WO2006094673A2 - Nexines de tri dans une intervention medicale de troubles neurologiques et/ou metaboliques - Google Patents

Nexines de tri dans une intervention medicale de troubles neurologiques et/ou metaboliques Download PDF

Info

Publication number
WO2006094673A2
WO2006094673A2 PCT/EP2006/001800 EP2006001800W WO2006094673A2 WO 2006094673 A2 WO2006094673 A2 WO 2006094673A2 EP 2006001800 W EP2006001800 W EP 2006001800W WO 2006094673 A2 WO2006094673 A2 WO 2006094673A2
Authority
WO
WIPO (PCT)
Prior art keywords
snx
polynucleotide
expression
polypeptide
app
Prior art date
Application number
PCT/EP2006/001800
Other languages
English (en)
Other versions
WO2006094673A3 (fr
Inventor
Stefan Lichtenthaler
Christian Haass
Stefanie Neumann
Susanne SCHÖBEL
Maren Hertweck
Ralf Baumeister
Original Assignee
Ludwig-Maximilians-Universität München
Albert-Ludwigs-Universität Freiburg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig-Maximilians-Universität München, Albert-Ludwigs-Universität Freiburg filed Critical Ludwig-Maximilians-Universität München
Publication of WO2006094673A2 publication Critical patent/WO2006094673A2/fr
Publication of WO2006094673A3 publication Critical patent/WO2006094673A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to a polynucleotide encoding a specific novel sorting nexin, namely SNX-B 8/30 and is also related to a polypeptide encoded by said polynucleotides.
  • the invention also relates to specific medical, pharmaceutical and scientific uses of said new member of a herein described sorting nexin (SNX) subgroup consisting of SNX-9, SNX- 18 and the herein described SNX-B8/30.
  • specific screening methods for agonists or antagonists influencing the function and/or expression of the SNX-B8/30 and/or the further members of the herein identified subfamily of sorting nexins Accordingly, the present invention also relates to novel pharmaceutical compositions.
  • compositions may, inter alia, be employed in the treatment of diseases/disorders related to (pathological) amyloid precursor protein APP metabolism and/or the insulin metabolism, like Alzheimer's disease or diabetes.
  • non-human transgenic animals comprising a modified and/or altered SNX-B8/30 or expressing a heterologous SNX-B8/30.
  • the Sorting Nexins are a large family of proteins that are defined by the presence of a SNX phox homology (PX) domain (SNX-PX), a subgroup of the PX domain superfamily. In all of those SNXs tested, the SNX-PX domains act as phosphoinositide-binding motifs that aid in the targeting of the SNX protein to phosphoinositide-enriched membranes.
  • the SNXs are a family of oligomeric proteins found distributed between membranes and cytosol, and they contain a variety of protein-protein and protein-lipid interaction domains in addition to their SNX-PX domain. To date, 29 mammalian SNXs and 10 yeast SNX, or SNX-like proteins have been identified, although for the majority of these, little is known of their function, as also summarized in Carlton (2005), Traffic 6, 75-82.
  • the binding specificity of the SNXs for phospholipids vary and binding occurs to different Ptdlns phosphates. It is difficult to determine the exact specificity as demonstrated by the fact that it depends on the assay used for the determination of binding to said PtdIns(P) (reviewed in Worby (2002), Nature reviews 3, 919-931).
  • Mammalian SNXl the original family member, was identified as a yeast two-hybrid partner for the core kinase domain and the lysosomal targeting sequence of the EGF receptor. SNXl was found to associate with the sorting endosome, from where it was proposed to enhance the degradative sorting of the EGFR through an unknown mechanism.
  • SNX2 shares 63% of sequence identity with SNXl. Both proteins oligomerize as homo- oligomers or hetero-oligomers.
  • mice that lack SNXl and/or SNX2 indicate that the SNXs are functionally redundant, due to the finding that the single-knockouts are viable and fertile, whereas the embryogenesis is arrested at midgestation in the double-knockout, providing a necessary function of SNXl and
  • SNX2 and SNX4 do not interact with the transferrin-receptor (TfR), which indicates different binding specifities and may be a hint on different cellular functions (Zhong
  • SNX3 lacks the C-terminal interaction domain, it is not able to interact with the other SNXs. Therefore it may restrict the function of other SNXs by binding to Ptdlns at crucial membrane sites (Haft (2000), MoI. Biol. Cell 11, 4105-4116).
  • SNX6 is involved in TGF- ⁇ signalling. At a functional level, overexpression of SNX6 inhibits TGF- ⁇ signalling. SNX6 hetero-oligomerizes with SNXl, SNX2 and SNX4 (Parks (2001), J. Biol. Chem. 276, 19332-19339).
  • SNX13 is so far the only SNX that interferes with signal transduction that is triggered by G- Protein-coupled-receptors (GPCRs). SNX13 stimulates the GTP-hydrolysis the Gas subunit, thereby modulating its activity.
  • GPCRs G- Protein-coupled-receptors
  • SNXl 3 inhibits the degradation of the EGFR, which is the opposite effect to that seen for the overexpression of SNXl (Zheng (2001), Science 294, 1939-1942).
  • SNXl 5 was isolated as a result of a database search using the PX-domain consensus sequence that was obtained from SNXl, SNX2, SNX3 and SNX4. Overexpression of SNXl 5 alters the morphology of several endosomal compartments, therefore it may be involved in the endocytotic pathway (Barr (2000), Traffic 1, 904-916).
  • SNX 17 was isolated on the basis of its ability to interact with P-selectin a cell-adhesion molecule. The function of that interaction remains elusive.
  • the membrane localization of SNXs ist not only a result of PX domain function.
  • the interaction of several SNXs (SNXl, -2, -4, -5, -6, -7, -8, -9 and -18) with membranes is also due to the Bin/Amphiphysin/Rvs (BAR) domain.
  • BAR Bin/Amphiphysin/Rvs
  • a further function of the BAR domain the may be a potential binding to small G-proteins (Habermann, (2004), EMBO Rep. 5, 250-255).
  • the SNX family of proteins is involved in intracellular trafficking and protein sorting along the endocytotic pathway and may integrate into cellular signalling pathways (Worby (2002), loc. cit).
  • SNX-15 was merely identified via database search as discussed above. Accordingly, the problem remains that means and methods have to be provided, where sorting nexins can be used for the medical and/or pharmaceutical benefit in particular in the intervention of human disorders.
  • the present invention relates to a polynucleotide selected from the group consisting of (a) a polynucleotide having a nucleotide sequence encoding the polypeptide having the deduced amino acid sequence as shown in SEQ ID NO: 2;
  • the present invention provides for the identification of a novel member of a subgroup of the sorting nexin family, namely the herein identified SNX-B8 also denoted as SNX-30.
  • this novel attributed sorting nexin activity is termed SNX-B8, SNX-30 and/or SNX-B8/3O.
  • SNX-B8 SNX-B 8/30 modified the ⁇ - and ⁇ -secretase cleavage of amyloid precursor protein (APP).
  • the ⁇ -secretase cleaves APP at the N-terminus of the A ⁇ -peptide domain, thereby catalyzing the first step in A ⁇ -peptide generation.
  • the ⁇ -secretase cleaves within the A ⁇ - sequence, and thus precludes the generation of the pathogenic A ⁇ -peptide.
  • a genome-wide expression cloning screen was carried out using a human brain cDNA library and identified a novel member of the sorting nexin family of proteins (SNX), the herein described SNX-B8.
  • SNXs are a large family of cytoplasmic and membrane bound proteins assumed to be involved in protein trafficking from and to the endosomes.
  • Western Blot analysis using cleavage site-specific antibodies revealed that transfection of SNX-B8 into HEK293 cells strongly stimulated the secretion of (soluble) APP, increasing mainly the ⁇ - secretase cleavage and only to a lower extent ⁇ -secretase cleavage.
  • SNX-B8 reduced the rate of APP endocytosis and increased the amount of mature APP in the cell lysate.
  • SNX-B8 is a phospho-protein.
  • SNX-B8 phosphorylation of SNX-B8 controls APP trafficking and shedding.
  • the shedding-stimulating effect of SNX-B8 is specific for APP.
  • SNX-B8 has little or no effect on the shedding of other membrane proteins undergoing an ⁇ -secretase like cleavage, such as TNF-receptor2 and L-selectin.
  • SNX-B8 is a novel modifier of the endocytic trafficking of APP, thereby controlling the amount of APP available for ⁇ - and ⁇ -secretase cleavage.
  • the appended examples document the surprising finding that SNX-B 8/30 is also involved in insulin signaling. It is shown SNX- B8/30 is essential in insulin signal transduction in vivo.
  • the present invention provides with SNX-B8/30 a potent modifier and/or modulator of the APP metabolism as well as the insulin signal transduction. Accordingly, the present invention provides for novel medical and/or pharmaceutical means and methods for the treatment of APP related disorders and/or disorders of the insulin-signaling pathway. Besides further examples given herein below, these disorders comprise, but are not limited to Alzheimer's disease and diabetes.
  • the present invention provides for a new biological function of a sorting nexin identified herein, namely the sorting nexin SNX-B8/30.
  • the function of said SNX-B8/SNX- 30 defined and characterized herein is basically that it effects the endocytotic machinery of a given cell and is, accordingly, involved in endocytotic processes, namely and even specifically of amyloid precursor proteins (APP), of insulin receptor (and accordingly of insulin) and of the transferrin receptor.
  • APP amyloid precursor proteins
  • insulin receptor and accordingly of insulin
  • SNX-B8/30 may be used to stimulate in an organism, preferably in a patient, more preferably in a human patient the ⁇ -cleavage of APP and thereby influencing positively detrimental depositions of amyloid plaques. Moreover, it is clearly documented in the appended examples that SNX-B8/30 is also involved in the regulation of endocytotic processes of APP itself.
  • SNX-B8/30 leads to a lower endocytotic rate.
  • the SNX-B8/30 identified herein influences the proteolytic cleavage of amyloid precursor protein, it is furthermore essential in insulin signal transduction in vivo (whereby it is of note that insulin signaling is disturbed in particular in type 2 diabetes; "insulin resistance") and, in addition, SNX-B8/30 effects the endocytosis of APP as well as of the transferrin receptor.
  • polynucleotide as identified herein as well as the polypeptide denoted as SNX-B 8/30 are particularly useful in the generation of host cell and/or non-human transgenic animals which may function in screening assays for Alzheimer medicaments as well as diabetes medicaments or for medicaments related to an impaired transferrin receptor system. Details are given herein below and are described in the appended examples.
  • SNX-B 8/30 forms a novel subgroup of sorting nexin molecules.
  • This subgroup comprises sorting nexin 9 (SNX-9), sorting nexin 18 (SNX- 18) as well as the herein described SNX-B8/30.
  • means and methods and in particular uses described herein below apply, mutatis mutandis, to the use of SNX-9 and SNX-18.
  • Corresponding SNX-9 and SNX- 18 sequences are provided herein below and are characterized as SEQ ID NOS: 3 and 4 and 5 and 6, respectively.
  • SNXl 8 Due to its sequence homology SNXl 8 (also called SNAG-I) has been described as a homologue of SNX9 (Worby and Dixon, 2002). However, at present, there are no publications showing experiments using SNXl 8. Thus, at present it is unclear, if and where SNXl 8 is expressed and what its function is. SNX9 has been described in several publications. Initially, it was identified under the name SH3PX1, since it contains a SH3 and a PX domain (Howard et al., 1999).
  • SNX9 may be phosphorylated by ACK or by an unknown kinase, but it remains controversial whether the phosphorylation occurs within the SH3 or the LC domain.
  • the phosphorylation may alter the interaction of the SNX with binding partners (Clemens et al., 2000; Lin et al., 2002; Lundmark and Carlsson, 2004; Worby et al., 2002).
  • C. elegans has only one homologue of the herein defined SNX9/18/B8 group.
  • the C. elegans homologous is teremed "lst-4" which has been shown to be involved in vulva development (Yoo et al., 2004).
  • lst-4" which has been shown to be involved in vulva development (Yoo et al., 2004).
  • it is down-regulated upon EGFR signaling and upregulated upon Notch signal transduction.
  • the underlying molecular mechanisms have not yet been established.
  • SNX- 18 nor SNX-9 have been provided in the prior art as targets for the medical intervention in neurological or metabolic disorders, like Alzheimer's disease or diabetes.
  • nucleic acid sequence means the sequence of bases comprising purine- and pyrimidine bases which are comprised by nucleic acid molecules, whereby said bases represent the primary structure of a nucleic acid molecule.
  • Nucleic acid sequences include DNA, cDNA, genomic DNA, RNA, synthetic forms and mixed polymers, both sense and antisense strands, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • the "polynucleotide” as defined herein is an RNA molecule and may, additionally, comprise further nucleotides, like poly- A stretches and/or 5 '-regulating sequences. Accordingly, the polynucleotide as shown in SEQ ED NO: 1 also relates to a RNA molecule, whereby the "T" (Thymidine) is replaced by an "U” (Uracile).
  • polypeptide means a peptide, a protein, or a polypeptide which encompasses amino acid chains of a given length, wherein the amino acid residues are linked by covalent peptide bonds.
  • peptidomimetics of such proteins/polypeptides wherein amino acid(s) and/or peptide bond(s) have been replaced by functional analogs are also encompassed by the invention as well as other than the 20 gene-encoded amino acids, such as selenocysteine (Se-Cys).
  • Peptides, oligopeptides and proteins may be termed polypeptides.
  • the terms polypeptide and protein are often used interchangeably herein.
  • polypeptide also refers to, and does not exclude, modifications of the polypeptide, e.g., glycosylation, acetylation, phosphorylation and the like. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • nucleic acid sequence has a certain degree of identity to the nucleic acid sequence encoding SNX-B8/SNX30
  • skilled person can use means and methods well-known in the art, e.g., alignments, either manually or by using computer programs such as those mentioned further down below in connection with the definition of the term "hybridization” and degrees of homology.
  • BLAST2.0 which stands for Basic Local Alignment Search Tool (Altschul, Nucl. Acids Res. 25 (1997), 3389-3402; Altschul, J. MoI. Evol. 36 (1993), 290-300; Altschul, J. MoI. Biol. 215 (1990), 403-410), can be used to search for local sequence alignments.
  • BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying similar sequences.
  • the fundamental unit of BLAST algorithm output is the High-scoring Segment Pair (HSP).
  • An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user.
  • the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
  • the parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.
  • the present invention also relates to nucleic acid molecules which hybridize to the SNX- B8/SNX30 polynucleotide as defined herein. Identities as well as homologies are, accordingly, easily deducible by the person skilled in the art and corresponding examples are also provided in the experimental part.
  • hybridizes as used in accordance with the present invention may relate to hybridizations under stringent or non-stringent conditions. If not further specified, the conditions are preferably non-stringent. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, Russell “Molecular Cloning, A Laboratory Manual”, Cold Spring Harbor Laboratory, N. Y. (2001); Ausubel, “Current Protocols in Molecular Biology”, Green Publishing Associates and Wiley Interscience, N.Y. (1989), or Higgins and Hames .(Eds.) "Nucleic acid hybridization, a practical approach” IRL Press Oxford, Washington DC, (1985). The setting of conditions is well within the skill of the artisan and can be determined according to protocols described in the art.
  • Non- stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may be set at 6xSSC, 1% SDS at 65°C.
  • the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • Hybridizing nucleic acid molecules also comprise fragments of the above described molecule. Such fragments may represent nucleic acid sequences which code for SNX-B8/SNX30 and which have a length of at least 12 nucleotides, preferably at least 15, more preferably at least 18, more preferably of at least 21 nucleotides, more preferably at least 30 nucleotides, even more preferably at least 40 nucleotides and most preferably at least 60 nucleotides. Furthermore, nucleic acid molecules which hybridize with any of the aforementioned nucleic acid molecules also include complementary fragments, derivatives and allelic variants of these molecules.
  • a hybridization complex refers to a complex between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions.
  • the two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration.
  • a hybridization complex may be formed in solution (e.g., Cot or Rot analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., membranes, filters, chips, pins or glass slides to which, e.g., cells have been fixed).
  • the terms complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
  • the sequence "A-G-T” binds to the complementary sequence "T-C-A”.
  • Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between single-stranded molecules.
  • the degree of complementartity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands.
  • hybridizing sequences preferably refers to sequences which display a sequence identity of at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, particularly preferred at least 80%, more particularly preferred at least 90%, even more particularly preferred at least 95%, 97% or 98% and most preferably at least 99% identity with a nucleic acid sequence as described above encoding SNX-B 8/SNX30 as described herein above.
  • the term "identical” or “percent identity” in the context of two or more nucleic acid or amino acid sequences refers to two or more sequences or subsequences that are the same, or that have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60% or 65% identity, preferably, 70-95% identity, more preferably at least 95%, 97%, 98% or 99% identity), when compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or by manual alignment and visual inspection. Sequences having, for example, 60% to 95% or greater sequence identity are considered to be substantially identical.
  • Such a definition also applies to the complement of a test sequence.
  • the described identity exists over a region that is at least about 15 to 25 amino acids or nucleotides in length, more preferably, over a region that is about 50 to 100 amino acids or nucleotides in length.
  • Those having skill in the art will know how to determine percent identity between/among sequences using, for example, algorithms such as those based on CLUSTALW computer program (Thompson Nucl. Acids Res. 2 (1994), 4673-4680) or FASTDB (Brutlag Comp. App. Biosci. 6 (1990), 237-245), as known in the art.
  • the FASTDB algorithm typically does not consider internal non-matching deletions or additions in sequences, i.e., gaps, in its calculation, this can be corrected manually to avoid an overestimation of the % identity.
  • CLUSTALW does take sequence gaps into account in its identity calculations.
  • the BLASTP program uses as defaults a wordlength (W) of 3, and an expectation (E) of 10.
  • W wordlength
  • E expectation
  • the present invention also relates to nucleic acid molecules the sequence of which is degenerate in comparison with the sequence of an above-described hybridizing molecule.
  • the term "being degenerate as a result of the genetic code” means that due to the redundancy of the genetic code different nucleotide sequences code for the same amino acid.
  • the nucleic acid molecule according to the invention may be any type of nucleic acid, e.g. DNA, RNA or PNA (peptide nucleic acid).
  • a peptide nucleic acid is a polyamide type of DNA analog and the monomelic units for adenine, guanine, thymine and cytosine are available commercially (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxides, or deoxyribose derivatives, are not present in PNAs. As disclosed by Nielsen et al., Science 254:1497 (1991); and Egholm et al, Nature 365:666 (1993), PNAs bind specifically and tightly to complementary DNA strands and are not degraded by nucleases. In fact, PNA binds more strongly to DNA than DNA itself does.
  • PNA/DNA duplexes bind under a wider range of stringency conditions than DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller probes can be used than with DNA due to the strong binding.
  • T.sub.m melting point
  • vs. 4°-16° C melting point
  • the absence of charge groups in PNA means that hybridization can be done at low ionic strengths and reduce possible interference by salt during the analysis.
  • the DNA may, for example, be cDNA. In a preferred embodiment it is a genomic DNA.
  • the RNA may be, e.g., mRNA.
  • the nucleic acid molecule may be natural, synthetic or semisynthetic or it may be a derivative, such as peptide nucleic acid (Nielsen, Science 254 (1991), 1497-1500) or phosphorothioates.
  • the nucleic acid molecule may be a recombinantly produced chimeric nucleic acid molecule comprising any of the aforementioned nucleic acid molecules either alone or in combination.
  • the invention also provides for a polynucleotide as defined above, coding for the SNX-B8/30 defined herein, whereby said polynucleotide is fused to a heterologous polynucleotide, preferably encoding a heterologous polypeptide.
  • This heterologous polypeptide may, inter alia, be a marker, like a green fluorescent protein or HA, as shown in the appended examples.
  • the nucleic acid molecule(s) of the present invention is part of a vector.
  • Said vector may be a gene targeting vector or a gene expression vector. These are particularly useful in the generation of a non-human transgenic animal or a host cell expressing the SNX- B8/30 described herein.
  • the present invention relates in another embodiment to a vector comprising the nucleic acid molecule of this invention.
  • a vector may be, e.g., a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering, and may comprise further genes such as marker genes which allow for the selection of said vector in a suitable host cell and under suitable conditions.
  • the nucleic acid molecules of the present invention may be inserted into several commercially available vectors.
  • Nonlimiting examples include plasmid vectors compatible with mammalian cells, such as pUC, pBluescript (Stratagene), pET (Novagen), pREP (Invitrogen), pCRTopo (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMCl neo (Stratagene), pXTl (Stratagene), pSG5 (Stratagene), EBO- ⁇ SV2neo, ⁇ BPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pUCTag, pIZD35, pLXIN and pSIR (Clontech) and plRES-EGFP (Clontech).
  • plasmid vectors compatible with mammalian cells such as pUC
  • Baculovirus vectors such as pBlueBac, BacPacz Baculovirus Expression System (CLONTECH), and MaxBacTM Baculovirus Expression System, insect cells and protocols (Invitrogen) are available commercially and may also be used to produce high yields of biologically active protein, (see also, Miller (1993), Curr. Op. Genet. Dev., 3, 9; O'Reilly, Baculovirus Expression Vectors: A Laboratory Manual, p. 127).
  • prokaryotic vectors such as pcDNA2; and yeast vectors such as pYes2 are nonlimiting examples of other vectors suitable for use with the present invention.
  • For vector modification techniques see Sambrook and Russel (2001), loc. cit.
  • Vectors can contain one or more replication and inheritance systems for cloning or expression, one or more markers for selection hi the host, e. g., antibiotic resistance, and one or more expression cassettes.
  • the coding sequences inserted in the vector can be synthesized by standard, methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements (e. g., promoters, enhancers, and/or insulators) and/or to other amino acid encoding sequences can be carried out using established methods.
  • the vectors may, in addition to the nucleic acid sequences of the invention, comprise expression control elements, allowing proper expression of the coding regions in suitable hosts.
  • control elements are known to the artisan and may include a promoter, translation initiation codon, translation and insertion site or internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476) for introducing an insert into the vector.
  • the nucleic acid molecule of the invention is operatively linked to said expression control sequences allowing expression in eukaryotic or prokaryotic cells.
  • Control elements ensuring expression in eukaryotic and prokaryotic cells are well known to those skilled in the art. As mentioned above, they usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript.
  • Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally-associated or heterologous promoter regions.
  • Possible regulatory elements permitting expression in for example mammalian host cells comprise the CMV-HSV thymidine kinase promoter, SV40, RSV- promoter (Rous sarcome virus), human elongation factor l ⁇ -promoter, CMV enhancer, CaM- kinase promoter or SV40-enhancer.
  • promoters including, for example, the tac-lac-promoter, the lacUV5 or the trp promoter.
  • Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as SV40-poly-A site or the tk-poly-A site, downstream of the polynucleotide, hi this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pRc/CMV, pcDNAl, ⁇ cDNA3 (In-Vitrogene, as used, inter alia in the appended examples), pSPORTl (GIBCO BRL) or pGEMHE (Promega), or prokaryotic expression vectors, such as lambda gtl 1.
  • An expression vector according to this invention is at least capable of directing the replication, and preferably the expression, of the nucleic acids and protein of this invention.
  • Suitable origins of replication include, for example, the Col El, the SV40 viral and the M 13 origins of replication.
  • Suitable promoters include, for example, the cytomegalovirus (CMV) promoter, the lacZ promoter, the gal 10 promoter and the Autographa californica multiple nuclear polyhidrosis virus (AcMNPV) polyhedral promoter.
  • Suitable termination sequences include, for example, the bovine growth hormone, SV40, lacZ and AcMNPV polyhedral polyadenylation signals.
  • selectable markers include neomycin, ampicillin, and hygromycin resistance and the like.
  • Specifically-designed vectors allow the shuttling of DNA between different host cells, such as bacteria-yeast, or bacteria-animal cells, or bacteria- fungal cells, or bacteria-invertebrate cells.
  • the vector may further comprise nucleic acid sequences encoding secretion signals.
  • nucleic acid sequences encoding secretion signals.
  • sequences are well known to the person skilled in the art.
  • leader sequences capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the nucleic acid molecules of the invention and are well known in the art.
  • the leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, -and preferably, a leader sequence capable of directing secretion of translated protein, or a part thereof, into, inter alia, the extracellular membrane.
  • the heterologous sequence can encode a fusion protein including an C- or N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • the vector Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the proteins, antigenic fragments or fusion proteins of the invention may follow.
  • the vector can also comprise regulatory regions from pathogenic organisms.
  • RNA virus such as a retrovirus
  • retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
  • MoMuLV Moloney murine leukemia virus
  • HaMuSV Harvey murine sarcoma virus
  • MuMTV murine mammary tumor virus
  • RSV Rous Sarcoma Virus
  • a number of additional retroviral vectors can also incorporate multiple genes. AU of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated.
  • Retroviral vectors can be made target specific by inserting, for example, a polynucleotide encoding a sugar, a glycolipid, or a protein.
  • a polynucleotide encoding a sugar, a glycolipid, or a protein for example, a polynucleotide encoding a sugar, a glycolipid, or a protein.
  • specific polynucleotide sequences for example polynucleotide sequences encoding an antibody of the present invention, which can be inserted into the retroviral genome to allow target specific delivery of the retroviral vector containing the inserted polynucleotide sequence.
  • recombinant retroviruses are preferably defective, they require assistance in order to produce infectious viral particles.
  • This assistance can be provided, for example, by using helper cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These plasmids are missing a nucleotide sequence which enables the packaging mechanism to recognize an RNA transcript for encapsidation.
  • Helper cell lines which have deletions of the packaging signal include, but are not limited to w2, PA317 and PAl 2, for example. These cell lines produce empty virions, since no genome is packaged.
  • a retroviral vector is introduced into such cells in which the packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced.
  • NIH 3T3 or other tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.
  • colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the preferred colloidal system of this invention is a liposome.
  • Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 pm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules.
  • LUV large unilamellar vesicles
  • RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. ScL, 6:77, 1981).
  • liposomes In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells.
  • a liposome In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the genes of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988).
  • the composition of the liposome is usually a combination of phospholipids, particularly high- phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
  • lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
  • phosphatidyl compounds such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
  • Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
  • Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine.
  • the targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell- specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticuloendothelial system (RES) in organs which contain sinusoidal capillaries.
  • RES reticuloendothelial system
  • the present invention in addition relates to a host transformed with a vector of the present invention or to a host comprising the nucleic acid molecule of the invention.
  • Said host may be produced by introducing said vector or nucleotide sequence into a host cell which upon its presence in the cell mediates the expression of a protein encoded by the nucleotide sequence of the invention or comprising a nucleotide sequence or a vector according to the invention wherein the nucleotide sequence and/or the encoded polypeptide is foreign to the host cell.
  • nucleotide sequence and/or the encoded polypeptide is either heterologous with respect to the host, this means derived from a cell or organism with a different genomic background, or is homologous with respect to the host but located in a different genomic environment than the naturally occurring counterpart of said nucleotide sequence. This means that, if the nucleotide sequence is homologous with respect to the host, it is not located in its natural location in the genome of said host, in particular it is surrounded by different genes. In this case the nucleotide sequence may be either under the control of its own promoter or under the control of a heterologous promoter.
  • the location of the introduced nucleic acid molecule or the vector can be determined by the skilled person by using methods well-known to the person skilled in the art, e.g., Southern Blotting.
  • the vector or nucleotide sequence according to the invention which is present in the host may either be integrated into the genome of the host or it may be maintained in some form extrachromosomally. In this respect, it is also to be understood that the nucleotide sequence of the invention can be used to restore or create a mutant gene via homologous recombination.
  • Said host may be any prokaryotic or eukaryotic cell. Suitable prokaryotic/bacterial cells are those generally used for cloning like E. coli, Salmonella typhimurium, Serratia marcescens or Bacillus subtilis. Said eukaryotic host may be a mammalian cell, an amphibian cell, a fish cell, an insect cell, a fungal cell or a plant cell. Said prokaryotic cell may be bacterial cell (e.g., E coli strains HBlOl, DH5a, XLl Blue, Y1090 and JMlOl). Eukaryotic recombinant host cells are preferred.
  • eukaryotic host cells include, but are not limited to, yeast, e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis or Pichia pastoris cells, cell lines of human, bovine, porcine, monkey, and rodent origin, as well as insect cells, including but not limited to, Spodoptera frugiperda insect cells and Drosophila-derived insect cells as well as zebra fish cells.
  • yeast e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis or Pichia pastoris cells
  • insect cells including but not limited to, Spodoptera frugiperda insect cells and Drosophila-derived insect cells as well as zebra fish cells.
  • Mammalian species-derived cell lines suitable for use and commercially available include, but are not limited to, L cells, CV-I cells, COS-I cells (ATCC CRL 1650), COS-7 cells (ATCC CRL 1651), HeLa cells (ATCC CCL 2), C1271 (ATCC CRL 1616), BS-C-I (ATCC CCL 26), CHO cells (ATCC CRL1859, ATCC CRL 1866) and MRC-5 (ATCC CCL 171).
  • L cells L cells
  • CV-I cells COS-I cells
  • COS-7 cells ATCC CRL 1651
  • HeLa cells ATCC CCL 2
  • C1271 ATCC CRL 1616
  • BS-C-I ATCC CCL 26
  • CHO cells ATCC CRL1859, ATCC CRL 1866
  • MRC-5 ATCC CCL 171
  • the host according to the invention is a non-human transgenic organism.
  • the present invention also provides for a non-human transgenic animal, whereas the here described SNX-B8/30 is expressed heterologously (for example the human ortholog is expressed in a mouse) or wherein the endogenous SNX-B8/30 is down regulated or not expressed (SNX-B8/3O - "knock out").
  • Said non-human organism may be a mammal, an amphibian, a fish, an insect, a fungus or a plant.
  • transgenic animals are Drosophila species, Caenorhabditis elegans, Xenopus species, zebra fish, Spodoptera frugiperda, Autographa californica, mice and rats.
  • Transgenic plants comprise, but are not limited to, wheat, tobacco, parsley and Arabidopsis.
  • Transgenic fungi are also well known in the art and comprise, inter alia, yeasts, like S. pombe or S. cerevisae, or Aspergillus spec, Neurospora or Ustilago species or Pichia species.
  • a non-human transgenic animal which comprises a mutation in the ortholog of SNX-B8 as defined herein.
  • said ortholog comprises a mutation which leads to a non-functional SNX-B8 expression, function or activity.
  • a non-human transgenic animal may be considered as a "knockout” or a "knock-down” animal.
  • a non-human transgenic animal expressing in its somatic and/or its germ cells an expression product which is capable of interfering with the expression, function or activity of SNX-B8.
  • Such an animal may, inter alia, comprises an expression product (as transgene) which is an inhibiting RNA or siRNA.
  • the SNX-B8 ortholog mutation is a knock-out mutation and said expression product capable of interfering with the expression, function or activity of SNX-B8 leads to a "knock-out” or a "knock-down" of SNX-B8.
  • the present invention relates to a method or a process for producing the polypeptide encoded by the SNX-B8/3O nucleic acid molecule of the invention comprising culturing/raising the host of the invention and isolating the produced polypeptide. Accordingly, a process is provided for the production of a functional SNX-B8/30 molecule.
  • the produced protein is harvested from the culture medium or from isolated (biological) membranes by established techniques.
  • the produced polypeptide may be directly isolated from the host cell.
  • Said host cell may be part of or derived from a part of a host organism.
  • the produced polypeptide may be isolated from fluids derived from said host.
  • polypeptide of the invention may accordingly be produced by microbiological methods or by transgenic non-human mammals. It is also envisaged that the polypeptide of the invention is recovered from transgenic plants. Alternatively, the polypeptide of the invention may be produced synthetically or semi-synthetically.
  • nucleotide acid sequences comprising all or a portion of any one of the nucleotide sequences according to the invention can be synthesized by PCR, inserted into an expression vector, and a host cell transformed with the expression vector. Thereafter, the host cell is cultured to produce the desired polypeptide, which is isolated and purified.
  • Protein isolation and purification can be achieved by any one of several known techniques; for example and without limitation, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high pressure liquid chromatography (HPLC), reversed phase HPLC, preparative disc gel electrophoresis.
  • cell-free translation systems can be used to produce the polypeptides of the present invention. Suitable cell-free expression systems for use in accordance with the present invention include rabbit reticulocyte lysate, wheat germ extract, canine pancreatic microsomal membranes, E. coli S30 extract, and coupled transcription/translation systems such as the TNT-system (Promega).
  • protein isolation/purification techniques may require modification of the proteins of the present invention using conventional methods.
  • a histidine tag can be added to the protein to allow purification on a (immobilized) nickel column (IMAC).
  • IMAC immobilized nickel column
  • Other modifications may cause higher or lower activity, permit higher levels of protein production, or simplify purification of the protein.
  • fusion proteins are also provided in context of this invention, for example, a SNX-B 8/30-HA fusion polypeptide.
  • an antibody specifically binding to the polypeptide SNX-B 8/SNX30 is within the scope of the present invention.
  • the present invention relates to an antibody or aptamer specifically recognizing SNX-B8/SNX3O which is described herein.
  • Aptamers commonly comprise RNA, single stranded DNA, modified RNA or modified DNA molecules.
  • the preparation of aptamers is well known in the art and may involve, inter alia, the use of combinatorial RNA libraries to identify binding sides (Gold, Ann. Rev. Biochem. 64 (1995), 763-797).
  • the term "specifically” in this context means that the antibody reacts with SNX-B8/SNX30, such as the polypeptides of the present invention encoded by the polynucleotides of the present invention.
  • this term also means that such an antibody does not bind to other polypeptides which, may be, related to said polypeptides of the present invention. Whether the antibody specifically reacts as defined herein above can easily be tested, inter alia, by methods known in the art to determine the specificity of an antibody, such as ELISA, etc..
  • the antibody of the present invention can be, for example, polyclonal or monoclonal.
  • the term "antibody” also comprises derivatives or fragments thereof which still retain the binding specificity. Techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane “Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. These antibodies can be used, for example, for the immunoprecipitation and immunolocalization of the polypeptides of the invention as well as for the monitoring of the presence of such polypeptides, for example, in recombinant organisms or in diagnosis. They can also be used for the identification of compounds interacting with the proteins according to the invention (as mentioned herein below).
  • surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies which bind to an epitope of the polypeptide of the invention (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1995), 7- 13).
  • the present invention furthermore includes chimeric, single chain and humanized antibodies, as well as antibody fragments, like, inter alia, Fab fragments.
  • Antibody fragments or derivatives further comprise F(ab')2, Fv or scFv fragments; see, for example, Harlow and Lane, loc. cit.
  • F(ab')2, Fv or scFv fragments see, for example, Harlow and Lane, loc. cit.
  • the (antibody) derivatives can be produced by peptidomimetics.
  • techniques described for the production of single chain antibodies see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies to polypeptide(s) of this invention.
  • transgenic animals may be used to express humanized antibodies to polypeptides of this invention.
  • the antibody of this invention is a monoclonal antibody.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples for such techniques include the hybridoma technique (Kohler and Milstein Nature 256 (1975), 495- 497), the trioma technique, the human B-cell hybridoma technique (Kozbor, Immunology Today 4 (1983), 72) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985), 77-96).
  • transgenic mice may be used to express humanized antibodies directed against said immunogenic polypeptides. It is in particular preferred that the antibodies/antibody constructs as well as antibody fragments or derivatives to be employed in accordance with this invention or capable to be expressed in a cell. This may, inter alia, be achieved by direct injection of the corresponding proteineous molecules or by injection of nucleic acid molecules encoding the same. Furthermore, gene therapy approaches are envisaged.
  • the term "antibody molecule” relates to full immunoglobulin molecules as well as to parts of such immunoglobulin molecules. Furthermore, the term relates, as discussed above, to modified and/or altered antibody molecules, like chimeric and humanized antibodies. The term also relates to monoclonal or polyclonal antibodies as well as to recombinantly or synthetically generated/synthesized antibodies. The term also relates to intact antibodies as well as to antibody fragments thereof, like, separated light and heavy chains, Fab, Fab/c, Fv, Fab', F(ab')2. The term “antibody molecule” also comprises bifunctional antibodies and antibody constructs, like single chain Fvs (scFv) or antibody-fusion proteins.
  • scFv single chain Fvs
  • the term “antibody” comprises antibody constructs which may be expressed in cells, e.g. antibody constructs which may be transfected and/or transduced via, inter alia, viruses or vectors.
  • the term “antibody” comprises antibody constructs which may be expressed in cells, e.g. antibody constructs which may be transfected and/or transduced via, inter alia, viruses or vectors. It is particularly envisaged that such antibody constructs specifically recognize SNX-B8/SNX30 as described herein, such as the polypeptides of the present invention.
  • said antibody construct is employed in gene therapy approaches for treating and/or preventing the diseases associated with SNX- B8/SNX30 which are described herein. Therefore, not only the antibodies provided herein and directed against the herein identified SNX-B8/SNX30 may be medically used, but also nucleic acid molecules encoding the same.
  • an antibody specifically directed against SNX-B8/30 is provided.
  • Such an antibody molecule may function as an inhibitor of SNX-B 8/30 and may, accordingly, be clinically useful.
  • the antibody of the invention is preferably an antibody specifically binding to/interacting with an epitope comprising a polypeptide as set forth in SEQ ID NOS: 10 or 11.
  • the antibody molecule of the present invention may be detectably labelled, for example with a toxin, a radioisotope or a fluorescent label.
  • the invention also provides for an antagonist of SNX-B8/30.
  • an antagonist (of expression) may be an inhibiting RNA, RNAi, siRNA, shRNA or a ribozyme binding to or inhibiting the translation of a SNX-B 8/30 polynucleotide as defined herein.
  • SNX-B 8/30 comprise, inter alia, an antibody, an aptamer or an anticalin or an “antisense molecule”.
  • a potentially useful inhibiting RNA of the present invention is preferably selected from an antisense construct hybridizing to a SNX-B 8/30 polynucleotide defined herein, RNAi, siRNA, shRNA or a ribozyme.
  • potential "antagonist(s)/inhibitor(s)” or partial inhibitors(s) for SNX-B 8/SNX30 may be selected from aptamers (Gold, Ann. Rev. Biochem. 64 (1995), 763-797)), aptazymes, RNAi, shRNA, RNAzymes, ribozymes (see e.g., EP-Bl 0 291 533, EP-Al 0 321 201, EP-Bl 0 360 257), antisense DNA, antisense oligonucleotides, antisense RNA, siRNA, antibodies (Harlow and Lane “ Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988), affibodies (Hansson, Immunotechnology 4 (1999), 237-252; Herming, Hum Gene Ther.
  • aptamer means nucleic acid molecules that can bind to target molecules. Aptamers commonly comprise RNA, single stranded DNA, modified RNA or modified DNA molecules. The preparation of aptamers is well known in the art and may involve, inter alia, the use of combinatorial RNA libraries to identify binding sites (Gold (1995), Ann. Rev. Biochem 64 , 763-797).
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, whereby the inhibitory effect is based on specific binding of a nucleic acid molecule to DNA or RNA.
  • the 5' coding portion of a nucleic acid molecule encoding SNX-B8/SNX30 and/or fragments thereof to be inhibited can be used to design an antisense oligonucleotide, e.g., of at least 10 nucleotides in length.
  • the antisense DNA or RNA oligonucleotide hybridises to the niRNA in vivo and blocks translation of said mRNA and/or leads to destabilization of the mRNA molecule (Okano, J. Neurochem. 56 (1991), 560; Oligodeoxynucleotides as antisense inhibitors of gene expression, CRC Press, Boca Raton, FL, USA (1988).
  • the antisense molecule may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil,5-bromouracil, 5-chlorouracil, 5- iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxyhnethyl) uracil, 5- carboxymethylarninomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galaetosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine,2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-man ⁇ osylqueosine
  • the antisense molecule may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the antisense molecule comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense molecule is an a-anomeric oligonucleotide.
  • An a- anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual-units, the strands run parallel to each other (Gautier, 1987, Nucl. Acids Res. 15: 6625-6641).
  • the oligonucleotide is a 2'-O-methylribonucleotide (Inoue, 1987, Nucl. Acids Res. 15: 6131-6148), or a chimeric RNA-DNA analogue (Inoue, 1987, FEBS Lett. 215: 327-330).
  • Antisense molecules of the invention may be synthesized by standard methods known in the art, e. g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein (1988, Nucl. Acids Res. 16:3209)
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin,1988, Proc. Natl. Acad. Sci. U. S. A. 85: 7448-7451), etc.
  • a DNA oligonucleotide can be designed to be complementary to a region of the gene encoding SNX-B 8/SNX30 and/or fragments thereof to be inhibited according to the principles laid down in the prior art (see for example Lee, Nucl. Acids Res. 6 (1979), 3073; Cooney, Science 241 (1988), 456; and Dervan, Science 251 (1991), 1360). Such a triple helix forming oligonucleotide can then be used to prevent transcription of the specific gene, and is, accordingly, an inhibition in the sense of this invention.
  • the oligonucleotides described above can also be delivered to target cells via a gene delivery vector as described above in order to express such molecules in vivo to inhibit gene expression of the respective protein.
  • antisense molecules are oligonucleotides specifically hybridising to a polynucleotide encoding SNX-B 8/SNX30 and/or fragments thereof.
  • Such oligonucleotides have a length, of preferably at least 10, in particular at least 15, and particularly preferably of at least 50 nucleotides. They are characterized in that they specifically hybridise to said polynucleotide, that is to say that they do not or only to a very minor extent hybridise to other nucleic acid sequences.
  • RNAi refers to the introduction of homologous double stranded RNA (dsRNA) to specifically target a gene's product, resulting in null or hypomorphic phenotypes.
  • dsRNA homologous double stranded RNA
  • Introduction of dsRNA into a eukaryotic cell results in the loss of the function of SNX- B8/SNX3O and/or fragments thereof.
  • RNAi is also remarkably potent (i.e., only a few dsRNA molecules per cell are required to produce effective interference), the dsRNA must be either replicated and/or work catalytically .
  • RNAi constructs form typical hairpin structures.
  • RNA molecules with ribozyme activity which specifically cleave transcripts of a gene encoding SNX-B8/SNX30 and/or fragments thereof can be used as "antagonist/inhibitor" as provided.
  • Said ribozymes may also target DNA molecules encoding the corresponding RNAs.
  • Ribozymes are catalytically active RNA molecules capable of cleaving RNA molecules and specific target sequences. By means of recombinant DNA techniques it is possible to alter the specificity of ribozymes.
  • the first group is made up of ribozymes which belong to the group I intron ribozyme type.
  • the second group consists of ribozymes which as a characteristic structural feature exhibit the so-called "hammerhead” motif.
  • the specific recognition of the target RNA molecule may be modified by altering the sequences flanking this motif. By base pairing with sequences in the target molecule these sequences determine the position at which the catalytic reaction and therefore the cleavage of the target molecule takes place. Since the sequence requirements for an efficient cleavage are low, it is in principle possible to develop specific ribozymes for practically each desired RNA molecule.
  • a DNA sequence encoding a catalytic domain of a ribozyme is bilaterally linked with DNA sequences which are homologous to sequences encoding the target protein.
  • the expression of ribozymes in order to decrease the activity in certain proteins is also known to the person skilled in the art and is, for example, described in EP-Bl 0 321 201 or EP-Bl 0 360 257.
  • the inhibiting nucleic acid molecule is siRNA as dislosed in Elbashir (2001), Nature 411, 494-498.
  • RNAi small temporal RNAs
  • Paddison (2002) Genes Dev. 16, 948-958
  • approaches for gene silencing are known in the art and comprise "RNA"- approaches like RNAi or siRNA.
  • Successful use of such approaches has been shown in Paddison (2002) loc. cit, Elbashir (2002) Methods 26, 199-213; Novina (2002) Mat. Med. June 3, 2002; Donze (2002) Nucl. Acids Res. 30, e46; Paul (2002) Nat. Biotech 20, 505-508; Lee (2002) Nat. Biotech. 20, 500-505; Miyagashi (2002) Nat. Biotech.
  • RNA pol III vectors may be employed as illustrated, inter alia, in Yu (2002) loc. cit.; Miyagishi (2002) loc. cit. or Brummelkamp (2002) loc. cit.
  • siRNA is targeted to deplete SNX-B 8/SNX30 and/or fragments thereof.
  • targeted means that (an) siRNA duplex(es) is/are specifically targeted to a coding sequence of SNX-B8/SNX30 and/or fragments thereof, to cause gene silencing by RNA interference (RNAi) since said siRNA duplex(es) is/are homologous in sequence to a gene desired to be silenced, for example, SNX- B8/SNX30 and/or fragments thereof.
  • RNA interference RNA interference
  • “Homologous in sequence” in the context of the present invention means that said siRNA duplex(es) is/are homologous in the sequence to a gene, for example the SNX-B8/SNX30 and/or fragments thereof desired to be silenced by the mechanism/pathway of RNA interference (RNAi). It is envisaged that the degree of homology between the siRNA duplex(es) and the sequence of the gene desired to be silenced is sufficient that said siRNA duplex(es) is/are capable to cause gene silencing of said desired gene initiated by double-stranded RNA (dsRNA), for example, (an) siRNA duplex(es). The person skilled in the art is readily in a position to determine whether the degree of homology is sufficient to deplete SNX-B 8/SNX30 and/or fragments thereof.
  • dsRNA double-stranded RNA
  • RNA encoding for example SNX-B 8/SNX30 and/or fragments thereof may be partially or completely degraded by the mechanism/pathway of RNAi and, thus, may not be translated or only translated in insufficient amounts which causes a phenotype almost resembling or resembling that of a knock-out of the respective gene. Consequently, for example, no or at least to less of SNX-B8/SNX30 will be produced.
  • 20- to 50-nucleotide RNAs preferably 15, 18, 20, 21, 25, 30, 35, 40, 45 and 50-nucleotide RNAs are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • siRNAs and the like are obtained from commercial RNA oligo synthesis suppliers, which sell RNA- synthesis products of different quality and costs.
  • 20 to 50-nucleotide RNAs are not too difficult to synthesize and are readily provided in a quality suitable for RNAi.
  • RNA for example long dsRNA which may comprise even 500 nt; see, inter alia, Paddison (2002), PNAS 99, 1443-1448.
  • the preferred targeted region is selected from a given nucleic acid sequence beginning, inter alia, 50 to 100 nt downstream of the start codon.
  • RNAi As documented herein, preferred "inhibiting RNAs", "RNAi”, “siRNA” or “shRNA” target a SNX-B8/30 nucleotide sequence, which, e.g., comprises or is a sequence as shown in SEQ ID NOS: 7, 8 or 9. These may also be the target for antisense molecules and ribozymes. For particular uses and methods provided herein, also inliibiting molecules directed against SNX- 9 or SNX-18 are envisaged.
  • the appended SEQ ID NOS: 20 to 27 provide for corresponding target molecules and non-limiting examples of corresponding RNAi-molecules are also provided.
  • the above cited SEQ ID NOS. comprise the target sequences for the inhibiting nucleic acid molecules.
  • a target sequence (of SNX-B8/30) may, inter alia, be targeted by RNAi using duplex sequences as given in siRNAs of SEQ ID NOS: 28 and 29, 30 and 31, 32 and 33 and/or 50 and 51.
  • Illustrative target sequence for inhibiting molecules for SNX-9 are given in SEQ ID NOS: 20, 21, 22, 23 and 24.
  • Corresponding duplex sequences for RNAi approaches are given in SEQ ID NOS: 34 and 35, 36 and 37, 38 and 39, 40 and 41 and/or 42 and 43.
  • Illustrative target sequences for SNX-18 inhibition are provided with SEQ ID NOS: 25, 26 and 27 and corresponding (duplex) sequences for RNAi approaches are given in SEQ ID NOS: 44 and 45, 46 and 47 and/or 48 and 49.
  • the invention also provides for an agonist/enhancer of the SNX- B8/30 polypeptide of the invention.
  • Said agonist/enhancer may be a transcription factor capable of enhancing expression of any one of the SNX-B 8/30 polynucleotides as defined above.
  • composition comprising the polynucleotide, the vector, the host cell, the polypeptide, the antagonist/inhibitor, the RNAi or siRNA, the antibody or the agonist/enhancer of the invention is provided.
  • said composition is a pharmaceutical composition optionally further comprising a pharmaceutically acceptable carrier and/or a diluent and/or an excipient and/or a microcapsulated host cell.
  • a diagnostic composition optionally further comprising suitable means for detection is envisaged.
  • Dosage, pharmaceutical preparation and delivery of the compounds of the present invention as described herein for use in accordance with the present invention may be formulated in conventional manner according to methods found in the art, using one or more physiological carriers or excipients, see, for example Ansel et al., "Pharmaceutical Dosage Forms and Drug Delivery Systems", 7 th edition, Lippincott Williams & Wilkins Publishers, 1999.
  • the compounds of the invention acceptable salts and solvates may be formulated for administration by inhalation, insufflation (either through the mouth, or nose), oral, buccal, parenteral, or rectal administration.
  • the pharmaceutical composition may be administered with a physiologically acceptable carrier to a patient, as described herein.
  • pharmaceutically acceptable means approved by a regulatory agency or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
  • Such compositions will contain a therapeutically effective amount of the inhibitor described herein, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • pharmaceutical compositions are in a water- soluble form, such as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts.
  • the administration of the candidate agents of the present invention can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, inrranasally, transdermally, intranodally, peritumourally, intratumourally, intrarectally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilised powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the pharmaceutical composition of the for example SNX-B 8/SNX30 inhibitors or enhancers may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutical acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone, hydroxypropyl methylcellulose), fillers (e.g., lactose, microcrystalline cellulose, calcium hydrogen phosphate), lubricants (e.g., magnesium stearate, talc, silica), disintegrants (e.g., potato starch, sodium starch glycolate), or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone, hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose, calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc
  • Liquid preparations for oral administration may take the form of, for example, solutions, syrups, or suspensions, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparation may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol, syrup, cellulose derivatives, hydrogenated edible fats), emulsifying agents (e.g., lecithin, acacia), non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, fractionated vegetable oils), preservatives (e.g., methyl or propyl-p-hydroxycarbonates, soric acids).
  • suspending agents e.g., sorbitol, syrup, cellulose derivatives, hydrogenated edible fats
  • emulsifying agents e.g., lecithin, acacia
  • non-aqueous vehicles e.g., almond oil, oily esters, ethyl alcohol
  • preparations may also contain buffer salts, flavouring, coloring and sweetening agents as deemed appropriate.
  • Preparations for oral administration may be suitably formulated to give controlled release of the SNX-B8/SNX3O inhibitors, SNX-B8/30 enhancers, or the other medically useful compounds of the present invention.
  • the compounds of the present invention for use according to the present invention is conveniently delivered in the form of an aerosol spray presentation from a pressurised pack or a nebulizer, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas).
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, for example, gelatine, for use in an inhaler or insufflator may be formulated containing a powder mix of the compounds of the invention and a suitable powder base such as lactose or starch.
  • a compounds of the invention may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion.
  • Site of injections include intravenous, intraperitoneal or sub-cutaneous.
  • Formulations for injection may be presented in units dosage form (e.g., in phial, in multi-dose container), and with an added preservative.
  • the compounds of the invention may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, or dispersing agents.
  • the agent may be in powder form for constitution with a suitable vehicle (e.g., sterile pyrogen-free water) before use.
  • Compounds of the invention may, if desired, be presented in a pack, or dispenser device which may contain one or more unit dosage forms containing the said agent.
  • the pack may for example comprise metal or plastic foil, such as blister pack.
  • the pack or dispenser device may be accompanied with instruction for administration.
  • the term "subject” means an individual in need of a treatment of an affective disorder.
  • the subject is a vertebrate, even more preferred a mammal, particularly preferred a human.
  • administered means administration of a therapeutically effective dose of the aforementioned inhibitor to an individual.
  • therapeutically effective amount is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
  • the methods are applicable to both human therapy and veterinary applications.
  • the compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein.
  • the compounds may be formulated in a variety of ways as discussed below.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt %.
  • the agents maybe administered alone or in combination with other treatments.
  • the administration of the pharmaceutical composition can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, intraarterial, intranodal, intramedullary, intrathecal, intraventricular, intranasally, mtrabronchial, transdermally, intranodally, intrarectally, intraperitoneally, intramuscularly, intrapuhnonary, vaginally, rectally, or intraocularly.
  • the candidate agents may be directly applied as a solution dry spray.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • a typical dose can be, for example, in the range of 0.001 to 1000 ⁇ g; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors.
  • the dosages are preferably given once a week, however, during progression of the treatment the dosages can be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., daily.
  • the immune response is monitored using herein described methods and further methods known to those skilled in the art and dosages are optimized, e.g., in time, amount and/or composition.
  • Dosages will vary but a preferred dosage for intravenous administration of DNA encoding SNX-B8/SNX3O as described herein is from approximately 10 6 to 10 12 copies of the DNA molecule. Similar ranges are envisaged for e.g. inhibitory molecules, like RNAi, siRNAs and the like.
  • the pharmaceutical composition of the invention may be administered locally or systemically. Administration will preferably be parenterally, e.g., intravenously. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium ion solution, Ringer's dextrose, dextrose and sodium ion, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • the above described diagnostic composition may optionally comprises suitable means for detection.
  • the nucleic acid molecule(s), vectors, host(s), antibody(ies), and polypeptide(s) described above are, for example, suitable for use in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier.
  • suitable carriers include glass, polystyrene, polyvinyl ion, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite.
  • the nature of the carrier can be either soluble or insoluble for the purposes of the invention.
  • Solid phase carriers are known to those in the art and may comprise polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, membranes, sheets, duracytes and the walls of wells of a reaction tray, plastic tubes or other test tubes.
  • Suitable methods of immobilizing nucleic acid molecule(s), vector(s) host(s), antibody(ies), aptamer(s), polypeptide(s), etc. on solid phases include but are not limited to ionic, hydrophogic, covalent interactions or (chemical) crosslinking and the like.
  • immunoassays which can utilize said compounds of the invention are competitive and non-competitive immunoassays in either a direct or indirect format.
  • Commonly used detection assays can comprise radioisotopic or non-radioisotopic methods.
  • immunoassays are the radioimmunoassay (RIA), the sandwich (immunometric assay) and the Northern or Southern blot assay.
  • these detection methods comprise, inter alia, IRMA (Immune Radioimmunometric Assay), EIA (Enzyme rmmuno Assay), ELISA (Enzyme Linked Imrnuno Assay), FIA (Fluorescent hnmuno Assay), and CLIA (Chemioluminescent Immune Assay).
  • the diagnostic compounds of the present invention may be are employed in techniques like FRET (Fluorescence Resonance Energy Transfer) assays.
  • labels and methods for labeling are known to those of ordinary skill in the art.
  • Examples of the types of labels which can be used in the present invention include inter alia, fluorochromes (like fluorescein, rhodamine, Texas Red, etc.), enzymes (like horse radish peroxidase, ⁇ -galactosidase, alkaline phosphatase), radioactive isotopes (like P, P, S or 125 I), biotin, digoxygenin, colloidal metals, chemi- or bioluminescent compounds (like dioxetanes, luminol or acridiniums).
  • fluorochromes like fluorescein, rhodamine, Texas Red, etc.
  • enzymes like horse radish peroxidase, ⁇ -galactosidase, alkaline phosphatase
  • radioactive isotopes like P, P, S or 125 I
  • biotin digoxygenin
  • biomolecules A variety of techniques are available for labeling biomolecules, are well known to the person skilled in the art and are considered to be within the scope of the present invention and comprise, inter alia, covalent coupling of enzymes or biotinyl groups, phosphorylations, biotinylations, random priming, nick-translations, tailing (using terminal transferases).
  • Detection methods comprise, but are not limited to, autoradiography, fluorescence microscopy, direct and indirect enzymatic reactions, etc.
  • a diagnostic application in which the kit or the diagnostic composition of the present invention is used comprises any amplification technique.
  • amplification technique refers to any method that allows the generation of a multitude of identical or essentially identical (i.e. at least 95% more preferred at least 98%, even more preferred at least 99% and most preferred at least 99.5% such as 99.9% identical) nucleic acid molecules or parts thereof. Such methods are well established in the art; see Sambrook et al. "Molecular Cloning, A Laboratory Manual", 2 nd edition 1989, CSH Press, Cold Spring Harbor. Various PCR techniques, including real-time PCR are reviewed, for example, by Ding, J. Biochem. MoI. Biol. 37 (2004), 1-10.
  • PCR is an example of an amplification technique.
  • PCR is a powerful technique used to amplify DNA millions of fold, by repeated replication of a template, in a short period of time.
  • the process utilizes sets of specific in vitro synthesized oligonucleotides to prime DNA synthesis.
  • the design of the primers is dependent upon the sequences of the DNA that is desired to be analyzed. It is known that the length of a primer results from different parameters (Gillam (1979), Gene 8, 81-97; Innis (1990), PCR Protocols: A guide to methods and applications, Academic Press, San Diego, USA).
  • the primer should only hybridize or bind to a specific region of a target nucleotide sequence.
  • the length of a primer that statistically hybridizes only to one region of a target nucleotide sequence can be calculated by the following formula: (Vi) x (whereby x is the length of the primer). For example a hepta- or octanucleotide would be sufficient to bind statistically only once on a sequence of 37 kb. However, it is known that a primer exactly matching to a complementary template strand must be at least 9 base pairs in length, otherwise no stable-double strand can be generated (Goulian (1973), Biochemistry 12, 2893-2901). It is also envisaged that computer-based algorithms can be used to design primers capable of amplifying the nucleic acid molecules of the invention.
  • the primers of the invention are at least 10 nucleotides in length, more preferred at least 12 nucleotides in length, even more preferred at least 15 nucleotides in length, particularly preferred at least 18 nucleotides in length, even more particularly preferred at least 20 nucleotides in length and most preferably at least 25 nucleotides in length.
  • the invention can also be carried out with primers which are shorter or longer.
  • the person skilled in the art can readily design primers to be used in the diagnostic method of the invention, particular on basis of the nucleic acid molecules provided herein and homologous molecules as defined herein above.
  • the appended examples provide for means and methods how specific primers (or probes) may be generated. "Primers” and "probes" are particularly useful in the diagnostic methods provided herein.
  • the PCR technique is carried out through many cycles (usually 20 - 50) of melting the template at high temperature, allowing the primers to anneal to complimentary sequences within the template and then replicating the template with DNA polymerase.
  • the process has been automated with the use of thermostable DNA polymerases isolated from bacteria that grow in thermal vents in the ocean or hot springs.
  • thermostable DNA polymerases isolated from bacteria that grow in thermal vents in the ocean or hot springs.
  • a single copy of DNA is converted to two copies and so on resulting in an exponential increase in the number of copies of the sequences targeted by the primers.
  • a single copy of DNA is amplified over 2,000,000 fold.
  • the invention as provided herein is particularly useful in the medical intervention of different diseases like, for example, diseases related to APP metabolism, insulin pathway, transferrin receptor pathway and the like.
  • diseases related to APP metabolism, insulin pathway, transferrin receptor pathway and the like As documented in the appended examples SNX-B 8/30 as well as the other members of the herein defined SNX subgroup, namely SNX-9 and SNX-18 are useful in the prevention, amelioration and/or treatment of disorders linked to the physiological pathways and metabolisms. Accordingly, SNX-B8/30, SNX-9 as well as SNX-18 (in their polynucleotide as well as their polypeptide form) may be employed in the medical intervention of these disorders.
  • disorders comprise, in particular neurological, neurodegenerative disorders, diabetes and obesity, whereby a particular referred disorder to be treated are Alzheimer's disease and diabetes.
  • enhancers/agonists of SNX-B8/30 or of the other members of the family, namely SNX-9 and SNX-18 may be employed.
  • the present invention also relates to the use of the SNX-B8/30 polynucleotide of the invention, the vector, the host cell, the SNX-B8/30 polypeptide or the agonist/enhancer described herein above for the preparation of a pharmaceutical composition for preventing, ameliorating and/or treating neurological, neurodegenerative disorders, diabetes or obesity.
  • said neurological and/or neurodegenerative disorders are selected from the group consisting of Alzheimer's disease, Parkinson's disease or a prion-disease.
  • Prion disorders comprise Creutzfeld- Jacob-disease; Kuru-Ruru, Gerstmann-Straussler-Scheinker syndrome, BSE Bovine Spongiform Encephalopathy "mad-cow disease", Scrapie in sheep, TME (transmissible mink encephalopathy) in mink or CWD (chronic wasting disease) in muledeer, elk.
  • the above-mentioned compounds, leading to an enhanced level or an enhanced function of SNX-B8/30 are useful for the preparation of a pharmaceutical composition for preventing, ameliorating and/or treating a disorder, wherein ⁇ -cleavage of the Amyloid Precursor Protein (APP) is inhibited, wherein ⁇ -secretase is inhibited and/or malfunctioning or wherein it is desired that ⁇ -secretase activity is enhanced.
  • APP Amyloid Precursor Protein
  • AD Alzheimer's disease
  • AD amyloid ⁇ peptide
  • a ⁇ amyloid ⁇ peptide
  • APP amyloid precursor protein
  • the Alzheimer protein APP is a membrane protein and consists of a large extracellular domain, a transmembrane and a cytoplasmic domain (Fig. IA).
  • the two proteases, which cleave APP and generate A ⁇ , are referred to as ⁇ - and ⁇ -secretase (Fig. IA).
  • ⁇ -secretase cleaves first, ⁇ -secretase cleaves second.
  • APP may be cleaved by ⁇ -secretase, which cleaves within the A ⁇ domain (Fig. IA).
  • ⁇ -cleavage precludes A ⁇ peptide generation, since the resulting APP fragments do not contain the full A ⁇ sequence anymore.
  • ⁇ - but not ⁇ -cleavage generates a secreted form of APP (sAPP ⁇ ), which is neuroprotective.
  • sAPP ⁇ secreted form of APP
  • ⁇ - or ⁇ -cleavage of APP are also referred to as shedding or ectodomain shedding, which in general stands for the proteolytic conversion of membrane proteins to their soluble counterparts (Fig. IB).
  • shedding or ectodomain shedding in general stands for the proteolytic conversion of membrane proteins to their soluble counterparts (Fig. IB).
  • Fig. IB soluble counterparts
  • a large number of membrane-anchored proteins can be proteolytically cleaved in an ⁇ -secretase like fashion (Blobel, 2002).
  • Type 2 diabetes affects about 150 million people world-wide and is responsible for 95% of all cases of diabetes.
  • type 2 diabetes cells become insulin-resistant. Under normal conditions, insulin binds to its receptor and induces a signal transduction cascade. As one of the consequences, sugar transporters move to the cell surface and allow sugar entry into the cell, which leads to a reduced blood sugar level. In insulin-resistant cells, the insulin signal transduction is not working properly and is reduced.
  • One of the therapeutic aims for diabetes is therefore to stimulate insulin signal transduction in insulin resistant cells (Musi and Goodyear, 2002).
  • genes affecting insulin signal transduction may be novel drug targets for the development of anti-diabetes drugs.
  • Diabetes is a risk factor for AD (Arvanitakis et al., 2004), and decreased insulin signaling has been observed in AD brain.
  • Reduced insulin signaling may have several consequences, which could contribute to the pathogenesis of AD and exacerbate the symptoms.
  • the complex consequences of reduced insulin signaling are mechanistically not fully elucidated but include reduced expression of IDE (an enzyme which can cleave and thereby neutralize A ⁇ ) (Zhao et al., 2004), reduced secretion of the neurotrophic and neuroprotective, ⁇ -secretase cleaved APP (sAPP ⁇ ) and increased phosphorylation of the protein tau (reviewed in Gasparini et al., 2002).
  • NFTs neurofibrillary tangles
  • amyloid aggregates the NFTs are a second hallmark in AD brains.
  • increasing insulin signaling may be therapeutically helpful for AD (discussed in Zhao et al., 2004). This increase of insulin signaling may be obtained by the agonists/enhancers of SNX-B 8/30 function/expression as provided herein.
  • Obesity is a complex disorder of appetite regulation and/or energy metabolism controlled by specific biological factors. Besides severe risks of illness such as diabetes, hypertension and heart disease, individuals suffering from obesity are often isolated socially. Human obesity is strongly influenced by environmental and genetic factors, whereby the environmental influence is often a hurdle for the identification of (human) obesity genes.
  • Obesity is defined as a Body Mass Index (BMI) of 30 kg/m 2 or more. BMI is calculated by dividing the weight in kg by the height in metres squared. "Overweight” is defined as a BMI between 25 and 30 kg/m 2 . A person is considered obese if he or she has 20 percent (or more) extra body fat for his/her age, height, sex, and bone structure.
  • BMI Body Mass Index
  • SNX-B8/30 (or the other two members of the herein defined subgroup, namely SNX-9 and SNX-18) are down-regulated or their expression and function is inhibited in order to achieve a positive medical intervention. Accordingly, also the use of antagonists or inhibitors of the herein defined SNX-B8/30 (or of SNX-9 or of SNX-18) for the preparation of a pharmaceutical composition for the treatment of, for example, cancer or a transferrin receptor related disorders are described.
  • the invention also relates to the use of the antagonist/inhibitor of particular SNX-B8/30 (or SNX-9; SNX-18), the inhibiting RNA, the shRNA, RNAi or siRNA described herein and directed against the expression of SNX-B8/30 or the (inhibitory) antibody described above for the preparation of a pharmaceutical composition for preventing, ameliorating and/or treating cancer or transferrin- receptor-related disorders.
  • Said transferrin-receptor-related disorder may be cancer or an apoptosis-related disorder.
  • Said cancer is preferably selected from the group of cancers, where insulin receptor expression is high, like cancers of prostate, breast or colon.
  • Transferrin has several polymorphisms with > 30 different species detected to date. Three major isotypes known as B, C and D are found, whereas the majority of people carry the C allele in particular Cl .
  • Tf polymorphism a link between Tf polymorphism and susceptibility to diseases e.g. cardiovascular disease (CVD) and Alzheimer's disease (AD).
  • CVD cardiovascular disease
  • AD Alzheimer's disease
  • Individuals possessing the Tf C2 allele in combination with the C282Y allele of the haemochromatosis (HFE) gene have a higher risk of developing AD. This risk is further increased in individuals carrying the allele apolipoproein E epsilon 4 (Apo E4).
  • Apo E4 apolipoproein E epsilon 4
  • Tf is synthesized in a variety of cells including predominantely hepatocytes, but also in Sertoli, ependymal, oligodendroglial, metastatic melanoma cell lines and human breast cancer cell lines. TF has been detected in various body fluids including plasma, bile, amniotic, cerebrospinal, lymph and breast milk.
  • TfRl is expressed on a range of cells, including blood cells, erythroid cells, hepatocytes, monocytes and cells of the blood-brain barrier.
  • TfR2 is expressed as two transcripts (alphaTfR2 and betaTfR2) whereas alphaTfR2 is predominantly expressed on liver cells and betaTfR2 at low levels on a variety of cell types.
  • Non-dividing cells can have extremely low levels of TfR expression, whereas rapidly proliferating cells (e.g. carcinoma cells) can express up to 100.000 copies per cell.
  • Tf The antimicrobial activity of Tf is mainly linked to the reduction of free iron via Tf but also apo-Tf has an antimicrobial effect.
  • Apo-Tf is . being capable of reducing the adhesion of bacteria to surfaces.
  • Tf has been implicated in growth and differentiation activities including myotrophic, embryo- morphogenic, proliferative, mitogenic, neurotrophic, chemotactic and angiogenic activities. These activities seem to be at least partially iron-binding independent since apo-Tf can have growth promoting effects.
  • Tf has been suggested to have paracrine and autocrine roles e.g. the proliferation of brain melanoma metastasis is promoted by Tf produced by brain cells.
  • Tf Cell response to Tf signal can change throughout the life cycle of the cell.
  • intracranial injection of apo-Tf in two-to-seven day old rats results in rapid differentiation of oligodendroglial cells whereas the same treatment has no effect in ten-day old rats.
  • Iron-bound Tf has been shown to inhibit apoptosis in ovarian cancer cell lines.
  • the apoptotic pathway acts by up regulating ferritin which results in reduced levels of intracellular iron.
  • the presence of iron-bound Tf can restore intracellular iron levels, thereby preventing cell death.
  • Tf can modulate different cellular events.
  • An example is the antiproliferative and anti- apoptotic effect of the binding of Tf to insulin-like growth factor-binding protein 3 (IGFBP- 3).
  • IGFBP- 3 insulin-like growth factor-binding protein 3
  • the complex of Tf and IGFBP-3 prevents the proliferative effect of IGFBP-3 on bladder smooth muscle cells and the apoptotic effect in prostate cancer cells. Accordingly, the antagonist/inhibitor of SNX-B8/30 is particularly useful in the treatment of, inter alia, prostate cancers or breast or colon cancers.
  • CVD cardiovascular disease
  • the negative effect of unbound iron can be treated by infusion with apo-Tf to scavenge the iron.
  • a main field of therapeutic interest is targeted drug delivery via the Tf-TfR transport system.
  • Tf can bind a variety of metals which are useful in treatment and/or diagnostics e.g. 67 Ga 3+ and 111 In 3+ radioisotopes.
  • Tf-conjugation of Tf with small molecules, peptides, proteins or genes can be used.
  • An example is the delivery of a Tf-conjugated diphtheria toxin to malignant brain tumors (phase III is under way for glioblastoma).
  • Tf in combination with other factors can promote cytotoxicity and proliferation in lymphokine activated killer cells (LAK) and natural killer cells (NK).
  • LAK lymphokine activated killer cells
  • NK natural killer cells
  • TfR tumor necrosis factor receptor
  • the delivery systems could be tailored by altering the metal binding site or by inserting peptide sequences for specific delivery of drugs to rapidly dividing cells.
  • a further aspect of the present invention is the use of a modulator of SNX-B 8/SNX3O activity or expression for the preparation of a pharmaceutical composition for treating a disorder.
  • modulator means (a) compound(s), a complex of compounds, (a) substance(s) or complex of substances which can modify, i.e. modulate the activity of SNX-B8/SNX30 or the expression of SNX-B 8/SNX3O either directly or indirectly.
  • the modulation can, for example, occur at the protein level.
  • the invention also provides for a method for identifying an antagonist/inhibitor of an SNX-B 8 molecule comprising the steps of:
  • the invention also provides for a method for screening of an inhibitor/antagonist for SNX-B8 function comprising the steps of: (a) contacting a cell expressing SNX-B 8 with a compound to be tested; (b) determining whether in said cell SNX-B 8 is functional in the presence of the compound to be tested when compared to a cell not contacted with said compound; and (c) identifying the compound which inhibits SNX-B8 function and/or expression.
  • the above recited methods may comprise an additional step (V), wherein steps (a) and (b) are carried out in a control experiment in the absence of an inhibitor/antagonist to be screened.
  • SNX-B8/30 expression or function are particularly useful in the treatment of cancer.
  • the term “inhibitor”, “antagonist” denotes molecules or substances or compounds or compositions or agents or any combination thereof described herein below, which are capable of inhibiting and/or reducing SNX-B8/SNX30 expression and/or function.
  • the term “inhibitor” when used in the present application is interchangeable with the term “antagonist”.
  • the term “inhibitor” comprises competitive, non-competitive, functional and chemical antagonists as described, inter alia, in Mutschler, “Arzneistoff Stren” (1986),ticianliche Verlagsgesellschaft mbH, Stuttgart, Germany.
  • partial inhibitor in accordance with the present invention means a molecule or substance or compound or composition or agent or any combination thereof that is capable of incompletely blocking the action of agonists through, inter alia, a noncompetitive mechanism. It is preferred that said inhibitor alters, interacts and modulates SNX- B8/SNX30 expression and/or function.
  • the invention also provides for a method for identifying an agonist/enhancer of SNX-B 8 molecule expression comprising the steps of:
  • the invention also provides for a method for screening of an agonist/enhancer for SNX-B 8 function comprising the steps of:
  • steps (c) identifying the compound which alters SNX-B8 function and/or expression may also comprise an additional step Qo'), wherein steps (a) and (b) are carried out in a control experiment in the absence of an agonist/enhancer to be screened.
  • the present invention also relates to a method for identifying a compound which is capable of enhancing or reducing the expression of the SNX-B 8/SNX30 gene comprising the steps of contacting a cell which expresses the SNX-B8/30 gene from its natural promoter or a reporter gene driven by the SNX-B 8/SNX30 promoter and determining whether the expression of the gene is increased or reduced when compared to conditions in which the compound is not present.
  • candidate molecules or candidate mixtures of molecules may be, inter alia, substances, compounds or compositions which are of chemical or biological origin, which are naturally occurring and/or which are synthetically, recombinantly and/or chemically produced or compounds or compositions described hereinabove.
  • candidate molecules may be proteins, protein-fragments, peptides, amino acids and/or derivatives thereof or other compounds, such as ions, which bind to and/or interact with SNX-B8/SNX30.
  • Such binding and/or interacting candidate compounds may be found employing, inter alia, yeast two-hybrid systems or modified yeast two-hybrid systems as described, for example in Fields, Nature 340 (1989), 245-246; Gyuris, Cell 75 (1993), 791-801; or Zervos, Cell 72 (1993), 223-232.
  • agonist in accordance with this invention, molecules/substances are denoted which have an affinity as well as an intrinsic activity.
  • said intrinsic activity ( ⁇ ) is defined as being proportional to the quotient of the effect, triggered by said agonist (EA) and the effect which can be maximally obtained in a given biological system (Emax): therefore, the intrinsic activity can be defined as
  • an agonist or full agonist is an endogenous substance or a drug that can interact with SNX-B8/SNX30 and initiate a maximal or complete physiological or a pharmacological response characteristic of SNX-B8/SNX30.
  • a partial agonist is an endogenous substance or a drug that also provokes physiological or a pharmacological response but, the maximum response is less than the maximum response to a full agonist, regardless of the amount of drug applied.
  • the methods for screening "inhibitors” or “activators” of SNX-B8/30 may also be employed for the screening of medically useful activators of SNX-9 or SNX- 18 (for example for the intervention in Alzheimer's disease or diabetes) or medically useful inhibitors of SNX-9 or SNX- 18 expression or function. These inhibitors of other subgroup members SNX-9/SNX-18 may also be employed in the treatment of, inter alia, cancer as described for SNX-B8/30 inhibitors/antagonists.
  • the person skilled in the art may easily modify the above recited screening methods by employing, inter alia, SNX-9 or SNX- 18 polypeptides, or nucleic acid molecules encoding the same.
  • test compound refers to a molecule or substance or compound or composition or agent or any combination thereof to be tested by one or more screening method(s) of the invention as a putative "inhibitor” or “activator'V'enhancer” of SNX-B8/SNX3O.
  • a test compound can be any chemical, such as an inorganic chemical, an organic chemical, a protein, a peptide, a carbohydrate, a lipid, or a combination thereof or any of the compounds, compositions or agents described herein. It is to be understood that the term “test compound” when used in the context of the present invention is interchangeable with the terms “test molecule”, “test substance”, “potential candidate”, “candidate” or the terms mentioned hereinabove.
  • small peptides or peptide-like molecules as described hereinbelow are envisaged to be used in the screening methods for "inhibitor(s)" or “activators” SNX-B8/SNX3O.
  • Such small peptides or peptide-like molecules bind to and occupy the active site of a protein thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented.
  • any biological or chemical composition(s) or substance(s) may be envisaged as SNX-B 8/SNX30 inhibitor or activator.
  • the inhibitory function of the inhibitor can be measured by methods known in the art and by methods described herein.
  • Such methods comprise interaction assays, like immunoprecipitation assays, ELISAs, RIAs as well as specific inhibition assays, like the assays provided in the appended Examples.
  • elements of the SNX-B8/SNX30 pathway may be used, e.g., enzymes.
  • Said enzymes may be present in whole cell extracts of cells expressing SNX- B8/SNX30 or said enzymes may be purified, partially purified or recombinantly expressed as described hereinbelow.
  • candidate molecules or candidate mixtures of molecules to be used when contacting a cell expressing SNX-B 8/SNX30 may be, inter alia, substances, compounds or compositions which are of chemical or biological origin, which are naturally occurring and/or which are synthetically, recombinantly and/or chemically produced.
  • candidate molecules may be proteins, protein-fragments, peptides, amino acids and/or derivatives thereof or other compounds, such as ions, metabolites, intermediates or enzymes.
  • Synthetic compound libraries are commercially available from Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, N.J.), Brandon Associates (Merrimack, N.H.), and Microsource (New Milford, Conn.).
  • a rare chemical library is available from Aldrich (Milwaukee, Wis.).
  • libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available from e.g. Pan Laboratories (Bothell, Wash.) or MycoSearch (N.C.), or are readily producible.
  • natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means.
  • a combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building block" reagents.
  • a linear combinatorial chemical library such as a polypeptide library is formed by combining amino acids in every possible combination to yield peptides of a given length. Millions of chemical compounds can theoretically be synthesized through such combinatorial mixings of chemical building blocks.
  • libraries of compounds are screened to identify compounds that function as inhibitors or activators of the target gene product, here SNX- B8/SNX30 (or the gene target product of the other member of the subgroup defined herein, namely SNX-9 or SNX-18).
  • SNX- B8/SNX30 or the gene target product of the other member of the subgroup defined herein, namely SNX-9 or SNX-18.
  • a library of small molecules is generated using methods of combinatorial library formation well known in the art.
  • U. S. Patent Nos. 5,463,564 and 5,574,656 are two such teachings.
  • the library compounds are screened to identify those compounds that possess desired structural and functional properties.
  • U. S. Patent No. 5,684, 711 discusses a method for screening libraries. To illustrate the screening process, the target cell or gene product and chemical compounds of the library are combined and permitted to interact with one another.
  • a labeled substrate is added to the incubation.
  • the label on the substrate is such that a detectable signal is emitted from metabolized substrate molecules.
  • the emission of this signal permits one to measure the effect of the combinatorial library compounds on the enzymatic activity of target enzymes by comparing it to the signal emitted in the absence of combinatorial library compounds.
  • the characteristics of each library compound are encoded so that compounds demonstrating activity against the cell/enzyme can be analyzed and features common to the various compounds identified can be isolated and combined into future iterations of libraries. Once a library of compounds is screened, subsequent libraries are generated using those chemical building blocks that possess the features shown in the first round of screen to have activity against the target cell/enzyme.
  • some techniques involve the generation and use of small peptides to probe and analyze target proteins both biochemically and genetically in order to identify and develop drug leads.
  • Such techniques include the methods described in PCT publications No. WO 99/35494, WO 98/19162, WO 99/54728.
  • candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 Daltons, preferably less than about 750, more preferably less than about 350 daltons.
  • Candidate agents may also comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise carbocyclic or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Exemplary classes of candidate agents may include heterocycles, peptides, saccharides, steroids, and the like.
  • the compounds may be modified to enhance efficacy, stability, pharmaceutical compatibility, and the like.
  • Structural identification of an agent may be used to identify, generate, or screen additional agents.
  • peptide agents may be modified in a variety of ways to enhance their stability, such as using an unnatural amino acid, such as a D-amino acid, particularly D-alanine, by functionalizing the amino or carboxylic terminus, e.g. for the amino group, acylation or alkylation, and for the carboxyl group, esterification or amidification, or the like.
  • Other methods of stabilization may include encapsulation, for example, in liposomes, etc.
  • candidate agents are also found among biomolecules including peptides, amino acids, saccharides, fatty acids, steroids, purines, pyrimidines, nucleic acids and derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides.
  • libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced.
  • natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries.
  • Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alleviation, esterification, amidification, etc. to produce structural analogs.
  • candidate compounds to be used as a starting point for the screening of inhibitors of SNX-B8/SNX30 are aptamers, aptazymes, RNAi, shRNA, RNAzymes, ribozymes, antisense DNA, antisense oligonucleotides, antisense RNA, antibodies, affybodies, trinectins, anticalins, or the like compounds which are described in detail hereinbelow.
  • the person skilled in the art is readily in a position to have candidate compounds at his disposal which can be used in the screening methods for inhibitors of SNX-B8/SNX30 biosynthesis as a basis to, inter alia, improve or further develop the capability of such compounds to inhibit or activate SNX-B8/SNX30 biosynthesis. Accordingly, the person skilled in the art can readily modify such compounds by methods known in the art to improve their capability of acting as an inhibitor in the sense of the present invention.
  • the capability of one or more of the aforementioned compounds to inhibit SNX-B8/SNX30, preferably in a eukaryotic cell, more preferably in mammalian cells is tested as described hereinabove.
  • the SNX-B8/SNX30 as described herein are isolated and expressed. These recombinant proteins are then used as targets in assays to screen libraries of compounds for potential drug candidates.
  • a number of highly sensitive cell-based assay methods are available to those of skill in the art to detect binding and interaction of test compounds with specified- target molecules.
  • these methods are generally not highly effective when the test compound binds to or otherwise interacts with its target molecule with moderate or low affinity, hi addition, the target molecule may not be readily accessible to a test compound in solution, such as when the target molecule is located inside the cell or within a cellular compartment such as the periplasm of a bacterial cell.
  • current cell-based assay methods are limited in that they are not effective in identifying or characterizing compounds that interact with their targets with moderate to low affinity or compounds that interact with targets that are not readily accessible.
  • the cell-based assay methods of the present invention have substantial advantages over current cell-based assays.
  • This information is used to design subsequent directed libraries containing compounds with enhanced activity against the target molecule. After one or several iterations of this process, compounds with substantially increased activity against the target molecule are identified and may be further developed as drugs. This process is facilitated by use of the sensitized cells of the present invention since compounds acting at the selected targets exhibit increased potency in such cell-based assays, thus, more compounds can now be characterized providing more useful information than would be obtained otherwise.
  • the method for screening inhibitors or activators SNX- B8/SNX30 (or the other members of the herein defined subgroup, namely SNX-9 or SNX- 18) function or expression are screened in a high through put screening assay.
  • High-throughput screening methods are described in U.S. Pat. Nos. 5,585,277 and 5,679,582, in U.S. Ser. No. 08/547,889, and in the published PCT application PCT/US96/19698, and may be used for identifying an inhibitor or activator of SNX-B8/SNX30 function or expression as described herein.
  • High-throughput screening methods and similar approaches which are known in the art (Spencer, Biotechnol. Bioeng.
  • the invention also provides for a method for the production of a pharmaceutical composition comprising the screening methods of the invention and, optionally, further comprising a pharmaceutically acceptable carrier and/or a diluent and/or an excipient and/or a microcapsulated host cell.
  • kits comprising a SNX-B8/30 polynucleotide, the SNX-B 8/30 polypeptide, the antagonist/inhibitor or the agonist/enhancer of the invention.
  • the kit of the present invention further comprises, optionally (a) reaction buffer(s), storage solutions and/or remaining reagents or materials required for the conduct of scientific or diagnostic assays or the like.
  • parts of the kit of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units.
  • the kit of the present invention may be advantageously used, inter alia, for detecting one or more of the nucleic acid molecules described herein which encode (a) polypeptide(s) involved endocytotic pathways as described herein.
  • said kit could be, for example, employed in a variety of applications, e.g., as diagnostic kit, as research tool or therapeutic tool.
  • the kit of the invention may contain means for detection suitable for scientific, medical and/or diagnostic purposes.
  • the manufacture of the kits follows preferably standard procedures which are known to the person skilled in the art.
  • a method for the preparation of a non- human double transgenic animal comprising the steps of
  • the above method for the preparation of a "double transgenic animal” comprises a further step, i.e. a step (c), wherein said offspring is again mated and whereby generating double- homozygous non-human transgenic animals.
  • a step (c) wherein said offspring is again mated and whereby generating double- homozygous non-human transgenic animals.
  • heterozygous non-human animals are useful in particular in drug screening assays, however also as scientific, medical and pharmacological research tools.
  • the invention also relates to double-transgenic animals obtained by the method described herein. It is evident for the person skilled in the art that also other double-transgenics may be obtained and produced by mating a given non-human transgenic animals with a "SNX-B 8/30 transgenic" as provided herein.
  • the invention also provides for any double-transgenic non-human animal wherein at least one copy of the SNX-B 8/30 ortholog is modified/mutated or wherein at least one copy of a heterologous SNX8/30 (for example the human SNX8/30 described herein expressed in a mouse) is expressed.
  • a heterologous SNX8/30 for example the human SNX8/30 described herein expressed in a mouse
  • the term "comprising a modification of/in a gene” may relate to the expression of an additional gene, for example a heterologous gene from a different species or to the expression of a(n) additional copy (copies) of said gene, e.g. also genes of the same species (so-called “over”-expressors). Said term also relates to genes which are mutated, silenced and/or down-regulated. The same applies mutatis mutandis for the "SNX-B8/3O" transgenics defined herein above.
  • the term "gene which is related to APP processing” comprises, inter alia, wildtype genes, like APP, presenilins, (presenilin 1 or presenilin 2) or BACE. Said wildtype genes may be overexpressed or may relate to heterologously expressed wildtype genes like the expression of corresponding human genes in a non-human transgenic animal. It is evident for the skilled artisan that the term "a gene which leads to an altered APP metabolism” may not only comprise the expression of a (heterologous) wildtype gene or additional copies of a homologous wildtype gene but also to gene(s) comprising a mutation. For example may APP expressed in said non-human transgenic animal which comprises a mutation like, e.g. the Swedish-, Arctic-, Indiana- or London mutation.
  • APP mouse models there are age-related accumulations of amyloid-beta (Abeta)- containing neuritic plaques in the hippocampus and cerebral cortex, activation of astrocytes and microglial cells in regions containing plaques, and degeneration of cholinergic nerve terminals in brain regions that eventually become plaque containing.
  • Abeta amyloid-beta
  • Missing in the APP and PS mouse models are neurofibrillary tangles and robust neuronal loss in cerebral cortical and subcortical regions such as the basal forebrain cholinergic andiocus coeruleus noradrenergic nuclei.
  • Neurofibrillary tangles can be produced in mice expressing mutant tau protein, and the tangle formation is further enhanced in animals that also express mutant APP.
  • Studies in APP mouse models indicate that, like AD, there are abnormalities in adult hippocarnpal neurogenesis.
  • the animal models of AD are employed to develop and test treatments that reduce brain levels of the Abeta42 protein, neuritic plaque load and glial activation.
  • the mating with the non-human transgenic animals of this invention lead to double-transgneic animals which are particularly useful in drug screening approaches for medicaments to stop the neurodegenerative process and restore hippocampal neurogenesis, damaged brain circuits may be replaceable in patients with AD.
  • the Swedish mutation is associated with elevated levels of production of AB in brain, plasma, and fibroblasts of affected and at-risk individuals and in a variety of cells transfected with such constructs; see Suzuki in Science 1994, 264:1336-1340. Both studies document aggregation and phenotypic activation of microglia associated with dense amyloid deposits, but limited or no association of microglia with diffuse amyloid deposits.
  • Non-human transgenic animals comprising a gene mutation or a gene insertion leading to a modified APP metabolism may, e.g., be selected from the group consisting of animals expressing human APP or a variant/mutation thereof, like the "Swedish mutation”, “Indiana mutation” and/or the "London mutation; V642I". It is also envisaged and non-limiting that animals comprising a gene encoding the "Flemish” or "Arctic" mutation are employed in context of this invention.
  • Such animals are well known in the art, see, inter alia, Dominguez-del-Toro (2004) Eur J Neurosci. 20(7): 1945- 1952; Wenk (2004) Neuroscience.;125(3):769-776 or Jin (2004) Proc Natl Acad Sci U S A. 101(36):13363-13367. It is also envisaged to mate the non-human transgenic animals of this invention ("SNX-B 8/30 animals") with animal models lacking APP, like mice described by Wang (2005) J Neurosci. 2005 Feb 2;25(5):1219-25.
  • PSl presenilin 1
  • AD Alzheimer's disease
  • changes in the presenilin metabolism and fucnetion have been associated with modified APP-metabolism.
  • double-mutated non-human transgenic animals are to be produced in accordance with this invention, wherein a first mutation relates to SNX-B 8/30 and the second mutation influences presenilin expression and/or function.
  • These animals may have an alteration in their presenilin 1 or 2 or may express presenilin form another sprecies, like PSl or PS2 from human. Therefore, also presenilin (in a particular 1) animals (in particular mice) are useful in the embodiment provided above.
  • presenilin transgenic animals are known in the art, see, inter alsi, Cataldo 2004; J Neuropathol Exp Neurol. 63(8):821-30; Jankowsky (2004) Neurobiol Aging. 25(7):885-92.
  • BACE amyloid precursor protein
  • non-human transgenic animals may be mated with the non-human transgenic animals provided in this invention, i.e. the SNX-B8/30 over-expressing animals or animals where the corresponding ortholog comprises a mutation, like, inter alia, SNX-B8/30 knock-outs.
  • a corresponding, non-limiting example may be, the double transgenic for amyloid precursor protein (AA substitution K670N,M671L) and presenilin-1 (AA substitution M146V) where both synaptic and cognitive deficits have been described, see, e.g. Gong, 2004, J Clin Invest. 114:1624-1634.
  • non-human transgenic animals may be obtained by the method provided above, whereby as mating partners non-human transgenic animals are employed which comprise a modification in genes relating to metabolic pathways, in particular to the insulin pathway.
  • non-human transgenic animals provided herein and comprising a modified gene relating to the herin described SNX B8/30 gene (or an orthologue thereof) are, in accordance with this invention amted with such animals comprising gene modifications in a metabolic pathway.
  • non-limiting examples of such non-human transgenic animals, having modifications in a metabolic pathway, like the insulin pathway are provided below.
  • the terms "gene which alters insulin metabolism” or " a gene which is related to the insulin pathway” may comprise heterologously wildtype genes, additional copies of the relevant (homologous) wildtype genes as well as mutated versions of said genes. Also comprised are in the context (as well as in the context relating to APP processing or APP metabolism) "knock-out” or “knock-down” non- human transgenic animals to be mated with the herein defined "SNX-B8/30" non-human transgenics.
  • insulin metabolism or "insulin pathway” may comprise, but are not limited to insulin, insulin receptor(s), insulin- like growth factor(s), insulin receptor substrate(s), lipoprotein lipase(s), PD kinase, Akt3 and the like.
  • IGF-I insulin-like growth factor I
  • IR insulin receptor
  • IGF-IR insulin-like growth factor I receptor
  • IGF-IR insulin receptor substrates 1-4
  • IRS 1-4 insulin receptor substrates 1-4
  • Fernandez et al. ((2001) Genes Dev. 75, 1926) generated a mouse model of diabetes which over-expresses a dominant-negative form of IGF-IR specifically in muscle.
  • Expression of the mutant IGF-IR resulted in the formation of hybrid receptors between the mutant and the endogenous IGF-I and insulin receptors, thereby abrogating the normal function of these receptors and leading to insulin resistance.
  • IRS 1-4 are all involved in insulin signaling, but their knock-out has differential effects on insulin signaling and - in particular - on glucose metabolism and insulin resistance (for a review see Le Roith (2002) Curr Opin Clin Nutr Metab Care 5:371). Knock-out of IRSl and 2 revealed a role in insulin responsiveness in major tissues, IRS4 had a role in glucose tolerance, whereas IRS3 knock-out mice did not seem to be essential in these processes. Thus, IRS-I, -2 and -4 transgenic animals may be used for mating with the non-human "SNX-B8" transgenics provided herein.
  • Another genetic (mouse) model for diabetes has a transgenic muscle- and liver-specific overexpression of lipoprotein lipase (Kim et al. (2001) Proc. Natl Acad Sci 98,7522). Muscle- lipoprotein lipase mice had a 3-fold increase in muscle triglyceride content and were insulin resistant because of decreases in insulin-stimulated glucose uptake in skeletal muscle and insulin activation of insulin receptor substrate- 1 -associated phosphatidylinositol 3-kinase activity.
  • liver-lipoprotein lipase mice had a 2-fold increase in liver triglyceride content and were insulin resistant because of impaired ability of insulin to suppress endogenous glucose production associated with defects in insulin activation of insulin receptor substrate-2-associated phosphatidylinositol 3-kinase activity. Accordingly, also this non-human transgenic is to be mated with the SNX-B8/30 animals provided herein.
  • tansgenic ,,SNX-B8/30 animals which show a reduced expression of , e.g. PI-3 kinase or Akt-2.
  • a reduced expression may, inter alia, be obtained by employing corresponding RNAi technology, i.e. the generation of non-human tansgenic animals expressing a corresponding inhibitory molecule, like an RNAi.
  • a "double-transgenic" non-human animal which has/comprises at least one modified/altered or at least one additional SNX- B8/30 allele or gene copy and at least one further modified or altered allele of a further genetic locus (or an additional, further heterologous gene/allele).
  • double-transgenic non-human animals are particularly useful in screening methods as provided herein as well as research tools in, inter alia, neurological research, obesity research, diabetes research or cancer research.
  • the above defined uses of the polynucleotides encoding SNX-B8/30, of SNX-B8/30 polypeptides (or functional fragments thereof), of the vector provided herein, of the inventive host cells as well as of the agonists/enhancers of SNX-B8/30 defined herein are particular relevant in a medical setting, in particular in the treatment, prevention and/or amelioration of neurological neurodegenerative disorders as well as in metabolic disorders, in particular diabetes and/or obesity.
  • the corresponding method of preventing, ameliorating and/or treating said disorders comprises the administration of any of the above recited compounds in a pharmaceutically acceptable form and in a therapeutically active amount to a subject in need of such a treatment, prevention and amelioration.
  • the neurodegenerative disorder to be treated is Alzheimer's disease. Further corresponding disorders are provided herein above.
  • the invention provides for a method of treating, ameliorating and/or preventing cancer (or a tumorous disease) and/or transferrin receptor related disorders by administering to a subject in need of such a treatment, amelioration and/or prevention a pharmaceutically active form and in a therapeutically active amount of an antagonist/inhibitor of SNX-B8/30 (or of SNX-9 and/or SNX-18), of an inhibiting RNA,shRNA, RNAi or siRNA of the invention or of (inhibiting or antagonizing) antibody as defined above.
  • the subject to be treated by the methods provided herein is preferably a human subject.
  • the term "subject” means an individual in need of a treatment of an affective disorder.
  • the subject is a vertebrate, even more preferred a mammal, particularly preferred a human.
  • the subject will receive a "therapeutically effective amount” or a “pharmaceutically effective amount” of the inventive substances disclosed herein.
  • administered means administration of a therapeutically effective dose of the aforementioned inventive compounds to an individual.
  • therapeutically effective amount is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art. The methods are applicable to both human therapy and veterinary applications.
  • the compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways as discussed below.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt %.
  • the agents maybe administered alone or in combination with other treatments.
  • the administration of the pharmaceutical composition can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, intraarterial, intranodal, intramedullary, intrathecal, intraventricular, intranasally, intrabronchial, transdermal ⁇ , intranodally, intrarectally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly.
  • the candidate agents may be directly applied as a solution dry spray.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • the molecular machinery receives incoming signals and reacts by increasing ⁇ - cleavage of APP.
  • Figure 2 The novel sorting nexin SNX-B8: sequence alignment, domain structure, homologues
  • the SH3 domain is underlined with a box, the PX domain with a black bar and the BAR domain with a dotted line.
  • the novel SNX-B8 is a homologue of SNX9 and SNXl 8 and consists of a SH3 domain, a PX domain and a BAR domain.
  • the domain between the SH3 and the PX domain is now termed low-complexity domain, but is not indicated in the figure, (figure adapted from Habermann (2004) EMBO Rep. 5, 250)
  • SNXB8-HA was immunoprecipitated with HA antibodies (1:200) from 293E cell lysates transiently overexpressing SNXB8-HA.
  • Immunoprecipitated SNXB8-HA coupled to Protein A Sepharose (PAS) was incubated with (+) or without (-) shrimp alkaline phosphatase (SAP at a dilution of 1:100) in SAP Buffer containing protease inhibitors (protease inhibitor mix, Sigma) overnight at 37°C. After centifugation PAS beads were incubated with protein loading buffer at 95°C and loaded on a 8 % SDS gel, blotted and analyzed with an HA antibody.
  • HEK293 cells stably expressing the alkaline phosphatase (AP)-APP fusion protein were transiently transfected with empty control (Con) vector, with the known APP ⁇ -secretase ADAMlO (ADlO), SNX-B8, wild-type dynamin (Dyn), a dominant-negative dynamin mutant (DynK44A) or a dominant-negative dynamin mutant lacking its N-terminus (Dyn ⁇ NT).
  • ADlO ADAMlO
  • SNX-B8 wild-type dynamin
  • DynK44A wild-type dynamin
  • DynK44A dominant-negative dynamin mutant
  • Dyn ⁇ NT dominant-negative dynamin mutant lacking its N-terminus
  • the phosphatase activity measured in the conditioned medium was corrected for the protein concentration in the cell lysate (relative AP activity) and represents the mean of at least two independent experiments, each one carried out in duplicate.
  • aliquots of the conditioned medium were treated for 30 min at 65 0 C to heat- inactivate the endogenous alkaline phosphatase activity.
  • the experiment was carried out as in Fig. 4B.
  • the indicated plasmids were used for transfection. All four proteins carrying the HA epitope tag were expressed in the cell lysate as determined by immunoblot analysis using an antibody against the HA-tag. To this aim, aliquots of the lysates (corrected for protein concentration in the lysates) were directiy loaded onto the electrophoresis gels.
  • Antibody HA.11 was purchased from Covance.
  • FIG. 5 SNX-B8 stimulates the a- and ⁇ -secretase cleavage of APP HEK293 cells expressing endogenous APP (left panels) and COS7 cells stably transfected with APP (right panel) were transiently transfected with SNX-B 8 carrying the HA epitope tag or with empty control vector. Experiments were carried out in duplicate. Secreted APP was detected in the supernatant with antibodies specific for ⁇ - (W02) or ⁇ -secretase cleaved APP (192 wt).
  • APP in the cell lysate was detected with antibody 6687 against the C- terminus of APP (epitopes of the antibodies are indicated in Fig. 4A).
  • SNX-B8 expressed in the cell lysate was detected with an antibody against the HA-tag.
  • a ⁇ was immunoprecipitated from the conditioned medium with a polyclonal antiserum against A ⁇ and detected with monoclonal antibody 6E10.
  • the APP uptake assay was essentially carried out as described previously (Kaether et al., J. Cell Biol. 158, 551). In brief: one day after transfection, COS cells transiently transfected with ⁇ CEP-APP695 and GFP or pCEP-APPwt and SNXB8-GFP grown on glass coverslips were incubated on ice with anti-APP antibody 5313 (polyclonal, against ectodomain of APP) diluted 1:200 in PBS supplemented with 0.5 niM MgCl 2 and 1 mM CaCl 2 for 20 min, washed with cold PBS and returned to standard medium at 37°C .
  • HEK293 cell lysates were precipitated with a polyclonal antibody against SNX-B8.
  • the same antibody was used for detection in the immunoblot and revealed two to four protein bands of a similar apparent molecular weight of around 75 kDa (labeled SNX-B8), which correspond to the protein bands of HA-epitope tagged SNX-B8 expressed in HEK293 cells (direct loading of cell lysates).
  • the heavy chain of the SNX-B8 antibody used for the immunoprecipitation is detected in the left lane (labeled IgG). The vertical line between the two lanes indicates that both lanes were next to each other on the same blot, but that a longer exposure of the blot was used for the right lane (no immunoprecipitation).
  • GFP fluorescence was detected by standard procedures using a fluorescence microscope.
  • Figure 8 SNX-B8 inhibits endocytosis of transferrin (Tf) in a dose-dependent manner
  • COS cells transiently transfected with GFP as a control or GFP-tagged SNX- B8 were incubated on ice with Alexa-fluorophore labeled Tf. After removing the non-bound Tf the cells were moved back to 37 0 C, allowing endocytosis of the bound Tf. After 7 or 20 min respectively, the cells were fixed and analyzed by fluorescence microscopy for internalized fluorescent Tf. At 7 min, most GFP expressing cells showed Tf endocytosis. At the same time most cells weakly expressing SNX-B8 showed endocytosis, whereas cells with a middle or strong expression of SNX-B8 showed strongly reduced or no endocytosis, respectively. At 20 min, SNX expressing cells showed increased rates of endocytosis, revealing that SNX-B8 expression does not completely abolish but reduce the rate of Tf endocytosis.
  • FIG. 9 RNAi experiment A. Reduction of SNX-B8/30 expression by RNAinterference.
  • HEK293 cells were transiently co-transfected with HA-epitope tagged SNX-B 8/30 and either empty pSuper vector (control) or pSuper RNAi vector containing the indicated short hairpin sequences of the SNX-B8 sequence. Aliquots of cell lysates were directly loaded onto electrophoresis gels. Immunoblot detection was carried out with an anti-HA-tag antibody.
  • Short hairpin sequences encoding bases 13-31 (ggccgagccctctatgact; SEQ ID NO: 7; see RNAi I) or 1629-1647 (gcacatgatgcagaactac; SEQ ID NO: 8; see RNAi II) of SNX-B8/30 were cloned into the pSuper vector (Brurnmelkamp et al. Science 2002, 296, 550).
  • HEK293 cells were transiently co-transfected with HA-epitope tagged SNX-B8/30 and either empty pSuper vector (control) or pSuper RNAi vector containing the indicated short hairpin sequences of the SNX-B8 sequence. Aliquots of cell lysates were directly loaded onto electrophoresis gels. Immunoblot detection was carried out with an anti-HA- tag antibody.
  • Example 1 Expression cloning screen for activators of APP shedding
  • a dominant-negative dynamin mutant has previously been shown to inhibit APP endocytosis and to stimulate APP secretion, presumably by making more APP available for ⁇ -secretase cleavage at the cell surface. Together, these cDNAs validate the screening approach since that physiologically relevant cDNAs were obtained.
  • a novel protein has been identified. Based on the predicted protein-domain structure the novel protein can be assigned to the sorting nexin (SNX) protein family. Sorting nexins are a large family of proteins (Fig. 2B). Their biological function is only partly understood. SNXs are thought to be involved in intracellular transport from and to the endosomes and may be involved in regulating stability and degradation of cell surface receptors (Worby and Dixon, 2002). Currently, 29 SNXs have been described.
  • SNXs are characterized by the presence of a well-conserved phosphoinositide-binding domain (PX domain, Fig. 2B) but otherwise do not share a high degree of similarity (Fig. 2A). In fact, some SNXs may not even function in protein trafficking and therefore be falsely assigned to the SNX group (Worby and Dixon, 2002). SNXs can be divided into subgroups depending on what other domains are present besides the PX domain (Fig. 2B).
  • the BAR domain was originally referred to as coiled coil domain (Lundmark and Carlsson, 2004).
  • the herein illustrated SNX- B8/30 sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2 and relate to the human protein.
  • C. elegans comprises only one SNX of the herein defined SNX-B8/30, SNX-9 and SNX-18 family.
  • Genbank entries NM_153271 (hypothetical protein MGC32065), BC018775, AL833039 and ACl 05020 appear to be identical to the cDNA provided herein.
  • the cDNA obtained in the examples provided here has however a longer 5' untranslated region (5' UTR) than most submitted sequences, but has the same 5'UTR as ACl 05020.
  • the molecule provided herein is surprisingly be shown as being a functional member of the SNX-family and is denoted in context of the invention as "SNX30" or "SNX-B8". The above receited Genebank entries are not annotated.
  • SNX-B8/SNX30 encoded protein has a homology of 50-60% on protein-level to its homologues SNX9 and 18, with the homology being higher within the SH3, the PX and parts of the BAR domain.
  • SNX9 and SNX-18 sequences are provided in SEQ ID NOS: 3 and 4 and SEQ DD NOS: 5 and
  • the alignment values were calculated by blasting the SNX-B8/SNX30 nucleotide sequence against the Genbank database.
  • the only SNX homologue obtained is SNXl 8, which shows in three short stretches (72, 56, 31 bp) the following homology- values:
  • the alignment values were calculated using the EMBL-EBI Emboss program:
  • the C.elegans SNX (lst-4) is more homologous to the SNX-B8/SNX30 described herein than to SNX9 and SNX18.
  • the alignment values were calculated by blasting the human SNX- B8 protein sequence against the Genbank database.
  • the alignment values were calculated using the EMBL-EBI Emboss program:
  • Transfection studies were carried out using lipofectamine 2000 according to the manufacturers instructions (Invitrogen). Transfection of SNX-B 8/SNX30 into human embryonic kidney HEK293 cells, followed by its detection in the cell lysate by Western blotting reveals a protein with an apparent molecular weight of around 70-75 kDa (Fig. 3), which is in the range of its calculated molecular weight (65 IcDa). The protein shows two to four bands of slightly different molecular weight, which can be converted to a single band upon dephosphorylation (Fig. 3). This result reveals that SNX-B8/SNX30 may be phosphorylated at multiple sites.
  • SNX-B8/SNX30 is also expressed endogenously in HEK293 cells, where it shows the same pattern in the immunoblot as the transfected protein (as shown in Figure 7A). Moreover, SNX-B8/SNX30 is ubiquitously expressed, as analyzed by Northern blot (as shown in Figure 7B). Immunofluorescence of C-terrninally GFP -tagged SNX-B8/30 shows a partly cytoplasmic and partly membrane-associated and vesicular staining (as shown in Figure 7C), which is consistent with the function of the SNX in membrane and protein trafficking processes.
  • HEK293 cells stably expressing the alkaline phosphatase (AP)-APP fusion protein were transiently transfected with empty control (Con) vector, or the same vector encoding HA epitope tagged SNX-B 8.
  • Con empty control
  • the phosphatase activity measured in the conditioned medium was corrected for the protein concentration in the cell lysate (relative AP activity) and represents the mean of at least two independent experiments, each one carried out in duplicate.
  • aliquots of the conditioned medium were treated for 30 min at 65 °C to heat-inactivate the endogenous alkaline phosphatase activity.
  • Example 5 Specificity of the APP shedding effect
  • SNXl another member of the SNX family, which does not belong to the same subgroup as SNX9/18/B8 defined herein, did not have any effect on APP shedding (Fig. 4C). This suggests that the observed effect is specific for the SNX-B8/SNX3O and corresponding homologue subgroup. Moreover, SNX-B8/SNX30 and SNX9 had no effect on the shedding of L-selectin and only a minor effect on the shedding of TNF receptor 2 (TNFR2), as measured by alkaline phosphatase fusions of both proteins (Fig. 4D).
  • TNFR2 TNF receptor 2
  • L-selectin and TNFR2 - like APP belong to a large and diverse group of membrane proteins undergoing ectodomain shedding (Blobel, 2002).
  • results provided herein show that the SNX9/18/B8 subgroup is not a general stimulator of protein shedding but specifically act on APP (or a subset of proteins) undergoing shedding. Accordingly, it was surprisingly found that the SNX9/18/30 subgroup provided herein is specifically involved in APP metabolism.
  • SNX-B8/SNX3O specifically stimulates ⁇ - or ⁇ -secretase cleavage of APP or both of them.
  • SNX-B8/SNX30 was transiently transfected into HEK293 cells expressing endogenous APP.
  • SNX-B8/SNX30 strongly stimulated ⁇ -secretase cleavage of endogenous APP but only had a minor stimulatory effect on ⁇ -secretase cleavage (Fig. 5).
  • Similar effects on ⁇ -secretase cleavage were observed in COS7 cells overexpressing APP.
  • ⁇ -secretase cleavage in the COS7 was not increased, but rather slightly reduced (Fig. 5).
  • Example 7 Functional characterization of SNX-B8/SNX30 in endocytosis in regard of APP
  • Example 8 Functional characterization of the sorting nexins with regard to insulin receptor signal transduction
  • RNA interference RNA interference
  • elegans has only one member of the SNX9/18/B8 group, termed lst-4 (Genbank accession number for the protein is CAD56253: C. elegans hypothetical protein Y37A1B.2 or lst-4), such that a loss-of-function phenotype of SNX-B8/SNX30 or its homologues should be more readily visible.
  • the C. elegans SNX-B8/SNX30 orthologue lst-4 has been identified by computational search of Notch receptor target genes and has been implicated in vulva development in C. elegans. Other functions or mechanistic details of its functions have not been described in that paper (Yoo et al., 2004). No other in vivo functional studies have been published about the SNX9/18/B8 group.
  • Wild-type C. elegans as well as mutant strains carrying known gain-of-function or loss-of- function mutations in genes in the insulin signaling pathway were incubated at 15°C or 26°C.
  • 15 0 C permissive temperature
  • the mutants behave as wild-type worms or show a mild phenotype.
  • 26°C non-permissive temperature
  • the mutant phenotype becomes fully visible.
  • worms with loss-of-function mutations in the insulin receptor (daf-2(el370)) or the PDK-I kinase (pdk-l(sa680) show no or only mild phenotypes compared to wild-type worms (upper part of table I).
  • the daf-2(el370); lst-4(RNA ⁇ ) worms show a synergistic effect, which is much stronger than the individual effects of the insulin receptor mutation (daf-2(el370)) or the SNX knock-down (lst-4(KNAi)) alone.
  • This synergistic effect indicates that both insulin receptor and the SNX act in the same pathway.
  • a similar synergistic effect is observed for the SNX knock-down in the PDK-I mutant worm (Ist- ⁇ (RNAi); pdk-l(sa680), again pointing to an essential role of the SNX in insulin signaling. Not only the insulin receptor but also the TGF ⁇ signaling pathway and the cGMP pathway control dauer formation.
  • Example 9 Co-immunoprecipitation of SNX9 and dynamin /SNX-B8/SNX30 and dynamin
  • HEK293 cells were transiently transfected with plasmids encoding SNX9 or SNX-B8/SNX3O. Both proteins carried a C-terminal HA-epitope tag. Transfection was carried out as described above. Two days after transfection cell lysates were prepared using the following buffer: 50 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40 and Sigma protease inhibitor mix. Cell lysates were incubated with anti-HA-tag antibody Ha.11 (Covance; dilution 1:100) and Protein A- Sepharose beads (30 ⁇ l). After rotating incubation at 4°C for 2 h, samples were precipitated by centrifugation.
  • the beads were washed 3 times with the above solubilization buffer or the buffer with an increased NaCl concentration (500 mM). Samples were boiled in protein sample buffer containing mercaptoethanol and loaded onto electrophoresis gels. For the detection of dynamin binding antibody dynamin I/II from Cell Signaling was used. The coimmunoprecipitation was also carried out under identical conditions using the dynamin antibody for immunoprecipitation and the HA antibody for detection.
  • Example 10 Screen for interaction partners for SNX9 and SNX-B8/SNX30 using split ubiquitin assay
  • the split ubiquitin assay (Fetchko (2004) Methods, 32, 349) which is similar to the Yeast- Two-Hybrid assay was used to screen for interaction partners. Screening with SNX9 reveals Nucleoporin, COG5, SEC6 and 14-3-3eta as potential binding partners. Screening with SNX- B8/SNX30 reveals RACKl as a potential binding partner. These results show that both SNXs have different binding partners and, thus, potentially different functions.
  • Example 11 Experimental set-up for testing the involvement of SNX-B8/SNX30 in insulin signaling in human cell lines:
  • a plasmid encoding SNX-B8/SNX3O is stably or transiently transfected into HEK293 cells. These cells are serum-starved for 3 hours and then stimulated for a few minutes with insulin or buffer (as a control). Cell lysates are prepared and tested by Western blotting for the amount of phosphorylated (and thus activated) ERK kinase and Akt kinase. Both kinases are activated by the insulin receptor. If increased amounts of phosphorylated kinases are detected upon insulin stimulation, this indicates that expression of the SNX stimulates insulin signaling. Additionally the opposite strategy is to be followed. Upon down-regulation of SNX-B8/SNX30 expression by RNAi, the effects on insulin signaling is to be measured.
  • Example 12 Functional differences between the known SNX9 and the inventive SNX- B8/SNX30 and functional analysis
  • the invention provides for a novel subgroup of sorting nexins comprising the members SNX- 9, SNX-18 as well as the herein identified SNX-B8/30.
  • SNX- 9, SNX-18 as well as the herein identified SNX-B8/30.
  • said members of the novel subgroup share functional and structural features, there are some differences as documented in this experimental part and as listed below.
  • the SNX-B8/SNX30 (and its homologues SNX9 and SNXl 8) modulate the intracellular trafficking of the insulin receptor, its interaction with cytoplasmic binding partners, as well as the endocytosis of the insulin receptor. Without being bound by theory it is speculated that the SNX binds directly to the insulin receptor. This is very likely, since the cytoplasmic domain of the insulin receptor comprises a proline-rich region, potentially binding to SH3 domains. Importantly, SNX-B8/SNX30 and its homologues have a SH3 domain.
  • the dynamin loss-of-function mutation led to early developmental arrest in C. elegans and thus to a much more severe phenotype than the RNAi of the C. elegans SNX (lst-4).
  • the C. elegans SNX lst-4 knock-down did not show a synergistic effect with the dynamin mutant (in contrast to the insulin signaling mutants), making it unlikely that SNX-B 8/SNX30 is required for exactly the same functions as dynamin.
  • SNX-B8/SNX30 is only expressed in multicellular organisms but not in yeast, where endocytosis occurs in the absence of SNX.
  • SNX-B8/SNX30 Given the function of SNX-B8/SNX30 in insulin signaling documented herein and in the endocytic process, there may be two mutually not excluding possibilities how the SNX may influence APP shedding. Since SNX-B 8/SNX30 is required for insulin signaling and since insulin signaling stimulates APP shedding, expression of SNX-B8/SNX30 stimulates APP shedding, potentially by stimulating insulin signaling.
  • SNX-B8/SNX30 influence the intracellular trafficking of APP, such as the endocytosis (as documented herein).
  • SNX expression level can undergo dramatic changes in vivo.
  • vulval precursor cells in C. elegans can have a high expression or a nearly completely suppressed expression level of the SNX-B8/SNX3O (Yoo et al., 2004).
  • SNX-B 8/SNX30 may control the amount of APP shedding through phosphorylation.
  • This invention also documents for the SNX-B8/SNX30. Since phosphorylation often modifies protein function, SNX-B8/SNX30 may be used as a molecular switch, which - depending on its phosphorylation status - could increase or decrease APP shedding and insulin signal transduction. Thus, SNX-B8/SNX30 may be used to influence the molecular processes underlying disorders or pathological conditions, like Alzheimer's disease and diabetes. Given, that SNX9 and SNXl 8 have similar effects on APP shedding as SNX-B8/SNX30 (Fig.
  • SNX-B8/SNX3O may be medically employed as SNX-B8/SNX3O.
  • SNX-9 and SNX-18 are comprised in a novel, functionally are structurally defined subgroup of sorting nexins. Accordingly, the embodiments provided herein for SNX-B8/30 apply, mutatis mutandis, for SNX-9 and SNX- 18. Therefore, the present invention also provides for screening methods for antagonists or agonists of SNX-9 and/or SNX- 18 function and/or expression.
  • the antagonists/agonists provided by the methods disclosed herein may specifically influence the function/expression of each SNX of the herein defined "SNX-9/18/B8"-subgroup but may also be agonists or antagonists for each member.
  • the agonists/enhancers of SNX-B 8 are particularly useful in the treatment of neurodegenerative disorders, like Alzheimer's disease.
  • agonist/enhancers (as well as the proteins themselves or nucleic acid molecules encoding the same) of SNX-B8 and/or SNX-18 may be used in medical intervention of metabolic disorders, like diabetes or obesity. Also the corresponding nucleic acid molecules may be employed, for example in gene therapy approaches. Corresponding medical means and methods are provided in the specification above as well as in the appended claims. .
  • the invention relates to and/or provides for the following sequences:
  • SEQ ID NO: 1 SNX-B8/30 (DNA, Homo sapiens)
  • SEQ ID NO: 3 SEQ ID NO: 3: SNX9 (DNA; Homo sapiens) atggccaccaccaaggctcgggttatgtatgattttgctgctgaacctggaaataatgaactgacggttaatgaaggagaaatcatcacaatc acaaatccggatgtaggtggaggatggctggaaggaagaaacatcaaaggagaacgagggctggttcccacagactacgttgaaatttttacccagtgatggaaaagatcaattttcttgtggaaattcagtggctgaccaagccttccttgattctctctcagccagcagctcaggc cagttcgtcggctgccagcaacaatcaccaggttggcggctgccagcaacaatcaccaggtt
  • SEQ ID NO: 4 SNX9 (Protein; Homo sapiens]
  • SEQ ID NO: 5 SNX18 (DNA; Homo sapiens)
  • SEQ ID NO: 6 SNX18 (Protein; Homo Sapiens)
  • SEQ ID NO: 7 target sequence RNAi-I directed against human SNX-B8/30 (nucleotide; Homo sapiens)
  • the corresponding strand and antisense sequences to be used are as follows: ggccgagcccucuaugacutt (SEQ ID NO: 28) and agucauagagggcucggcctt (SEQ ID NO: 29)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 8 target sequence RNAi-2 directed against human SNX-B8/30 (nucleotide; Homo sapiens)
  • the corresponding strand and antisense sequences to be used are as follows: gcacaugaugcagaacuactt (SEQ ID NO: 30) and guaguucugcaucaugugctt (SEQ ID NO: 31)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 9 target sequence RNAi-3 directed against human SNX-B8/30 (nucleotide; Homo sapiens)
  • the corresponding strand and antisense sequences to be used are as follows: ccucaaccguuucucaugctt (SEQ E) NO: 32) and gcaugagaaacgguugaggtt (SEQ ID NO: 33)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 10 Epitope of SNX-B8/30 (protein; Homo sapiens)
  • SEQ ID NO: 12 SNX-B8/30 (nucleic acid/mouse)
  • SEQ ID NO: 13 SNX-B8/30 (amino acid; mouse)
  • SEQ ID NO: 14 Rat orthologue of SNX-B8/30 (nucleic acid; rat)
  • SEQ ID NO: 15 Rat orthologue of SNX-B8/30 (amino acid; rat)
  • SEQ ID NO: 16 C. elegans orthologue of SNX-B8/30 (nucleic acid)
  • SEQ ID NO: 17 C. elegans orthologue of SNX-B8/30 (amino acid)
  • SEQ ID NO: 18 C. elegans SNX-B8/30 (Ist-4) RNAi sequence (1 st strand)
  • SEQ ID NO: 19 C. elegans SNX-B8/30 (Ist-4) RNAi sequence (2 nd strand)
  • SEQ ID NO: 20 target sequence RNAi-4 directed against human SNX-9 (nucleotide; Homo sapiens)
  • GAGAGUCAGCAUCAUGUCUTT SEQ ID NO: 34
  • the "tt" sequence at the 3 ' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector. .
  • SEQ ID NO: 21 target sequence RNAi-5 directed against human SNX-9 (nucleotide; Homo sapiens)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 22 target sequence RNAi-6 directed against human SNX-9 (nucleotide; Homo sapiens)
  • AACAGTCGTGCTAGTTCCTCA The corresponding strand and antisense sequences to be used are as follows: CAGUCGUGCUAGUUCCUCATT (SEQ ID NO: 38) and
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 23 target sequence RNAi-7 directed against human SNX-9 (nucleotide; Homo sapiens)
  • the corresponding strand and antisense sequences to be used are as follows: uucaguggcugaccaagcctt (SEQ ID NO: 40) and ggcuuggucagccacugaatt (SEQ ID NO: 41)
  • the "tt" sequence at the 3 ' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 24 target sequence RNAi-8 directed against human SNX-9 (nucleotide; Homo sapiens)
  • the corresponding strand and antisense sequences to be used are as follows: accuggcacggaacaguautt (SEQ ID NO: 42) and auacuguuccgugccaggutt (SEQ ID NO: 43)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides (dTdT), whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 25 target sequence RNAi-9 directed against human SNX-18 (nucleotide; Homo sapiens) CTGTGGGTTTCAGACTCAT
  • CUGUGGGUUUCAGACUCAUTT SEQ ID NO: 44
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 26 target sequence RNAi-IO directed against human SNX-18 (nucleotide; Homo sapiens)
  • GCAGGUGAUAUGGAGUGUATT SEQ ID NO: 46
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 27 target sequence RNAi-Il directed against human SNX-18 (nucleotide; Homo sapiens)
  • GGACCUAUUAGCGCUGUAUTT SEQ ID NO: 48
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides. Additionally, the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.
  • SEQ ID NO: 28 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens) ggccgagcccucuaugacutt
  • SEQ ID NO: 29 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • SEQ ID NO: 30 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • SEQ ID NO: 31 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • SEQ ID NO: 32 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • SEQ ID NO: 33 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • SEQ ID NO: 34 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 35 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 36 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens) CCUACUAACACUAAUCGAUTT
  • SEQ ID NO: 37 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 38 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 39 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 40 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 41 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 42 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 43 inhibiting RNA for SNX-9 (nucleotide; Homo sapiens)
  • SEQ ID NO: 44 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • CUGUGGGUUUCAGACUCAUTT SEQ ID NO: 45 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • SEQ ID NO: 46 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • SEQ ID NO: 47 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • SEQ ID NO: 48 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • SEQ ID NO: 49 inhibiting RNA for SNX-18 (nucleotide; Homo sapiens)
  • SEQ ID NO: 50 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • SEQ ID NO: 51 inhibiting RNA for SNX-B8/30 (nucleotide; Homo sapiens)
  • the "tt" sequence at the 3' end of the nucleotides are desoxyribonucleotides, whereas the preceding nucleotides are ribonucleotides.
  • the "tt" sequence at the 3' end of the nucleotides in context of inhibiting RNA provided herein may be employed in form of desoxyribonucleotides (dTdT), whereas the preceding nucleotides are ribonucleotides.
  • the indicated target sequence (as desoxyribonucleotides) may directly be cloned into siRNA vectors such as the pSuper vector.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a trait à un polynucléotide codant pour une nouvelle nexine de tri spécifique, la SNX-B8/30 ainsi qu'à un polypeptide codé par lesdits polynucléotides. L'invention a également trait à des utilisations spécifiques médicales, pharmaceutiques et scientifiques dudit nouveau membre d'un sous-groupe de nexines de tri (SNX) constitué de SNX-9, SNX-18 et de la SNX-B8/30 de l'invention. L'invention a trait en outre à des procédés de criblage spécifique pour des agonistes et des antagonistes exerçant une influence sur la fonction et/ou l'expression de la SNX-B8/30 et/ou d'autres membres de la sous-familles identifiée de l'invention de nexines de tri. Par conséquent, la présente invention a également trait à de nouvelles compositions pharmaceutiques. Ces compositions pharmaceutiques peuvent, entre autres, être utilisées dans le traitement de maladies/troubles liés au métabolisme de l'APP (pathologique) et/ou le métabolisme de l'insuline, tels que la maladie d'Alzheimer ou le diabète. L'invention a trait enfin à des animaux transgéniques non humains comportant une SNX-B8/30 modifiée et/ou altérée ou exprimant une SNX-B8/30 hétérologue.
PCT/EP2006/001800 2005-03-08 2006-02-27 Nexines de tri dans une intervention medicale de troubles neurologiques et/ou metaboliques WO2006094673A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP05005038 2005-03-08
EP05005038.4 2005-03-08

Publications (2)

Publication Number Publication Date
WO2006094673A2 true WO2006094673A2 (fr) 2006-09-14
WO2006094673A3 WO2006094673A3 (fr) 2006-12-14

Family

ID=36440930

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/001800 WO2006094673A2 (fr) 2005-03-08 2006-02-27 Nexines de tri dans une intervention medicale de troubles neurologiques et/ou metaboliques

Country Status (1)

Country Link
WO (1) WO2006094673A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012104836A1 (fr) * 2011-01-31 2012-08-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Snx9 en tant que nouveau biomarqueur pour l'inflammation chronique et l'immunosuppression associée et nouveau régulateur de l'expression des récepteurs de cellules t et fonction
WO2024068010A1 (fr) * 2022-09-30 2024-04-04 Universität Basel Cibler snx9 sauve les lymphocytes t recombinés dans le cadre d'une thérapie adoptive

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002101008A2 (fr) * 2001-06-08 2002-12-19 Incyte Genomics Inc. Molecules intracellulaires de signalisation
US20030171356A1 (en) * 2002-03-07 2003-09-11 Neurologic, Inc. Methods for alzheimer's disease treatment and cognitive enhancement
US20040016008A1 (en) * 2002-01-07 2004-01-22 Brimijoin William Stephen Hybrid transgenic mouse with accelerated onsent of Alzheimer type amyloid plaques in brain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002101008A2 (fr) * 2001-06-08 2002-12-19 Incyte Genomics Inc. Molecules intracellulaires de signalisation
US20040016008A1 (en) * 2002-01-07 2004-01-22 Brimijoin William Stephen Hybrid transgenic mouse with accelerated onsent of Alzheimer type amyloid plaques in brain
US20030171356A1 (en) * 2002-03-07 2003-09-11 Neurologic, Inc. Methods for alzheimer's disease treatment and cognitive enhancement

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012104836A1 (fr) * 2011-01-31 2012-08-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Snx9 en tant que nouveau biomarqueur pour l'inflammation chronique et l'immunosuppression associée et nouveau régulateur de l'expression des récepteurs de cellules t et fonction
WO2024068010A1 (fr) * 2022-09-30 2024-04-04 Universität Basel Cibler snx9 sauve les lymphocytes t recombinés dans le cadre d'une thérapie adoptive

Also Published As

Publication number Publication date
WO2006094673A3 (fr) 2006-12-14

Similar Documents

Publication Publication Date Title
US10774121B2 (en) Methods and compositions for treating neurodegenerative disorders and Alzheimer's Disease and improving normal memory
Hashimoto et al. Involvement of tyrosine kinases and STAT3 in Humanin-mediated neuroprotection
US20220090086A1 (en) Identification of molecular pathways and methods of use thereof for treating retinal neurodegeneration and other neurodegenerative disorders
Botzolakis et al. The effect of HSP-causing mutations in SPG3A and NIPA1 on the assembly, trafficking, and interaction between atlastin-1 and NIPA1
JP2002521004A (ja) ヒトβアミドイド前駆体タンパク質（β−ＡＰＰ）のヒトＬＯＮプロテアーゼ様タンパク質（ＨｓＬＯＮ）との相互作用
US20080227745A1 (en) Methods and compositions for soluble CPG15
WO2006094673A2 (fr) Nexines de tri dans une intervention medicale de troubles neurologiques et/ou metaboliques
JP2005518187A (ja) 心臓、心筋または心筋細胞の収縮能を増大する方法
AU2004233060A1 (en) A novel method of modulating bone-realted activity
EP1270588A1 (fr) Nouvelle proteine clac du type collagene, precurseur de ladite proteine, et genes codant pour cette proteine
US20060148057A1 (en) Thioredoxin mutants and uses thereof
US20220356218A1 (en) Methods and compositions for treating neurodegenerative disorders and alzheimer's disease and improving normal memory
WO2006017386A2 (fr) Intermédiaires de signalisation dans un modèle in vitro de la maladie d'alzheimer
Jessen Characterization of the protein phosphatase 1E (PPM1E): localisation and truncation in brain tissue and effects on neuronal morphology in primary neuronal culture
WO2012007740A1 (fr) Maladies neurodégénératives
CA2493007A1 (fr) Complexes proteiques de la proteine activatrice de la transcription de tip60
JP2002360252A (ja) アミロイド前駆体タンパク質代謝分解の阻害因子
JP2006075152A (ja) 細胞移動阻害剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

NENP Non-entry into the national phase in:

Ref country code: RU

WWW Wipo information: withdrawn in national office

Country of ref document: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06723132

Country of ref document: EP

Kind code of ref document: A2

WWW Wipo information: withdrawn in national office

Ref document number: 6723132

Country of ref document: EP