WO2007020405A2 - Nouveaux peptides et utilisations associees - Google Patents

Nouveaux peptides et utilisations associees Download PDF

Info

Publication number
WO2007020405A2
WO2007020405A2 PCT/GB2006/003015 GB2006003015W WO2007020405A2 WO 2007020405 A2 WO2007020405 A2 WO 2007020405A2 GB 2006003015 W GB2006003015 W GB 2006003015W WO 2007020405 A2 WO2007020405 A2 WO 2007020405A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
integrin
polypeptide according
disease
seq
Prior art date
Application number
PCT/GB2006/003015
Other languages
English (en)
Other versions
WO2007020405A3 (fr
Inventor
Evy LUNDGREN-ÅKERLUND
Christian Kjellman
Original Assignee
Cartela R & D Ab
Smith, Stephen, Edward
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0516571A external-priority patent/GB2429012A/en
Application filed by Cartela R & D Ab, Smith, Stephen, Edward filed Critical Cartela R & D Ab
Priority to EP06765268A priority Critical patent/EP1924595A2/fr
Publication of WO2007020405A2 publication Critical patent/WO2007020405A2/fr
Publication of WO2007020405A3 publication Critical patent/WO2007020405A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0002—General or multifunctional contrast agents, e.g. chelated agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70546—Integrin superfamily
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70546—Integrin superfamily, e.g. VLAs, leuCAM, GPIIb/GPIIIa, LPAM

Definitions

  • the present invention relates to novel polypeptides capable of binding to an integrin I-domain, and to pharmaceutical compositions comprising the same.
  • the invention further provides uses of such polypeptides and pharmaceutical compositions in the treatment of diseases and conditions associated with abnormal function of cellular processes involving integrins and metzincins.
  • the present invention provides novel agents for the treatment of arthritic diseases (such as osteoarthritis and rheumatoid arthritis), inflammatory diseases and cancer.
  • Integrins are widely expressed receptors that function primarily as mediators of cell-extracellular matrix (ECM) interactions. Integrins consist of one ⁇ subunit and one ⁇ subunit, which together form a non-covalently bound heterodimer (Hynes 2002). To date, eight ⁇ subunits and 18 ⁇ subunits have been characterised in man, forming twenty-four different heterodimers. Four of the integrin heterodimers, namely ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ lO ⁇ l and ⁇ ll ⁇ l, are receptors for collagens, the most abundant of ECM proteins, and are known as the 'collagen- binding integrins'.
  • the collagen-binding integrin heterodimers are glycoproteins having masses ⁇ 220 kDa ( ⁇ -130, ⁇ ⁇ 90) for the polypeptides, plus additional glycosylation.
  • the ⁇ -subunit ectodomains consist of the N-terminal head region and the leg or stalk region.
  • the ⁇ -subunit head regions are formed from a seven-bladed ⁇ -propeller domain, with the ⁇ l-domain looping out from between blades 2 and 3.
  • the ⁇ -subunit head region includes the PSI, hybrid and I-like ( ⁇ l) domains, and interacts extensively with the ⁇ -propeller domain of the ⁇ -subunit.
  • the collagen-binding integrins contain an ⁇ l-domain (von Willebrand factor A- like domain) inserted into the ⁇ -subunit ⁇ -propeller domain between blades 2 and 3.
  • the ⁇ l-domain is the main collagen-binding site.
  • the ⁇ l-domains inserted into integrin ⁇ -subunit hybrid domains share homology with ⁇ l-domains.
  • the ⁇ l- domains and ⁇ l-domains have a central ⁇ -sheet surrounded with ⁇ -helices.
  • Metal binding sites are present in ⁇ l-domains and ⁇ l-domains, and divalent cations (specifically Mg 2+ , Ca 2+ or Mn 2+ ), are required for high affinity binding to collagens.
  • the ⁇ l-domains of the collagen-binding integrins exhibit structural differences giving rise to their different ligand preferences. Structural differences that enable discrimination between the ⁇ -s ⁇ bunits are also useful in design of ⁇ lO ⁇ l- and ⁇ l l ⁇ l-selective peptides capable of binding to the ⁇ l-domains.
  • Integrin ⁇ l ⁇ l is expressed in mesenchymal cell types including smooth muscle cells, endothelial cells, fibroblasts and chondrocytes (Voigt et al. 1995). It is also found on certain lymphocytes and monocytes. Integrin ⁇ 2 ⁇ l is expressed on epithelial cells, platelets, endothelial cells, fibroblasts, chondrocytes (Zutter and Santoro 1990), lymphocytes, mast cells, and neutrophilic granulocytes. In comparison, expression of the integrins ⁇ lO ⁇ l and ⁇ l l ⁇ l is more restricted.
  • the ⁇ lO ⁇ l integrin is mainly expressed by chondrocytes but has also been detected in the heart valves and in the fibrous lining of skeletal muscle, tendon and in periosteum and perichondrium.
  • the ⁇ ll ⁇ l integrin is expressed on specialised fibroblasts in tendon, periodontal ligaments, perichondrium, periosteum, and synovium. (Camper et al. 2001;Tiger et al. 2001).
  • the restricted distribution of the integrins ⁇ lO ⁇ l and ⁇ l l ⁇ l implicates a potential role for these integrins as therapeutic targets for diseases associated with such tissues, for example osteoarthritis and rheumatoid arthritis (Iannone and Lapadula 2003).
  • the ⁇ lO ⁇ l and ⁇ l l ⁇ l integrins are believed to play a role in other pathological conditions involving tissues in which the expression of these integrins is altered, such as atherosclerosis (WO 03/105886), carcinoma (Wang et al. 2002), tumour metastasis (Melendez et al.
  • Metzincins are a superfamily of proteases that includes the matrixin family of matrix metalloproteinases (MMPs), which are well known regulators of extracellular matrix (ECM) proteolysis in the microenvironment.
  • MMPs matrix metalloproteinases
  • Other members of the metzincin superfamily include the transmembrane proteases ADAMs (a disintegrin and metalloproteinases) and the secreted ADAMTSs (ADAM with thrombospondin domain).
  • ADAMs a disintegrin and metalloproteinases
  • ADAMTSs a secreted ADAMTSs
  • MMPs Matrix metalloproteinases
  • ECM extracellular matrix
  • the MMP family contains the only mammalian proteinases which can specifically degrade triple helical collagens, the ligands for the ⁇ lO ⁇ l and ⁇ l l ⁇ l integrins, at neutral pH. These so-called collagenases specifically cleave a single locus in all three collagen chains at a point three-quarters from the N-terminus of the molecule.
  • the 'classical' collagenases (MMP-I, -8 and -13) have differing substrate specificities for collagens I, II and III, with MMP- 13 showing a preference for type II collagen (Knauper et al. 1996).
  • MMP-2 gelatinase A
  • MMP- 14 MTl-MMP
  • the enzyme(s) responsible for cartilage collagen cleavage in the arthritides remains open to debate, but the dogma has been that MMP-I, produced in the synovium, is the primary collagenase in rheumatoid arthritis (RA), whilst MMP- 13, produced by the chondrocyte, is the foremost collagenase in OA.
  • RA rheumatoid arthritis
  • OA rheumatoid arthritis
  • MMPs Due to their destructive nature in pathological diseases such as OA and RA, the synthesis and activation of the MMPs are very tightly controlled in • normal tissues. Cells release most of the MMPs as pro-enzymes which are later activated in the extracellular matrix. Additionally, MMPs are often trapped in a deactivating complex with tissue inhibitors of metalloproteinases (TIMP).
  • TIMP tissue inhibitors of metalloproteinases
  • MMPs can bind to MMPs and that ligand binding to an integrin can also regulate MMP expression (Lee and Murphy 2004).
  • the induction of MMP expression upon collagen stimulation has been reported from several different cell lines, including keratinocj ⁇ es, smooth muscle and osteoprogenitor cells (Riikonen et al. 1995).
  • Major functions of the ⁇ 2 ⁇ l receptor include the induction of MMPl, MMP 13 and MTl-MMP 5 as well as activation of proMMP2 (Langholz et al. 1995;Heino 2000;Eckes et al. 2000;Zigrino et al. 2001).
  • Collagen-induced ligation of ⁇ 2 ⁇ l was also reported to up-regulate collagen levels, thereby antagonising ⁇ l ⁇ l function (Ivaska et al. 1999).
  • collagen-binding integrins are capable of regulating MMP activity via binding of both their natural ligand ⁇ e.g. collagen) and/or by binding the MMP at the cell surface for further processing and/or activation (Lee and Murphy 2004).
  • the ECM of cartilage is made up of two main macromolecules, type II collagen and aggrecan, the latter being a large aggregating proteoglycan (Hardingham and Fosang 1992;Prockop 1998).
  • type II collagen scaffold endows the cartilage with its tensile strength, whilst the aggrecan, by virtue of its high negative charge, swells against the collagen network as it draws water into the tissue, enabling it to resist compression.
  • Quantitatively less abundant components ⁇ e.g. type IX, XI and VI collagens, biglycan, decorin, COMP etc.
  • also have important roles in controlling matrix structure and organisation Heinegard et al. 2003).
  • chondrocytes chondrocytes
  • OA osteoarthritis
  • MMPs play significant roles in both developmental and repair processes, and it appears that aberrant regulation, which can occur at many levels, leads to their hyperactivity in diseases such as rheumatoid arthritis (RA) and osteoarthritis (OA).
  • RA rheumatoid arthritis
  • OA osteoarthritis
  • Cartilage degradation in OA and RA is primarily mediated by the chondrocytes, the synovial fibroblasts and on occasions by osteoclasts (Vincenti and Brinckerhoff 2002).
  • MMP 13 or MMP8 are responsible for the generation of the Glu975-Leu976 cleavage (Billinghurst et al. 2000).
  • MMP 13 is transcriptionally regulated in areas of degraded cartilage matrix in osteoarthritic tissue by cytokines such IL-I and TNF ⁇ (Iannone and Lapadula
  • MMP 13 is determined, in part, by the production and regulation of MTlMMP.
  • MMP 13 levels are also regulated by the abundance of TIMPs 1, 2 and 3 (tissue inhibitor of metalloproteinases), the protective effects of which are overwhelmed in osteoarthritic cartilage. Further support for the central role of MMP 13 has been obtained from a transgenic mouse over-expressing MMP 13 (Neuhold et al.
  • MMP 13 rnRNA and protein appear to be localised to areas of high collagenolytic activity.
  • hMMP13 is 5-10 times as active as hMMPl in its ability to digest collagen type II, suggesting that MMP 13 has a unique role in collagen Il-rich tissue such as articular cartilage (Knauper et al. 1996). This therefore makes MMP13 production and regulation a suitable target for therapeutic control in diseases such as, but not limited to, the arthritides.
  • RA 5 a disease that affects multiple synovial joints and involves inflammation of the synovial membrane
  • the synovium proliferates to form an invasive pannus and the cartilage pannus junction is a site of enhanced cartilage degradation.
  • Inflammation is accompanied by an influx of immune-competent cells, which constitute not only the resident fibroblast-like synoviocytes, but also macrophages, T-lymphocytes and mast cells (Kobayashi and Okunishi 2002).
  • Fibroblasts contribute to joint destruction both directly, through enhanced production of MMPs, and indirectly, through excessive release of cytokines that boost the immune system and in turn stimulate the MMP production. Targeting the proliferative fibroblast and its MMP production could facilitate regeneration of synovial joints.
  • MMPl and MMP3 are the most important MMPs for joint destruction in RA (Poole 2001), although almost all the MMPs have been detected in RA synovium (Pap et al. 2000). MMP3's role appears to be restricted to invasiveness, probably permitting transmigration of inflammatory cells from the blood vessels into the synovium, leaving MMPl as the main MMP responsible for cartilage collagen degradation. Cytokines such as IL-I and TNF ⁇ produced by the invading inflammatory cells (Arend 2001;Goldring 2003) stimulate the resident synovial fibroblasts to produce MMPl (and MMP3). Furthermore, botfi MMPl and MMP3 are also induced by the recently discovered extracellular matrix metalloproteinase inducer (EMMPRIN) (Tomita et al. 2002).
  • EMMPRIN extracellular matrix metalloproteinase inducer
  • MMPl 5 MMP8 and MMP 13 are secreted collagenases
  • the affected tissue is remodelled in a manner that is detrimental to the patient.
  • the contribution of MMPs to the pathology and resulting debility is exemplified by the role of these enzymes in diseases such as arthritis, COPD, atherosclerosis and inflammatory bowel disease (IBD) (Whelan 2004).
  • MMPs can function independently of their ECM degrading activity. Recent reports suggest that specific MMPs may serve as proinflammatory mediators whereas others serve to dampen inflammation through the control of chemoldne regulation (Mohammed et al. 2003).
  • the present inventors focused upon regulating the binding of the MMP to the collagen-binding integrins. This approach can circumvent the problems with toxic side effects of direct MMP binders and allow a more tissue (site) specific regulation of the MMPs.
  • MMPs are believed to contribute to the tissue destruction damage associated with these diseases (Mohammed et at 2003).
  • peptide libraries displayed on the surface of bacteriophage have often yielded valuable binding peptides to target proteins, including integrins.
  • the identified peptides can either be developed as drugs themselves or be used in screening of chemical substances that bind to the same site or be used in co-crystallisation together with the target for subsequent drug design.
  • the present invention seeks to provide novel treatment for diseases and conditions involving abnormal function of integrins and/or metzincins.
  • a first aspect of the invention provides an isolated polypeptide capable of binding to an integrin I-domain wherein the polypeptide comprises an amino acid sequence selected from the following group:
  • WIWPDSGW [SEQ ID NO:2]
  • WENWDGWG [SEQ ID NO:3]; WEDGWLHA [SEQ ID NO :4] ; and/or
  • 'I-domain' we mean an inserted (I-) domain of an integrin ⁇ -subunit and/or an integrin ⁇ -subunit, located in the N-terminus of the subunit and typically comprising approximately 200 amino acids in length.
  • the ⁇ l-domain (von Willebrand factor A-like domain) is an independent, autonomously folding domain inserted into the ⁇ -subunit ⁇ -propeller domain between blades 2 and 3.
  • ⁇ l-domains share homology with ⁇ l-domains. Both the ⁇ l-domains and ⁇ l- domains have a central ⁇ -sheet surrounded with ⁇ -helices.
  • 'I-domain' we include related A-domains, for example the A-domain of von Willebrand factor.
  • binding of the said polypeptide to the said I-domain can be detected using techniques known in the art, for example as described in Examples below. Convenient methods include phage display, affinity chromatography, surface plasmon resonance, yeast two-hybrid interactions, co-purification, ELISA, co-immunoprecipitation methods and cellular response assays.
  • the polypeptide is capable of inhibiting (at least in part) the degradation of collagen in cartilage tissue.
  • inhibitors we include a reduction of collagen degradation by at least 10% compared to collagen degradation in cartilage in the absence of the polypeptide of the invention, for example a reduction of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. Most preferably, the polypeptide of the invention inhibits the degradation of collagen in cartilage completely.
  • the degradation of collagen in cartilage may be measured using methods well known in the art, for example by measuring glycosaminoglycan (GAG) release in human cartilage explants (see Examples).
  • GAG glycosaminoglycan
  • polypeptide' as used herein means a plurality of amino acids that are linked together via a peptide bond.
  • the amino- and carboxy-terminal groups although often not specifically shown, will be understood to be in the form they would assume at physiological pH values, unless otherwise specified.
  • the N-terminal H and C-terminal O " at physiological pH are understood to be present though not necessarily specified and shown, either in specific examples or in generic formulas.
  • the left-hand end of the molecule is the amino terminal end and the right-hand end is the carboxy-terminal end, in accordance with standard usage and convention.
  • the basic and acid addition salts including those which are formed at non-physiological pH values are also included in the polypeptides of the invention.
  • 'amino acid' as used herein includes the standard twenty genetically- encoded amino acids and their corresponding stereoisomers in the 'D' form (as compared to the natural 'L' form), omega-amino acids other naturally-occurring amino acids, unconventional amino acids (e.g. ⁇ , ⁇ -disubstituted amino acids, N- alkyl amino acids, etc.) and chemically derivatised amino acids (see below).
  • omega-amino acids other naturally-occurring amino acids
  • unconventional amino acids e.g. ⁇ , ⁇ -disubstituted amino acids, N- alkyl amino acids, etc.
  • chemically derivatised amino acids see below.
  • polypeptides of the present invention may also be suitable components for polypeptides of the present invention, as long as the desired functional property is retained by the polypeptide.
  • each encoded amino acid residue where appropriate, is represented by a single letter designation, corresponding to the trivial name of the conventional amino acid.
  • polypeptides of the invention comprise or consist of L-amino acids
  • the polypeptide is less than 50 amino acids in length.
  • the polypeptide is less than 40 amino acids in length, for example less than 30, less than 20, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, or less than 7 amino acids in length. More preferably, the polypeptide is between 8 and 10 amino acids in length. Most preferably, the polypeptide of the invention is 10 amino acids in length.
  • the first aspect of the invention encompasses variants, fusions and derivatives of the defined polypeptides, as well as fusions of a said variants or derivatives, provided such variants, fusions and derivatives retain the capability of binding to an integrin I- domain.
  • Variants may be made using the methods of protein engineering and site-directed mutagenesis well known in the art using the recombinant polynucleotides (see example, see Molecular Cloning: a Laboratory Manual, 3rd edition, Sambrook & Russell, 2001, Cold Spring Harbor Laboratory Press).
  • polypeptide fused to any other polypeptide we include a polypeptide fused to any other polypeptide.
  • the said polypeptide may be fused to a polypeptide such as glutathione-S-transferase (GST) or protein A in order to facilitate purification of said polypeptide. Examples of such fusions are well known to those skilled in the art.
  • the said polypeptide may be fused to an oligo- histidine tag such as His6 or to an epitope recognised by an antibody such as the well-known Myc tag epitope. Fusions to any variant or derivative of said polypeptide are also included in the scope of the invention.
  • fusions or variants, derivatives or fusions thereof which retain desirable properties, such as I-domain binding properties are preferred. It is also particularly preferred if the fusions are ones which are suitable for use in the methods and screening assays described herein.
  • the fusion may comprise a further portion which confers a desirable feature on the said polypeptide of the invention; for example, the portion may useful in detecting or isolating the polypeptide, or promoting cellular uptake of the polypeptide.
  • the portion may be, for example, a biotin moiety, a radioactive moiety, a fluorescent moiety, for example a small fiuorophore or a green fluorescent protein (GFP) fiuorophore, as well known to those skilled in the art.
  • GFP green fluorescent protein
  • the moiety may be an immunogenic tag, for example a Myc tag, as known to those skilled in the art or may be a lipophilic molecule or polypeptide domain that is capable of promoting cellular uptake of the polypeptide, as known to those skilled in the art.
  • variants of the polypeptide we include insertions, deletions and substitutions, either conservative or non-conservative. In particular we include variants of the polypeptide where such changes do not substantially alter the activity of the said polypeptide. In particular, we include variants of the polypeptide where such changes do not substantially alter the I-domain binding activity of the said polypeptide.
  • a variant that comprises substantially all of the sequences shown above may be particularly useful.
  • substantially all' is meant at least six amino acids of the defined sequence, for example at least six consecutive amino acids. More preferably, the variant may comprise at least seven amino acids or, most preferably, all eight of the amino acids of the defined sequence.
  • conservative substitutions' is intended combinations such as GIy 5 Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • polypeptide variant has an amino acid sequence which has at least 75% identity with the amino acid sequence given above, more preferably at least 87.5%, and most preferably 100% identity with the amino acid sequence given above.
  • the percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequences have been aligned optimally.
  • the alignment may alternatively be carried out using the Clustal W program (as described in Thompson et al, 1994, Nuc. Acid Res. 22:4673-4680).
  • the parameters used may be as follows:
  • the BESTFIT program may be used to determine local sequence alignments.
  • the variant polypeptides do not comprise the tetrapeptide motif D/E- D/E-G/K-W.
  • the polypeptides of the first aspect of the invention may comprise one or more amino acids which have been modified or derivatised.
  • Chemical derivatives of one or more amino acids may be achieved by reaction with a functional side group.
  • derivatised molecules include, for example, those molecules in which free amino groups have been derivatised to form amine hydrochlorides, p-toluene sulphonyl groups, carboxybenzoxy groups, t- butyloxycarbonyl groups, chloroacetyl groups or formyl groups.
  • Free carboxyl groups may be derivatised to form salts, methyl and ethyl esters or other types of esters and hydrazides.
  • Free hydroxyl groups may be derivatised to form O-acyl or O-alkyl derivatives.
  • Also included as chemical derivatives are those peptides which contain naturally occurring amino acid derivatives of the twenty standard amino acids.
  • 4-hydroxyproline may be substituted for proline
  • 5- hydroxylysine may be substituted for lysine
  • 3-methylhistidine may be substituted for histidine
  • homoserine may be substituted for serine and ornithine for lysine.
  • Derivatives also include peptides containing one or more additions or deletions as long as the requisite activity is maintained.
  • Other included modifications are amidation, amino terminal acylation ⁇ e.g. acetylation or thioglycolic acid amidation), terminal carboxylamidation ⁇ e.g. with ammonia or methylamine), and the like terminal modifications.
  • peptidomimetic compounds may also be useful.
  • 'polypeptide' or 'peptide' we include peptidomimetic compounds which are capable of binding to an integrin I-domain.
  • 'peptidomimetic' refers to a compound that mimics the conformation and desirable features of a particular peptide as a therapeutic agent.
  • polypeptides of the invention include not only molecules in which amino acid residues are joined by peptide (-CO-NH-) linkages but also molecules in which the peptide bond is reversed.
  • retro-inverso peptidomimetics may be made using methods known in the art, for example such as those described in Meziere et al. (1997) J. Immunol. 159, 3230-3237. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains.
  • Retro-inverse peptides which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.
  • the polypeptide of the invention is a peptidomimetic compound wherein one or more of the amino acid residues are linked by a -y(CH 2 NH)- bond in place of the conventional amide linkage.
  • the peptide bond may be dispensed with altogether provided that an appropriate linker moiety which retains the spacing between the carbon atoms of the amino acid residues is used; it is particularly preferred if the linker moiety has substantially the same charge distribution and substantially the same planarity as a peptide bond.
  • the peptide may conveniently be blocked at its N- or C- terminus so as to help reduce susceptibility to exoproteolytic digestion.
  • a presumed bioactive conformation may be stabilised by a covalent modification, such as cyclisation or by incorporation of lactam or other types of bridges, for example see Veber et ah, 1978, Proc. Natl. Acad. Sd. USA 75:2636 and Thursell et al, l9S3, Biochem. Biophys. Res. Comm. 111:166.
  • a common theme among many of the synthetic strategies has been the introduction of some cyclic moiety into a peptide-based framework.
  • the cyclic moiety restricts the conformational space of the peptide structure and this frequently results in an increased affinity of the peptide for a particular biological receptor.
  • An added advantage of this strategy is that the introduction of a cyclic moiety into a peptide may also result in the peptide having a diminished sensitivity to cellular peptidases.
  • preferred polypeptides of the invention comprise terminal cysteine amino acids.
  • Such a polypeptide may exist in a heterodetic cyclic form by disulphide bond formation of the mercaptide groups in the terminal cysteine amino acids or in a homodetic form by amide peptide bond formation between the terminal amino acids.
  • cyclising small peptides through disulphide or amide bonds between the N- and C-terminus cysteines may circumvent problems of affinity and half-life sometime observed with linear peptides, by decreasing proteolysis and also increasing the rigidity of the structure, which may yield higher affinity compounds.
  • Polypeptides cyclised by disulphide bonds have free amino and carboxy-termini which still may be susceptible to proteolytic degradation, while peptides cyclised by formation of an amide bond between the N-terminal amine and C-terminal carboxyl and hence no longer contain free amino or carboxy termini.
  • the peptides of the present invention can be linked either by a C-N linkage or a disulphide linkage.
  • Cyclic peptides may have longer half-lives in serum (see, for example, (Picker and Butcher 1992;Huang et al. 1997). Moreover, the side-effects from cyclic peptide therapy are minimal, since anaphylaxis and immune responses against the small peptide occur only rarely (Ohman et al. 1995;Adgey 1998). In addition, cyclic peptides have been shown to be effective inhibitors in vivo of integrins involved in human and animal disease (Jackson et al. 1997;Cuthbertson et al. 1997;Lefkovits and Topol 1995;Lefkovits and Topol 1995;Lefkovits and Topol 1995;Goligorsky et al.
  • heterodetic linkages may include, but are not limited to formation via disulphide, alkylene or sulphide bridges.
  • Methods of synthesis of cyclic homodetic peptides and cyclic heterodetic peptides, including disulphide, sulphide and alkylene bridges, are disclosed in US 5,643,872. Other examples of cyclisation methods are discussed and disclosed in US 6,008,058. Cyclic peptides can also be prepared by incorporation of a type H 1 ⁇ -turn dipeptide (Doyle et al. 1996).
  • RCM ring-closing metathesis
  • terminal modifications are useful, as is well known, to reduce susceptibility by proteinase digestion and therefore to prolong the half-life of the peptides in solutions, particularly in biological fluids where proteases may be present.
  • Polypeptide cyclisation is also a useful modification and is preferred because of the stable structures formed by cyclisation and in view of the biological activities observed for cyclic peptides.
  • polypeptide of the first aspect of the invention is linear.
  • polypeptide is cyclic.
  • the present invention also includes compositions comprising pharmaceutically acceptable acid or base addition salts of the polypeptides of the present invention.
  • the acids which are used to prepare the pharmaceutically acceptable acid addition salts of the aforementioned base compounds useful in this invention are those which form non-toxic acid addition salts, i.e.
  • salts containing pharmacologically acceptable anions such as the hydrochloride, hydrobromide, hydroiodide, nitrate, sulphate, bisulphate, phosphate, acid phosphate, acetate, lactate, citrate, acid citrate, tartrate, bitartrate, succinate, maleate, fumarate, gluconate, saccharate, benzoate, methanesurphonate, ethanesulphonate, benzenesulphonate, p-toluenesulphonate and pamoate [i.e. l,l'-methylene-bis-(2- hydroxy-3 naphthoate)] salts, among others.
  • Pharmaceutically acceptable base addition salts may also be used to produce pharmaceutically acceptable salt forms of the compounds according to the present invention.
  • the chemical bases that may be used as reagents to prepare pharmaceutically acceptable base salts of the present compounds that are acidic in nature are those that form non-toxic base salts with such compounds.
  • Such non-toxic base salts include, but are not limited to those derived from such pharmacologically acceptable cations such as alkali metal cations (e.g. potassium and sodium) and alkaline earth metal cations (e.g. calcium and magnesium), ammonium or water- soluble amine addition salts such as N-methylglucamine-(meglumine), and the lower alkanolammonium and other base salts of pharmaceutically acceptable organic amines, among others.
  • polypeptides of the invention may exist in monomeric form or in the form of a multimer thereof (e.g. dimer, trimer, tetramer, pentamer, etc.).
  • polypeptide comprising the amino acid sequence of SEQ ID NO:1.
  • polypeptide comprising or consisting of the amino acid sequence CGIWFENEWC [SEQ ID NO:6].
  • polypeptide comprising the amino acid sequence of SEQ ID NO:2.
  • polypeptide comprising or consisting of the amino acid sequence CWTWPDSGWC [SEQ ID NO:7].
  • polypeptide comprising the amino acid sequence of SEQ ID NO:3.
  • polypeptide comprising or consisting of the amino acid sequence CWENWDGWGC [SEQ ID NO:8].
  • polypeptide comprising the amino acid sequence of SEQ ID NO:4.
  • polypeptide comprising or consisting of the amino acid sequence CWEDGWLHAC [SEQ ID NO:9].
  • polypeptide comprising the amino acid sequence of SEQ ID NO:5.
  • polypeptide comprising or consisting of the amino acid sequence CWCWPDSCWC [SEQ ID NOlO].
  • polypeptide comprising or consisting of the amino acid sequence of SEQ ID NOS: 5, 6, 7, or 8 contains a disulphide bond between the two cysteine amino acids.
  • a characterising feature of the polypeptides of the present invention is their ability to bind to an I-domain of an integrin subunit.
  • the I-domain is from an integrin which is expressed on chondrocytes, fibroblasts and/or cancer cells.
  • the integrin is a collagen-binding integrin. More preferably, the I- domain is from an integrin selected from the group consisting of ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ lO ⁇ l and ⁇ ll ⁇ l. Most preferably, the integrin is ⁇ lO ⁇ l or ⁇ ll ⁇ l integrin.
  • the integrin may be selected from the group consisting of ⁇ D ⁇ 2, ⁇ M ⁇ 2, ⁇ L ⁇ 2, ⁇ X ⁇ 2 and ⁇ E ⁇ 7.
  • polypeptides of the invention may be capable of binding specifically to the I- domain of a single integrin species or may be capable of binding to the I-domain of a number of different integrin species.
  • the polypeptides of the invention are capable of inhibiting a function or property of an integrin.
  • the polypeptide may be capable of inhibiting the binding of collagen to an integrin.
  • the polypeptide is capable of inhibiting the binding of a metzincin to an integrin.
  • MMPs matrix metalloproteinases
  • ADAMs disintegrin and metalloproteases
  • ADAMTSs disintegrin and metalloproteases with thrombospondin motifs
  • the metzincin is a disintegrin and metalloprotease (ADAM) (Clark and Parker 2003).
  • ADAM disintegrin and metalloprotease
  • the metzincin is a disintegrin and metalloprotease with thrombospondin motifs (ADAMTS).
  • ADAMTS thrombospondin motifs
  • the metzincin is a matrix metalloproteinase (MMP) or a pro-form thereof. More preferably, the metalloproteinase is selected from the group consisting of the collagenases MMP 1 , MMP 8 and MMP 13 , and pro-MMPs thereof.
  • MMP matrix metalloproteinase
  • the metalloproteinase is MMP 13 or pro-MMP13.
  • novel polypeptides provided by the present invention may inhibit one or more of the following:
  • polypeptides of the invention have efficacy in the prophylactic and therapeutic treatment of diseases and conditions associated with abnormal function of integrins and/or MMPs. As discussed in detail below, the polypeptides of the invention are particularly suited for the treatment of arthritic diseases, inflammatory diseases and cancer.
  • any of a number of assays are available to the persons skilled in the art.
  • Suitable in vivo methods for identifying and evaluating polypeptides of the invention include several well known animal models in mice, rats, rabbits, guinea pigs and dogs.
  • suitable in vivo models for arthritic diseases include:
  • partial medial meniscectomy is performed under anaesthetic on the knee of a group of guinea pigs.
  • a group of animals undergo sham surgery, in which the joint capsule is opened by transection of the medial collateral ligament and the meniscus is left intact. After the operation, the collateral ligament is sutured and the skin incision closed and disinfected.
  • AU animals are randomly allocated into different groups: 1) sham operated animals; 2) control meniscectomized animals receiving a vehicle made of a suspension e.g. 0.2% hydroxypropyl cellulose; 3) meniscectomized animals treated with polypeptides at, for example, 10 mg/kg (bid) twice per day; and 4) meniscectomized animals treated with polypeptides at a range of concentrations from lmg/kg - lOOOmg/kg bid.
  • Oral bid treatment administered by gavage is started 1 day after surgery and continued for 12 weeks, at which time the animals were killed.
  • the weight and the food consumption of the guinea pigs is recorded weekly. Animals are killed by exsanguinations under anaesthesia, and the proximal part of the tibias (from the operated knees) are removed and stripped of tendon and musculature. Immediately after dissection, the joints are placed in 10% formalin for further analyses.
  • rabbits of age 7-8 months old are operated on for unilateral anterior cruciate ligament transection (ACLT) to create degenerative changes in the articular cartilage.
  • ACLT anterior cruciate ligament transection
  • These rabbits are skeletally mature, with closed epiphyses as seen by roentgenogram.
  • Each animal is anaesthetised and a hind limb is shaved and disinfected.
  • Medial parapatellar incision and arthrotomy are performed.
  • the patella is dislocated laterally and the knee placed in full flexion.
  • the ACL is visualised and transected with a surgical blade.
  • the contralateral non-operated knee serves as control (sham).
  • the joint is washed and the capsule and then skin is closed with sutures. After surgery, the rabbits are returned to cage activity and the limbs are not immobilised.
  • the rabbits are divided into two groups.
  • the knees of the test group are injected intra-articularly with peptides in the range 0.1-lOOOmg/kg in a suitable suspension once daily for 2 weeks, and the knees of the control group (nonoperated) are injected with the same amount of suspension without peptide.
  • the animals were anaesthetised.
  • AU rabbits are killed 2 weeks after the last injection and histological examination of the cartilage tissue is performed.
  • mice are injected intra-articularly in the right knee with highly purified bacterial collagenase followed by a second injection three days later.
  • the first ligament damage and synovial inflammation occurs one day after the first injection.
  • Mice are then sacrificed after six weeks.
  • Both right and left knee are fixed in formalin for 3 days, followed by decalcification and embedding in paraffin.
  • Both joints are then sectioned for histology staining.
  • the development of osteoarthritis in the joints is visually scored by light microscopy for cartilage lesions in four locations in the joint as well as for the size of osteophyte formation. Digital image analysis of the histological sections is also performed.
  • Polypeptides to be tested are administrated during the experiments for a four- week period starting approximately at day 8.
  • Peptides will be injected intra- peritoneally (i.p.) in a volume of 0.2 ml at a range of concentration 0.01 mg to 1O g or more per day, preferably about 0.1 mg to about I g per day. Administration may be from one to four times per day.
  • Collagen type II (100 microgram) emulsified in adjuvant is injected sub- cutaneously (s.c.) in a volume of 0.1 ml. Thirty-five days after the first injection the mice are boosted with an additional injection of half the amount of collagen. The clinical signs of arthritis are scored using a scoring system where every affected finger or knuckles gets 1 point and ankle 5 points (maximum of 60 points).
  • Mice are treated i.p. with test polypeptides at four occasions; 1, 5, 9 and 13 days after antigen-injection.
  • Polypeptides are injected in a volume of 0.2 ml at a range of concentration 0.01 mg to 10 g or more per day, preferably about 0.1 mg to about 1 g per day. Administration may be from one to four times per day.
  • AIA Antigen-induced arthritis
  • mice are sensitised by injections of methylated bovine serum albumin (mBSA).
  • mBSA methylated bovine serum albumin
  • An acute arthritis reaction is induced by intra-articular (i.a.) injection of 60 ⁇ g mBSA.
  • the mice were then followed for 15 days.
  • the swelling of the knee is measured at day 3 after i.a. injection, in the very acute phase, and at 10 days using.
  • Mice were sacrificed at day 15 and inflammation, cartilage pathology and osteophyte formation was scored in histology sections of the knees as above.
  • Mice are treated i.p. with test polypeptides at four occasions; 1, 5, 9 and 13 days after antigen-injection.
  • Polypeptides are injected in a volume of 0.2 ml at a range of concentration 0.01 mg to 10 g or more per day, preferably about 0.1 mg to about 1 g per day. Administration may be from one to four times per day.
  • Suitable in vivo methods for evaluating the polypeptides of the invention include several well known models (Hirst and Balmain 2004;Khanna and Hunter 2005) and the means for testing peptide agents for anti-cancer activity in such models are well known in the art (Koivunen et al. 1999a;Medina et al. 2001;Bjorklund et al. 2004;Stefanidakis and Koivunen 2004).
  • a second aspect of the invention provides an isolated nucleic acid molecule encoding a polypeptide according to the first aspect of the invention.
  • the isolated nucleic acid molecule is suitable for expressing a polypeptide of the invention.
  • the nucleic acid molecule is a polynucleotide that may be translated to form the polypeptide, for example RNA, or that the polynucleotide (which is preferably DNA) encoding the polypeptide of the invention is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression.
  • the polynucleotide may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognised by any desired host; such controls may be incorporated in the expression vector.
  • the nucleic acid molecule of the invention may be DNA or RNA, preferably DNA.
  • the nucleic acid molecule may or may not contain introns in the coding sequence; preferably the nucleic acid molecule is a cDNA.
  • the nucleic acid molecule (or polynucleotide) may be expressed in a suitable host to produce a polypeptide of the invention.
  • the polynucleotide encoding the polypeptide of the invention may be used in accordance with known techniques, appropriately modified in view of the teachings contained herein, to construct an expression vector, which is then used to transform an appropriate host cell for the expression and production of the polypeptide of the invention (for example as described in Sambrook & Russell, supra.)
  • nucleic acid molecule encoding the polypeptide of the invention may be joined to a wide variety of other polynucleotide sequences for introduction into an appropriate host.
  • the companion polynucleotide will depend upon the nature of the host, the manner of the introduction of the polynucleotide into the host, and whether episomal maintenance or integration is desired.
  • the nucleic acid molecule is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression. If necessary, the nucleic acid molecule may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognised by the desired host, although such controls are generally available in the expression vector.
  • the vector is then introduced into the host through standard techniques. Generally, not all of the hosts will be transformed by the vector. Therefore, it will be necessary to select for transformed host cells.
  • One selection technique involves incorporating into the expression vector a polynucleotide sequence, with any necessary control elements, that codes for a selectable trait in the transformed cell, such as antibiotic resistance. Alternatively, the gene for such selectable trait can be on another vector, which is used to co-transform the desired host cell.
  • Host cells that have been transformed by the recombinant nucleic acid molecule of the invention are then cultured for a sufficient time and under appropriate conditions known to those skilled in the art in view of the teachings disclosed herein to permit the expression of the polypeptide, which can then be recovered.
  • bacteria for example E. coli and Bacillus subtilis
  • yeasts for example Saccharomyces cerevisiae
  • filamentous fungi for example Aspergillus
  • plant cells animal cells and insect cells.
  • the vectors typically include a prokaryotic replicon, such as the CoIEl on, for propagation in a prokaryote, even if the vector is to be used for expression in other, non-prokaryotic, cell types.
  • the vectors can also include an appropriate promoter such as a prokaryotic promoter capable of directing the expression (transcription and translation) of the genes in a bacterial host cell, such as E. coli, transformed therewith.
  • Promoter sequences compatible with exemplary bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a polynucleotide of the present invention.
  • Typical prokaryotic vector plasmids are pUC18, pUC19, pBR322 and pBR329 available from Biorad Laboratories, (Richmond, CA, USA) and pTrc99A and pKK223-3 available from Pharmacia, Piscataway, NJ, USA.
  • a typical mammalian cell vector plasmid is pSVL available from Pharmacia, Piscataway, NJ, USA. This vector uses the SV40 late promoter to drive expression of cloned genes, the highest level of expression being found in T antigen-producing cells, such as COS-I cells.
  • an inducible mammalian expression vector is pMSG, also available from Pharmacia. This vector uses the glucocorticoid-inducible promoter of the mouse mammary tumour virus long terminal repeat to drive expression of the cloned gene.
  • Useful yeast plasmid vectors are pRS403-406 and pRS413-416 and are generally available from Stratagene Cloning Systems, La Jolla, CA 92037, USA.
  • Plasmids pRS403, pRS404, pRS405 and pRS406 are Yeast Integrating plasmids (Yips) and incorporate the yeast selectable markers HIS3, TRPl, LEU2 and URA3.
  • Plasmids pRS413-416 are Yeast Centromere plasmids (YCps).
  • the present invention also relates to a host cell transformed with a polynucleotide vector construct of the present invention.
  • the host cell can be either prokaryotic or eukaryotic.
  • Bacterial cells are preferred prokaryotic host cells and typically are a strain of E. coli such as, for example, the E. coli strains DH5 available from Bethesda Research Laboratories Inc., Bethesda, MD, USA, and RRl available from the American Type Culture Collection (ATCC) of Rockville, MD, USA (No ATCC 31343).
  • Preferred eukaryotic host cells include yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human fibroblastic and kidney cell lines.
  • Yeast host cells include YPH499, YPH500 and YPH501 which are generally available from Stratagene Cloning Systems, La Jolla, CA 92037, USA.
  • Preferred mammalian host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NTH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658, monkey kidney-derived COS-I cells available from the ATCC as CRL 1650 and 293 cells which are human embryonic kidney cells.
  • Preferred insect cells are Sf9 cells which can be transfected with baculovirus expression vectors. Transformation of appropriate cell hosts with a nucleic acid molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used.
  • Transformation of prokaryotic host cells see for example Sambrook & Russell ⁇ supra). Transformation of yeast cells is described in numerous reviews, for example see Gietz & Woods (2001) Biotechniques 30:816-228. With regard to vertebrate cells, reagents useful in transfecting such cells, for example calcium phosphate and DEAE-dextran or liposome formulations, are available from Stratagene Cloning Systems, or Life Technologies Inc., Gaithersburg, MD 20877, USA.
  • Electroporation is also useful for transforming and/or transfecting cells and is well known in the art for transforming yeast cell, bacterial cells, insect cells and vertebrate cells.
  • many bacterial species may be transformed by the methods described in Luchansky et al. (1988) MoI. Microbiol. 2:637-646. Methods for transformation of yeast by electroporation are disclosed in Becker & Guarente (1990) Methods Enzymol. 194: 182.
  • Successfully transformed cells i.e. cells that contain a nucleic acid molecule of the present invention
  • cells resulting from the introduction of an expression construct of the present invention can be grown to produce the polypeptide of the invention.
  • Cells can be harvested and lysed and their DNA content examined for the presence of the DNA using a method such as that described by Sambrook & Russell ⁇ supra.).
  • the presence of the protein in the supernatant can be detected using antibodies.
  • a third aspect of the invention provides a vector comprising a nucleic acid molecule according to the second aspect of the invention.
  • the vector is an expression vector.
  • the vector is suitable for replication in a eulcaryotic cell, such as a mammalian cell.
  • Preferred vectors may be selected from the group consisting of pTWIN, pShuttle, pUC18, pUC19, pBacPAK, pBR322, pBR329, pTrc99A, pKK223-3, pSVL, pMSG, pRS403 to 406 and ⁇ RS413 to 416.
  • a fourth aspect of invention provides a host cell comprising a nucleic acid molecule according to the second aspect of the invention or a vector according to the third aspect of the invention.
  • the cell is a eulcaryotic cell, for example a mammalian cell.
  • the host cell is selected from the group consisting of E. coli strain DH5, RRl, ER2566, CHO cells ⁇ e.g. CCL61), NIH Swiss mouse embryo cells (NIH/3T3), COS-I cells ⁇ e.g. CRL 1650 and 293), Sf9 cells and yeast cell lines YPH499 to 501.
  • the present invention also contemplates a culture of those cells, preferably a monoclonal (clonally homogeneous) culture, or a culture derived from a monoclonal culture, in a nutrient medium.
  • a fifth aspect of the invention provides a method for making a polypeptide according to the first aspect of the invention, the method comprising culturing a host cell according to the fourth aspect of the invention which expresses the polypeptide, and isolating the polypeptide therefrom.
  • Methods of cultivating host cells and isolating recombinant proteins are well known in the art.
  • a sixth aspect of the invention provides a method for making a polypeptide according to the first aspect of the invention comprising solid phase synthesis of the polypeptide.
  • the polypeptides may be synthesized as described in Solid-Phase Peptide Synthesis (1997) Fields, Abelson & Simon (Eds), Academic Press (ISBN: 0-12-182190-0).
  • a seventh aspect of the invention provides a pharmaceutical formulation comprising a polypeptide according to the first aspect of the invention in admixture with a pharmaceutically or veterinarily acceptable adjuvant, diluent or carrier.
  • 'pharmaceutical formulation means a therapeutically effective formulation according to the invention.
  • a 'therapeutically effective amount', or 'effective amount', or 'therapeutically effective', as used herein, refers to that amount which provides a therapeutic effect for a given condition and administration regimen. This is a predetermined quantity of active material calculated to produce a desired therapeutic effect in association with the required additive and diluent, i.e. a carrier or administration vehicle. Further, it is intended to mean an amount sufficient to reduce and most preferably prevent, a clinically significant deficit in the activity, function and response of the host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in a host. As is appreciated by those skilled in the art, the amount of a compound may vary depending on its specific activity.
  • Suitable dosage amounts may contain a predetermined quantity of active composition calculated to produce the desired therapeutic effect in association with the required diluent.
  • a therapeutically effective amount of the active component is provided.
  • a therapeutically effective amount can be determined by the ordinary skilled medical or veterinary worker based on patient characteristics, such as age, weight, sex, condition, complications, other diseases, etc., as is well known in the art.
  • the present invention provides a pharmaceutical formulation comprising an amount of a polypeptide of the invention effective to reduce the activity, function and/or expression of one or more MMPs, especially ⁇ of MMP- 13 and/or INIMP-I, and a pharmaceutically and biochemically acceptable carrier.
  • polypeptides of the invention will generally be administered in admixture with a suitable pharmaceutical excipient diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice (for example, see
  • Suitable routes of administration include topical, intravenous, oral, pulmonary, nasal, aural, ocular, bladder and CNS delivery.
  • polypeptides, molecules and pharmaceutical formulations of the present invention may be delivered using an injectable sustained-release drug delivery system, such as a microsphere. These are designed specifically to reduce the frequency of injections.
  • an injectable sustained-release drug delivery system such as a microsphere.
  • Nutropin Depot which encapsulates recombinant human growth hormone (rhGH) in biodegradable microspheres that, once injected, release rhGH slowly over a sustained period.
  • polypeptides, molecules and pharmaceutical formulations of the present invention can be administered by a surgically implanted device that releases the drug directly to the required site.
  • Electroporation therapy (EPT) systems can also be employed for the administration of proteins and polypeptides.
  • EPT Electroporation therapy
  • a device which delivers a pulsed electric field to cells increases the permeability of the cell membranes to the drug, resulting in a significant enhancement of intracellular drug delivery.
  • Proteins and polypeptides can also be delivered by electroincorporation (EI).
  • EI occurs when small particles of up to 30 microns in diameter on the surface of the skin experience electrical pulses identical or similar to those used in electroporation. In EI 3 these particles are driven through the stratum corneum and into deeper layers of the skin.
  • the particles can be loaded or coated with drugs or genes or can simply act as "bullets" that generate pores in the skin through which the drugs can enter.
  • ReGeI thermo-sensitive ReGeI injectable. Below body temperature, ReGeI is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve.
  • Protein and polypeptide pharmaceuticals can also be delivered orally.
  • One such system employs a natural process for oral uptake of vitamin B 12 in the body to co-deliver proteins and polypeptides. By riding the vitamin B 12 uptake system, the protein or polypeptide can move through the intestinal wall.
  • Complexes are produced between vitamin B 12 analogues and the drug that retain both significant affinity for intrinsic factor (IF) in the vitamin B 12 portion of the complex and significant bioactivity of the drug portion of the complex.
  • IF intrinsic factor
  • the pharmaceutical formulation of the present invention is a unit dosage containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the active ingredient.
  • polypeptides and pharmaceutical formulations of the present invention will normally be administered orally or by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
  • a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
  • the compositions may be administered at varying doses.
  • the polypeptides of the invention can be administered alone but will generally be administered in admixture with a suitable pharmaceutical excipient diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
  • a suitable pharmaceutical excipient diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the compounds, i.e. polypeptides, of the invention can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications.
  • the compounds of invention may also be administered via intracavernosal injection.
  • Such tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrates such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
  • excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
  • disintegrates such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation
  • Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
  • Preferred excipients in this regard include lactose, starch, cellulose, milk sugar or high molecular weight polyethylene glycols.
  • the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • the compounds of the invention can also be administered parenterally, for example, intravenously, intra-articularly, intra-arterially, intraperitoneally, intra- thecally, intraventricularly, intrasternally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood.
  • the aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary.
  • the preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.
  • Formulations suitable for parenteral administration include aqueous and nonaqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
  • the daily dosage level of the compounds of the invention will usually be from 1 to 1000 mg per adult ⁇ i.e. from about 0.015 to 15 mg/kg), administered in single or divided doses.
  • the tablets or capsules of the compound of the invention may contain from 1 mg to 1000 mg of active compound for administration singly or two or more at a time, as appropriate.
  • the physician in any event will determine the actual dosage which will be most suitable for any individual patient and it will vary with the age, weight and response of the particular patient.
  • the above dosages are merely exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention.
  • the compounds of the invention can also be administered intranasally or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134A3 or 1,1,1,2,3,3,3-heptafiuoropropane (HFA 227EA3), carbon dioxide or other suitable gas.
  • a suitable propellant e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134A3
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate.
  • a lubricant e.g. sorbitan trioleate.
  • Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of a compound of the invention and a suitable powder base such as lactose or starch.
  • Aerosol or dry powder formulations are preferably arranged so that each metered dose or 'puff contains at least 1 mg of a compound of the invention for delivery to the patient. It will be appreciated that the overall daily dose with an aerosol will vary from patient to patient, and may be administered in a single dose or, more usually, in divided doses throughout the day.
  • the compounds of the invention can be administered in the form of a suppository or pessary, or they may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder.
  • the compounds of the invention may also be transdermally administered, for example, by the use of a skin patch. They may also be administered by the ocular route.
  • the compounds of the invention can be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.
  • the compounds of the invention can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
  • they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
  • Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier.
  • oral or parenteral administration of the compounds of the invention is the preferred route, being the most convenient.
  • such an effective amount of the polypeptide or formulation thereof may be delivered as a single bolus dose (i.e. acute administration) or, more preferably, as a series of doses over time (i.e. chronic administration).
  • polypeptides and pharmaceutical formulations of the present invention have utility in both the medical and veterinary fields.
  • the methods of the invention may be used in the treatment of both human and non-human animals (such as horses, dogs and cats).
  • the patient is human.
  • a compound of the invention is administered as a suitably acceptable formulation in accordance with normal veterinary practice and the veterinary surgeon will determine the dosing regimen and route of administration which will be most appropriate for a particular animal.
  • An ninth aspect of the invention provides the use of a polypeptide according to the first aspect of the invention or a pharmaceutical formulation according to the seventh aspect of the invention in the preparation of a medicament for treating a disease or condition capable of being treated by an agent which modulates the function of an integrin and/or a metzincin (e.g. an MMP, ADAM or ADAMTS).
  • an agent which modulates the function of an integrin and/or a metzincin e.g. an MMP, ADAM or ADAMTS.
  • the polypeptides and formulations of the present invention may be used to treat patients or subjects who suffer from or are at risk of suffering from the following conditions or disease states; arthritic diseases (including osteoarthritis, rheumatoid arthritis and reactive arthritis), inflammatory conditions (including atherosclerosis and multiple sclerosis), cancer and metastasis progression (including melanoma), oral diseases (including periodontitis; see Sorsa et al (2004) Oral Diseases 10:311-318), osteoporosis, tissue remodeling, angiogenesis, angiogenesis, lung diseases (bronchiectasis and chronic obstructive pulmonary diseases and other lung diseases), wounds, burns, fractures, lesions and ulcers.
  • arthritic diseases including osteoarthritis, rheumatoid arthritis and reactive arthritis
  • inflammatory conditions including atherosclerosis and multiple sclerosis
  • cancer and metastasis progression including melanoma
  • oral diseases including periodontitis; see Sorsa et al (2004) Or
  • the disease or condition capable of being treated by an agent which modulates the function of an integrin and/or a metzincin is an arthritic disease or an inflammatory disease or condition.
  • 'arthritic disease we include osteoarthritis, rheumatoid arthritis and reactive arthritis.
  • 'inflammatory disease or condition' we include Alzheimer's disease, psoriasis, asthma , atherosclerosis , sarcoidosis, atopic dermatitis , systemic lupus erythematosus, bullous pemphigoid , type I diabetes mellitus, chronic obstructive pulmonary disease, ulcerative colitis, gout, Helicobacter pylori gastritis*, inflammatory bowl disease , Hepatitis C*, ischaemia-reperfusion injury, multiple sclerosis, Neisserial or pneumococcal meningitis*, tuberculosis and periodontitis (* indicated diseases of infectious origin in which the host inflammatory reaction is as important to its pathology as the microbial infection itself).
  • the disease or condition is osteoarthritis or rheumatoid arthritis.
  • the disease or condition capable of being treated by an agent which modulates the function of an integrin and/or a metzincin is a proliferative disease (i.e. cancer).
  • proliferative disease may be selected from the group consisting of sarcomas (e.g. bone and connective tissues including synovium), carcinomas (e.g. mammary, pancreatic, colon, squamous cell, adeno, large cell), myelomas, leukaemias, lymphomas (e.g. Hodgkins disease, non-Hodgkins lymphomas, T- cell lymphomas), melanoma and small cell lung cancer.
  • sarcomas e.g. bone and connective tissues including synovium
  • carcinomas e.g. mammary, pancreatic, colon, squamous cell, adeno, large cell
  • myelomas e
  • a tenth aspect of the invention provides a method of treating a patient in need of modulation of the function of an integrin and/or a metzincin (e.g. an MMP, ADAM or ADAMTS), the method comprising administering to the patient an effective amount of a polypeptide according to the first aspect of the invention or a pharmaceutical formulation according to the seventh aspect of the invention.
  • a metzincin e.g. an MMP, ADAM or ADAMTS
  • 'treatment' we include both therapeutic and prophylactic treatment of the patient.
  • 'prophylactic' is used to encompass the use of a polypeptide or formulation described herein which either prevents or reduces the likelihood of a condition or disease state in a patient or subject.
  • the term 'effective amount' is used herein to describe concentrations or amounts of compounds according to the present invention which may be used to produce a favourable change in a disease or condition treated, whether that change is a remission, a favourable physiological result, a reversal or attenuation of a disease state or condition treated, the prevention or the reduction in the likelihood of a condition or disease state occurring, depending upon the disease or condition treated.
  • polypeptides of the invention are used in combination, each of the polypeptides may be used in an effective amount, wherein an effective amount may include a synergistic amount.
  • the method of the tenth aspect of the invention comprises treating a patient suffering from an arthritic disease, an inflammatory disease or condition and/or cancer (see above).
  • the polypeptides and formulations of the invention may be co-administered in combination with one or more known or conventional agents for the treatment of the particular disease or condition.
  • 'co-administer' it is meant that the present polypeptides are administered to a patient such that the polypeptides as well as the co-administered compound may be found in the patient's body (e.g. in the bloodstream) at the same time, regardless of when the compounds are actually administered, including simultaneously.
  • the polypeptide or formulation of the invention comprises may be administered in combination with one or more conventional anti-inflammatory agents, including corticosteroids, non-steroidal anti-inflammatory drugs (NSAIDs), disease modifying anti-rheumatic drugs (DMARDs) and antibody therapies (e.g. anti-TNF ⁇ antibodies).
  • NSAIDs non-steroidal anti-inflammatory drugs
  • DMARDs disease modifying anti-rheumatic drugs
  • antibody therapies e.g. anti-TNF ⁇ antibodies.
  • the polypeptide or formulation of the invention comprises may be administered in combination with one or more conventional anti-cancer agents, including cytotoxic drugs (e.g. alkylating drugs, cytotoxic antibiotics, antimetabolites, vinca alkaloids and etoposide), drugs affecting the immune response (e.g. antiproliferative immunosuppressants, corticosteroids and other immunosuppressants, rituximab and alemtuzumab), and sex hormones and hormone antagonists (e.g. estrogens, progestogens, androgens).
  • cytotoxic drugs e.g. alkylating drugs, cytotoxic antibiotics, antimetabolites, vinca alkaloids and etoposide
  • drugs affecting the immune response e.g. antiproliferative immunosuppressants, corticosteroids and other immunosuppressants, rituximab and alemtuzumab
  • sex hormones and hormone antagonists e.g. estrogens, pro
  • polypeptides and formulations of the invention may be co -administered in combination with one or more agents that inhibit the function of integrins and/or MMPs.
  • the present invention provides the use of a polypeptide according to the first aspect of the invention to detect the presence of an integrin in a sample.
  • a polypeptide of the invention in the diagnosis of a disease or condition associated with abnormal level of an integrin (such as osteoarthritis, rheumatoid arthritis, or cancer).
  • the polypeptide of the invention may be used to detect the presence of an integrin in a sample in vitro or in vivo.
  • the polypeptide of the invention comprises a detectable moiety (i.e. label) or indicating means, such as a fluorescent or radioactive label.
  • the terms 'label' and 'indicating means' refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal to indicate the presence of the polypeptide.
  • Any label or indicating means can be linked to or incorporated in a polypeptide of the present invention, or used separately, and those atoms or molecules can be used alone or in conjunction with additional reagents.
  • Such labels are themselves well known in clinical diagnostic chemistry and the linking of these labels to polypeptides and proteins is well known in the art.
  • Examples of labels for polypeptides include, but are not limited to, the following: radioisotopes (e.g.
  • labels are attached by spacer arms of various lengths to reduce potential stearic hindrance.
  • the technique of labelling polypeptides and their use in diagnostics is well known to the skilled man in the art (Li and Anderson 2003;Haubner et al. 2003).
  • Means for performing peptide-based imaging, including suitable labels and linkers, are also known in the art, for example see WO 03/006491 to Amersham Health A/S; EP 1 272 507 Bl to Amersham Health A/S, and (Medina et al. 2005;Medina et al. 2005).
  • the sample is selected from the group consisting of tissue samples (e.g. cartilage, bone, synovium, atherosclerotic plaque, or tumour samples), synovial fluid, blood samples and plasma samples.
  • the sample is a connective tissue sample.
  • the sample is a cartilage tissue sample, synovium sample or tumour sample
  • the integrin is detected in vivo by X-ray, MR, ultrasound, scintigraphy, PET, SPECT, electrical impedance, light or magnetometric imaging modalities.
  • a twelve aspect of the invention provides a method for diagnosing in a patient a disease or condition associated with abnormal amount and/or function of an integrin, the method comprising:
  • the amount of polypeptide bound to the sample from the patient to be tested provides an indication of the amount and/or function of integrin in the sample.
  • the method further comprises step (d) of comparing the amount of polypeptide bound to the sample from the patient to be tested with the amount of the polypeptide bound to a sample from a healthy individual (or population of individuals).
  • the integrin is a collagen-binding integral, for example ⁇ lO ⁇ l or ⁇ l l ⁇ l.
  • the method comprises
  • An altered level of binding of the polypeptide to the 'diseased' tissue sample may indicate the likely presence of a chondrocyte-mediated disease state, a fibroblast- mediated state, an osteoclast or osteoblast-mediated disease state, a smooth- muscle cell disease state, a macrophage-mediated disease state, a stem cell- mediated disease state or cancerous cells.
  • Such a method may also be used to detect diseases in which the integrin levels are changed, such as OA, RA, atherosclerosis and cancer.
  • diagnostic methods of the present invention may be of a competitive or non-competitive nature, as those terms are understood in the art.
  • a thirteenth aspect of this invention provides a kit for performing a method according to the twelfth aspect of the invention comprising a polypeptide of the invention.
  • the diagnostic kit comprises, in an amount sufficient for at least one assay, a peptide of this invention as a separately packaged reagent.
  • Instructions for use of the packaged reagent are also typically included.
  • Such instructions typically include a tangible expression describing the reagent concentration or at least one assay method parameter such as the relative amounts of reagent and sample to be mixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions and the like.
  • a fourteenth aspect of the invention provides the use of a polypeptide according to the first aspect of the invention to improve targeting of liposomes to target cells (useful in drug delivery and for delivery of gene expression vectors).
  • a polypeptide according to the first aspect of the invention to improve targeting of liposomes to target cells (useful in drug delivery and for delivery of gene expression vectors).
  • Such uses are well known in the art and described in detail in WO 02/076491, Koivunen et al (Koivunen et al. 1999a);(Medina et al. 2001) and (Medina et al. 2004).
  • a fifteenth aspect of the invention provides a polypeptide complex comprising a polypeptide according to the first aspect of the invention and an integrin s ⁇ bunit, or fragment thereof comprising an I-domain.
  • Such complexes are of particular use in molecular modelling and drug design.
  • the complex is in crystalline form.
  • novel peptides developed are useful lead compounds to design peptidomimetics and to develop more selective inhibitors for MMPs.
  • Methods for using the peptides of the invention co-crystallised with their ligand for drug design are well known in the art and described in (Blundell et al. 2002;Hruby 2002;Kitchen et al. 2004;Williams et al. 2005)
  • a sixteenth aspect of the invention provides a method of making a complex according to the fifteenth aspect of the invention comprising a peptide of the invention and its ligand.
  • methods for the co-crystallisation of peptides and antibody fragments with collagen-binding integrins are described in the literature (Karpusas et al. 2003);(Emsley et al. 2004).
  • a seventeenth aspect of the invention provides a method for identifying a candidate compound for the treatment of a disease or condition capable of being treated by an agent which modulates the function of an integrin and/or a metzincin the method comprising determining if a compound to be tested alters or interferes (e.g. competes) with the binding of a polypeptide according to the first aspect of the invention to an integrin I-domain.
  • a compound to be tested alters or interferes (e.g. competes) with the binding of a polypeptide according to the first aspect of the invention to an integrin I-domain.
  • the ability of candidate compounds to bind to an integrin and/or MMP may be assessed by a competitive binding assay.
  • Candidate compounds may be peptide or non-peptide compounds.
  • Binding to an integrin and/or MMP is quantified by the ability to displace a peptide of the present invention, including the peptides of the present invention.
  • the displaced peptide can be assayed by a number of techniques.
  • radiolabeled peptide can be synthesized using commercial available radiolabeled amino acids precursors.
  • Peptides radiolabeled with 3 H 5 14 C or 35 S can be quantified by routine liquid scintillation techniques.
  • a fluorescent labelled peptide can be synthesized.
  • lysine can be inserted in a non-critical position and labelled with fluoroescein isothiocyanate (FITC).
  • FITC fluoroescein isothiocyanate
  • the peptide may be labelled with any suitable fluorophore.
  • a carboxy fluoroescein derivative of one or more of the peptides of the present invention may be prepared.
  • peptides cyclised with an amide peptide linkage have free sulfhydryl groups available for linkage to fluorescent compounds such as thiocyanates. Separation of bound from unbound peptide and quantitation of displaced peptide can be performed by routine techniques known to one of skill in the art.
  • This embodiment of the invention is not limited by the method used to quantify the displaced peptide, and it will be appreciated that any suitable analytical technique may be used.
  • the candidate compound may be a drug-like compound or lead compound for the development of a drug-like compound for each of the above methods of identifying a compound. It will be appreciated that the said methods may be useful as screening assays in the development of pharmaceutical compounds or drugs, as well known to those skilled in the art.
  • a drug-like compound may be a molecule that may be synthesized by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which ma ⁇ ' be of less than 5000 daltons molecular weight.
  • a drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate cellular membranes, but it will be appreciated that these features are not essential.
  • 'lead compound' is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, difficult to synthesize or has poor bioavailability) may provide a starting-point for the design of other compounds that may have more desirable characteristics.
  • the compound may be a polypeptide that is capable of competing with the polypeptide of the invention for binding to an integrin.
  • a screening method as described above may be useful in identifying polypeptides that may also interact with an integrin, for example a receptor molecule.
  • reagents and conditions used in the method may be chosen such that the interactions between the said polypeptide and the integrin are substantially the same as between the said polypeptide or a fragment thereof and a naturally occurring interacting polypeptide in vivo.
  • the 'drug-like compounds' and 'lead compounds' identified in the screening assays of the invention are suitably tested in further screens to determine their potential usefulness in treating arthritic diseases, inflammatory conditions, proliferative disorders, etc.
  • the method further comprises the step of mixing the compound thus identified with a pharmaceutically acceptable carrier.
  • An eighteenth aspect of the invention provides a kit for performing a method according to the seventeenth aspect of the invention comprising a polypeptide of the invention and an integrin subunit or fragment comprising or consisting of an I-domain thereof, or means for producing the same.
  • a nineteenth aspect of the invention provides a compound identified by a method according to the seventeenth aspect of the invention.
  • a twentieth aspect of the invention provides a compound according to the nineteenth aspect of the invention for use in medicine.
  • a twenty-first aspect of the invention provides a pharmaceutical formulation comprising a compound according to the nineteenth aspect of the invention in admixture with a pharmaceutically or veterinarily acceptable adjuvant, diluent or carrier.
  • Figure 1 Stereoview (above) and tube drawing (below) of predicted structure of (A) peptide 'p617' (corresponding to the cyclic form of SEQ ID NO: 6) and (B) peptide 'p618' (corresponding to the cyclic form of SEQ ID NO:5).
  • FIG. 1 Binding of phageAl (expressing the cyclic peptide CGIWFENEWC) and phageA2 (expressing the cyclic peptide CWTWPDSGWC) to immobilised integrin I-domains ( ⁇ l, ⁇ lO and all), to GST-control or to BSA. Bound phages were detected using an anti-M13 antibody.
  • FIG. 1 Binding of phageAl (A) and phageA2 (B) to immobilised integrin a l l I-domain in the presence of synthetic cyclic peptides (p617, p618 and control peptide (ctrl-pep). Binding of phageA2 (C) to integrin ⁇ 10 I-domain in the presence of synthetic cyclic peptides. Bound phages were detected using an anti- Mi 3 antibody.
  • FIG. 4 Binding of phageAl to an anti- ⁇ l l coated surface with or without cell extract (CE) from integrin all transfected cells. Blocking by synthetic peptide p618 and p617. Bound phages were detected using an anti-M13 antibody.
  • FIG. 5 (A) Solid-phase interaction to collagen VI, of recombinant GST-tagged I-domains ( ⁇ l, ⁇ lO and all and GST-control) in the presence or absence of EDTA. (B) I-domain interaction to collagen VI in the presence of synthetic cyclic peptides (p617, p618 or control-peptide). (C) Titration of the p618 effect on I- domain interaction to collagen VI. (**: pO.Ol, ***: pO.OOl). Bound I-domain was detected using an anti-GST antibody.
  • FIG. 1 Integrin ⁇ l 0 and al l I-domain binding to pro-MMP 13. Titration of I-domain ( ⁇ lO, al l and GST-control) (20-32OnM) with a fixed concentration of ⁇ ro-MMP13 (33 nM).
  • B Binding between all I-domain and ⁇ ro-MMP13 in the presence or absence of EDTA. Controls include a GST-control, a control without I-domain and a control without pro-MMP13. Black bars represent anti-his coating and grey bars represent BSA coating.
  • C all I-domain and GST-control interaction to pro-MMP 13 or active MMPl 3.
  • A-C wells are coated with anti-his antibody that bind the C-terminally his-tagged pro-MMP 13. Interacting I-domain is detected using an anti-GST antibody.
  • D I-domain ( ⁇ M, ⁇ lO, all and GST-control) solid-phase interaction to pro-MMP9. Wells were pre- coated with pro-MMP9 and bound GST-fusion was detected using an anti-GST antibody. Values are corrected for unspecific binding to BSA.
  • FIG. 9 Human chondrocytes cultured in high-density monolayer induce MMP- activity after 2 days of interleukin-113 (IL-l ⁇ ) stimulation.
  • Dexamethasone (Dex) inhibits the IL-l ⁇ induced MMP-activity.
  • MMP production was measured in the APMA activated culture supernatants using a quenched fluorescence assay.
  • FIG. 11 Effect of peptides p617 and p618 on IL-l ⁇ induced mRNA expression of (A) MMPl, (B) MMPl 3 and (C) MMPl 4 from both ⁇ lO (Adeno5- ⁇ lO) and al l (Adeno5-all) Adeno5 transfected human chondrocytes. Measured using real-time RT-PCR and MMP-specific primers. Values relative to a housekeeping gene (GAPDH). (D) Effect of peptides p617 and p618 on IL-l ⁇ induced total
  • MMP activity in the supernatants of transfected compared to un-transfected human chondrocytes MMP activity measured in APMA activated culture supernatants using a quenched-fluorescence assay.
  • Dex Dexamethasone.
  • FIG. 12 Effect of exemplary polypeptides of the invention on glycosarnino- glycan (GAG) release in human cartilage explants.
  • Exemplary polypeptides of the invention tested were p617 [SEQ ID NO:7], p617:2 [SEQ ID NO:10] 5 p618 [SEQ ID NO:6], p619 [SEQ ID NO:8] and ⁇ 620 [SEQ ID NO:9] (p620N indicates a new batch of p620).
  • One control peptide was tested, p618:l [SEQ ID NO: 23]. The following additional controls were included; BMP2 with IGF-I and lLl ⁇ with OSM.
  • the objective with this example was to present a model structure of the peptides of the invention.
  • Model structures of the peptides were created by means of molecular dynamics simulations.
  • the peptides were cyclised prior to simulation and built such that residues within the ring adopt a ⁇ -turn conformation.
  • Molecular dynamics simulations were performed without solvent using the AMBER 7 FF02 force field (Ponder and Case 2003).
  • the dielectric constant was set to 80 and the temperature was 300 K.
  • Simulations were sampled with a time step of 1 fs for a total length of 1 ns for exemplary polypeptide of the invention 'P617' (corresponding to the cyclic form of SEQ ID NO:7) and for 80 ps for exemplary polypeptide of the invention 'P618' (corresponding to the cyclic form of SEQ ID NO: 6).
  • the final structure of each simulation was used for the drawings and is represented in Figure 1.
  • the objective with this example was to demonstrate binding of I-domain selected phages to different recombinant I-domains by phage ELISA.
  • the integrin ⁇ l (Genbank acc#: NP_852478 amino acids (aa): 167-364 (CST- LEA) 5 ⁇ lO (Genbank acc#: NP_003628 aa: 162-359 (CPT-LEG)) and al l (Genbank acc#: NP_036343 aa: 159-354 (CQT-LEG)) I-domains were cloned in fusion with a N-terminal GST-tag in the pCEP4-vector (Invitrogen).
  • the constructs also contain a c-myc tag (sequence: MEQKLISEEDLGKL; SEQ ID NO: 11) located between the GST-tag and the I-domain.
  • HEK-293 cells were transfected with the expression constructs using GenePORTERTMTransfection Reagent (Gene Therapy Systems, San Diego, CA, USA) according to the manufacturers recommendations and stably transfected cells were selected using 260 mM Hygromycin B (Dugina, Haarlem, the Netherlands).
  • HEK-293 cells stably expressing GST- ⁇ l I-domain, GST- ⁇ lO I-domain, GST- ⁇ l l I-domain or GST-only (GST-control) were maintained in DMEM:F12 medium (GIBCO BRL) supplemented with 260 mM Hygromycin B (Dugina, Haarlem, the Netherlands), 50 U/ml penicillin / 50 ⁇ g/ml streptomycin (PEST)(GIBCO BRL) and 10 % foetal bovine serum (FBS) (GIBCO BRL) until confluent.
  • the medium was replaced with DMEM:F12 supplemented with 130 mM Hygromycin B and 50 U/ml PEST.
  • the eluted samples were concentrated and dialysed against PBS in Amicon® Ultra-4, 10 000 NWML filter tubes (Millipore, Molsheim, France) following the manufacturer's instructions. Size and quality of the purified proteins were analysed on SDS-PAGE and samples were aliquoted and stored at -8O 0 C for later use.
  • I-domain binding phages were selected from a phage library expressing 6-10 amino acid long cyclic peptides (C-X 6-1O -C) using panning as described elsewhere (Koivunen et al. 1994;Koivunen et al. 1999b). Briefly described, the phage libraries were pre-selected in tris-buffered-saline with 0.05% Tween-20 (TBS-T) for 2h at room temperature on 96-well plates pre-coated with GST-control (20 ⁇ g/ml) and blocked with 2 % bovine serum albumin (BSA).
  • TBS-T tris-buffered-saline with 0.05% Tween-20
  • the un-bound phages were transferred to 96-well plates, pre-coated with recombinant GST- ⁇ lO (20 ⁇ g/ml) or al l (20 ⁇ g/ml) I-domains and blocked for Ih at room temperature with tris-buffered-saline (TBS) + 1% BSA + ImM Mg 2+ .
  • TBS tris-buffered-saline
  • the selected and amplified phages were subjected to a second and third round of panning as described above.
  • Selected individual phages were sequenced using BigDye (Applied BioSystems, UK) and the primers A and B (primer A: TAATACGACTCACTATAGGGCAAGCTGATAAACCGATACAAT [SEQ ID NO: 12] and B: CCCTCATAGTTAGCGTAACGATCT [SEQ ID NO: 13] (15 pmol / ml) for 35 cycles of the following conditions; 95°C - 5 min, 92 0 C - 20 sec, 60 0 C - 20 sec, 72°C 1 min,, followed by 72°C for 4 minutes.
  • 96-well MaxiSorb plates (Nunc) was coated with I-domain-GST fusions or the GST-control (2nM) at 4°C for 2Oh. Wells were blocked with TBS-T+1 % BSA for 1 h at room temperature. After blocking plates were washed three times with phosphate-buffered-saline with 0.05% Tween-20 (PBS-T) and incubated (shaking) for Ih at room temperature with 1x10 9 plaque forming units (pfu) of phages. Plates were washed three times with PBS-T and bound phages detected with HRP-anti-M13 (1:3000 in TBS-T+0.1% BSA) (Calbiochem) staining for Ih at room temperature.
  • HRP-anti-M13 1:3000 in TBS-T+0.1% BSA
  • PhageAl expressing the p618 peptide, binds ⁇ l and ⁇ l 1 equally well but not ⁇ lO.
  • PhageA2 expressing the p617 peptide binds to ⁇ l, all and weaker to ⁇ lO. Neither phageAl nor phageA2 bind to the GST control or to BSA coated wells.
  • the objective with this example was to demonstrate that synthetic cyclic peptides with sequences derived from the selected phages could inhibit the phage interaction to I-domains.
  • 96-well MaxiSorb plates (Nunc) were coated with I-domarn-GST fusions (2nM) or the GST control (2nM) (see example 2) at 4°C for 2Oh.
  • Wells were blocked with 1 % bovine serum albumin (BSA) in tris-buffered-saline with 0.05% Tween- 20 (TBS-T+1% BSA) for Ih at room temperature.
  • BSA bovine serum albumin
  • Tween- 20 Tween- 20
  • PBS- T phosphate-buffered-saline with 0.05% Tween-20
  • Cyclic peptides were synthesized at the Department of Bioscience (Helsinki, Finland) as described (Koivunen et al. 1994;Koivunen et al. 1999b). Peptide sequences were as follows:
  • p617 CWTWPDSGWC [SEQ ID NO:7]
  • p618 CGIWFENEWC [SEQ ID NO:6]
  • the objective with this example was to demonstrate that phages and peptides could interact with whole integrin.
  • 96-well MaxiSorb plates (Nunc) were coated with polyclonal antibodies (5 ⁇ g/ml) recognising the cytoplasmic tail of ⁇ l 1 integrins, over night at 4°C in phosphate buffered saline (PBS)+Mg 2+ /Ca 2+ (GIBCO BRL) followed by washing in tris buffered saline with 0.05% Tween-20 (TBS-T) and blocking with 2 % bovine serum albumin (BSA) in TBS-T with 1 mM Mg 2+ and 10 ⁇ M Ca 2+ at room temperature for Ih.
  • PBS phosphate buffered saline
  • GOBCO BRL phosphate buffered saline
  • TBS-T tris buffered saline with 0.05% Tween-20
  • BSA bovine serum albumin
  • cell-extract from HEK 293-cells transfected with ⁇ l 1 -integrins in cell lysis buffer (1% NP40, 20 mM Tris pH 7.5, 150 mM NaCl, 1 mM MgCl 2 , 10 ⁇ M CaCl 2 , 1:50 Complete proteinase inhibitor).
  • phages (10 9 plaque forming units (pfu)/ml in TBS + ImM Mg 2+ and 10 ⁇ M Ca 2+ with 1 % BSA and peptides (see example 3)(200 ⁇ g/ml in TBS + ImM Mg 2+ and 10 ⁇ M Ca 2+ with 1 % BSA) were added. After incubation for one hour at room temperature, the plates were washed and bound phages detected with HRP conjugated anti-M13 phage antibody (diluted 1:3000) (Calbiochem) for Ih at room temperature.
  • the objective with this example is to demonstrate that peptides p617 and p618 are functional modulators of integrin ⁇ l, ⁇ lO and/or all I-domain interaction to collagen.
  • 96-well MaxiSorb plates were coated with 10 mg/ml collagen type VI in phosphate buffered saline (PBS) at 4°C for 48 hours followed by blocking with 1% bovine serum albumin (BSA) in tris-buffered-saline with 0.05% Tween-20 (TBS-T), ImM Mg 2+ and 10 ⁇ M Ca 2+ , for 1 hour at room temperature.
  • PBS phosphate buffered saline
  • BSA bovine serum albumin
  • Tween-20 Tween-20
  • the wells were washed 3 x 300 ⁇ l with TBS-T+Mg/Ca and the recombinant I-domains (10OnM) (see example 2), when indicated preincubated for 30 min with peptides (see example 3) (160 ⁇ M or as indicated in figure), were added in TBS-T+Mg/Ca with or without 10 mM EDTA.
  • P618 significantly inhibits ⁇ l (pO.OOl), ⁇ lO (pO.OOl) and al l (pO.OOl) interaction to collagen.
  • the inhibitory effect of p618 on collagen interaction is strongest on ⁇ l 1 I-domain interaction, then ⁇ lO I-domain interaction. This could reflect a different affinity/specificity of p618 for the different integrin ⁇ chains.
  • the results in figure 5C demonstrate that p618 inhibits ⁇ l, ⁇ lO and al l I-domain interaction to collagen type VI in a concentration dependent manner.
  • the peptides are functional modulators of integrin function, since they can reduce I-domain interaction to a natural ligand (collagen) in a concentration dependant manner. As a consequence it is likely that the peptides would interfere with e.g. integrin dependent focal adhesion and migration.
  • the objective with this example is to demonstrate that pro-MMP13 but not pro- MMP9 interacts with ⁇ lO and all I-domains.
  • Sandwich ELISA (figures 6A, B and C): MaxiSorb plates were coated with 10 ⁇ g/ml anti-his-antibody (MAB050 R&D Systems) diluted in tris-buffered- saline (TBS) over night at 4°C followed by blocking with 1 % bovine serum albumin (BSA) in TBS-T (TBS+0.05% Tween 20) for 1 hour and washing (x3) with TBS-T. His-tagged proMMP-13 (33nM) was allowed to interact with the GST-tagged I-domains (see example 2) (20 - 320 nM) in 100 ⁇ l TBS-T with ImM Mg 2+ , lOO ⁇ M Ca +2 and 0.1% BSA for 1 hour.
  • BSA bovine serum albumin
  • Solid phase assay (figure D): MaxiSorb plates were coated over night at 4°C with 20 ng/ml proMMP9 (Calbiochem, San Diego, CA, USA) in TBS followed by blocking with TBS-T+1% BSA for 1 hour at room temperature. Plates were washed 3x with TBS-T and incubated with recombinant GST-tagged I-domains (2OnIvI) in TBS-T+Mg/Ca+0.1% BSA for 2h at room temperature.
  • proMMP9 Calbiochem, San Diego, CA, USA
  • proMMP13 e.g. proMMP 13
  • collagen binding integrins e.g. integrin ⁇ lO/betal or ⁇ ll/betal
  • the inactive proMMP is localised to the cell surface and presented for activation by e.g. the membrane bound MMP 14.
  • the active MMP is released from the integrin to digest its substrate. This way the integrin could be involved in both localisation of MMP and regulation of MMP activity.
  • this interaction could be a way of blocking matrix degradation.
  • proAl l I-domain (80 nM) or GST-control (80 nM) was allowed to interact with recombinant bis-tagged pro-MMP13 (33 nM) or APMA activated MMP 13 (33 nM) in solution.
  • the complex was then added to wells pre- coated with anti-His-antibody. Bound GST-fusions was detected using a monoclonal anti-GST antibody. Values are corrected for unspecific binding to BSA.
  • the objective with this example was to demonstrate that the synthetic cyclic peptide p618 could inhibit pro-MMP13 interaction to integrin ⁇ lO and all I- domains.
  • the objective with this example is to demonstrate that the synthetic peptide p618 inhibits pro-MMP13 interaction to the whole integrin using integrin ⁇ lO as an example.
  • Cell-extract from HEK 293-cells transfected with ⁇ lO-rntegrin in cell lysis buffer (1% NP40, 20 mM Tris pH 7.5, 150 mM NaCl, 1 mM MgCl 2 , 10 ⁇ M CaCl 2 , 1:50 Complete proteinase inhibitor) was preincubated at room temperature with peptides (see example 3)(160 ⁇ M). After 10 minutes of pre-incubation bis-tagged proMMP-13 (22nM) was added and incubation was continued for an additional Ih at room temperature. The samples were then diluted and added to parallel wells of the anti-His coated plate and incubated for 1 hour at room temperature.
  • the objective with this example is to show that human chondrocytes cultured in high-density monolayer up-regulate MMP production after IL- l ⁇ stimulation and that this induction is prohibited in the presence of dexamethasone.
  • DMEM/F12 Human chondrocytes from femur condyle cartilage of a 56-year old donor was cultured in DMEM/F12 (GIBCO BRL) supplemented with 10% FCS, PEST and ascorbic acid (50 ⁇ g/ml) for 10 days before onset of experiment.
  • cells were plated (100,000 cells/well) in 96-well culture plates in DMEM/F12 supplemented with 10% FCS 5 PEST and ascorbic acid (50 ⁇ g/ml).
  • DMEM high glucose without phenol red GEBCO BRL
  • IL-IB R&D Systems
  • IL-IB plus dexamethasone Sigma
  • MMP activity was measured as described by (Knight et al. 1992) using a quenched fluorescence assay. Briefly, the supernatants were treated with 1 mM amino-phenyl-mercuric-acetate (APMA) in assay-buffer (5OmM Tris/HCl, 5mM CaCl 2 , pH 7.5) for one hour at 37°C.
  • APMA amino-phenyl-mercuric-acetate
  • the objective with this example was to demonstrate that cyclic peptides p617 and p618 could inhibit IL-IB induced increased MMP protein production.
  • Human chondrocytes were prepared from femoral condyle cartilage of a 63 -year- old donor as described in Example 9 above.
  • the chondrocytes were cultured in DMEM-Fl 2 (GIBCO BRL) supplemented with 10% foetal calf serum (FCS), PEST (50 U/ml penicillin and 50 ⁇ g/ml streptomycin) and ascorbic acid (50 ⁇ g/ml), for ten days post isolation.
  • FCS foetal calf serum
  • PEST 50 U/ml penicillin and 50 ⁇ g/ml streptomycin
  • ascorbic acid 50 ⁇ g/ml
  • the objective with this example was to demonstrate that the altered MMP gene expression profile and increased total MMP protein production induced by over- expression of integrin ⁇ lO and all in human chondrocytes could be inhibited by treatment with peptides p617 and p618.
  • chondrocytes Human chondrocytes were prepared from tibial plateau of a 45-year-old donor as described (Goldring et al. 1986;Archer et al. 1990). The chondrocytes were cultured in DMEM-F12 (GIBCO BRL) supplemented with 10% foetal calf serum (FCS), PEST (50 U/ml penicillin and 50 ⁇ g/ml streptomycin) and ascorbic acid (50 ⁇ g/ml), for ten days post isolation.
  • FCS foetal calf serum
  • PEST 50 U/ml penicillin and 50 ⁇ g/ml streptomycin
  • ascorbic acid 50 ⁇ g/ml
  • chondrocytes were detached and infected in suspension (100 ⁇ l of DMEM-F 12 supplemented with 10% FCS and PEST) with 100 multiplicity of infection (MOI) of adenovirus (Adeno5) encoding human ⁇ lO or all integrins (He et al. 1998). After 2h of infection, the cells seeded in a 96 well culture plate at high cell density (100 000 cells/well) and allowed to adhere over night (37°C, 5% CO 2 ).
  • MOI multiplicity of infection
  • the supernatants were treated with 1 mM amino-phenyl-mercuric-acetate (APMA) in assay-buffer (5OmM Tris/HCl, 5mM CaC12, pH 7.5) for one hour at 37°C.
  • APMA amino-phenyl-mercuric-acetate
  • assay-buffer 5OmM Tris/HCl, 5mM CaC12, pH 7.5
  • 2 ⁇ l MMP-substrate Calbiochem
  • the increase of fluorescence (ex 328 ⁇ m and em 393 nm) was measured during one hour at 37 0 C.
  • the Vmax / second was calculated.
  • the cells were gently washed with PBS and medium changed to DMEM-high glucose medium (without indicator) (GIBCO BRL) supplemented with PEST and ascorbic acid.
  • the reaction parameters were: 10 minutes at 25 0 C, 30 minutes at 37°C, 30 minutes at 42 0 C and 15 minutes at 65 0 C.
  • cDNA (20 ng) was subjected to realtime RT-PCR analyses to determine the relative mRNA levels of MMPl, MMP 13 and MMP 14 to glyceraldehyde-3 -phosphate dehydrogenase (GAPDH).
  • the primer sequences used were as follows:
  • GAPDH GGAGGGGAGATTCAGTGTGGT [SEQ ID NO:21] 5 and ACCAGCGACACCCACTCCTC [SEQ ID NO:22].
  • mRNA expression levels were quantified with Real-Time reversed PCR (RT- PCR) using FastStart DNA Master SYBR Green I (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufactures instructions and analysed on a LightCycler (Roche Diagnostics).
  • the amplification parameters were: 10s at 95°C, 5s at 65 0 C and 12s at 65°C. Products were checked using the melting curve function of the LightCycler. The relative ratio of MMP to GAPDH was calculated.
  • the objective with this example was to test how exemplary peptides of the invention affect reduction of collagen degradation in human explants.
  • Peptide concentration 50 ⁇ g/ml; growth factor concentrations: BMP2 200ng/ml, IGF-I 200ng/ml, ILl ⁇ 0.02ng/ml, OSM 50 ng/ml.
  • Days 2-6 Incubate explant samples in presence of peptides or growth factors four 4 days. Change of medium every second day.
  • GAG Glycosaminoglycan
  • Test peptides p617, P617:2, p618 & p620 are able to reduce collagen degradation in human cartilage explants.
  • Goldring MB Sandell LJ, Stephenson ML, Krane SM (1986) Immune interferon suppresses levels of procollagen mRNA and type II collagen synthesis in cultured human articular and costal chondrocytes. J Biol Chem 261 :9049-9055 Goldring SR (2003) Pathogenesis of bone and cartilage destruction in rheumatoid arthritis. Rheumatology (Oxford) 42 Suppl 2:iill-iil6
  • Integrin alpha 2 beta 1 is a positive regulator of collagenase (MMP-I) and collagen alpha 1(1) gene expression. J Biol Chem 270:13548-13552

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un nouveau polypeptide comprenant la séquence d'acides aminés représentée par SEQ ID NOS: 1, 2, 3, 4 ou 5, des variants, des fusions ou des dérivés dudit polypeptide, ainsi que des préparations pharmaceutiques de ce dernier. Les peptides et préparations de l'invention sont utiles pour le traitement de maladies ou d'états pouvant être traités par un agent qui module la fonction d'une intégrine et/ou d'une metzincine, telles que les maladies arthritiques, les maladies et états inflammatoires ainsi que le cancer. L'invention concerne également des méthodes de diagnostic desdites maladies et desdits états, ainsi que des méthodes de criblage de composés candidats présentant une efficacité dans le traitement desdites maladies et desdits états.
PCT/GB2006/003015 2005-08-12 2006-08-11 Nouveaux peptides et utilisations associees WO2007020405A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP06765268A EP1924595A2 (fr) 2005-08-12 2006-08-11 Nouveaux peptides et utilisations associees

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US70789505P 2005-08-12 2005-08-12
GB0516571.7 2005-08-12
GB0516571A GB2429012A (en) 2005-08-12 2005-08-12 Polypeptides capable of binding an integrin I-domain.
US60/707,895 2005-08-12

Publications (2)

Publication Number Publication Date
WO2007020405A2 true WO2007020405A2 (fr) 2007-02-22
WO2007020405A3 WO2007020405A3 (fr) 2007-05-03

Family

ID=37487992

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/003015 WO2007020405A2 (fr) 2005-08-12 2006-08-11 Nouveaux peptides et utilisations associees

Country Status (2)

Country Link
EP (1) EP1924595A2 (fr)
WO (1) WO2007020405A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112313514A (zh) * 2018-04-12 2021-02-02 皇家飞利浦有限公司 轻度或重度牙周炎的诊断

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997016557A1 (fr) * 1995-10-31 1997-05-09 Boehringer Ingelheim International Gmbh TRAITEMENT DE TUMEURS PAR TRANSFERT ADOPTIF DE LYMPHOCYTES T CYTOTOXIQUES SPECIFIQUES DU CD44v
WO1999002551A1 (fr) * 1997-07-11 1999-01-21 Biotie Therapies Ltd. Peptide de liaison avec integrine et son utilisation
WO2003022991A2 (fr) * 2001-09-07 2003-03-20 Board Of Regents, The University Of Texas System Compositions et procedes d'utilisation de peptides de ciblage contre les tissus adipeux et placentaires
WO2004110477A1 (fr) * 2003-06-19 2004-12-23 Ctt Cancer Targeting Technologies Oy Inhibiteurs du complexe prommp-9 leucocytaire /integrine beta (2)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001233114A1 (en) * 2000-02-04 2001-08-14 Aeomica, Inc. Methods and apparatus for predicting, confirming, and displaying functional information derived from genomic sequence

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997016557A1 (fr) * 1995-10-31 1997-05-09 Boehringer Ingelheim International Gmbh TRAITEMENT DE TUMEURS PAR TRANSFERT ADOPTIF DE LYMPHOCYTES T CYTOTOXIQUES SPECIFIQUES DU CD44v
WO1999002551A1 (fr) * 1997-07-11 1999-01-21 Biotie Therapies Ltd. Peptide de liaison avec integrine et son utilisation
WO2003022991A2 (fr) * 2001-09-07 2003-03-20 Board Of Regents, The University Of Texas System Compositions et procedes d'utilisation de peptides de ciblage contre les tissus adipeux et placentaires
WO2004110477A1 (fr) * 2003-06-19 2004-12-23 Ctt Cancer Targeting Technologies Oy Inhibiteurs du complexe prommp-9 leucocytaire /integrine beta (2)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BJORKLUND M ET AL: "Peptide Inhibition of Catalytic and Noncatalytic Activities of Matrix Metalloproteinase-9 Blocks Tumor Cell Migration and Invasion" JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 279, no. 28, 9 July 2004 (2004-07-09), pages 29589-29597, XP002990968 ISSN: 0021-9258 cited in the application *
DATABASE Geneseq [Online] 4 February 2002 (2002-02-04), "Peptide #1939 encoded by human foetal liver single exon probe." XP002411307 retrieved from EBI accession no. GSN:ABB34433 Database accession no. ABB34433 & WO 01/57277 A2 (MOLECULAR DYNAMICS INC [US]; PENN SHARRON G [US]; HANZEL DAVID K [US];) 9 August 2001 (2001-08-09) *
GULLBERG ET AL: "Collagen-binding I domain integrins - what do they do?" PROGRESS IN HISTOCHEMISTRY AND CYTOCHEMISTRY, GUSTAV FISCHER VERLAG, STUTTGART, DE, vol. 37, no. 1, 2002, pages 3-54, XP005032609 ISSN: 0079-6336 *
NYMALM YVONNE ET AL: "Jararhagin-derived RKKH peptides induce structural changes in alpha1I domain of human integrin alpha1beta1." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 9, 27 February 2004 (2004-02-27), pages 7962-7970, XP002411305 ISSN: 0021-9258 *
PASQUALINI R ET AL: "A PEPTIDE ISOLATED FROM PHAGE DISPLAY LIBRARIES IS A STRUCTURAL AND FUNCTIONAL MIMIC OF AN RGD-BINDING SITE ON INTEGRINS" THE JOURNAL OF CELL BIOLOGY, ROCKEFELLER UNIVERSITY PRESS, US, vol. 130, no. 5, September 1995 (1995-09), pages 1189-1196, XP000944635 ISSN: 0021-9525 *
STEFANIDAKIS MICHAEL ET AL: "Identification of a negatively charged peptide motif within the catalytic domain of progelatinases that mediates binding to leukocyte beta2 integrins." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 36, 5 September 2003 (2003-09-05), pages 34674-34684, XP002411304 ISSN: 0021-9258 cited in the application *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112313514A (zh) * 2018-04-12 2021-02-02 皇家飞利浦有限公司 轻度或重度牙周炎的诊断

Also Published As

Publication number Publication date
WO2007020405A3 (fr) 2007-05-03
EP1924595A2 (fr) 2008-05-28

Similar Documents

Publication Publication Date Title
US20080254506A1 (en) Claudin polypeptides
US10557129B2 (en) Peptides derived from human PCSK9 catalytic domain and uses thereof for promoting LDL-R activity
US8313914B2 (en) Compositions and methods for modulation of cell migration
US5892014A (en) DNA encoding a protease-activated receptor 3
AU2672899A (en) Protease-activated receptor 4 and uses thereof
AU2001284977A1 (en) Claudin polypeptides
Shimamura et al. Identification of a stable chemerin analog with potent activity toward ChemR23
US8697629B2 (en) Modulation of intracellular signaling
US5955431A (en) Mast cell protease peptide inhibitors
WO1997035969A2 (fr) Ligands peptidiques du recepteur de l'urokinase
JP2009502192A (ja) 新規抗凝固ポリペプチド及び複合体
CA2610496A1 (fr) Inhibiteur de thrombine a peptides synthetiques et activation par thrombine des recepteurs actives par les proteases 1 et 4
JP2008509077A (ja) Ｃ５ａ受容体を遮断する化合物および治療法におけるその使用
JP2010229093A (ja) 新規ＣｈｅｍｅｒｉｎＲアゴニスト
GB2429012A (en) Polypeptides capable of binding an integrin I-domain.
WO2007020405A2 (fr) Nouveaux peptides et utilisations associees
Eguchi et al. Chemogenomics with peptide secondary structure mimetics
US7186802B2 (en) Claudin polypeptides
KR20020086491A (ko) 스크리닝 방법
US20050266421A1 (en) Claudin polypeptides, polynucleotides, and methods of making and use thereof
Hendrickson The anticancer effects of the different analogs of cysteine deleted tachyplesin on A549 lung cancer cells
Pascarella Design, synthesis and biological activity evaluation of peptide-based collagen turnover modulators
WO2009143493A2 (fr) Modulateurs des voies de signalisation dépendantes de tnfa et leurs utilisations
Parry et al. Marian L. Plunkett, PhD, David E. Shaw, PhD, Steven Pirie-Shepherd, PhD, and Andrew P. Mazar, PhD
AU2006200669A1 (en) Claudin polypeptides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006765268

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2006765268

Country of ref document: EP