WO2006121208A1 - Polymorphismes de l’element de liaison de e2f-1 et procedes de determination de la sensibilite au cancer - Google Patents

Polymorphismes de l’element de liaison de e2f-1 et procedes de determination de la sensibilite au cancer Download PDF

Info

Publication number
WO2006121208A1
WO2006121208A1 PCT/JP2006/309887 JP2006309887W WO2006121208A1 WO 2006121208 A1 WO2006121208 A1 WO 2006121208A1 JP 2006309887 W JP2006309887 W JP 2006309887W WO 2006121208 A1 WO2006121208 A1 WO 2006121208A1
Authority
WO
WIPO (PCT)
Prior art keywords
znfn3a1
cancer
seq
binding
tandem repeat
Prior art date
Application number
PCT/JP2006/309887
Other languages
English (en)
Inventor
Yusuke Nakamura
Yoichi Furukawa
Shuichi Nakatsuru
Original Assignee
Oncotherapy Science, Inc.
The University Of Tokyo
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science, Inc., The University Of Tokyo filed Critical Oncotherapy Science, Inc.
Publication of WO2006121208A1 publication Critical patent/WO2006121208A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the field of cancer diagnostics. More particularly, the present method relates to the correlation between the number of tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene, particularly at positions -30 to -11 on the genome, and a subject's susceptibility for certain types of cancer.
  • Background Art
  • Cancer is a leading cause of death in industrialized populations.
  • Breast cancer (BC) in particular, is the leading cause of death in women between the ages of 40 and 55.
  • BC breast cancer
  • liver, and colorectal cancers are particularly problematic.
  • HCC hepatocellular carcinoma
  • colorectal carcinoma is a leading cause of cancer deaths in developed countries.
  • Many patients have a diagnosis of pre-cancerous colon or rectal polyps before the onset of cancer. While many small colorectal polyps are benign, some types may progress to cancer.
  • the most widely used screening test for colorectal cancer is colonoscopy. This method is used to visualize a suspicious growth and/or take a tissue biopsy. Typically, the tissue biopsy is histologically examined and a diagnosis delivered based on the microscopic appearance of the biopsied cells. However, this method is limited in that it yields subjective results and can not be used for very early detection of pre-cancerous states.
  • ZNFN3A1 (also known as "SMYD3") is a gene whose over-expression is involved in - 0 ⁇
  • siRNAs of ZNFN3A1 and modulators of the methyl transferase activity of the ZNFN3A1 protein have been shown to be useful in the treatment of colorectal and hepatocellular carcinomas. See WO 2004/76623 and Hamamoto, R. et ah, (2004) Nat Cell Biol;6:731-40., incorporated by reference in their entirety.
  • the present invention relates to the discovery of a mechanism of induction of ZNFN3A1 and the further identification of ZNFN3A1 as a novel downstream target of the RB-E2F signal- transduction pathway.
  • the evidence demonstrating that elevated expression of ZNFN3A1 plays an important role in carcinogenesis of the colon, liver and breast prompted the present inventors to investigate a possible association of the variable nucleotide tandem repeat (VNTR) polymorphism with susceptibility to these cancers.
  • VNTR variable nucleotide tandem repeat
  • the tandem repeat unit sequence preferably consists of 5'-CCGCC-3' and the detection step preferably involves the detection of one or more tandem repeat unit alleles.
  • the subject may be either heterozygous or homozygous for the allele.
  • the cancer susceptibility factor can be used to identify subjects at risk for a number of types of cancer, including, but not limited to, colorectal cancer, hepatocellular carcinoma and breast cancer.
  • the present invention further provides a method for detecting in a subject a predisposition for over-expression of ZNFN3A1 gene, the method comprising the steps of:
  • step (b) associating the number detected in step (a) with an increased risk for over-expressing the ZNFN3 Al gene.
  • Preferred primer sets for use with the cancer susceptibility detection kit include:
  • an oligonucleotide comprising the nucleotide sequence of S'-AGACTCCATCTGCGCATGCTCTTGC-S' (SEQ ID NO: 25), and
  • an oligonucleotide comprising the nucleotide sequence of 5'-CTTTTCCACCTTCAGCGGCTCCATC-S' (SEQ ID NO: 26);
  • an oligonucleotide comprising the nucleotide sequence of 5'-CGCCTGTCTTCTGCGCAGTCG-S' (SEQ ID NO: 32), and
  • an oligonucleotide comprising the nucleotide sequence of 5'-CACCTTCAGCGGCTCCATCCTC-S' (SEQ ID NO: 33).
  • the present invention further provides a cancer susceptibility detection kit including at least one probe for detecting tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome.
  • Preferred probes for use with the cancer susceptibility detection kit include:
  • a double-stranded oligonucleotide comprising the nucleotide sequences of: 5'-CGCCCGCCCCGCCCC-3' (forward; SEQ ID NO: 34), and 5'-GGGGCGGGGCGGGCG-S' (reverse; SEQ ID NO: 35); and
  • oligonucleotide comprising the nucleotide sequences of: 5'-CGCCCGCCCCGCCCCGCCCC-S' (forward; SEQ ID NO: 36), and 5'-GGGGCGGGGCGGGGCGGGCG-S' (reverse; SEQ ID NO: 37).
  • the present invention provides a method of screening a subject for cancer susceptibility, the method comprising the step of detecting in the subject or in a sample derived from the subject the presence of one or more tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome, wherein an occurrence of one or more tandem repeat units is diagnostic of a cancer susceptibility.
  • the present invention provides a method for identifying in a subject an increased risk of developing cancer, the method comprising the step of identifying in the subject or in a sample derived from the subject one or more tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome, wherein an occurrence of one or more tandem repeat units is associated with increased risk of developing cancer.
  • a final objective of the present invention is to provide a method of diagnosing cancer susceptibility in a subject comprising detecting in a nucleotide sample obtained from the subject the number of tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome, and diagnosing cancer susceptibility in the subject based on the detected number.
  • Figure 1 depicts the transcriptional activity in the 5' flanking region of ZNFN 3 Al .
  • Figure l(a) is a schematic presentation of reporter plasmids containing various lengths of the 5' flanking region of ZNFNSAl .
  • Figure l(b) depicts reporter activities of the plasmids in HepG2 (left panel) and SNU475 (right panel) cells. Reporter assays were carried out in triplicate at 24 h after transfection. Bars, SD. (*, P ⁇ 0.001 by a Fisher's protected least-significant test).
  • Figure 2 depicts a detailed promoter analysis of ZNFN 3 Al.
  • Figure 2(a) is a schematic presentation of additional reporter plasmids containing various lengths of the 5' flanking region of ZNFN 3 Al .
  • Figure 2(b) depicts reporter activities of the plasmids in HepG2 (left panel) and SMJ475 (right panel) cells. Reporter assay was carried out in triplicate at 24 h after transfection. Bars, SD. (*, PO.001 by a Fisher's protected least-significant test).
  • Figure 3 identifies putative E2F-1 binding sequences in the ZNFN3A1 promoter region, and involvement of E2F-1 in the induction of ZNFN 3 Al .
  • Figure 3 (a) is a schematic presentation of a putative Nrfl binding sequence and four putative E2F-1 binding sequences with three tandem repeats of "5'-CCGCC-3"' in the 5' flanking region of 2NFN3A1.
  • Reporter plasmids containing either wild type (ZNFN3A1-P#1 and pNwt) or mutant (ZNFN3A1-P#lmt and pNmt) E2F-1 binding sequences.
  • TSS Transcription Start Site.
  • Figure 3(b) depicts reporter activities of ZNFN3A1-P#1 and ZNFN3A1-P#lmt plasmids in SNU475 and SNU423 cells.
  • the assay was carried out in triplicate. ⁇ Bars, SD; *,/> ⁇ 0.001 by a Fisher's protected least-significant test).
  • Figure 3(c) Effect of exogenous E2F-1 on reporter activities of pNwt or pNmt in SNU475 (left) and HCTl 16 (right) cells.
  • the assay was carried out in triplicate. ⁇ Bars, SD; *,/7 ⁇ 0.001 by a Fisher's protected least-significant test).
  • Figure 4 depicts the positive correlation between E2F-1 and ZNFN3A1.
  • Figure 4(a) depicts the increase of ZNFN3A1 protein in response to exogenous E2F-1 by western blot analysis in SNU423 cells. Reporter activity was analyzed using pGL3b-ZNFN3AlP#13 plasmids. Bars, SD. (*, PO.001 by a Fisher's protected least-significant test).
  • Figure 4(b) depicts the reduced ZNFN3A1 expression in response to effective E2F-1 siRNAs in SNU475 cells. Anti- ⁇ actin antibody was used as a control.
  • Figure 5 depicts the accumulated ZNFN3A1 protein after association of E2F-1 with the putative E2F-1 binding sequences.
  • Figure 5(a) depicts the results of ChJP assays of the ZNFN3A1 promoter region in HCC-derived SNU475 and SNU423 cells. After each cell line was transfected with pcDNA-E2F-l, the ZNFN 3 Al product was immunoprecipitated with anti-HA, anti-Flag, or anti-E2F-l antibody, for subsequent amplification by PCR.
  • Figure 5(b) depicts ZNFN3A1 accumulated in HeLa cells expressing exogenous E2F-1, after transfection with pcDNA-E2F-l, fixation, and staining with anti-E2F-l or anti-ZNFN3Al antibodies. Nuclei were counter-stained with DAPI.
  • Figure 6 depicts the interaction of Nrfl to the putative binding sequence in the 5' flanking region of ZNFN 3 Al.
  • Figure 6(a) is a schematic presentation of PCR primers for the ChIP assay and the putative Nrfl -binding sequence.
  • Figure 6(b) depicts the results of Nrfl ChTP assay in SNU423 (left) and SNU475 (right) cells. DNA from SNU423 or SNU475 cells was immunoprecipitated with anti-HA, anti-Flag, or anti-Nrfl antibody, and amplified by PCR.
  • Figure 7 depicts the association between activity of ZNFN 3 'Al promoter and a polymorphism in the promoter region.
  • Figure 7(a) depicts the identification of a polymorphism, by sequence analysis of two or three tandem repeats of the E2F-1 binding elements, "5'- CCGCC-3'". (Upper panel, homozygous alleles of two-tandem repeats; lower panel, homozygous alleles of three-tandem repeats).
  • Figure 7(b) is a schematic presentation of reporter plasmids containing two or three tandem repeats of "5'-CCGCC-S'".
  • the resulting cancer susceptibility factor can be used to identify subjects at risk for a number of types of cancer.
  • preferable cancer is a cancer over-expressing ZNFN3 Al .
  • the cancer includes, but not limited to, colorectal cancer, hepatocellular carcinoma, and breast cancer.
  • the term "subject" refers to the animal being studied.
  • the subject is preferably a mammal, more preferably a human.
  • the sample derived from the subject includes any cell, tissue or fluid containing an amount of genome sufficient for evaluation. Exemplary samples include, but are not limited to, blood cells, biopsy tissue and bodily fluids, such lymphocytes, and the like.
  • the nucleotide occurrence of a polymorphism for example the VNTR polymorphism described herein, can be identified by direct sequencing of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome.
  • the nucleotide occurrence of a polymorphism can be identified using for example, an amplification reaction, a primer extension reaction, or hybridization with a probe. Specifically, the following methods are well known for identifying a polymorphism;
  • the nucleotide occurrence of the polymorphism can also be identified by contacting polynucleotides in the sample or polynucleotides derived from the sample, with a specific binding pair member that selectively hybridizes to a polynucleotide region comprising the nucleotide occurrence of a polymorphism, under conditions wherein the binding pair member specifically binds at or near the polymorphism.
  • the specific binding pair member can be a polynucleotide.
  • the nucleic acids are labeled with directly or indirectly detectable signals or means for amplifying a detectable signal. Examples include radiolabels, luminescent (e.g.
  • nucleic acid samples can be subject to purification, synthesis, modification, sequencing, recombination, incorporation into a variety of vectors, expression, transfection, administration or methods of use disclosed in standard manuals such as Molecular Cloning, A Laboratory Manual (2nd Ed., Sambrook, et al, Cold Spring Harbor), Current Protocols in Molecular Biology (Eds. Ausubel, et al, (1992) Greene Publ. Assoc, Wiley-Interscience, NY, N. Y.) or that are otherwise known in the art.
  • Particularly preferred methods for identifying the number of tandem repeat units of the E2F- 1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome, which number of repeat units has been found to be related to cancer susceptibility by the present inventors, include any methods that are known in the art to identify short tandem repeat polymorphisms.
  • Exemplary methods include, but are not limited to, those which utilize PCR and electrophoresis in combination like the single strand conformation polymorphism (SSCP) method (IizukaM, et al, (1992) Genomics.;12: 139-46; Mashiyama S, etal, (1991) Oncogene ;6: 1313-8; Iwahana H, et al, (1995) PCR Methods Appl.;4: 275-82; Humphries SE, et al, (1997) Clin.
  • SSCP single strand conformation polymorphism
  • the tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome are amplified by PCR and then subjected to electrophoresis. Thereby, the difference in the number of the tandem repeat units can be detected based on the difference in the size or the conformation of the amplified nucleotide fragments. Further, gel shift assay (electrophoretic mobility shift assay (EMSA)) as used in Example 4 may be utilized for the detection.
  • ESA epitrophoretic mobility shift assay
  • the polymorphism can also be identified using SNPs that has linkage disequiliblium with the polymorphism. Such SNPs can be screened by linkage analysis. Accordingly, in further embodiment, the present invention provides a method of detecting a cancer susceptibility factor in a subject, the method comprising the steps of:
  • step (b) associating the SNPs detected in step (a) with the presence of a cancer susceptibility factor.
  • ZNFN3 Al has been previously documented as a protein that functions as histone H3 lysine-4 (H3-K4)-specific di- and tri-methyltransferase in the presence of heat-shock protein 90 ⁇ (Hamamoto, R. et al, (2004) Nat Cell Biol;6:73lA0).
  • H3-K4 Methylation of H3-K4 is observed frequently in transcriptionally active regions of the human genome; tri-methylation of H3-K4 changes the chromatin structure, leading to transactivation of target genes (Boggs, BA., et al., (2002) Nat Genet;30:73-6, Litt, MD., et al., (2001) Science;293:2453-5, Schneider, R., et al., (2004) Nat Cell Biol;6:73-7 , Bernstein, BE., et al., (2002) Proc Natl Acad Sd t/S ⁇ ;99:8695- 700). It has also been observed that ZNFN3 Al formed a complex with HELZ, an RNA helicase, and RNA polymerase II, and directly interacted with a 5'-CCTCCC-3' binding motif.
  • ZNFN3 Al facilitates association with DNA-binding elements by changing chromatin structure, and increases the transcription of target genes by recruiting transcriptional complexes including RNA polymerase II (Hamamoto, R., et al., (2004) Nat Cell Biol;6:73 ⁇ -40). Accordingly, a total of 61 genes whose expression was up-regulated by ZNFN3 Al were identified. It was then discovered that ZNFN3A1 expression was markedly elevated in colorectal cancers (CRC) and hepatocellular carcinomas (HCC) (Hamamoto, R., et al., (2004) Nat Cell Biol;6:731-40). Moreover, in breast cancers (BC) (unpublished data), this up-regulation was demonstrated to enhance growth of the tumor cells.
  • CRC colorectal cancers
  • HCC hepatocellular carcinomas
  • Deregulation of the chromatin-modification mechanism is a feature of human carcinogenesis.
  • augmented expression ofZNFN3Al conferred a growth-promoting effect on cancer cells through its histone methyltransferase activity.
  • the present invention relates to the discovery that ZNFN3A1 is transcriptionally enhanced by E2F-1 through the interaction at the E2F-1 binding elements present in its 5' flanking region.
  • E2F-1 a member of E2F transcription factors (Bell, LA., et al., (2004) Cell Death Differ; ⁇ l: ⁇ 37-42), plays crucial roles in cell-cycle control, DNA synthesis, DNA repair, replication, and apoptosis through transcriptional activation of a number of downstream genes(Black, AR., et al., (1999) Ge «e;237:281-302, Stevaux, O., et al., (2002) Curr Opin Cell 5zo/;14:684-91, Phillips, A.C. et al., (2001) Apoptosis 6, 173-82).
  • E2F-1 Interaction of E2F-1 with the 'pocket' domain of the retinoblastoma tumor suppressor protein RB represses its transcriptional ability; however, during cell cycle progression from Gl to S phase, phosphorylation of RB by the cyclin-cdk complex releases E2F-1, resulting in augmented transcription of downstream genes such as cyclinE and cyclinDl (Dyson, N., (1998) Genes Dev; 12:2245-62, Harbour, JW., et al, (2000) Genes Dev; 14:2393-409).
  • VNTRs defined as highly polymorphic structures characterized by tandem repetition of short-sequence motifs (Nakamura, Y., et al, (1988) Am J Hum Genet;43: 854-9, Nakamura, Y., et al, (1998) J Hum Genet;43:U9-52, Nakamura, Y., et al, (1987) Science 235, 1616-22), are thought to play crucial roles in the regulation of transcription, stability of mRNA, and/or translational efficacy (Nakamura, Y. et al., (1998) J Hum Genet 43, 149-52).
  • Polymorphisms in tumor suppressor genes are often relevant to cancer susceptibility.
  • a polymorphism of codon 72 in the p53 gene confers a higher binding affinity to HPV- El 6, a protein implicated in susceptibility to cervical cancer (Zehbe, I. et al., (1999) Lancet;354:218-9).
  • APC allele I1307K has been reported as a risk factor for colorectal cancer in the Ashkenazi Jewish population(Stern, HS., et al., (2001) Gastroenterology; 120: 392-400); others have reported that a single-nucleotide polymorphism in the MDM2 promoter enhances expression of MDM2 by increasing its affinity for the transcription activator SpI, and that this polymorphism associates with accelerated tumor formation in hereditary and sporadic human cancers (Bond, G.L. et al., (2004) Ce//; 119:591-602).
  • the present invention also provides a method for detecting a predisposition for over-expression of ZNFN3A1 gene in a subject.
  • the method comprising the steps of:
  • step (b) associating the number detected in step (a) with an increased risk for over-expressing the ZNFN3A1 gene.
  • predisposition indicates a potential for over-expression of ZNFN3A1.
  • predisposition also refers that a subject being studied has at least one risk factor for the over-expression of ZNFN3A1.
  • ZNFN3A1 promotes carcinogenesis and cell proliferation of some types of cancer. Accordingly, it is useful to detect a predisposition for over-expression of ZNFN3A1 gene in a subject for prediction or estimation of malignancy of a cancer.
  • a risk for over-expression of ZNFN3A1 gene can be detected or estimated by the present invention.
  • the present invention provides a kit for detecting a predisposition for over-expression of ZNFN3A1 gene in a subject.
  • the kit comprising a primer set for synthesizing tandem repeat units of the E2F-1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome.
  • the kit of the present invention may include:
  • an oligonucleotide comprising the nucleotide sequence of 5 I -AGACTCCATCTGCGCATGCTCTTGC-3 1 (SEQ ID NO: 25), and
  • an oligonucleotide comprising the nucleotide sequence of 5 ,_ CTTTTCCACCTTCAGCGGCTCCATC 3I ⁇ SEQ ID N0. 2 ⁇ . mi ⁇
  • an oligonucleotide comprising the nucleotide sequence of 5'-CGCCTGTCTTCTGCGCAGTCG-3' (SEQ ID NO: 32), and
  • an oligonucleotide comprising the nucleotide sequence of 5 • -CACCTTCAGCGGCTCCATCCTC-3 I (SEQ ID NO: 33).
  • the kit may comprise a probe for detecting tandem repeat units of the E2F- 1 binding motif in the upstream region of ZNFN3A1 gene at positions -30 to -11 on the genome.
  • the kit of the present invention may include:
  • oligonucleotide comprising the nucleotide sequences of: 5'-CGCCCGCCCCGCCCC-3' (forward; SEQ ID NO: 34), and 5'-GGGGCGGGGCGGGCG-3 I (reverse; SEQ ID NO: 35); and
  • oligonucleotide comprising the nucleotide sequences of: 5'-CGCCCGCCCCGCCCCGCCCC-S' (forward; SEQ ID NO: 36), and 5'-GGGGCGGGGCGGGGCGGGCG-3 l (reverse; SEQ ID NO: 37).
  • kits of the present invention may include both the primer set and the probe described above. Further, the kits of the present invention may include a control for each polymorphism. For example, genomic DNA comprising specific polymorphism or cell sample derived therefrom are useful as the control, hi addition, a kit of the present invention may include other materials desirable from a commercial and user standpoint, including buffers, diluents, membranes, gels, filters, containers, and package inserts with instructions for use.
  • a human hepatoma cell line (HepG2), a human cervical-cancer line (HeLa), and a human colon-cancer line (HCTl 16) were obtained from the American Type Culture Collection (ATCC).
  • Two other human hepatocellular carcinoma cell lines, SNU423 and SNU475, were obtained from the Korean cell-line bank.
  • a breast-cancer cell line (MCF7) was obtained from the Cancer Institute of the Japanese Foundation for Cancer Research. All cells were grown in monolayers in appropriate media.
  • ZNFN3A1-P#1 — P#14 and, -P#C Reporter plasmids containing various lengths of sequence from the 5' flanking region of ZNFN3A1 were amplified using primers shown in Table 4 and cloned into pGL3 basic vector (Promega, Madison, Wisconsin, USA). Plasmids containing mutant E2F-1 binding sequences (ZNFN3A1-P#lmt) were prepared using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).
  • E2F-1 The coding region of E2F-1 was amplified by RT-PCR, and the products were cloned into pcDNA3.1 (Invitrogen, San Diego, CA) and pGEX-6P-3 vectors (Amersham Biosciences Corp., Piscataway, NJ).
  • R 5'-CCGCTCGAGCGAACTTTTCCACCTTCAGCGGCTC-S' 11 pGL3b-ZNFN3A1P#2 F: 5'-GGGGTACCGCTCCCTCCAGGCTTCTAGAAGCATC-S' 12
  • R 5'-CCGCTCGAGCGAACTTTTCCACCTTCAGCGGCTC-S' 11 pGL3b-ZNFN3A1P#3 F: S'-GGGGTACCCTCATGGAAGCATAACCACCTTCATG-S' 13
  • R ⁇ '-CCGCTCGAGCGAACTTTTCCACCTTCAGCGGCTC-S' 11 pGL3b-ZNFN3A1P#4 F: 5'-GGGGTACCAAAATACAAAAATTAGCCGGGCGTGG-S' 14
  • R 5'-CCGCTCGAGCGAACTTTTCCACCTTCAGCGGCTC-S' 11 pGL3b-ZNFN3A1P#9
  • F ⁇ '-GGGGTACCCGGAGCCTTACGACCACCTTCAG-S' 19
  • ZNFN3A1P#10 R 5 '- GGGGTACCAGACTCCATCTGCGCATGCTC ⁇ G - 3 ' 20
  • ZNFN3A1P#11 F 5 '- GGGGTACCCGGGCGTACGTGTGCGCGCAGG - 3 ' 21
  • ZNFN3A1P#14 5 ⁇ - GGGG TACCCGCGCCCGCCCCGCCCCTCG-3' 24 F: 5'-CCGCTCGAGCGAACTT ⁇ CCACCTTCAGCGGCTC-3' 1_
  • Reporter plasmids with or without E2F-1 binding sequences, were transfected into HCTl 16, SUN475, SUN423 and MCF7 cells using FuGENE ⁇ reagent according to the manufacturer's instructions (Roche, Basel, Switzerland).
  • the plasmid pRL-TK was co- transfected to normalize the transfection efficiency. Reporter activities were analyzed at 24 hours after transfection, using a Dual-Luciferase Reporter Assay System according to the supplier's protocol (Promega, Madison, WI).
  • SNU423 and SNU475 were cross-linked in 1% formaldehyde for 10 minutes.
  • DNAs from the fixed-chromatin cells were subjected to immunoprecipitation using a ChIP assay kit according to the manufacturer's recommendations (Promega) and anti-Flag, anti-HA, anti-E2F-l (KH95; Santa Cruz Biotechnology, Santa Cruz, CA) or anti-Nrfl antibodies.
  • the sets of primers used for ChIP assay are listed in Table 5.
  • HeLa cells transfected with five- ⁇ g of pcDNA3.1/E2F-l plasmids were fixed and stained with rabbit anti-ZNFN3 Al antibody or mouse anti-E2F-l antibody as a primary antibody, as described elsewhere(Okabe, H. et ah, (2003) Cancer i?e.s;63:3043-8.).
  • the antibodies were detected with an Alexa488-conjugated anti-rabbit antibody or an Alexa594-co ⁇ jugated anti- mouse antibody, respectively (Molecular Probes, Eugene, OR). Nuclei were counter-stained with 4', 6'-diamidino-2'-phenylindole (DAPI, Vector laboratories, Burlingame, CA).
  • Plasmids expressing E2F-1 siRNAs were prepared by cloning of double-stranded oligonucleotides into psiU6BX vector.
  • the plasmids were designed to express double-stranded RNA with hairpin loop.
  • the target sequences of the siRNAs corresponded to:
  • Cells transfected with or without different amount of plasmids expressing E2F-1 were immunoblotted with rabbit anti-ZNFN3Al antibody or mouse anti-E2F-l antibody.
  • tandem repeats polymorphisms in the promoter of ZNFN3A1 were genotyped on the basis of the length of each PCR product (177 or 182 bp), using GeneMapper ver3.5 (Applied Biosystems Japan, Tokyo, Japan). PCR experiments were performed with FAM-labeled primers (Table 6) using 10-ng aliquots of human genomic DNA from healthy volunteers and from patients with gastric, colorectal, liver or breast cancer that had been collected in BioBank Japan as part of the Japanese Project for Personalized Medicine. The genotypes were confirmed by sequence analyses using the primers listed in Table 6.
  • EMSA was carried out by incubating GST-E2F-1 with P-labelled oligonucleotide as previously described (Tang, CJ. et al, (2001) J Biol Chem;21 '6:19631-9). Sequences of the double stranded oligonucleotide probes are given in Table 7.
  • Example 11 Mechanism ofZNFN3Al Induction
  • the ZNFN3A1 gene was assigned at chromosomal band of Iq44 by the comparison of ZNFN3A1 cDNA sequence with human genome sequence. Gene amplification of this region had not been reported in colorectal carcinoma (CRC) or hepatocellular carcinoma (HCC).
  • CRC colorectal carcinoma
  • HCC hepatocellular carcinoma
  • Antisense 5'- TGA ACA GCA TTT TCC AAG GTG TC-3 1 3
  • Table 2 Quantitative genomic PCR of ZNFN3A1 and GAPDH, in HCC tissue and noncancerous liver tissue. Relative ratio of ZNFN3A1 PCR product in tumor tissue (T) to the product in corresponding non-cancerous tissue (N) was divided by the ratio of GAPDH. Two regions of ZNFN3A1 were investigated; one in the exon 1 and the other in the promoter region.
  • the 5' flanking region of ZNFN3A1 was examined for regulatory region(s). Specifically, an approximately 2-kb region (from -1982 to +124 of transcriptional starting site) in the 5' flanking region of this gene was amplified by PCR and the product was cloned upstream of a luciferase gene in pGL3 basic vector. In addition, a set of deletion constructs containing various length of the 5' flanking region were prepared as described above (Fig. Ia).
  • reporter plasmids or pGL3 basic mock vector (pGL3b-ZNFN3AlP#C) were transiently transfected into HepG2 or SNU475 cells, and luciferase activity was measured 24 h after transfection according to the assay described above. All activities were normalized by activity measurements from co-transfected pRL-TK Renilla luciferase plasmids. The normalized luciferase activity for each plasmid is shown in Fig. Ib. As a result, marked decrease of reporter activity was observed between pGL3b-ZNFN3AlP-#10 and pGL3b-ZNFN3AlP-#l 1 in both cell lines (Fig. Ib). These data indicate that the region between -64 to -11 of the 5' flanking region contained a crucial element for the transcriptional activation of the ZNFN3A1 promoter.
  • the promoter activity of ZNFN3A1 was further analyzed using reporter plasmids containing various length of the region (Fig. 2a).
  • a significant decrease in reporter activities was observed between pGL3b- ZNFN3A1P-#12 and pGL3b-ZNFN3AlP-#13, and between pGL3b-ZNFN3AlP-#14 and pGL3b-ZNFN3 A1P-#11 in both cell lines (Fig. 2b).
  • reporter plasmids were constructed as described above, one containing wild-type binding elements (ZNFN3A1-P#1), another a deleted form of reporter plasmids without the possible binding elements (ZNFN3A1-P#2), and a third comprising a mutated form containing substitutions in all of four binding elements (ZNFN3A1-P#lmt). These plasmids were transfected into SNU475 and SNU423 HCC cells for reporter assays.
  • ZNFN3A1-P#2 showed reporter activity approximately 7-fold lower than ZNFN3A1-P#1, and ZNFN3A1-P#lmt revealed approximately one-tenth of the activity of ZNFN3A1-P#1 in both cell lines (Fig. 3b), indicating that this motif is likely to be a target of E2F-1.
  • plasmids lacking the 5' UTR-region in ZNFN3A1-#1 or ZNFN3Al-#lmt (pNwt or pNmt, respectively), that harbored the putative E2F-binding element(s), were prepared as described above.
  • a chromatin immunoprecipitation (ChIP) assay was carried out using a set of PCR primers designed to amplify a genomic DNA region (-59 to +93) encompassing all four putative E2F-1 binding motifs.
  • protein-DNA complexes were immunoprecipitated with anti-HA, anti-Flag, and anti-E2F-l antibody from SNU423 or SNU475 cells that were transfected with pcDNA-E2F-l .
  • Nrfl recognizes and binds to the putative Nrfl -binding sequence of 5' flanking region of ZNFNS Al gene
  • ChoIP chromatin immunoprecipitation
  • VNTR variable nucleotide tandem repeat
  • homo2ygosity of the three-repeat allele of the GC patients (68.7%) was not significantly higher than that of the controls.
  • Homozygosity of the 3 -copy allele was associated with increased risk for CRC, HCC, and BC tumors, with respective odds ratios of 2.58, 3.50, and 4.48, but not with increased risk of gastric cancer.
  • the present inventors have found a significant correlation between an increased risk in developing certain cancers and polymorphism of the tandem repeats of the E2F-1 binding element in the ZNFN3A1 gene regulatory region. Specifically, alleles of three tandem repeat unites are shown to be present in a significantly higher frequency in patients with cancer. Furthermore, reporter assays show that a plasmid containing three repeats of the biding motif has higher transcriptional activity. These data suggest that polymorphism of the E2F-1 binding motif in ZNFN3 Al represents to a susceptibility factor for certain types of cancer.
  • Such a factor finds utility as a diagnostic marker, for identifying subjects at risk for developing cancer who, in turn, may avail themselves of both general and specific prophylactic measures, such as more frequent monitoring, as well as early stages cancer treatments.
  • therapies involving the suppression of the activity of ZNFN3A1 should benefit this high-risk group by preventing these types of tumors.
  • a risk or predisposition of over-expression of ZNFN3A1 gene can be detected by the analysis of the polymorphism.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La ZNFN3A1 régulée à la hausse, une histone méthyltransférase, est un promoteur critique de la croissance cellulaire dans une grande majorité des cancers humains colorectaux, du foie, et du sein. Ici, les régions régulatrices transcriptionnelles dans la région flanquante 5’ de ZNFN3A1 qui contient quatre motifs de liaison E2F-1 et un motif de liaison Nrf1 sont identifiées. En particulier, les données expérimentales décrites ici suggèrent que E2F-1 induit l’expression de ZNFN3A1 au moyen de l’activation transcriptionnelle à travers une liaison à la région du promoteur. De plus, une association significative entre une séquence de polymorphisme répété en tandem d’un nombre variable (VNTR) d’une unité CCGCC dans la région régulatrice du gène ZNFN3A1 et un risque accru de cancer colorectal (khi-carré = 17,86, p=3,8 x 10^-5, risque relatif approché = 2,20), carcinome hépatocellulaire (khi-carré = 25,39, p=4,7 x 10^-7, risque relatif approché = 2,74) et aussi le cancer du sein ( khi-carré = 38,91, p=3,4 x 10^-9, risque relatif approché = 3,79) a été découverte. On a montré que cette séquence répétée en tandem est un site de liaison pour le facteur transcriptionnel E2F-1 et le polymorphisme VNTR commun dans ZNFN3A1 est montré ici comme étant un facteur de sensibilité pour certains types de cancers humains.
PCT/JP2006/309887 2005-05-12 2006-05-11 Polymorphismes de l’element de liaison de e2f-1 et procedes de determination de la sensibilite au cancer WO2006121208A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US68111105P 2005-05-12 2005-05-12
US60/681,111 2005-05-12

Publications (1)

Publication Number Publication Date
WO2006121208A1 true WO2006121208A1 (fr) 2006-11-16

Family

ID=36699092

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/309887 WO2006121208A1 (fr) 2005-05-12 2006-05-11 Polymorphismes de l’element de liaison de e2f-1 et procedes de determination de la sensibilite au cancer

Country Status (1)

Country Link
WO (1) WO2006121208A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033904A2 (fr) * 1997-01-31 1998-08-06 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH Procede de preparation d'un oligonucleotide antisens
WO2002059377A2 (fr) * 2001-01-24 2002-08-01 Protein Design Labs Procedes de diagnostic du cancer du sein, compositions et procedes de criblage de modulateurs du cancer du sein
WO2003027143A2 (fr) * 2001-09-25 2003-04-03 Japan As Represented By The President Of The University Of Tokyo Gene et proteine lies au carcinome hepatocellulaire
WO2004076623A2 (fr) * 2003-02-28 2004-09-10 Oncotherapy Science, Inc. Compositions et methodes permettant d'inhiber la croissance cellulaire

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033904A2 (fr) * 1997-01-31 1998-08-06 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH Procede de preparation d'un oligonucleotide antisens
WO2002059377A2 (fr) * 2001-01-24 2002-08-01 Protein Design Labs Procedes de diagnostic du cancer du sein, compositions et procedes de criblage de modulateurs du cancer du sein
WO2003027143A2 (fr) * 2001-09-25 2003-04-03 Japan As Represented By The President Of The University Of Tokyo Gene et proteine lies au carcinome hepatocellulaire
US20040235018A1 (en) * 2001-09-25 2004-11-25 Yusuke Nakamura Gene and protein relating to hepatocellular carcinoma and methods of use thereof
WO2004076623A2 (fr) * 2003-02-28 2004-09-10 Oncotherapy Science, Inc. Compositions et methodes permettant d'inhiber la croissance cellulaire

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE DBSNP 13 November 2003 (2003-11-13), DBSNP-NCBI: "rs10672134", XP002393724, Database accession no. rs10672134 *
TSUGE M ET AL: "A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 5' flanking region of SMYD3 is a risk factor for human cancers", NATURE GENETICS, NEW YORK, NY, US, vol. 37, no. 10, 11 September 2005 (2005-09-11), pages 1104 - 1107, XP002385376, ISSN: 1061-4036 *

Similar Documents

Publication Publication Date Title
JP5843840B2 (ja) 新しい癌マーカー
EP2740742B1 (fr) Gène chimère de gène kif5b et de gène ret, et procédé de détermination de l'efficacité d'un traitement anticancéreux ciblant le gène chimère
Wang et al. LGALS3 promotes treatment resistance in glioblastoma and is associated with tumor risk and prognosis
DK3055429T3 (en) Procedure for the prognosis and treatment of metastatic bone cancer resulting from breast cancer
KR101872965B1 (ko) Ｃ―ｍａｆ를 이용하는 전립선암 전이의 진단, 예후 및 치료 방법
KR20150122731A (ko) 암 전이의 예후 및 치료 방법
JP2017538404A (ja) 癌を診断及び／又は観察するための循環無細胞ｒｎａの使用
WO2012040614A1 (fr) Compositions et méthodes de détection de métastases cancéreuses
CN103732759A (zh) 用于确定癌症对象之预后的方法和核酸
Roldán et al. Tumoral expression of BRCA1, estrogen receptor alpha and ID4 protein in patients with sporadic breast cancer
EP2633070B1 (fr) Nouveau marqueur du cancer du sein de sous type luminal b
Liu et al. Association between functional PSMD10 Rs111638916 variant regulated by MiR-505 and gastric cancer risk in a Chinese population
Grenda et al. Tissue microRNA expression as a predictor of response to immunotherapy in NSCLC patients
Ifere et al. Prostate cancer gene expression marker 1 (PCGEM1): a patented prostate-specific non-coding gene and regulator of prostate cancer progression
Lee et al. Long noncoding RNA HOTTIP overexpression: A potential prognostic biomarker in prostate cancer
US20110151443A1 (en) Marker for gastric cancer
KR20110015013A (ko) 결장직장암의 평가 방법 및 여기에 사용하기 위한 조성물
US20110159509A1 (en) Use of runx3 and mir-532-5p as cancer markers and therapeutic targets
Cavusoglu et al. Promoter methylation and expression changes of CDH1 and P16 genes in invasive breast cancer and adjacent normal breast tissue
Ma et al. BRIP1 variations analysis reveals their relative importance as genetic susceptibility factor for cervical cancer
WO2009068409A1 (fr) Procédé d'évaluation d'un pronostic et de prédiction d'une réponse thérapeutique à un traitement endocrinien
Landreville et al. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization
JP2014501496A (ja) 消化管間質腫瘍における臨床転帰のシグネチャーおよび消化管間質腫瘍の治療の方法
EP2716767A1 (fr) Procédé pour déterminer le pronostic du cancer du pancréas
WO2006121208A1 (fr) Polymorphismes de l’element de liaison de e2f-1 et procedes de determination de la sensibilite au cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06732636

Country of ref document: EP

Kind code of ref document: A1