WO2006104448A1 - Xylanase active en milieu alcalin et thermiquement stable - Google Patents

Xylanase active en milieu alcalin et thermiquement stable Download PDF

Info

Publication number
WO2006104448A1
WO2006104448A1 PCT/SE2006/000391 SE2006000391W WO2006104448A1 WO 2006104448 A1 WO2006104448 A1 WO 2006104448A1 SE 2006000391 W SE2006000391 W SE 2006000391W WO 2006104448 A1 WO2006104448 A1 WO 2006104448A1
Authority
WO
WIPO (PCT)
Prior art keywords
xylanase
activity
xylanase according
further characterized
enzyme
Prior art date
Application number
PCT/SE2006/000391
Other languages
English (en)
Inventor
Bo Mattiasson
Rajni Hatti-Kaul
Gashaw Mamo
Original Assignee
Forskarpatent I Syd Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forskarpatent I Syd Ab filed Critical Forskarpatent I Syd Ab
Publication of WO2006104448A1 publication Critical patent/WO2006104448A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/248—Xylanases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/189—Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K50/00—Feeding-stuffs specially adapted for particular animals
    • A23K50/70—Feeding-stuffs specially adapted for particular animals for birds
    • A23K50/75—Feeding-stuffs specially adapted for particular animals for birds for poultry
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38636—Preparations containing enzymes, e.g. protease or amylase containing enzymes other than protease, amylase, lipase, cellulase, oxidase or reductase
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
    • D21C5/00—Other processes for obtaining cellulose, e.g. cooking cotton linters ; Processes characterised by the choice of cellulose-containing starting materials
    • D21C5/005—Treatment of cellulose-containing material with microorganisms or enzymes
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
    • D21C9/00—After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
    • D21C9/001—Modification of pulp properties
    • D21C9/002—Modification of pulp properties by chemical means; preparation of dewatered pulp, e.g. in sheet or bulk form, containing special additives

Definitions

  • the present invention relates to a thermostable alkaline active xylanase, free from cellulase activity for use in industrial applications such as pulp treatment and recycling, detergent formulation, feed applications, separation of starch and gluten and waste management.
  • Xylan is a major component of hemicellulose, which is present in both hardwood and annual plants. It is known to be the second most abundant renewable resource in nature. It is a heteropolymer composed of ⁇ -1,4 linked D-xylose backbone and branches of arabinose, glucuronic acid, mannose or acetyl residues. Complete hydrolysis of xylan to these monomers usually requires the combined action of various enzymes such as endo- ⁇ - 1,4-xylanase, ⁇ -xylosidase, ⁇ -L-arabinofuranosidase, ⁇ -glucuronidase and acetylxylan esterase. These enzymes act together to convert xylan into its constituent sugars.
  • xylanases are crucial for xylan depolymerisation in that they randomly hydrolyze ⁇ -l,4-glycosidic bonds of xylan to produce xylo-oligosaccharides and xylose.
  • Xylanases have received growing attention during recent years because of application in pulp and paper industries (Subramaniyan S, and Prema P. Cellulase free xylanases from Bacillus and other microorganisms. FEMS Microbiol. Lett. 2000, 183, 1-7; Srinivasan MC, and ReIe MV. Microbial xylanases for pulp and paper industry. Curr. Sci. 1999, 77, 137- 142).
  • Pulp for paper and paperboard production is conventionally processed by kraft pulping.
  • free cellulose fibers are obtained by dissolving the cementing lignin in alkaline cooking liquor.
  • the resulting pulp contains residual lignin and lignin derivatives, which can be covalently attached to carbohydrate moieties and give undesirable brownish colour to the pulp.
  • the removal of this characteristic colouration involves a multistage bleaching process, which involves elemental chlorine. Although chlorine-based bleaching of pulp is effective, it results in chlorinated organic by-products which have highly persistent toxic and mutagenic effects. Because of the growing public concern about environment and strict legislations regarding pollution, the search for alternative ways to reduce or avoid the release of chlorogenic compounds with Kraft mill bleaching effluent has been promoted.
  • thermostable alkaline xylanases are optimally active in the acidic or neutral pH range, and at or below 60 0 C. Relatively few microorganisms produce xylanases which are optimally active either at elevated temperatures or alkaline conditions. Xylanases which are optimally active and stable both at elevated temperature and pH are rare (Gessesse A. Purification and properties of two thermostable alkaline xylanases from an alkaliphilic Bacillus sp., Appl. Environ. Microbiol. 1998, 64, 3533-3535). Since the incoming pulp for enzymatic bleaching is hot and alkaline, the use of thermostable alkaline xylanases is very attractive from an economical and technical point of view.
  • Xylanase preparations produced for pulp treatment are often accompanied by cellulase activity which may result in poor fiber mechanical strength.
  • Some initial approaches for overcoming cellulase activity included treatment with mercurial compounds which selectively inhibits cellulase or cloning with selective expression of xylanase genes.
  • the most practical approach is screening for naturally occurring strains that are capable of secreting cellulase-free xylanases.
  • the search for novel xylanases for pulp and paper industries has continued and resulted in the present invention.
  • the search for cellulase-free xylanases from diverse microbial strains that are active under high alkaline pH conditions having high temperature stabilities has resulted in a xylanolytic alkaliphilic Bacillus strain isolated from a soda lake in Ethiopia.
  • the properties of the xylanase produced by this organism, for use especially in pulp treatment, but also other industrial applications are very attractive from an economical and technical point of view.
  • Enzymes such as proteases, cellulases, lipases and amylases have been incorporated in detergent formulations to increase the efficiency of cleaning. Addition of xylanase to detergents promotes the removal of stains of plant origin (WO9839403 to Herbots et al.; WO9839402) to Herbots et al.).
  • Xylanase in combination with ⁇ -glucanase and cellulase effectively increases the yield of starch and gluten in the separation process (WO0200911).
  • Enzymes such as xylanase are used to get value added products from wastes such as agricultural residues.
  • Xylanases have been used in processes such as the release of fermentable sugars for the production of fuel ethanol (Leathers, T. D. (2002) FEMS Yeast Research 3:133-140) and the release of xylose from xylan for xylitol production (Tada, K,, et al. (2004) Journal of Bioscience and Bioengineering 98(3): 228-230).
  • the present invention relates to a isolated xylanase characterized by having activity at a pH-range of 5-12, at temperatures of above 50 0 C to 85 °C, with a capacity of hydrolyzing birchwood xylan, and being free from cellulase activity and a cellulose binding domain.
  • the xylanase is obtained from a strain belonging to the genus Bacillus.
  • the xylanase is obtained from a strain of Bacillus halodurans.
  • the xylanase is obtained from Bacillus halodurans S7.
  • the xylanase has the nucleotide sequence as AY687345.
  • the xylanase has over 80 % peak activity between pH 6 and 10.5.
  • the xylanase has over 80 % peak activity between pH 8 and 10.5.
  • the xylanase has over 80 % peak activity between temperatures of 65 °C to 82 0 C.
  • the xylanase has full activity for 12 h from pH 5.5 to 10.5 at 50 0 C.
  • the xylanase is optimally active at 75 0 C and 70 °C at pH 9 and 10, respectively.
  • the xylanase has no detectable activity with the substrates CMC, avicel, laminarin, p-nitrophenyl (pNP)- ⁇ -galactopyranoside, pNP- ⁇ -glucopyranoside, pNP- ⁇ -xylopyranoside, pNP- ⁇ -L-arabinofuranoside, pNP- acetate or pNP- ⁇ -D-xylopyranoside.
  • the xylanase has no binding domain to avicel or xylan.
  • the xylanase is sensitive to Mn 2+ - ions. In a preferred embodiment of the invention the xylanase is insensitive to Hg 2+ -ions.
  • the xylanase is insensitive to EDTA.
  • the xylanase is used in pulp treatment.
  • the xylanase is used as a detergent component for cleaning fruit and vegetable soils and grass stains.
  • the xylanase is used for deinking during paper recycling.
  • the xylanase is used for waste management.
  • the xylanase is used as a feed supplement.
  • the xylanase is used for separation of gluten from starch.
  • the Bacillus isolate S7 from an Ethiopian soda lake is aerobic, motile, rod-shaped, catalase-positive and endospore-forming.
  • the xylanase was purified from the culture supernatant of the Bacillus isolate S7 following the steps indicated in Table 1.
  • a DNA fragment (2155 nucleotide-long) containing the xylanase encoding gene of B. halodurans S7 was PCR amplified using a pair of primers SEQ ID No. 1 (XyIAF- GGCATAGAGCATGTATTTAG and SEQ ID No. 2 XyIAR-GGCCTAATTGAATGTTGG). Sequence analysis of the fragment has shown that it contains an open reading frame of 1188 nucleotides, encoding 396 amino acids. A consensus ribosome binding site (AGGAG) has been identified 8 nucleotides up stream of the translation initiation codon ATG.
  • the potential promoter regions which can be recognised by ⁇ 43 , the -10 (TATAAT) and -35 (GGATCA) elements are located upstream of the ribosome binding site from nucleotide position 139 to 168.
  • a 13-base inverted repeat sequence, SEQ ID No. 3 (AATAAACTTAGTTtgttcactggatcAACTAAGTTTATT) is located 5 nucleotides upstream of the -10 promoter.
  • the inverted repeat sequence SEQ ID No. 4 (AGCTGCCTcaaaggtctatcttttaAGGCAGCT) located between the positions 70 and 103 downstream of the stop codon TAA might serve as transcription terminator.
  • the translated protein contains 396 amino acids of which the first 28 amino acids show high similarity to bacterial leader peptide. The remaining 368 amino acids, SEQ ID No. 5, form the mature peptide.
  • B. halodurans S7 xylanase Similarity searches were performed by comparing the deduced amino acid sequence of B. halodurans S7 xylanase with entries in GenBank and SWISS-PROT databases which disclosed that it contained a single domain with high homology to the family-10 xylanases. .
  • the B. halodurans S7 xylanase has shown the highest homologies, 99 and 97 % identities with XynlOA (Acc.No. AAQ83582) of B. firmus and xynlOA (Acc.No. D00087) of ⁇ . halodurans, respectively.
  • Xylanases of Bacillus sp. NG-27 (Acc.No. AAB70918), B.
  • stearothermophilus (Acc.No. CAA82319) and Clostridium stercorarium (Acc.No. CAD48313) have shown 75, 62 and 54 % identity with S. halodurans S7 xylanase, respectively.
  • a multiple sequence alignment analysis revealed the presence of insert amino acids between positions 146-164 in B. halodurans S7 xylanase as in other family-10 xylanases of B. firmus, B. halodurans C-125, Bacillus sp NG-27, B. stearothermophilus 1-6 and C. stercorarium (Fig. 2).
  • the high sequence homology and the insert amino acids show a close evolutionary relationship.
  • the enzymes are optimally active around 70-80 0 C (depending on the pH) and display a good degree of heat stability. These xylanases are optimally active at or above pH 6.5 and exhibit over 50 % of the optimum activity at pH 9. There is no information available so far if the insert amino acids have effect on alkaline activity and stability.
  • the expressed xylanase activity of B. halodurans S7 was detected in the cytoplasm, periplasm and cell free culture medium. The relative distribution of the enzyme in these locations varies with the age of the culture (Fig. 3). Although the extracellular xylanase activity had been increasing with the age of the culture, cytoplasmic xylanase activity remained higher than the extracellular level. This shows that expression of B, halodurans S7 xynlOA under pelB leader peptide resulted in only partial secretion of the translated protein. Analysis of an 18 h old culture revealed that about 39 % of the active xylanase was secreted to the medium while 51 % remained in the cytoplasm.
  • Bacillus halodurans S7 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH on 2005-03-14 according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and has the accession number: DSM 17179.
  • alkaline active xylanases in pulp delignification would allow direct enzymatic treatment of the alkaline pulp and avoids the cost incurring and time consuming steps of pH re-adjustment.
  • alkaline xylanases which are operationally stable at higher temperatures are more beneficial because of savings in cooling cost and time. Determination of the B. halodurans S7 xylanase enzyme activity at 70 0 C at pH values ranging from 4 to 12 showed the xylanase to be active in a wide pH range (Fig. 4) with over 80 % of the peak activity displayed between at pH 6.0 and 10.5, respectively.
  • the enzyme was fully stable from pH 5.5 to 10.5 at 50 0 C after 12 h of incubation (Fig. 5).
  • the enzyme was optimally active at 75 0 C and 70 0 C at pH 9 and 10, respectively (Fig. 6).
  • the thermal stability of the enzyme was determined at 60 0 C and 65 0 C at the same pH values.
  • the enzyme was fully stable after 4 h incubation at pH 9 while it retained about 45 % of the original activity at pH 10 (Fig. 7).
  • the enzyme retained over 60 % of its initial activity after 3 h at pH 9, but there was no detectable activity after 1 h at pH 10.
  • the present xylanase is able to operate under conditions close to those of most mills, i.e. high pH and temperature. So far, only few xylanases with an optimum temperature for activity exceeding 70 0 C at or above pH 9 have been reported (Gessesse A. Purification and properties of two thermostable alkaline xylanases from an alkaliphilic Bacillus sp. Appl. Environ. Microbiol. 1998, 64, 3533-3535). Due to better solubility of xylan under alkaline conditions, alkaline active xylanases may also find other potential applications in addition to pulp bleaching. In waste management programs xylanases can be used to hydrolyse xylan in industrial and municipal waste.
  • the substrate specificity of the enzyme was determined by performing the assay with different substrates.
  • the apparent Km and Vmax at 70 0 C and pH 10 on birchwood xylan were estimated to be 2.7 + 0.4 mg/ml and 598.9 ⁇ 35.9 ⁇ mol/min.mg.
  • many xylanases are known to have binding domains for cellulose or xylan, by way of which they bind to the surface of pulp fibers or reprecipitated xylan and may result in local bleaching. Moreover, the binding of such enzymes to cellulose fibers may lead to cellulose disruption.
  • xylooligosaccharides from xylan by S7 xylanase indicates that its mode of action is endotype.
  • xylobiose and xylotriose were the major end products of the hydrolysis. These sugars selectively favour the growth of Brevibacterium bacteria which are known to inhibit the growth of intestinal pathogens. So far, production of xylobiose and xylotriose has been tried using neutral xylanases.
  • the use of alkaline active xylanases may improve the yield due to high solubility of xylan in alkaline solutions.
  • a water suspension of furnish (or feed stock), primarily consisting of materials such as wood chips, are added to a reaction chamber known as digester, and is treated with chemicals to dissolve lignin. After delignification the brownish pulp is washed and ready for bleaching.
  • the furnish which can be virgin or secondary fiber, woody or nonwoody fiber, softwood or hardwood, or a mixture thereof is resuspended preferably to 10% pulp consistency.
  • the pH is adjusted preferably to 5-11, and the xylanase solution is added.
  • the xylanase dosage is preferably 1-10 U (1 U of xylanase equals the amount of enzyme which releases 1 ⁇ mol of reducing sugar (xylose) per minute) per gram of pulp.
  • the mixture is incubated at 70-75 0 C for 30-90 min.
  • the properties (i.e. the high temperature and high alkaline optimum) of the xylanase of this invention allow enzymatic treatment during the pulping process and/or right after the pulping process in the brownstock storage tower.
  • the pulp can be chemically bleached the conventional way.
  • the chemicals used in the bleaching process can include, but are not limited to hydrogen peroxide, oxygen, ozone, chlorine, chlorine dioxide, nitrogen dioxide, hypochlorites, etc. Those skilled in the art of pulp processing will understand that it may be necessary to optimize the conditions in the method described above, for each particular process to achieve optimal effect.
  • the Bacillus xylanase of this invention can be used in the deinking process.
  • the xylanase is preferably added in a range of 0.5-5 U/g of dry waste paper and incubated at 40 to 65 0 C. It can be used together with conventional chemical deinking chemicals or alone in a pure enzymatic process.
  • the type of deinking, the nature of paper furnish, the operating temperature, pulp consistency, treatment duration, the mixture and dose of enzymes, etc. affect the efficiency of deinking. Thus, it may be necessary to optimize these parameters for each particular recycling facility.
  • enzymatic treatment plays an important role in improving the properties of recycled pulp.
  • Recycled pulp has much lower drainage rate (rate of water removal during paper formation) which greatly slows down paper formation process.
  • improved drainage has been reported when the recycled pulp has been treated with xylanases and cellulases Moreover, xylanases are known to improve "enzyme beating" during conventional chemical deinking
  • Hydrolytic alkaline active enzymes such as proteases, cellulases, lipases and amylases have been incorporated in detergent formulations to increase the efficiency of cleaning.
  • Vegetable, fruit, grass, coffee, tea, and tobacco derived stains are known to be very difficult to solubilize and remove during washing.
  • Addition of xylanase to detergents promotes the removal of stains of plant origin.
  • the Bacillus halodurans xylanase of this invention is active and stable under high temperature and alkaline washing conditions and can be dosed from 0.0001% to 2% of the detergent composition weight.
  • Chicken feed containing grains like wheat and rye become too viscous and are difficult to be completely digested in the guts of chickens.
  • Addition of xylanase to the feed, with a dosage of 100-5000 U (depending on the feed ingredient) of xylanase per kg of any xylan containing feed decreases the viscosity of the gut contents and increases nutrient absorption and diffusion of pancreatic enzymes in the digesta hydrolysis. It also changes hemicellulose to sugars so that nutrients formerly trapped within the cell walls are released.
  • the chickens absorb more energy from less feed and grow better.
  • the barn is cleaner because the feed is more thoroughly digested resulting in drier and less sticky chicken waste.
  • thermostable xylanase as the feed processing and pasteurization involves a high temperature.
  • the xylanase of the present invention is stable at elevated temperatures and can digest the xylan component of the feed during preparation and storage.
  • Xylanase in combination with ⁇ -glucanase and cellulase effectively increases the yield of starch and gluten in the separation process.
  • a Bacillus halodurans S7 xylanase enzyme addition of 0.001-1% of the flour weight gives a good separation of gluten and starch depending on the botanical source.
  • the use of these enzymes proved to reduce water and energy consumption, and shorten processing time. It also decreases the pentosan fraction viscosity and cut down the cost of energy required for drying.
  • Enzymes are used to get value added products from wastes such as agricultural residues.
  • Xylanases alone or together with other hydrolytic enzymes can be used in the treatment of agricultural residues to release fermentable sugars for the production of fuel ethanol.
  • Xylose released from xylan by xylanases is also used for xylitol production.
  • Xylanase addition in the biological treatment process of xylan containing industrial or municipal waste could be attractive.
  • These applications require the use of enzymes which are resistant to various organic and inorganic substances and which are able to maintain their activity and stability in wider pH ranges, etc. Impurities, like metal ions in industrial wastes can potentially inhibit the activity of xylanases.
  • the activity of B is a catases which are resistant to various organic and inorganic substances and which are able to maintain their activity and stability in wider pH ranges, etc. Impurities, like metal ions in industrial wastes can potentially inhibit the activity of xylanases
  • halodurans S7 xylanase was not significantly inhibited by the presence of different metal ions or the chelating agent (EDTA). In this regard, the properties of Bacillus halodurans S7 xylanase are attractive. Due to impurities, xylanase inhibitors, and possible low mixing etc waste treatment need higher enzyme dose. It is advisable to add Bacillus halodurans S7 xylanase at a dose of more than 0.1% of the waste weight.
  • Fig. 1 SDS-PAGE of the purified xylanase. Lane A: purified protein, Lane B: protein molecular weight markers.
  • Fig. 2 Part of an alignment of amino acid sequences of family 10 xylanases corresponding to positions 146 and 164 of Bacillus halodurans C-125 xylanase (D0087). The accession number for each amino acid sequence is indicated in bracket.
  • Fig. 3 Growth and xylanase production by recombinant E. coli cells expressing the B. halodurans S7 xylanase gene.
  • the symbols indicate: ( ⁇ ) OD 600 of uninduced culture, ( ⁇ ) ODsoo of induced culture, ( ⁇ ) xylanase activity of uninduced culture and (D) xylanase activity of induced culture.
  • the enzyme was incubated at 70 °C with 1 % (w/v) birchwood xyian dissolved in 50 mM sodium acetate (•), sodium phosphate ( ⁇ ), Tris-HCI ( ⁇ ) and Glycine-NaOH ( ⁇ ). About 0.5 U of the xylanase activity was taken as 100 %.
  • Fig. 5 The pH stability of Bacillus halodurans S7 xylanase.
  • the enzyme was incubated with 50 mM buffers at 50 0 C for 12 h and residual activity measured under the standard assay conditions.
  • the buffers used were sodium acetate (4-5.5), sodium phosphate (6-7.5), Tris- HCI (8 &. 8.5) and glycine- NaOH (9-12).
  • Fig. 6 Effect of temperature on Bacillus halodurans S7 xylanase activity.
  • the enzyme activity was determined by incubating the enzyme with 1 % (w/v) birchwood xylan dissolved in 50 mM glycine-NaOH buffer, pH 9 (•) or 10 ( ⁇ ). About 0.4 U of the xylanase activity was taken as 100%.
  • Fig. 7 Thermal stability of Bacillus halodurans S7 xylanase at pH 9 ( ⁇ ) and pH 10 ( ⁇ ) at 60 0 C, and at pH 9 (*), 65 °C.
  • a water sample from a soda lake (Shalla, Ethiopia) was added to a 250 ml Erlenmeyer flask containing 25 ml medium composed of (g/l): Bactopeptone (Difco), 5; Xylan (Sigma), 10; NaCI, 2; KH 2 PO 4 , 2; MgSO 4 , 0.1; CaCI 2 , 0.1; and Na 2 CO 3 , 10.
  • the latter was sterilised separately and added to the rest of the medium after cooling.
  • the inoculated medium was incubated at 37 0 C with shaking in an orbital incubator shaker.
  • the alkaliphilic B. halodurans S7 isolated in our laboratory was used as source of the gene encoding the xylanase (xynlOA).
  • Escherichia coli NovaBlue was used for cloning and E.coli BL21 (DE3) was used as expression host.
  • the plasmid used for cloning and expression was pET 22b(+). All the items were obtained from Novagen (Novagen Madison, WI, USA).
  • Genomic DNA extraction was performed following the method of Sambrook et al. (Sambrook J, Fritsch EF, and Maniatis T. Molecular cloning: a laboratory manual, 2 nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, NY, 1989). Plasmid DNA was purified from cells by alkaline lysis method. Plasmids and PCR products were recovered from agarose gel using Qiagen purification kit (Qiagen, Chatsworth, CA) following the manufacturer's instructions.
  • Qiagen purification kit Qiagen, Chatsworth, CA
  • a pair of primers, SEQ ID No. 1, XyIAF (GGCATAGAGCATGTATTTAG) and SEQ ID No. 2, XyIAR (GGCCTAATTGAATGTTGG) were designed based on the sequence of B. halodurans C-125 xylanase A gene and used to amplify the gene.
  • PCR amplification was for 30 cycles of 1 min at 95 0 C, 1.5 min at 55 0 C and 4 min at 70 0 C using a blend of Pfu and Taq polymerases (Promega). Additional extension was carried out for 7 min at 72 0 C and the product was purified using Qiagen PCR purification kit.
  • the purified product was sequenced in both directions with the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, USA) following the manufacturer's protocol. Sequencing reactions were electrophoresed using ABI 3100 DNA sequencer. The nucleotide sequence of xynlOA has been deposited in Gene Bank under the accession number AY687345. Has this sequence been deposited according to the Budapest convention, and if so at what date?
  • the xylanase gene sequence was compared to other xylanase sequences available in public databases using the BLAST algorithm (Altschhul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J MoI Biol 215: 403-410).
  • CLUSTAL W program (Thompson 3D, Higgins DG, Gibson, TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence weighing, position-specific gap penalties and weight matrix choice. Nuclic Acids Res 76: 4350-4354) was used for multiple sequence alignment of amino acid sequences. Amino acid positions referred to in this paper are based on positions of B. halodurans C-125 xynlOA (Ace. No. D00087) starting from the first amino acid of the signal peptide.
  • the mature peptide coding region of the gene was amplified using primers, SEQ ID No. 6, AXNcoI (AATGTAGCCATGGCTCAAGGAGGACCACCAAAATC) and SEQ ID No. 7, AXXhoI (AGTAGCTACCTCGAGATCAATAATTCTCCAGTAAGC) which contain restriction sites for the enzymes Ncol and Xh o ⁇ , respectively.
  • the PCR product was purified, digested by the restriction enzymes (Ncol and Xho ⁇ ) and cloned in pET 22b(+) vector.
  • the constructed vector contains pelB leader peptide for possible secretion of the enzyme.
  • Leu-Glu-(His) 6 sequence was added before the stop codon for easy metal ion affinity purification of the expressed protein.
  • a single colony of recombinant vector harbouring Ecoli BL21 (DE3) cells was cultured overnight, which was then used to inoculate 100 ml of LB broth containing ampicillin (100 ⁇ g/ml) and incubated at 37 0 C and shaking rate of 200 rpm in an orbital shaker incubator.
  • OD optical density
  • IPTG IPTG was added to a final concentration of 1 mM. Samples were taken periodically to determine the culture OD and xylanase activity.
  • Cytoplasmic, periplasmic and extracellular xylanase activity was determined as described in Novagen pET System manual (http://www.novagen.com). The extracellular activity is determined from the cell free culture supernanatnt obtained after centrifugation. The pellet was resuspended in 30 mM Tris-HCI pH 8 buffer containing 20% of sucrose and then EDTA was added to a final concentration of 1 mM. After gentle shaking at room temperature for 10 min, cells were harvested by centrifugation at 4 0 C. Cells were subjected to osmotic shock by resuspending in ice cold 5 mM MgSO 4 and shaken for 10 min on ice.
  • periplasmic xylanase activity was determined from the cell free supernatant. The remaining pellet was resuspended and the cytoplasmic content was released by sonication. Cytoplasmic xylanase activity was measured from the clarified lysate of sonicated cells after centrifugation.
  • Immobilized metal ion affinity chromatography was used to purify the recombinant xylanase.
  • Iminodiacetic acid gel was prepared by covalently binding iminodiacetic acid to epoxy activated Sepharose CL-6B. Cu 2+ was coupled to the gel, packed in a column and washed extensively with water. After passing 5 volumes of 50 mM imidazole through it, the column was washed with 5 volumes of water and then equilibrated with at least 5 volumes of binding buffer (20 mM Tris-HCI, pH 7.4 containing 20 mM imidazole and 0.5 M NaCI). The clarified cell homogenate was loaded on the equilibrated IMAC column and then unbound protein was washed off with binding buffer.
  • the bound protein was eluted in a linear gradient of 20-250 mM imidazole in 20 mM Tris-HCI (pH 7.4)/ 0.5 M NaCI. The purity of the eluted protein was checked on SDS-PAGE (10 % (w/v) gel).
  • Fractions exhibiting xylanolytic activity were pooled and concentrated.
  • the concentrate was fractionated using Sephadex G-75 column at a flow rate of 10 ml/h.
  • Xylanolytic fractions were pooled, concentrated and refractionated on the same G-75 column at a flow rate of 5 ml/h.
  • the enzyme obtained after the second gel filtration was used for characterization.
  • the homogeneity of the purified enzyme was checked by Sodium dodecyl sulfate- polyacrylamide gel electrophoresis, using 10 % polyacrylamide gel (Laemmli, UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970, 227, 680-685). Protein bands were developed by silver staining (Oakley BR 7 Kirsch DR, and Morris NR. A simplified ultrasensitive stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 1980, 105, 361-363).
  • the isoelectric point of the purified protein was determined by Rotofor using broad range ampholytes (Bio-Rad Laboratories, Hercules, CA 94547). Dialysed, (NH 4 ) 2 SO 4 precipitated protein was subjected to isoelectric focusing after addition of ampholytes (IEF 3-10). The pH and xylanase activity of each fraction were determined.
  • Protein concentration was determined following bicinchoninc acid method using bovine serum albumin as standard (Smith PK 1 Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, and Klenk DC. Measurement of protein using bicinchoninc acid. Anal. Biochem. 1985, 150, 76-85).
  • the enzyme activity was determined based on the release of reducing sugar from xylan using the dinitrosalicylic acid (DNS) method (Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 1959, 31, 426-428).
  • DNS dinitrosalicylic acid
  • a mixture of appropriately diluted enzyme and 1 % (w/v) birchwood xylan dissolved in 50 mM Glycine- NaOH buffer, pH 10 was incubated at 70 0 C for 10 min and then the reaction was stopped by adding DNS reagent.
  • One unit of the xylanase activity was defined as the amount of enzyme that releases 1 ⁇ mol of reducing sugar equivalent to xylose per minute under the assay condition.
  • the kinetic properties of the enzyme were determined using birchwood xylan at a concentration range of 0.5-10 mg/ml.
  • the apparent Km and Vmax values were calculated using EnzFitter program version 2.0.14.0 (Biosoft).
  • Binding of the purified enzyme to Avicel and insoluble xylan was determined in pH 7 (Phosphate), 8 (Tris-HCI), 9 and 10 (Glycine-NaOH) buffers at 5 and 25 0 C.
  • Insoluble xylan was prepared by the method of Irwin et al (Irwin D, Jung ED, and Wilson DB. Characterization and sequence of a Thermomonospora fusca xylanase. Appl. Environ, Microbiol. 1994, 60, 763-770).
  • Enzyme (10 U) was mixed with 0.5 g of avicel or insoluble xylan suspended in 10 ml buffer. After 2 h of gentle shaking, the preparation was centrifuged at low speed (lOOOxg) for 10 min and activity in the supernatant was determined. Loss of activity in the supernatant was assumed to be due to binding to the substrate.
  • the purified xylanase was mixed with 3 % (w/v) xylan in 50 mM GIy-NaOH buffer, pH 10 and incubated at 60 0 C. Samples were taken out at different time intervals and analysed by high performance thin layer chromatography (HPTLC). Samples (8 ⁇ l) were deposited on silica gel plates by CAMAG automatic sampler (CAMAG AT53, Switzerland). The plate was then developed in CAMAG Development Chamber (CAMAG ADC) in a solvent system butanol-ethanol-water (5:3:2) with two ascents. The plate was developed by dipping into 15 % (v/v) H 2 SO 4 and heating at 110 0 C until spots became visible. D-xylose, xylobiose, xylotriose, xylotetraose and xylopentose were used as standards.
  • CAMAG ADC CAMAG Development Chamber

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Husbandry (AREA)
  • Biomedical Technology (AREA)
  • Food Science & Technology (AREA)
  • Birds (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne une xylanase active en milieu alcalin et thermiquement stable, laquelle a été purifiée à partir d'un Bacillus halodurans S7 présentant une affinité pour des alcali, isolé à partir d'un lac salé dans la vallée éthiopienne du Rift. Le poids moléculaire et le pI de cette enzyme étaient autour de 43 kDa et de 4,5, respectivement. La température optimale pour son activité était de 75°C à pH 9 et de 70°C à pH 10. L'enzyme était stable sur une large plage de pH et présenta une bonne stabilité thermique lorsqu'elle fut incubée à 65°C dans un tampon à pH 9. L'activité de l'enzyme était fortement inhibée par Mn2+ avec une inhibition partielle en présence de 5 mM de Cu2+, de Co2+ et d'EDTA. L'inhibition par Hg2+ et le dithiothréitol n'était pas significative. L'enzyme ne présentait pas d'activité de cellulase. Les propriétés de la xylanase produite par cet organisme sont très intéressantes pour l'utiliser dans le traitement et le recyclage de pâte à papier, la formulation de détergents, des applications en alimentation, la séparation de l'amidon et du gluten et la gestion des déchets.
PCT/SE2006/000391 2005-03-30 2006-03-30 Xylanase active en milieu alcalin et thermiquement stable WO2006104448A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE0500707-5 2005-03-30
SE0500707A SE0500707L (sv) 2005-03-30 2005-03-30 Nytt Xylanas

Publications (1)

Publication Number Publication Date
WO2006104448A1 true WO2006104448A1 (fr) 2006-10-05

Family

ID=37053642

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2006/000391 WO2006104448A1 (fr) 2005-03-30 2006-03-30 Xylanase active en milieu alcalin et thermiquement stable

Country Status (2)

Country Link
SE (1) SE0500707L (fr)
WO (1) WO2006104448A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008095057A2 (fr) * 2007-01-31 2008-08-07 Novozymes A/S Anhydrases carboniques stables à la chaleur et leur utilisation
WO2012015452A1 (fr) * 2009-11-11 2012-02-02 International Paper Company Effet de xylanase à faible dose sur la pâte dans un procédé de traitement de blanchiment préalable
EP2468951A1 (fr) 2010-12-21 2012-06-27 Realco S.A. Procédé de traitement de matières cellulosiques
CN103437231A (zh) * 2013-08-30 2013-12-11 华南理工大学 一种碱性生物酶脱墨剂及其在废纸脱墨中的应用工艺
US9012186B2 (en) 2009-04-27 2015-04-21 The Board Of Trustees Of The University Of Illinois Hemicellulose-degrading enzymes
CN104807764A (zh) * 2015-04-21 2015-07-29 华南理工大学 碱性木聚糖酶活力测定的方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995018219A1 (fr) * 1993-12-24 1995-07-06 Gist-Brocades N.V. Xylanases supportant l'alcalinite

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995018219A1 (fr) * 1993-12-24 1995-07-06 Gist-Brocades N.V. Xylanases supportant l'alcalinite
US6140095A (en) * 1993-12-24 2000-10-31 Dsm N.V. Alkalitolerant xylanases

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CHANG P. ET AL.: "Cloning and characterization of two thermostable xylanases from an alkaliphilic Bacillus firmus", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 319, no. 3, 2 July 2004 (2004-07-02), pages 1017 - 1025, XP004512539 *
DATABASE UNIPROT [online] 1 April 1988 (1988-04-01), Database accession no. (P07528) *
DATABASE UNIPROT [online] 5 July 2004 (2004-07-05), Database accession no. (Q60892) *
DHILLON A. ET AL.: "Production of a thermostable alkali-tolerant xylanase from Bacillus circulans AB 16 grown on wheat straw", WORLD JOURNAL OF MICROBIOLOGY & BIOTECHNOLOGY, vol. 16, 2000, pages 325 - 327, XP003001363 *
HAMAMOTO T. ET AL.: "Nucleotide Sequence of the Xylanase A Gene of Alkalophilic Bacillus sp. Strain C-125", AGRIC. BIOL. CHEM., vol. 51, no. 3, 1987, pages 953 - 955, XP001021309 *
NISHIMOTO N. ET AL.: "A Kinetic Study on pH-Activity Relationship of XynA from Alkaliphilic Bacillus halodurans C-125 Using Aryl-Xylobiosides", JOURNAL OF BIOSCIENCE AND BIOENGINEERING, vol. 93, no. 4, 2002, pages 428 - 430, XP008044915 *
SUBRAMANIYAN S. ET AL.: "Cellulase-free xylanases from Bacillus and other microorganisms", FEMS MICROBIOLOGY, vol. 183, no. 1, 1 February 2000 (2000-02-01), pages 1 - 7, XP003001364 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008095057A2 (fr) * 2007-01-31 2008-08-07 Novozymes A/S Anhydrases carboniques stables à la chaleur et leur utilisation
WO2008095057A3 (fr) * 2007-01-31 2009-02-12 Novozymes As Anhydrases carboniques stables à la chaleur et leur utilisation
US7803575B2 (en) 2007-01-31 2010-09-28 Novozymes A/S Heat-stable carbonic anhydrases and their use
US7892814B2 (en) 2007-01-31 2011-02-22 Novozymes A/S Heat-stable carbonic anhydrases and their use
US8697428B2 (en) 2007-01-31 2014-04-15 Novozymes A/S Heat-stable carbonic anhydrases and their use
US9012186B2 (en) 2009-04-27 2015-04-21 The Board Of Trustees Of The University Of Illinois Hemicellulose-degrading enzymes
WO2012015452A1 (fr) * 2009-11-11 2012-02-02 International Paper Company Effet de xylanase à faible dose sur la pâte dans un procédé de traitement de blanchiment préalable
EP2468951A1 (fr) 2010-12-21 2012-06-27 Realco S.A. Procédé de traitement de matières cellulosiques
WO2012085088A1 (fr) 2010-12-21 2012-06-28 S.A. Realco Procede de traitement de matieres cellulosiques
CN103437231A (zh) * 2013-08-30 2013-12-11 华南理工大学 一种碱性生物酶脱墨剂及其在废纸脱墨中的应用工艺
CN104807764A (zh) * 2015-04-21 2015-07-29 华南理工大学 碱性木聚糖酶活力测定的方法

Also Published As

Publication number Publication date
SE0500707L (sv) 2006-10-01

Similar Documents

Publication Publication Date Title
Mamo et al. A thermostable alkaline active endo-β-1-4-xylanase from Bacillus halodurans S7: purification and characterization
Spilliaert et al. Cloning and Sequencing of a Rhodothermus marinus Gene, bglA, Coding for a Thermostable β‐Glucanase and its Expression in Escherichia coli
Rajeshwari et al. Role of an in planta-expressed xylanase of Xanthomonas oryzae pv. oryzae in promoting virulence on rice
CN101864406B (zh) 内切-β-1,4-葡聚糖酶
Ruiz-Arribas et al. Overproduction, purification, and biochemical characterization of a xylanase (Xys1) from Streptomyces halstedii JM8
Lüthi et al. Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a beta-mannanase from the extremely thermophilic bacterium" Caldocellum saccharolyticum"
Gibbs et al. Cloning, sequencing, and expression of a xylanase gene from the extreme thermophile Dictyoglomus thermophilum Rt46B. 1 and activity of the enzyme on fiber-bound substrate
AU690955B2 (en) Alkali-tolerant xylanases
Gat et al. Cloning and DNA sequence of the gene coding for Bacillus stearothermophilus T-6 xylanase
Dong et al. Molecular cloning, purification, and characterization of a novel, acidic, pH-stable endoglucanase from Martelella mediterranea
Zheng et al. Overexpression of a Paenibacillus campinasensis xylanase in Bacillus megaterium and its applications to biobleaching of cotton stalk pulp and saccharification of recycled paper sludge
Da Silva et al. Application of thermostable xylanases from Humicola sp. for pulp improvement
CN103409393A (zh) 一种α-L-阿拉伯呋喃糖苷酶，编码基因及其制备方法与应用
WO2006104448A1 (fr) Xylanase active en milieu alcalin et thermiquement stable
Bezalel et al. Characterization and delignification activity of a thermostable α-L-arabinofuranosidase from Bacillus stearothermophilus
HOU et al. Novel cold‐adaptive Penicillium strain fs010 secreting thermo‐labile xylanase isolated from yellow sea
US6300114B1 (en) Sequences of xylanase and xylanase expression vectors
FI118010B (fi) Actinomaduran ksylanaasisekvenssit ja käyttömenetelmät
Waeonukul et al. Cloning, sequencing, and expression of the gene encoding a multidomain endo-$\beta $-1, 4-xylanase from Paenibacillus curdlanolyticus B-6, and characterization of the recombinant enzyme
US5871730A (en) Thermostable xylanase DNA, protein and methods of use
Comlekcioglu et al. Application of recombinant xylanase from Orpinomyces sp. in elemental chlorine-free bleaching of kraft pulps
Montiel et al. Evaluation of an endo-β-mannanase produced by Streptomyces ipomoea CECT 3341 for the biobleaching of pine kraft pulps
Mamo et al. Cloning, sequence analysis, and expression of a gene encoding an endoxylanase from Bacillus halodurans S7
Georis et al. Sequence, overproduction and purification of the family 11 endo-β-1, 4-xylanase encoded by the xyl1 gene of Streptomyces sp. S38
JP2004261173A (ja) 嫌気性真菌から取り出された新規の組換えキシラナーゼ、ならびに関連配列、発現ベクター、および宿主

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06717071

Country of ref document: EP

Kind code of ref document: A1