WO2006129717A1

WO2006129717A1 - Tumor marker for detection of pancreatic cancer and pancreatic cancer detection kit using the same

Info

Publication number: WO2006129717A1
Application number: PCT/JP2006/310886
Authority: WO
Inventors: Akira Togawa; Shigetsugu Takano; Masaru Miyazaki; Fumio Nomura; Takeshi Tomonaga; Kazuyuki Sogawa
Original assignee: National University Corporation Chiba University
Priority date: 2005-05-31
Filing date: 2006-05-31
Publication date: 2006-12-07
Also published as: JPWO2006129717A1

Abstract

Disclosed are a tumor marker which has a high test positivity for early pancreatic cancer and can detect pancreatic cancer with higher reliability and a kit for use in the detection of pancreatic cancer using the tumor marker. A tumor marker for use in the detection of pancreatic cancer comprising ApoC-1 protein; and a kit for use in the detection of pancreatic cancer comprising a protein chip for detecting ApoC-1 protein.

Description

Specification

Tumor marker for detection of sputum cancer and kit for detection of winning cancer using the same

Technical field

[0001] The present invention relates to a marker for detecting knee cancer and a kit for detecting knee cancer using the marker.

Background art

[0002] The incidence of knee cancer has been increasing year by year, and the incidence in Japan increased to 5.2 out of 100,000 in 1985. Furthermore, in 1995, deaths from spleen cancer were 14.7 out of 100,000, accounting for 5th place in male cancer deaths and 7th place in females (Health Statistics Association: National Health Trends) 1997).

[0003] Spleen cancer is known as a cancer with poor prognosis among cancers of extinct organs. The reasons are as follows: (1) Early detection is difficult, advanced cancer is already diagnosed at the time of diagnosis, and resection rate is low. (2) Peripheral plexus, peritoneal dissemination and liver metastasis have occurred at an early stage when the biological malignancy is high. (3) An effective adjunct therapy is established and it is a cunning thing.

[0004] Currently, advanced lymph node dissection and portal vein resection are attempted for locally advanced knee cancer, which contributes to the improvement of the resection rate, and 10 to 15% of splenic cancer cases are subject to surgical resection. It has become. However, the survival rate has not improved, and the 5-year survival rate is said to be 5-10% even in resected cases. Therefore, there is an urgent need to diagnose splenic cancer at an early stage and perform surgical resection to improve treatment results.

[0005] In addition, splenic cancer is very malignant, and metastasis (distant metastasis) has occurred at a site distant from the spleen. Because of this distant metastasis (especially the liver), many patients are subject to surgical resection. Do not become. Patients with inoperables have a worse prognosis. The 5-year survival rate is almost 0%. For this reason, diagnosis and resection as early as possible is the most effective treatment. Therefore, it is most important to develop a method for detecting splenic cancer patients at an early stage.

[0006] Conventionally, diagnosis of splenic cancer has been performed mainly by CT scan and ultrasonic examination as diagnostic imaging. However, with this diagnostic method, spleen cancer is usually found as an advanced case. Reasons include abdominal pain, back pain, jaundice This is because there are many cases in which surrounding organs and distant metastases have already occurred. Furthermore, it is difficult to detect small splenic cancer with a tumor diameter of less than 2 cm by CT scan or ultrasonography. For this reason, about 10 to 15% of all patients are subject to surgical resection, and most patients who have undergone resection are highly advanced.

[0007] On the other hand, various tumor markers such as CA19-9, DUPAN-2, SPAN-1, and SL X are used for detection of tumors of spleen cancer, which contributes to the diagnosis of spleen cancer (for example, the following) (See Non-Patent Documents 1 to 4).

Non-Patent Literature 1: Masakazu Zhang et al., “Clinical Significance of New Tumor Marker CA19-9”, “Knee Cancer Case Medium”, Monthly and Spleen, 1985, 6 卷, 1129–1135

Non-Patent Document 2: TAKASAKI et al. “Correlative Study on Expression of CA19 —9 and DU—PAN— 2 in Tumor Tissue and in Serum of Pancreatic Cancer Patients” Cancer Research, 1988, 48, 1435—1438 3: YONG S. CHUNG et al. "The Detection of Human Pancreatic Cancer— Associated Antigen in the Serum of Cancer Patients" Cancer, 1987, 60 卷, 1636-1643

Non-Patent Document 4: Hiroyasu Kawakami et al. “Clinical usefulness of serum SLX (sialyl SSEA—1) measurement in various cancers of cancer”, Journal of Japan Society of Surgery for Diseases, 1989, 86 卷, 1141— 1148 Page Disclosure of Invention

Problems to be solved by the invention

[0008] However, even with CA19-9, which is the most specific and highly sensitive among the above tumor markers, and is widely used, the positive rate of early splenic cancer is low. Search for cancer is not possible with this test. Furthermore, in Lewis antigen-negative patients, CA19-9 has the problem that it may become negative even in advanced splenic cancer (Hirano et al., “Loss of Lewis antigen expression on erythrocytes in some cancer patients with high serum). CA19—9 levels ”, J Natl Cancer Inst, 1987, 79 卷, 1261-1268). Furthermore, chronic knee inflammation shows high values even in patients with cholangitis and cholelithiasis V, and there remains a problem as a tumor marker for reliably detecting splenic cancer.

[0009] Therefore, in view of the above problems, the present invention is more reliable for splenic cancer with a higher positive rate of early splenic cancer. It is an object of the present invention to provide a tumor marker that is actually detected and a knee cancer detection kit using the same.

Means for solving the problem

[0010] The inventors of the present invention have compared ApoC-1 protein before and after surgery in patients with spleen cancer and after surgery to remove spleen cancer (20 cases each). It was found that it is expressed in patients with knee cancer before surgery, whereas it is almost expressed in patients after resection. This protein is found in splenic cancer! And see what can be used as a tumor marker! However, the present invention has been completed. This protein is also expressed in early patients with splenic cancer, and it is possible to detect knee cancer patients more extensively and more sensitively than conventional tumor markers.

[0011] That is, the tumor marker for detecting knee cancer according to one embodiment of the present invention is characterized by having ApoC-1 protein ability. This makes it possible to more reliably detect splenic cancer, which has a higher positive rate of early splenic cancer than conventional tumor markers. This can be detected using, for example, a protein chip system, ELISA method or the like. Examples of ELISA methods include (Micheal D. Curry, Walter J McConathy, Jim D. Fesmire, and Peter

Alaupovic. Quantitative Determination of Apolipoproteins C— 1 and C— II in Human Plasma by Separate

Electroimmunoassays., Clin. Chem. 1981, 27 卷, 543-548, Caroline Petit— Turcotte, Sheldon M. Stohl, et ai. Apolipoprotein

C— 1 Expression in the Brain in Alzheimer's Disease.

Neurobiology of Disease 2001, 8 卷, pages 953-963) can be used.

[0012] In addition, a spleen cancer detection kit according to another embodiment of the present invention is used in a protein chip system V, and can contribute to more reliable detection of spleen cancer.

[0013] The protein chip system is a system developed for the purpose of efficiently performing functional analysis such as protein expression, interaction, post-translational modification, and purification and identification of the target protein. It consists of a protein chip with various chemical properties suitable for protein analysis on the surface, a protein chip reader used for measurement, and a computer installed with software used for measurement and analysis. The [0014] The protein chip system can capture the protein of interest from a crude sample such as serum, urine, culture broth and cell lysate using the affinity for the protein chip, and measure its mass number. There is an advantage that protein can be easily analyzed on a protein chip without using labels or tags, and results can be obtained in a short time even with a small amount of sample force. Although not limited to a protein chip reader, for example, a time-of-flight mass spectrometer (SELDI—TOF—MS) is suitable. The time delinquent mass spectrometer irradiates the substance trapped on the surface of the protein chip with a laser to cause ionization. The ionized material is accelerated in the electric field and flies through the flight tube toward the detector. The flying speed is proportional to the molecular weight (more precisely, the molecular weight divided by the number of ionized charges). Therefore, by measuring the time from when the laser is irradiated until the force reaches the detector, the molecular weight of the substance existing on the surface of the protein chip can be known, and the target protein can be identified.

The invention's effect

As described above, according to the present invention, it is possible to provide a tumor marker for more reliably detecting splenic cancer having a higher positive rate of early splenic cancer and a knee cancer detection kit using the same.

BEST MODE FOR CARRYING OUT THE INVENTION

[0016] Hereinafter, the effects as a tumor marker and detection kit for detecting knee cancer according to the present invention will be described using a specific example for an actual patient.

[0017] Healing surgery was performed from June 2001 to October 2003, and 20 cases with pathological histopathology of invasive splenic cancer were targeted, and these pre- and post-operative sera were sampled. Used as. These 20 cases are shown in Table 1. In all of these cases, preoperative serum was serum that did not receive adjuvant therapy (chemotherapy, radiation therapy, etc.), postoperative serum was considered after surgery, and the postoperative condition became stable. Serum collected at least 3 or 4 weeks after surgery before postoperative adjuvant therapy was used. Each serum was centrifuged at 3000 rpm immediately for 5 minutes after blood collection, and the supernatant was dispensed and stored at -30 ° C.

[table 1] Background of Patients (n = 20)

No Age Sex Stage pre-CEA pre-CA19-9 Apo C-1

1 57 M IVa 2.0 18.1 (+++)

2 68 F I 1.8 46.6 (+)

3 37 I 2.3 26.2 (+++)

4 63 M IVb 5.8 5920.0 (-)

5 65 F III 1.9 11.1 (-)

6 49 IVa 4.3 40.0 (++)

7 65 M III 4.8 2438.0 (+-)

8 54 M III 2.1 61.1 (++)

9 68 F IVa 2.9 25.8 (+-)

10 71 M III 3.5 398.6 (+-)

11 49 M IVa 7.6 636.0 (+-)

12 73 M IVb 4.2 1439.0 (+++)

13 54 F III 4.6 196.1 (+++)

14 69 F IVa 4.8 8190.0 (+++)

15 58 M III 4.4 396.3 (+-)

16 62 M III 3.3 175.2 (++)

17 45 F III 4.0 1205.0 (+-)

18 66 M IVa 5.0 266.7 (+-)

19 61 F IVb 3.4 680.0 (+++)

20 61 F III 2.6 14.3 (++)

Sex Histology

M 12 moderately 12

F 8 poorly 5

Age Invasive carcinoma 2

Mean 59_ 8 derived from IPMT

SD ± 9 Giant cell 1

Stage

2 Survival (M)

III Q Average 25.7

III

₀ MST 23.5

A time-flight mass spectrometer (SELDI-TOF-MS) was used as the protein chip reader in the IVa Vb protein chip system. WCX2 (cation exchange chip) (CIPHERGEN) was used as the protein chip, and pH 6.5 (50 mM sodium phosphate) urea was used as the buffer. The sample composition is urea; patient serum 20 μ 1 + denatured buffer 20 ^ 1 + pH buffer 160 l (lZlO diluted), and 100 1 is administered to each spot on the protein chip, and two spots of the same sample are performed. It was. And each Sinapic acid was dissolved in EAM solution (50% acetonotryl ZO. 5% TFA) and applied to the pot. SELDI-TOF—MS, a protein chip detector, is used to detect proteins in the serum and perform pre- and post-operative protein comparisons (Serum protein profiling). We found a peak (protein) that decreased after surgery, and detected a peak of about 6630 Da in mass as a candidate protein. A typical peak example is shown in Fig. 1, and the peak intensity of this protein before and after surgery is shown in Fig. 2.

[0019] According to Fig. 1, under the condition of pH 6.5, in urea buffer, a mass where pea k decreases significantly from pre-operation to post-operation is found, and its mass number is 6630 Da (p = 0. 0038). there were. When patients with peak were judged positive, 18 out of 20 (90%) were judged positive for splenic cancer. CA19-9, a specific tumor marker for conventional splenic cancer, was only positive in 15 (75%) of 20 cases, and the positive rate of CEA was only 2 (10%). . Among them, case 20 was a Lewis antigen (a-, b +) patient and CA19-9 had normal values. This protein was positive, and cases 2 and 3 were stage I, an early splenic cancer. In both cases, CA19-9 was negative in case 3, which was positive for this protein. In other words, this protein can be detected more frequently in early-stage knee cancer, is more sensitive than conventional CA19-9, and has the same strength as the Lewis antigen (a— , b +) It can be used as a tumor marker for detecting knee cancer that can be detected in patients.

[0020] Therefore, based on the above results, a specific protein was purified from serum to identify a protein that is expected to be a marker for detecting knee cancer. This specific protein was purified through examination of optimum pH (pi) and optimum salt (NaCl) concentration.

[0021] First, in urea buffer! /, Gradually increase the pH to 4.5, 5. 0, 5. 5, 6.0, and the peak of 6630 Da is optimal. The pH, that is, the most suitable pH for isolation and purification, was examined. As a result, peak had the highest strength under the condition of pH 4.5. Next, the salt concentration was increased stepwise to 0, 50, 100, 150, 200, 300, 400, and 500 mM, and then the salt concentration at which the peak of 6630 Da began to decrease was investigated. As a result, peak did not begin to fall even when the salt concentration was increased to 500 mM.

[0022] Based on the above optimum conditions, FPLC was performed, and a high peak FPLC fraction was applied to HPLC. The conditions of FPLC are to make a fraction of NaCl separated by 15 mM, 165mM ~: SELDI-TOF-MS analysis was performed with NP 20 chip using fraction every 30mM to LOOOmM. The HPLC conditions were linear-gradient with Buffer; 0.1% (A) to 80% (B) acetonitrile, flow rate: 200 1 / min, and C-18 was used as the separation column. The purified target protein was analyzed by analyzing the amino acid residues up to the 15th amino acid residue using the N-terminal amino acid sequence. As a result, the 6proteins of 6630 Da each were mature Apolipoprotein C-1 (57 amino acids) (mature ApoC-1 protein), 6 The body of 420Da was found to be Apolipoprotein C-1 (55 amino acids) with two mature N-terminal amino acids deleted. The results are shown in Figs. That is, it was found that the protein that can be used as a tumor marker for detecting splenic cancer is ApoC-1 protein.

[0023] Next, by examining the relationship between the serum level of this protein and clinicopathological factors and survival time, it was examined whether there was a correlation between this protein and the malignancy of splenic cancer. The median preoperative value of peak intensity data obtained by analysis with the ApoC-1 protein protein chip system (see Fig. 2) is divided into two groups, the serum ApoC-1 high value group and the low value group. Statistical analysis between groups using the Kaplan-Meier method revealed that patients with high ApoC-1 blood levels had no reoccurrence (P = 0. 0011; Logrank) and survival (p = 0. 006 ² ; Logrank) was found to be significantly shorter (see FIG. 10).

[0024] As described above, a tumor marker for detecting splenic cancer with a higher positive rate of early splenic cancer and a knee cancer detection kit using the same can be realized by using the tumor marker for detecting spleen cancer. Furthermore, the value of this tumor marker is related to the patient's survival time, and is closely related to the malignancy of the knee cancer.Therefore, there is a possibility that it can be a prognostic index. Has no features. A small amount of patient serum is sufficient for the practice of the present invention and can be stored at -30 ° C and measured at any time. Therefore, by using the protein chip method and its chip, more preferably WCX2 (cation exchange chip), spleen cancer can be detected positively even in early stage I where the positive rate is high. A preferable condition for detecting ApoC-1 as a tumor marker for detecting spleen cancer is pH 3 or more and 7 or less, more preferably pH 6 or more and 7 or less.

[0025] It should be noted that Apolipoprotein C-1 is also present in the serum of healthy individuals. It is involved in lipid metabolism and is abundant in chylomicron and VLDL, which are triglyceride transfer lipoproteins. It is synthesized in the rough endoplasmic reticulum of the liver, and the average blood concentration is said to be about 6 mg / dl. ApoC—1 has many lipid-related functions compared to other apolipoproteins. (1) It changes the form of ΑροΕ protein and binds LDL receptor (LDLR) or LDLR related protein to lipoproteins. It is suggested that it inhibits, and (2) has the function of promoting LCAT activity. ”(The interaction or human apolipoprotein

with sub— micellar phospholipid. Benjamin W.

(Atcliffe et al. Eur. J. Biochem. 2001; 268: 2838-2846.)

[0026] Recently, the association of ApoC-1 gene with cancer has been listed as one of nearly 100 candidates by large-scale gene cluster analysis, and it has been reported that its expression is enhanced particularly in splenic cancer tissues. (Byungwoo et al. Cancer Research 2002, 61 卷, pp. 1833-1838), the differences in gene expression between normal and cancerous organs in the National Cancer Institute database (http: // cgap.nci.nih.gov/ bAGE / Viewer

It is registered in. These facts indicate that ApoC-1 is very likely to be a tumor marker for detecting spleen cancer. In addition, the expression of spleen cancer is enhanced as a cause of increased ApoC-1 levels in the serum of knee cancer patients. If it is observed not only at the gene level but also at the protein level, the credibility as a spleen cancer-specific marker will be further shaken. Therefore, the present inventor used frozen specimens of cancerous and non-cancerous parts of splenic cancer obtained from surgical specimens to confirm whether Apolipoprotein C-1 was actually expressed in splenic cancer tissues. Using spleen cancer tissue and normal knee tissue, 8 ~ 1 gene expression 1 ^-? ^? , Real-time RT—PCR and ApoC-1 protein expression by Western blot analysis, and ApoC-1 protein by immunostaining using formalin-fixed paraffin-embedded specimens of all 20 cases analyzed by protein chip analysis. Intratumoral localization was confirmed.

[0027] First, RT-PCR was performed to confirm the expression of ApoC-1 gene in spleen cancer tissues, normal spleen tissues, and spleen cancer cell lines. First, the frozen specimen tissue is crushed and RNeasy Mini

Kit (Qiagen, Tokyo,

Japan) to make total RNA, then T- Primed

First— Strand it cDNA was prepared using for reverse transcription—PCR (Amersham Bioscience, USA). Add cDNA to AmpliTaq

RT-PCR was performed using Gold PCR Master Mix (Biosystem, Foster City, CA) under conditions of 37 cycles and a final ring temperature of 58 ° C. The obtained PCR product was electrophoresed in 2% Agaro-Sugenole. As ApoC—lprimer Forward— primer, 5,-CTCCAGTGCCTTGGATAAGC

3,

Reverse -primer, 5, 1, TTGAGTTTCTCCTTCACTTTCTGA

Using the —3 ′ sequence, the length of the ApoC-lPCR product was designed to be 150 bp. As a result, the ApoC-1 gene was clearly expressed more strongly in the cancerous part than in the non-cancerous part. Figure 11 shows the result.

[0028] Next, cDNA was prepared in the same manner as described above using frozen specimens of 16 specimens of cancerous and non-cancerous parts of splenic cancer resected by surgery. Then, to quantify ApoC-1 mRNA levels, we used a LightCycler instrument and LightCycler—Fast Start DNA Master SYBR Green I kit and PCR amplifications (Roche Diagnostics, Tokyo, Japan). PCR was performed. In order to make the amount of mRNA between tissues the same, the mRNA value ratio of each GAPDH was calculated. As a result, in all specimens, the expression of Apo C1 gene was enhanced in the cancerous part compared to the non-cancerous part (p> 0.0001) (see Fig. 12), and cancerous and non-cancerous parts within the same individual 13 In the pair, the difference in the expression level was 252 times on average and 39.1 times on the median in the cancerous part compared with the non-cancerous part.

[0029] Further, among the above specimens, the cancer part and the non-cancer part are paired with the same individual strength. The median value was divided into two groups, the high value group and the low value group, and the correlation with the malignancy of spleen cancer was examined. The high value group had a significantly shorter survival time than the low value group, and the above-mentioned protein chip The results correlate with the relationship between ApoC-1 during the serum by the system and the survival of splenic cancer patients (see Figure 13). Incidentally, these 13 pairs of patients are different from the patient group used for protein chip system analysis.

[0030] Subsequently, cancerous and non-cancerous parts of spleen cancer tissue and four types of spleen cancer cell lines (MIA Western blotting was performed to confirm the ApoC-1 protein level of PaCaII, PanC-1, CFPAC-1, AsPC-1). Mouse-anti-human-Apolipoprotein C-1 monoclonal antibody (CHEMICON INTERNATIONAL) was used as the primary antibody. As a control mouth, goat anti-β-actin antibody (Santa Cruz) was used.

[0031] After extracting proteins from spleen cancer, normal spleen tissue, and cultured cells, each 20 / zg protein was applied and 10-20% and 15-25% gradient gels (DRC) were used. PAGE was performed. After that, it was transferred to a PVDF membrane (Millipore), non-specific reaction was blocked with 0.5% skim milk and anti-ApoC-1 antibody diluted 1: 500 was used as the primary antibody. As secondary antibody, Goat-antiMouse-IgG antibody (HRP) (Bio-Rad) diluted 1: 3000 was used. An ECL solution (Amersham Pharmacia Biotech) was used as a color developing solution. As a result, ApoC-1 protein expression was not observed in normal spleen tissues, but was expressed in spleen cancer tissues. Furthermore, expression was confirmed in all four spleen cancer cell lines (see Fig. 14).

[0032] Next, immunohistological staining was performed on all 20 cases subjected to protein chip analysis this time, and the expression and localization of ApoC-1 protein expression in splenic cancer tissues were confirmed. Immunostaining was performed by the streptavidin-biotin peroxidase method (Dako LSAB2 kit, Dako Japan) using 10% formalin-fixed and paraffin-embedded tissue specimens. At that time, the dilution concentration of the anti-ApoC-1 antibody was 1: 100. As a result, it was confirmed that ApoC-1 protein was not expressed in the non-cancerous part, particularly in the normal knee canal, and was specifically expressed in the cytoplasm of splenic cancer in the cancerous part (see FIG. 15).

[0033] Based on the above, the present researchers were the first to demonstrate the expression of ApoC-1 gene and protein in spleen cancer tissues and spleen cancer cell lines. The existence was also clarified. The results of these studies indicate that ApoC-1 protein is closely related to spleen carcinogenesis, deviates into the blood as the expression level increases, and measures the concentration in the serum to measure sensitive and reliable knee cancer. This can greatly contribute to diagnosis. In addition, ApoC-1 protein can be used as an index of malignancy of knee cancer.

[0034] Next, in order to elucidate how ApoC-1 protein is actually involved in the carcinogenic effect of spleen cancer, four types of spleen cancer cell lines (MIA PaCaII, PanC-1, CFPAC-1, AsPC—1) SiRNA that specifically suppresses the ApoC-1 gene using RNAi (RNA interference) was transfected into cell lines and examined. In order to confirm whether the ApoC-1 gene was truly suppressed, Real-time RT-PCR was used to quantify the ApoC-1 RNA level, and the ApoC-1 protein level was examined by Western blot.

[0035] First, two types of siRNA for specifically suppressing ApoC-1 gene using RNAi were designed, and siRNA capable of suppressing ApoC-1 gene more effectively was selected. The sequence of this Oligonucleotide is shown below, Target sequence, siRNA-2; CTG GAG GAC AAG GCT CGG

GAA ₀

[0036] Here, Real-time RT-PCR and Western blot were performed in the same manner as described above. To investigate the effects of ApoC-1, which is specifically expressed in cancer cells, on canceration. Functional analysis of ApoC-1 in spleen cancer cell lines was performed by specifically suppressing the expression of ApoC-lmRNA by using RNAi.

[0037] First, a lOxlO ⁴ cells / ml cell suspension is prepared with a culture solution containing 10% FBS. 6-well plate the seeded cells by ^{2ml (20xl0 4 cells / well)} , confirmed by a microscope, to the goal of the next day 50% confluent. Incubate for 24 hours in a 37 ° C, 5% C02 incubator.

Then, after 24 hours, perform siRNA Transfection according to the following procedure.

1. Unzip Oligo

2. Transfection

Reagent adjustment

Lipofectamine2000 (Invitrogen

life

technologies) 6 μ 1 diluted with upti—MEM medium (GIB O, Invitrogen Corporation) 244 μ 1 and left at room temperature for 5 to 10 minutes

3. Oligo

Adjustment of dilution

20nM anniling Oligo 10 μ 1 <(200ηΜ

Final cone.) Adjust as appropriate according to the concentration> Dilute with Opti-MEM medium 240 μ 1 To do.

4. Transfection

Add Reagent 250 μ1 to oligo dilution and mix gently to make a total of 500 μ1. Let stand at room temperature for 15 to 20 minutes.

5. Set Opti-MEM to 50 to 1 month total 1000.

6. Aspirate the plate culture and wash with 2 ml of Opti-MEM medium.

7.5 Transfection

Sprinkle the mixture onto the cells.

8. After culturing at 37 ° C in a 5% C02 incubator for 4 hours, add FBS1501, DMEM350, and total 1500 µ1 (10% serum).

Thereafter, mRNA and protein are obtained from the cells using cell lysate as appropriate and used in subsequent experiments.

[0038] To confirm whether the ApoC-1 gene in the spleen cancer cell line is specifically suppressed by ApoC-IsiRNA, use the cDNA obtained by the above procedure. Real-time RT-PCR Went. As a result, about 90% gene suppression was observed in all four spleen cancer cell lines. Furthermore, when ApoC-1 protein level was examined by Western blot, it was confirmed that the expression level of the protein level 48 hours after transfection of ApoC-IsiRNA to Ml A PaCa II was lower than the final siRNA oligo concentration of 20 nM. (See Fig. 16).

[0039] Cell for the purpose of investigating the involvement of ApoC-1 cell proliferation in spleen cancer cell lines

7 with proliferation assay. In a 96-well microplate, 0.5xl0 ⁴ / lwell Itoda vesicles were incubated for 24 hours under conditions of 37 ° C and 5% CO, followed by specific ApoC—lsiRN

2

Mix A in the culture solution for transfection to a final concentration of 20 nM, change the culture solution after 4 hours, and incubate under the same conditions for cell culture. 24, 48, 72, 96, 120, 144 hours Later, Cel 1 proliferation assay was performed using Cell Counting Kit-8 [CCK-8] (DOJINDO JAPAN). Absorbance was measured at 450 nm, and the proliferation ability of cultured cells treated with specific ApoC IsiRNA was compared with cells treated with control siRNA. Cells treated with specific ApoC-IsiRNA were more cells than control cells. The results were obtained when the growth ability was significantly suppressed (see Fig. 17). As a negative control Non-silencing siRNA (Luciferase; GL2) (Qiagen, Japan) was used.

Brief Description of Drawings

FIG. 1 is a diagram showing a typical protein peak (mass 6000 to 7000 Da) of serum before and after splenic cancer surgery using a protein chip system. Top shows pre-operative results and bottom shows post-operative results.

FIG. 2 is a graph showing the results of examining the expression of a protein having a mass number of 6630 Da before and after surgery.

FIG. 3 is a diagram showing the results when the pH is changed in the analysis using the protein chip system.

[Fig. 4] A diagram showing the results when the NaCl concentration is changed stepwise from 0 mM to 500 mM in the analysis using the protein chip system!

FIG. 5 is a diagram showing the peak of HPLC.

[Fig. 6] Diagram showing the results of analysis using SELDI-TOF-MS for HPLC fraction with high peak.

FIG. 7 is a diagram showing the peak of the second HPLC.

[Fig. 8] A diagram showing the results of analysis using SELDI-TOF-MS for HPLC fraction with high peak.

FIG. 9 is a view showing the analysis results of the N-terminal amino acid sequence.

[Figure 10] Figure 2 Analysis of recurrence-free survival and survival by Kaplan-Meier method between two groups divided by the median peakintensity of ApoC-1 protein in preoperative serum obtained by protein chip system analysis .

[Fig. 11] RT-PCR study of ApoC-1 gene expression in spleen cancer tissue, normal spleen tissue, and spleen cancer cell lines.

[Fig. 12] A figure showing the quantification of ApoC-lmRNA by performing Real-time RT-PCR using frozen specimens of 16 cancerous and non-cancerous specimens of splenic cancer.

[Figure 13] Figure showing the correlation between malignancy and the median ApoC-lmRNA value when divided between two groups

FIG. 14 shows ApoC-1 protein expression confirmed by Western blotting in normal spleen and cancer tissues and four spleen cancer cell lines.

[Fig. 15] Immunohistochemical staining was performed. Expression of ApoC-1 protein expression in splenic cancer tissues and The figure which confirmed localization.

[FIG. 16] A diagram showing that the ApoC-1 gene of a 睥 cancer cell line was specifically suppressed by ApoC-IsiRNA and confirmed using Real-time RT-PCR and Western blotting.

FIG. 17: Cell proliferation assay of ApoC-1 involved in cell proliferation in spleen cancer cell lines.

Claims

The scope of the claims

[1] ApoC—A tumor marker for detecting splenic cancer that also has 1 protein.

[2] A spleen cancer detection kit containing a protein chip for detecting ApoC-1 protein under optimal conditions.

[3] The knee cancer detection kit according to claim 2, wherein the protein chip is used.