which is completely identical to the complement of a part of the nucleotide sequence of said Aph-lb nucleic acid.
  • the present invention further relates to a cell line harboring the SNP651 polymorphism in the Aph-lb " gene .
  • This cell line produces a Aph-lb protein in which the amino acid in position 217 is a leucine instead of a phenylalanine.
  • the cell line is either a transgenic cell line or a cell line derived from an individual that has the polymorphism.
  • the presence of SNP651 in an individual is indicative for the development of or an increased susceptibility for neurodevelopmental disorders or their complications.
  • the presence of SNP651 defines a novel subgroup in the group of patients suffering from these disorders or their complications and thereby, as a logical consequence, at least one causative factor responsible for development of the disease in this subgroup.
  • the present invention also relate to the use of the presence of SNP651 in a patient suffering from neurodevelopmental disorders, preferably psychiatric- neurodevelopmental disorders, more preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) , dyslexia, Rett's disorder and Asperger's, and most preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or complications thereof, in particular depression and epilepsy, in the treatment of the patient .
  • neurodevelopmental disorders preferably psychiatric- neurodevelopmental disorders, more preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) , dyslexia, Rett's disorder and Asperger's, and most preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or complications thereof, in particular depression and epilepsy, in the treatment of the patient .
  • Figure 1 shows the 905 bp cDNA sequence of the known human Aph-lb gene (accession AL136671 from GenBank) encoding the variant component Aph-lb of the human gamma-secretase gene as identified according to the invention.
  • SNP651 is the nucleotide at position 651 of the coding sequeri ' ce in which the ATG corresponds to positions 1-3.
  • FIGS 2A-F show examples of variant Aph-lb genes of the invention.
  • Figure 3 shows the known amino acid sequence of human component Aph-lb of the human gamma-secretase gene as found in the UniProtKB/Swiss-Prot at entry Q8WW43.
  • the length is 257 amino acids, the molecular weight is 28460 Da.
  • the amino acid in position 217 in this figure will always be designated as "the amino acid residue in position 217" thus referring to the protein that naturally occurs in humans, even when the actual position of that amino acid in an amino acid sequence is not position 217.
  • Figure 4 shows the amino acid sequence of an example of a variant Aph-lb protein.
  • Figure 5 shows the nucleotide sequence of the genomic region around SNP651 of the human Aph-lb gene. Exon 6 is shown in bold, primers are indicated with rectangles. The last nucleotide of the forward primer is specific for the T or G allele of SNP651.
  • Figure 6 shows the results of the PCR genotyping of SNP651 of the human Aph-lb gene.
  • TT means the presence of a phenylalanine at position 217.
  • TG individual heterozygous for SNP651, meaning 50% phenylalanine and 50% leucine at position 217.
  • GG individual homozygous for a leucine at position 217.
  • Genomic DNA from brain tissues was isolated using standard procedures, including treatment with proteinase K and phenol extraction (Michalowsky and Jones, 1989, MoI. Cell Biol. 3:885) . Genomic DNA from whole blood was isolated using FlexiGene DNA kit (Qiagen) .
  • Genotyping for variation in SNP651 of the human Aph-lb gene was performed via Polymerase Chain Reaction (PCR). For each DNA sample (control and patient), two PCRs were performed: the first reaction with a specific primer for the T-allele (TTT, encoding a phenylalanine at amino acid 217), and the second reaction specific for the G-allele (TTG, encoding for a leucine) .
  • TTTT a specific primer for the T-allele
  • G-allele encoding for a leucine
  • Fig. 2C SEQ ID NO: 4 novel Aph-lb variant
  • Fig. 2D SEQ ID NO: 5 novel Aph-lb variant

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne une molécule d'acide nucléique isolée impliquée dans la susceptibilité d'un individu à des troubles neurodéveloppementaux, en particulier des troubles psychiatriques et neurodéveloppementaux, par exemple la schizophrénie, l'autisme, le trouble d'hyperactivité avec déficit de l'attention (THADA), la dyslexie, le trouble de Rett et d'Asperger, plus précisément la schizophrénie, l'autisme, le trouble d'hyperactivité avec déficit de l'attention (THADA) et la dyslexie, et dans leurs complications, en particulier l'épilepsie et la dépression, ainsi que la protéine codée par l'acide nucléique. Plus précisément, l'invention concerne une molécule d'acide nucléique isolée comprenant un variant du gène humain Aph-1b illustré en Figure 1, responsable du résidu d'acide aminé en position 217 de Aph-1b codé qui devient un acide aminé aliphatique, en particulier une leucine.
PCT/EP2006/008777 2005-09-09 2006-09-08 Facteur de risque genetique de troubles neurodeveloppementaux et leurs complications WO2007028631A1 (fr)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
EP2005009852 2005-09-09
EPPCT/EP2005/009852 2005-09-09
EPPCT/EP2005/013056 2005-12-02
EP2005013056 2005-12-02
EPPCT/EP2005/013053 2005-12-02
EP2005013053 2005-12-02
EPPCT/EP2006/003807 2006-04-25
EP2006003807 2006-04-25

Publications (1)

Publication Number Publication Date
WO2007028631A1 true WO2007028631A1 (fr) 2007-03-15

Family

ID=37657629

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/008777 WO2007028631A1 (fr) 2005-09-09 2006-09-08 Facteur de risque genetique de troubles neurodeveloppementaux et leurs complications

Country Status (1)

Country Link
WO (1) WO2007028631A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008061672A2 (fr) * 2006-11-24 2008-05-29 Synthon B.V. Facteur de risque génétique pour le cancer
WO2008061674A2 (fr) * 2006-11-24 2008-05-29 Synthon B.V. Utilisation d'un modèle animal et procédé permettant de tester des médicaments et des traitements contre le cancer chez des humains
DE102017218522B3 (de) 2017-10-17 2018-12-06 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Verfahren zur genbasierten Diagnose eines Legasthenierisikos

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053312A1 (fr) * 1999-12-23 2001-07-26 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001085912A2 (fr) * 2000-05-05 2001-11-15 Exelixis, Inc. Amplificateurs de preseniline
WO2003018621A2 (fr) * 2001-08-23 2003-03-06 Oxford Biomedica (Uk) Limited Genes
WO2005023858A1 (fr) * 2003-09-05 2005-03-17 Cellzome Ag Complexes proteiniques associes au traitement de la proteine precurseur amyloide
WO2005042786A2 (fr) * 2003-11-03 2005-05-12 Exagen Diagnostics Compositions et procedes de classification des gliomes

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053312A1 (fr) * 1999-12-23 2001-07-26 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001085912A2 (fr) * 2000-05-05 2001-11-15 Exelixis, Inc. Amplificateurs de preseniline
WO2003018621A2 (fr) * 2001-08-23 2003-03-06 Oxford Biomedica (Uk) Limited Genes
WO2005023858A1 (fr) * 2003-09-05 2005-03-17 Cellzome Ag Complexes proteiniques associes au traitement de la proteine precurseur amyloide
WO2005042786A2 (fr) * 2003-11-03 2005-05-12 Exagen Diagnostics Compositions et procedes de classification des gliomes

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008061672A2 (fr) * 2006-11-24 2008-05-29 Synthon B.V. Facteur de risque génétique pour le cancer
WO2008061674A2 (fr) * 2006-11-24 2008-05-29 Synthon B.V. Utilisation d'un modèle animal et procédé permettant de tester des médicaments et des traitements contre le cancer chez des humains
WO2008061672A3 (fr) * 2006-11-24 2008-07-17 Synthon Bv Facteur de risque génétique pour le cancer
WO2008061674A3 (fr) * 2006-11-24 2008-07-31 Synthon Bv Utilisation d'un modèle animal et procédé permettant de tester des médicaments et des traitements contre le cancer chez des humains
DE102017218522B3 (de) 2017-10-17 2018-12-06 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Verfahren zur genbasierten Diagnose eines Legasthenierisikos

Similar Documents

Publication Publication Date Title
EP1649061B1 (fr) Genes utiles en tant qu'outils de diagnostic pour l'autisme
US8206911B2 (en) Identification of the gene and mutation responsible for progressive rod-cone degeneration in dog and a method for testing same
US20140342926A1 (en) Methods for Assessing Risk for Cardiac Dysrythmia in a Human Subject
EP1761649B1 (fr) Gene de predisposition a l'autisme humain codant pour un facteur de transcription et ses utilisations
AU2006215385B2 (en) Uses of human autism susceptibility gene encoding a kinase
Crawford et al. Translocation breakpoint in two unrelated Tourette syndrome cases, within a region previously linked to the disorder
WO2007028631A1 (fr) Facteur de risque genetique de troubles neurodeveloppementaux et leurs complications
EP1863937B1 (fr) Gene humain de susceptibilite a l'autisme codant une proteine transmembrane et ses utilisations
WO2007028655A2 (fr) Decouverte de medicament traitant de troubles neurodeveloppementaux et leurs complications
US20080213765A1 (en) Human Autism Susceptibility Genes Encoding a Neurotransmitter Transporter and Uses Thereof
CA2281000A1 (fr) Diagnostic et traitement de glaucome
CA2635343C (fr) Methodes de detection des mutations associees a l'ataxie avec apraxie oculomotrice type 2 (aoa2)
US20090317823A1 (en) Mutations in capillary morphogenesis gene-2 (cmg-2) and use thereof
US20030232365A1 (en) BDNF polymorphisms and association with bipolar disorder
US6764824B2 (en) Primers for screening schizophrenia and a method thereof
WO2007046094A2 (fr) Genes et marqueurs associes a la schizophrenie
RU2338788C2 (ru) Новые праймеры для скринирования шизофрении и способ ее скринирования
US20030022165A1 (en) Mutations in a novel photoreceptor-pineal gene on 17P cause leber congenital amaurosis (LCA4)
JP4220906B2 (ja) 統合失調症をスクリーニングするためのプライマーおよびその方法
WO2003096971A2 (fr) Diagnostic du glaucome
WO2008061672A2 (fr) Facteur de risque génétique pour le cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06791939

Country of ref document: EP

Kind code of ref document: A1