WO2006077736A1

WO2006077736A1 - Gene participating in silicon absorption and utilization of the same

Info

Publication number: WO2006077736A1
Application number: PCT/JP2005/024048
Authority: WO
Inventors: Jian Feng Ma
Original assignee: National University Corporation Kagawa University
Priority date: 2004-12-28
Filing date: 2005-12-28
Publication date: 2006-07-27
Also published as: JP2006187209A

Abstract

From a rice variant (lsi1 variant) having an activity of absorbing silicon, a gene participating in the silicon absorption is identified by the positional cloning and isolated as a novel gene. A transformant, which has the gene promoting the silicon absorption transferred thereinto, shows resistance against growth inhibitory stresses. Thus, it is possible to identify the gene participating in the silicon absorption, which has never been identified so far, and provide a method of using the gene.

Description

Specification

Genes involved in key absorption and use thereof

Technical field

[0001] The present invention relates to a gene involved in absorption of potassium that regulates the growth and hardness of plants, and the use thereof.

Background art

[0002] Monocotyledonous plants such as rice and wheat are typical plants that absorb a large amount of silicon (Si). Although key is not an essential element of plants, the properties of plants vary greatly depending on the amount of key accumulated.

[0003] For example, key elements are involved in plant growth, and when the amount of key elements accumulated increases,

(a) Resistance to disease and insect damage (for example, resistance to rice blast, coat blight and sesame leaf blight)

(b) Improvement of salt resistance and drought resistance

(c) To impart properties to plants such as tolerance to mineral stress (for example, reduction of toxicity due to inorganic substances such as aluminum and manganese, or improvement of effective utilization of phosphoric acid in plants).

[0004] In particular, the enhancement of resistance to diseases and insects due to an increase in the amount of accumulated potassium is a major cause of promoting plant growth.

[0005] Therefore, it can be said that increasing the amount of accumulated potassium is effective for the healthy growth of the plant and ensuring a stable yield. In addition, an increase in the amount of accumulated silicon is also effective in reducing various stresses such as biological stress and abiotic stress.

[0006] It is said that such resistance to complex stress is exerted by a large amount of key accumulated in tissues such as leaves, stems or fruit surfaces.

[0007] In addition, the key element is also involved in the hardness (viscosity) of the plant, and when the amount of accumulated key element decreases, the plant becomes softer. For example, soft rice has a low amount of accumulated keyine. This is because polymer (silica) is formed when the amount of cell accumulation in cells increases. This is to harden 1S cells.

[0008] Therefore, it can be said that reducing the amount of accumulated potassium is effective for changing (softening) the hardness of the plant.

[0009] As described above, by increasing the absorption of the plant by increasing the content of the key, it is possible to impart tolerance to the complex stress to the plant and promote the growth of the plant. On the other hand, if the absorption of the plant's absorption of silicon is suppressed to lower the content of the cage, the plant can be softened and softened.

[0010] However, the genes involved in the absorption of silicon have not yet been identified, and the mechanism of the absorption of plants in the plant has not been elucidated.

Disclosure of the invention

An object of the present invention is to identify a gene involved in absorption of silicon that has not been identified so far and to provide a method for using the gene.

[0012] The inventors of the present invention diligently studied a gene involved in strong absorption of key that has not been obtained so far. As a result, the gene was identified by map-based cloning using an F2 population obtained by crossing a mutant (lsil mutant) with a lower ability to absorb kaen compared to the wild type and Kasalath. As a result, the present inventors have succeeded in identifying the sequence and completed the present invention.

[0013] That is, the polynucleotide according to the present invention is a polynucleotide involved in the absorption of silicon,

The following (a) to (d) !, any polynucleotide:

(a) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1;

(b) Polynucleids that are hybridized under stringent conditions with either (i) or (ii) below:

(i) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1; or

(ii) a polynucleotide having a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1,

(c) a polynucleotide comprising the base sequence represented by SEQ ID NO: 3; or

(d) The following (iii) or (iv) under no stringent conditions Polynu clead Chido:

(iii) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3; or

(iv) It is characterized by having a polynucleotide power that is complementary to the base sequence shown in SEQ ID NO: 3! /

[0014] Here, in the present invention, "catheter absorption" refers to the absorption of kaen and compounds containing kaen (such as caic acid). For example, plants usually absorb keen as caustic acid. In addition, “involved in absorption of key” indicates that it is involved in suppression or promotion of such absorption.

[0015] Therefore, the "polynucleotide involved in the absorption of silicon" refers to a polypeptide that promotes absorption of the key or a polynucleotide that encodes a polypeptide that suppresses absorption of the key.

[0016] According to the above-described polynucleotide, a polypeptide involved in the absorption of silicon can be obtained as a translation product.

[0017] That is, according to the polynucleotide (a) or (b) above, a polypeptide that suppresses the absorption of silicon can be obtained as a translation product. On the other hand, according to the polynucleotide (c) or (d) described above, a polypeptide that promotes absorption of silicon can be obtained as a translation product.

[0018] Still other objects, features, and advantages of the present invention will be sufficiently enhanced by the following description. The benefits of the present invention will become apparent from the following description with reference to the accompanying drawings.

Brief Description of Drawings

FIG. 1 is a genetic map of the Lsil gene that is useful in the present invention.

FIG. 2 is a schematic diagram showing the structure and base substitution site on the genome of Lsil gene.

BEST MODE FOR CARRYING OUT THE INVENTION

[0020] An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this. SEQ ID NO: 1 is the nucleotide sequence of the Lsil gene (cDN A) of mutant rice. SEQ ID NO: 2 is an amino acid sequence encoded by the Lsil gene of the mutant rice of SEQ ID NO: 1. SEQ ID NO: 3 is the wild-type rice Lsil gene ( cDNA). SEQ ID NO: 4 is an amino acid sequence encoded by the Lsil gene of wild-type rice (vertical) of SEQ ID NO: 3. SEQ ID NO: 5 is the genome sequence of the Lsil gene of wild-type rice (Nipponbare).

[0021] (1) Polynucleotide useful for the present invention

The polynucleotide useful in the present invention encodes a polypeptide involved in the absorption of silicon.

Here, the “polynucleotide” can also be referred to as “nucleic acid” or “nucleic acid molecule”, and is intended to be a polymer of nucleotides. The “base sequence” can also be referred to as a “nucleic acid sequence” or a “nucleotide sequence”, and is indicated as a sequence of deoxyribonucleotides (abbreviated as A, G, C and T). The “polynucleotide having the base sequence ability shown in SEQ ID NO: 1” refers to a polynucleotide comprising the sequence shown by each of the dioxynucleotides A, G, C and Z or T of SEQ ID NO: 1. .

[0023] The polynucleotides of the invention may exist in the form of RNA (eg, mRNA) or in the form of DNA (eg, cDNA or genomic DNA). The DNA may be double stranded or single stranded. Single-stranded DNA or RNA can be the coding strand (also known as the sense strand) or the non-coding strand (also known as the antisense strand)! /.

[0024] The polynucleotide useful in the present invention is a polynucleotide involved in the absorption of silicon, and is any of the following (a) to (d)!

[0025] (a) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1;

(i) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1; or

(d) Polynucleids that are noisy under any of the following stringent conditions (iii) or (iv):

(iii) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3; or (iv) a polynucleotide having a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 3;

[0026] The polynucleotide (a) or (b) is a polynucleotide that suppresses absorption of silicon. The polynucleotide (c) or (d) is a polynucleotide that promotes absorption of silicon.

[0027] The above "stringent conditions" refer to hybrids only when at least 90% identity, preferably at least 95% identity, most preferably at least 97% identity exists between sequences. This means that a sesion occurs, for example, binding at 60 ° C under 2 X SSC wash conditions. The above hybridization can be performed by a conventionally known method such as the method described in “Molecular Cloning (Third Edition)” (J. bambrook & DW Russell, old Spring Harbor Laboratory Press, 2001). . Generally, the higher the temperature and the lower the salt concentration, the higher the stringency.

[0028] Among the above-mentioned polynucleotides, the polynucleotide consisting of the nucleotide sequences shown in SEQ ID NOS: 1 and 3 is a gene involved in the absorption of silicon, which was first identified in the plant kingdom.

[0029] The polynucleotide of SEQ ID NO: 1 is a base sequence (cDNA sequence) of a mutant Lsil gene derived from a rice mutant (lsil mutant). The lsil mutant is a mutant that has a lower ability to absorb keyine than wild-type rice. In addition, lsi mutants are softer than wild type because they have a small amount of accumulated potassium. Thus, SEQ ID NO: 1 is a polynucleotide (mutant Lsil gene) that suppresses the absorption of potassium derived from the lsil mutant having a low ability to absorb the key.

[0030] The polynucleotide of SEQ ID NO: 3 is the nucleotide sequence (cDNA) of the Lsil gene derived from wild type rice (vertical), which is expressed in the wild type rice. Rice is a typical plant that absorbs large amounts of potassium. Rice has a large amount of accumulated silicon, so it has resistance to diseases and insects, salt and drought resistance, and resistance to mineral stress. Thus, SEQ ID NO: 3 is a polynucleotide (wild-type Lsil gene) that promotes absorption of kaen derived from wild-type rice having high ability to absorb kaen.

[0031] Further, the polynucleotide useful in the present invention is a polynucleotide that codes for a polypeptide involved in the absorption of silicon, and the polynucleotide of any one of the following (a) to (d) is encoded. Polynucleotide.

[0032] (a) the amino acid sequence shown in SEQ ID NO: 2;

(b) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 2;

(c) the amino acid sequence shown in SEQ ID NO: 4; or

(d) An amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 4.

[0033] The above "one or several amino acids have been deleted, substituted, or added" means deletion, substitution, or addition by a known mutant polypeptide production method such as site-directed mutagenesis. (For example, 20 or less, preferably 10 or less, more preferably 7 or less, even more preferably 5 or less, particularly preferably 3 or less) of amino acids are substituted, deleted, or It means to be added. Such a mutant polypeptide is not limited to a polypeptide having a mutation artificially introduced by a known mutant polypeptide production method, but a similar naturally occurring mutant polypeptide is isolated and purified. It may be

[0034] As shown in the examples described later, the present inventor is that a polynucleotide involved in the absorption of rice, which is one of the polynucleotides that are useful in the present invention, exists in the second chromosome of rice. Was revealed. In addition, it was clarified that the 3rd exon region of chromosome 2 is particularly involved in the absorption of key elements. In other words, the key absorption activity is greatly changed by the mutation in the third exon region.

[0035] As such a mutation, for example, a hydrophobic amino acid encoded by the third exon in the second chromosome of rice is substituted with a hydrophilic amino acid, for example, the amino acid sequence shown in SEQ ID NO: 4 In the above, the 132rd amino acid force alanin force is replaced with threonine, and the like. The polypeptide shown in SEQ ID NO: 2 is a polypeptide that has been found by the inventor of the present application and that suppresses absorption of the enzyme encoded by the mutant Lsil gene. The polypeptide shown in SEQ ID NO: 4 is a polypeptide that promotes the absorption of silicon encoded by the wild-type Lsil gene.

[0036] Such amino acid mutations include polynucleotide mutations (deletions, substitutions, Or by addition). For example, one of the polynucleotides that is useful in the present invention can be expressed as a polynucleotide that has been subjected to polynucleotide force monobasic substitution (SNP) encoding a polypeptide that is involved in the absorption of silicon in wild rice. For example, the polynucleotide shown in SEQ ID NO: 3 matches the nucleotide sequence of the Nipponbare (wild type) cDNA clone published on the database (DDBJ Accession No. AK069842). The polynucleotide shown in SEQ ID NO: 1 is obtained by performing single base substitution from the 510th basic force G (guanine) to A (adenine) in the base sequence of the gene shown in SEQ ID NO: 3 ( (See also Figure 2). By this single base substitution, the polypeptide shown in SEQ ID NO: 2 (translation product of the base sequence of SEQ ID NO: 1) has the 132nd amino acid as alanine of SEQ ID NO: 4 (translation product of the base sequence of SEQ ID NO: 3). To threonine.

[0037] SEQ ID NO: 5 is a part of the genome sequence of the second chromosome of rice (wild type). FIG. 2 is a schematic diagram showing the structure and base substitution site on the genome of the Lsil gene shown in SEQ ID NO: 5. The sequence of SEQ ID NO: 5 corresponds to the 101780th to 105388th genome sequence of the rice genome sequence. The third exon of rice chromosome 2 corresponds to the 104018th to 104212th bases of the rice genome sequence, that is, the 2240th to 2435th bases of SEQ ID NO: 5. In SEQ ID NO: 5, the first exon is the 117th to 268th base, the second exon is the 411st to 635th base, the fourth exon is the 2540th to 2555th base, and the fifth exon is It corresponds to the 2950th to 3213th base, respectively. Note that the 1-base substitution in the third exon described below occurs at the 2257th base in SEQ ID NO: 3.

[0038] The polynucleotide useful in the present invention may be an oligonucleotide tide that is a fragment of the above-mentioned polynucleotide.

[0039] The polynucleotide or oligonucleotide useful for the present invention is not only a double-stranded DNA, but also a sense strand (coding strand) and an antisense strand (non-coding strand) t, each of which comprises single-stranded DNA. And RNA (eg, mRNA). In addition, the DNA includes, for example, cDNA and genomic DNA that can be obtained by cloning, chemical synthesis techniques, or a combination thereof. The base sequence shown in SEQ ID NO: 1, which is an example of a polynucleotide useful for the present invention, is the base sequence of the cDNA sequence of the polypeptide shown in SEQ ID NO: 2. [0040] Further, the polynucleotide or oligonucleotide according to the present invention may contain a sequence such as a sequence of an untranslated region (UTR) and a vector sequence (including an expression vector sequence).

[0041] The polynucleotide or oligonucleotide useful in the present invention can be used as a tool for gene expression manipulation by an antisense RNA mechanism. Antisense RNA technology is based on the introduction of chimeric genes that generate RNA transcripts complementary to the target gene. The resulting phenotype is a reduction of the gene product resulting from the endogenous gene. That is, by introducing antisense RAN, which is an oligonucleotide useful for the present invention, it is possible to adjust the absorption of silicon.

[0042] For example, by introducing an antisense RNA fragment of a polynucleotide that promotes absorption of potassium, the function of absorption of potassium can be reduced and the content of potassium in the plant can be reduced. Thereby, for example, feed rice having a low key content can be produced. Since feed rice is soft, it can be suitably used for livestock feed.

[0043] Examples of a method for obtaining a polynucleotide or oligonucleotide useful for the present invention include a method for isolating and cloning a DNA fragment containing a polynucleotide or oligonucleotide useful for the present invention by a known technique. . For example, prepare a probe that specifically hybridizes with a part of the nucleotide sequence of the polynucleotide of the present invention, and screen a genomic DNA library or cDNA library! As such a probe, if the probe specifically hybridizes to at least a part of the base sequence of the polynucleotide or the complementary sequence of the present invention, a misaligned sequence and Z or length can be used. Use things.

[0044] Further, examples of a method for obtaining a polynucleotide according to the present invention include a method using an amplification means such as PCR. For example, among the cDNA cDNAs of the present invention, primers are prepared from the 5 'side and 3, side sequences (or their complementary sequences), respectively, and genomic DNA (or cDNA) or the like is detected using these primers. A large amount of DNA fragments containing the polynucleotide according to the present invention can be obtained by performing PCR or the like in a mold and amplifying the DNA region sandwiched between both primers. In addition, for example, a primer that can amplify the Lsil gene region is designed based on the publicly known Nipponbare sequence information. A polynucleotide that is useful for the present invention can also be obtained by amplifying the Lsil gene region by converting the genomic DNA (or cDNA) or RT-PCR product into a saddle shape using the above primers.

[0045] The source for obtaining the polynucleotide useful for the present invention is not particularly limited, but it is preferably a gramineous plant. In the examples described later, the ability to obtain a mutant Lsil gene, which is one of the polynucleotides useful in the present invention, from a rice mutant (lsil mutant) is not limited thereto.

[0046] It should be noted that the polynucleotide useful in the present invention can be used to elucidate the mechanism of absorption of cage by plants, which has been clarified so far.

[0047] (2) Polypeptide according to the present invention

The polypeptide according to the present invention is a translation product of the polynucleotide described in (1) above, and is at least involved in the absorption of silicon.

Here, the “polypeptide” can also be referred to as “peptide” or “protein”. The “fragment” of a polypeptide indicates a partial fragment of the polypeptide.

[0049] The polypeptide of the present invention may be isolated from a natural source or chemically synthesized. Here, an “isolated” polypeptide or protein refers to the polypeptide or protein from which its natural environmental forces have been removed. For example, recombinantly produced polypeptides and proteins expressed in host cells have been isolated, as are natural or recombinant polypeptides and proteins that have been substantially purified by any suitable technique. Shall.

[0050] Polypeptides according to the present invention can be produced by natural purification products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, higher plant cells, insect cells, and mammals). (Including cells) Includes products produced by recombinant technology. Depending on the host used in the recombinant production procedure, the polypeptide of the present invention may be sugar chain-modified such as glycosyl potato. The polypeptide according to the present invention includes such a modified polypeptide.

[0051] The polypeptide according to the present invention is, for example, a polypeptide that is involved in at least absorption of silicon, and is any of the following (a) to (d)! [0052] (a) the amino acid sequence represented by SEQ ID NO: 2;

(b) In the amino acid sequence shown in SEQ ID NO: 2, this is a polypeptide that also has an amino acid sequence or force in which one or several amino acids are substituted, deleted, inserted, or added.

[0053] (c) the amino acid sequence shown in SEQ ID NO: 4; or

(d) A polypeptide having an amino acid sequence ability in which one or several amino acids are substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 4.

[0054] The polypeptide (a) or (b) is a polypeptide that suppresses absorption of silicon. On the other hand, the polypeptide (c) or (d) is a polypeptide that promotes absorption of silicon.

[0055] The polypeptide is not limited to the polypeptide as long as it is a polypeptide in which amino acids are peptide-bonded, but may contain a structure other than the polypeptide. The structure other than the polypeptide here is not particularly limited as long as it can include sugar chains and isoprenoid groups.

[0056] The polypeptide having the amino acid sequence ability shown in SEQ ID NO: 2 is a translation product of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1. In addition, this polypeptide is a polypeptide (mutant LSI1 protein) in which the 132nd amino acid in the amino acid sequence shown in SEQ ID NO: 4 (wild type LSI1 protein) is replaced by alanine to threonine. It is.

[0057] (3) Marker gene for transformation

The polynucleotide according to the present invention can be used as a marker gene for transformation. That is, the marker gene for selecting a transformant according to the present invention may be any gene as long as it is composed of the polynucleotide useful for the present invention described in (1) above. The polynucleotide useful in the present invention suppresses or promotes absorption of silicon. For this reason, the cell accumulation amount of the cells into which the polynucleotide according to the present invention is introduced is decreased or increased. Therefore, by measuring the amount of accumulated Ca (absorbed amount), cells into which the polynucleotide has been introduced can be selected. That is, it is possible to select cells whose absorption is promoted and cells whose absorption is suppressed.

[0058] In addition, the cells that have promoted absorption of kaen contain a large amount of kaen. Because germanium (Ge) is a family element with key, plants absorb germanium and key without distinguishing them. . However, germanium is a highly toxic element unlike key. For this reason, the cells whose absorption of potassium has been promoted cannot live on the germanium medium. In contrast, cells in which absorption of silicon is suppressed can survive in germanium medium. Therefore, by adding germanium to the medium, it is possible to select only the cells in which the absorption of silicon is suppressed.

[0059] Specifically, in order to use the polynucleotide according to the present invention as a marker gene for transformation, for example, an expression vector incorporating the polynucleotide is constructed, and the expression vector is introduced into a target cell. To do. When the expression vector is introduced and a polypeptide that suppresses the absorption of the key is expressed, the amount of the key accumulated in the cell decreases. On the other hand, when the polypeptide that promotes the absorption of potassium is expressed, the amount of accumulated potassium in the cell increases. Therefore, by culturing in the presence of potassium and measuring the amount of accumulated potassium before and after the introduction of the expression vector, it is possible to select cells expressing the polynucleotide involved in the absorption of the key. . In addition, for example, cultivars with strong key absorption activity or varieties with low key absorption activity can be selected.

[0060] In the above-described example, the polynucleotide according to the present invention is used for both the purpose of expressing a polynucleotide in a transformed cell and the marker gene. However, the polynucleotide useful for the present invention is used only as a marker gene. It is also possible to use it. In addition, for example, by using a transcription promoter specific to plant callus cells, it is possible to control the expression time as a selection marker of a polynucleotide that is useful in the present invention. In this case, an expression vector inserted with a gene encoding a protein to be expressed in the target cell may be constructed and transformed using the expression vector. It is also possible to introduce the polynucleotide useful for the present invention alone into a target cell without constructing an expression vector incorporating the polynucleotide according to the present invention.

[0061] It should be noted that in the present invention, stress that inhibits growth (for example, disease and insect damage, salt tolerance, and salt resistance and the like) by introducing the marker gene according to the present invention or the recombinant expression vector described below into cells. Also included is a method for selecting transformed cells, which provides cells with resistance to drought resistance and mineral stress, and promotes growth. [0062] Further, as described above, the polynucleotide represented by SEQ ID NO: 1 is identical to the 510th basic force G (guanine) to A (adenine) in the nucleotide sequence of the gene represented by SEQ ID NO: 3. It is a base-substituted one. For this reason, the polynucleotide containing the 510th base can be used as a marker gene for the present invention.

[0063] For example, in the polynucleotide shown in SEQ ID NO: 1, a polynucleotide having 20 to 100 consecutive bases including the 510th base is used to select a cell that suppresses absorption of potassium. be able to.

[0064] On the other hand, in the polynucleotide shown in SEQ ID NO: 3, a polynucleotide comprising 20 to: L00 consecutive basic forces including the 510th base is used for selecting cells that promote absorption of potassium. be able to.

[0065] That is, these polynucleotides can be used as marker genes for selecting cells involved in absorption of silicon.

[0066] (4) Recombinant expression vector and transformation kit for the present invention

The recombinant expression vector according to the present invention is not particularly limited as long as it contains the polynucleotide according to the present invention described in (1) above. For example, a recombinant expression vector into which the cDNA shown in SEQ ID NO: 1 or 3 is inserted can be mentioned. For the production of the recombinant expression vector, a plasmid, phage, cosmid or the like can be used, but it is not particularly limited. In addition, a manufacturing method may be performed using a known method.

[0067] The specific type of vector is not particularly limited, and a vector that can be expressed in a host cell may be appropriately selected. That is, if a promoter sequence is appropriately selected according to the type of host cell in order to reliably express the gene, and this and a polynucleotide useful for the present invention are incorporated into various plasmids or the like, it can be used as an expression vector.ヽ

[0068] The present recombinant expression vector can be used to express the polypeptide of the present invention! Needless to say, the polynucleotide according to the present invention is used as a marker gene, and the like. And can be used as a recombinant expression vector for expressing a protein encoded by the other gene.

[0069] Whether or not the polynucleotide useful for the present invention has been introduced into the host cell, and further the host cell Various markers may be used to confirm whether they are expressed reliably in the cell! For example, a drug resistance gene that gives resistance to antibiotics such as hygromycin is used as the best force, and a plasmid or the like containing this marker and a polynucleotide useful for the present invention is introduced into a host cell as an expression vector. Thereby, the expression power of the marker gene can be confirmed.

[0070] The host cell is not particularly limited as long as it is a cell or organism having a capacity of absorbing carbon, and various conventionally known cells can be preferably used. Specific examples include rice, cucumber, rape, and tomato, but are not particularly limited. The host cell is preferably a plant cell.

[0071] A method for introducing the above expression vector into a host cell, that is, a transformation method is not particularly limited. Conventionally known methods such as a method, a lithium acetate method, and a particle gun method can be preferably used.

[0072] The transformation kit according to the present invention only needs to contain at least one of the polynucleotide according to the present invention described in (1) above or the recombinant expression vector according to the present invention. Other specific configurations are not particularly limited, and necessary kits may be selected by appropriately selecting necessary reagents and instruments. By using the transformation kit, transformed cells can be obtained simply and efficiently.

[0073] (5) Transformant that is effective in the present invention

The transformant according to the present invention is introduced with the polynucleotide according to the present invention described in (1) above or the recombinant expression vector described in (4) above, and has a carrier absorption activity. There is no particular limitation as long as the transformant is capable of expressing a polypeptide having the above. Here, the “transformant” means not only a cell / tissue 'organ but also an individual organism.

[0074] Here, "the polynucleotide has been introduced" means that it is introduced into a target cell (host cell) so that it can be expressed by a known genetic engineering technique (gene manipulation technique). However, in addition to this, the present invention includes the case where the polynucleotide of the present invention contained in the genome is expressed in vivo. The polynucleotide of the present invention contained in this genome Examples of the expression of leotide in vivo include the aforementioned lsil mutant.

[0075] A method for producing a transformant (production method) is not particularly limited, and examples thereof include a method of transforming by introducing the above-described recombinant expression vector into a host cell. In addition, as long as the cells and organisms have the ability to absorb silicon, the organisms to be transformed are not particularly limited, and examples include plant cells exemplified as host cells in (4) above. .

[0076] The transformant that works for the present invention is preferably a plant cell or a plant. Such a transformed plant can reduce or increase the content (accumulation amount) of potassium in cells or plants. In the transformant in which the polynucleotide or the recombinant expression vector is introduced together with a promoter that promotes the expression of the polypeptide, absorption of the key is suppressed or promoted, and the amount of accumulated key is reduced or increased. Can be made.

[0077] Since the transformed sickle of the present invention is introduced with the polynucleotide according to the present invention, the absorption of potassium is suppressed or promoted.

[0078] Transformants (especially transformed plants) in which the absorption of potassium is suppressed become soft due to a decrease in the amount of accumulated potassium. Therefore, the transformant in which key absorption is suppressed can be suitably used as livestock feed.

[0079] On the other hand, transformants (especially transformed plants) with enhanced absorption of kaen are resistant to diseases and insects, resistant to salt and drought, and resistant to mineral stress due to an increase in the accumulation of kaen. Will improve. For this reason, the growth of the transformed product can be promoted.

[0080] Furthermore, since transformed plants with enhanced absorption of silicon have improved resistance to diseases and insects, transformed plants can be cultivated without using agricultural chemicals and chemical fertilizers as much as possible. . Therefore, organic cultivation and non-agricultural cultivation are possible, and a safer transformed product can be provided as food.

[0081] The recombinant expression vector used for transformation of the plant is not particularly limited as long as it can express the inserted gene in the plant cell. Especially when the method of introducing a vector into a plant is a method using agrobacterium. It is preferable to use a binary vector such as pBI. Specific examples of the noinary vector include pBIG, pBIN19, pBI101, pBI121, and pBI221. Moreover, a vector having a promoter capable of expressing a gene in a plant is preferable. Known promoters can be preferably used as the promoter, and specific examples include cauliflower mosaic virus 35S promoter (CaMV35S) and ubiquitin promoter. The plant cells include various types of plant cells such as suspension culture cells, protoplasts, leaf sections, and callus.

[0082] Introduction of recombinant expression vectors into plant cells includes agrobacterium infection method, electroporation method (elect mouth position method), calcium phosphate method, protoplast method, lithium acetate method, particle gun method, etc. Conventionally known methods can be used. In addition, regeneration of a plant body from transformed cells can be performed by a known method depending on the type of plant cell.

[0083] Transformation sickle body power into which the polynucleotide according to the present invention has been introduced into the genome, and once it has been obtained, the polynucleotide has also been introduced into the seed obtained from the plant body power. The present invention also includes seeds obtained from transformed plants.

[0084] (6) Food according to the present invention

The food of the present invention contains the transformant according to the present invention. That is, this food contains a transformant in which absorption of potassium is suppressed or promoted.

[0085] Since livestock tends to be hard and leave without eating the feed, it is not preferable to apply the hard to the feed. Since the transformant in which the absorption of silicon is suppressed is soft, the food containing the transformant can be particularly suitably used as a livestock feed.

[0086] On the other hand, a transformant with enhanced absorption of silicon can be cultivated without using agricultural chemicals and chemical fertilizers as much as possible. Therefore, the food containing the transformant can be provided as a safer food.

[0087] Thus, this food includes not only what humans ingest but also feed for livestock.

[0088] In recent years, there has been an interest in food safety, and food safety with higher safety is desired. The For this reason, attention is paid to agricultural products produced by organic and non-pesticide (reduced pesticide) cultivation that uses little or as much pesticides as possible.

[0089] Rice is a high-consumption plant that is considered a staple food in many parts of the world, not by the power of Japan. Fruits and vegetables are also high in production and consumption. For this reason, safety is especially important for these crops.

[0090] Therefore, the food containing the transformant in which absorption of potassium is promoted is preferably an agricultural product such as rice, vegetables, and fruits. This makes it possible to grow useful rice (rice), vegetables, and fruits that are highly safe.

[0091] Since the lsil mutant is a somatic mutant that is not a transformant, the lsi mutant is

It can be used for cultivation as it is. In addition, lsi mutants can be directly used for conventional hybrid breeding.

As described above, the polynucleotide useful in the present invention is a polynucleotide involved in the absorption of silicon,

The following (a) to (d) !, any polynucleotide:

(a) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1;

(i) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1; or

(iii) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3; or

[0092] According to the above-described polynucleotide, a polypeptide involved in the absorption of silicon can be obtained as a translation product. [0093] That is, according to the polynucleotide (a) or (b) above, a polypeptide that suppresses absorption of the key can be obtained as a translation product. On the other hand, according to the polynucleotide (c) or (d) described above, a polypeptide that promotes absorption of silicon can be obtained as a translation product.

[0094] The polypeptide according to the present invention is a polypeptide involved in the absorption of silicon, and is any of the following (a) to (d):

(a) the amino acid sequence shown in SEQ ID NO: 2;

(c) the amino acid sequence shown in SEQ ID NO: 4; or

(d) The amino acid sequence shown in SEQ ID NO: 4 is characterized by comprising a polypeptide having an amino acid sequence ability in which one or several amino acids are substituted, deleted, inserted, or added.

[0095] According to the above-mentioned polypeptide, absorption of silicon can be suppressed or promoted.

[0096] That is, according to the polypeptide (a) or (b) above, it is possible to suppress absorption of silicon. On the other hand, according to the above-mentioned polypeptide (c) or (d), absorption of silicon can be promoted.

[0097] Such a polypeptide involved in the absorption of silicon exists, for example, in a region containing the amino acid encoded by the third exon of the second chromosome in rice. Rice has a high absorption capacity for key elements. That is, rice has a polypeptide (polynucleotide) that promotes absorption of silicon. However, a polypeptide substituted with a hydrophobic amino acid force hydrophilic amino acid encoded in this region suppresses absorption of silicon. For example, in the amino acid sequence shown in SEQ ID NO: 4, a polypeptide substituted with the 132nd amino acid force alanin force threonine or the like suppresses absorption of the key. The polypeptide shown in SEQ ID NO: 4 is an amino acid sequence of a polypeptide that is involved in rice absorption (promotes absorption).

[0098] Further, the polynucleotide useful in the present invention may encode any of the above polypeptides. According to the above polynucleotide, the poly- gen that participates in the absorption of silicon. Peptides can be obtained as translation products. Examples of the polynucleotide include the polynucleotides (a) to (d) described above.

[0099] A marker gene for selection of transformants that is useful in the present invention is one having any of the above-mentioned polynucleotide strengths.

[0100] The polynucleotide according to the present invention can give a cell (in particular, a plant cell) in which it is expressed a function of suppressing or promoting absorption of potassium.

[0101] That is, by suppressing the absorption of the key, the amount of the key accumulated in the cell can be reduced. As a result, cells expressing a polypeptide that suppresses absorption of silicon are softened. Therefore, a marker gene composed of a polynucleotide encoding a polypeptide that suppresses absorption of key can be used as a marker gene for selecting transformed cells expressing the polypeptide that suppresses absorption of key. .

[0102] In addition, by promoting absorption of potassium, it is possible to increase the amount of accumulated potassium in the cell. As a result, cells expressing a polypeptide that promotes the absorption of silicon have improved resistance to various stresses such as disease and insect damage. For this reason, a marker gene comprising a polynucleotide encoding a polypeptide that promotes absorption of key can be used as a marker gene for selecting transformed cells that express the polypeptide that promotes absorption of key. it can.

[0103] These marker genes can also be used to select varieties having a strong key absorption activity and varieties or a weak key absorption activity.

[0104] A recombinant expression vector useful in the present invention contains any of the above-mentioned polynucleotides. The above-described recombinant expression vector can be used as a recombinant expression vector for introducing a polynucleotide useful for the present invention into a cell. It can also be used as a recombinant expression vector for introducing these genes into cells.

[0105] The transformant useful in the present invention has the above-described polynucleotide or the above-described thread-and-replaceable expression vector introduced therein and expresses a polypeptide involved in the absorption of silicon. is there. Here, since the polynucleotide is a polynucleotide involved in absorption of silicon, the transformant is preferably a plant (transformed product). [0106] This transformant has been introduced together with a promoter that promotes the expression of the above-mentioned polynucleotide or the polypeptide involved in the thread-reversible expression vector force absorption. For this reason, by expressing a polypeptide that suppresses or promotes absorption of potassium, the amount of accumulated Ca in this transformant can be reduced or increased.

[0107] Since livestock tends to leave a hard feed without eating, it is not preferable to apply a hard plant to the feed. Transformants in which the absorption of key is suppressed are softened due to a decrease in the amount of stored key. Therefore, the transformant in which key absorption is suppressed can be suitably used as livestock feed.

[0108] In addition, the transformant in which absorption of potassium is promoted is improved in resistance to diseases and insects, salt resistance and drought resistance, and resistance to mineral stress due to an increase in the amount of accumulated potassium. For this reason, transformation and growth of a product can be promoted.

[0109] Furthermore, since transformed plants with enhanced absorption of silicon have improved resistance to diseases and insects, transformed plants can be cultivated with minimal use of pesticides and chemical fertilizers. . Therefore, organic cultivation and non-agricultural cultivation are possible, and a safer transformed product can be provided as food.

[0110] The food according to the present invention contains the transformant. That is, this food

In addition, a transformant in which absorption of potassium is suppressed or promoted is included.

[0111] Since a transformant in which absorption of silicon is suppressed is soft, a food containing the transformant can be suitably used particularly as a livestock feed.

[0112] On the other hand, transformants with enhanced absorption of silicon can be cultivated without using agricultural chemicals and chemical fertilizers as much as possible. Therefore, the food containing the transformant can be provided as a safer food.

[0113] A transformation kit according to the present invention is characterized by containing at least one of the above-described polynucleotides or the above-described recombinant expression vector. By using the above transformation kit, a transformant expressing the polypeptide of the present invention can be obtained simply and efficiently.

As described above, according to the polynucleotide according to the present invention, it is possible to suppress or promote the absorption of the key by producing the polypeptide involved in the absorption of the key. And In the transformant of the present invention in which the polynucleotide of the present invention or a thread-replaceable expression vector containing the polynucleotide is introduced together with a promoter that promotes the expression of the polypeptide, the absorption of potassium is suppressed or promoted and the accumulation thereof The amount can be reduced or increased.

[0114] Decrease in the amount of accumulated potassium softens hard plants. For this reason, the transformed product with suppressed absorption of silicon can be used for livestock feed. On the other hand, an increase in the amount of accumulated potassium confers resistance (resistance) to various stresses such as disease and insect damage, and promotes growth. For this reason, if a transformed plant that promotes absorption of silicon is used, it is possible to cultivate a safer transformed plant without using agricultural chemicals and chemical fertilizer as much as possible.

The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope shown in the claims. That is, embodiments obtained by combining technical means appropriately modified within the scope of the claims are also included in the technical scope of the present invention.

[0115] The specific embodiments or examples made in the section of the best mode for carrying out the invention are merely to clarify the technical contents of the present invention. Various modifications can be made within the spirit of the present invention and the following claims, which should not be construed as narrowly limited to only examples.

[Example 1]

In this example, a detailed linkage analysis of the gene (Lsil gene) region involved in the absorption of key elements was performed by map-based cloning using a large-scale segregated population.

[0117] (a) Creating a population for linkage analysis

A population was created to map the Lsil gene of rice mutant (lsil mutant).

[0118] That is, first, an F1 individual was obtained by crossing an lsil mutant line with an Indian type cultivar Kasalath. And this F group was selfed and F2 group (105 individuals) was obtained.

[0119] Next, this F group individual was classified into an EST-PCR marker and an SSR marker (so-called my

2

The Lsil gene was mapped by analysis using a crostellite marker. As a result, as shown in Fig. 1, it became clear that the Lsil gene sits on chromosome 2. The flanking markers for the Lsil gene were RM5303 and E60168. [0120] The marker E60168 is open to RGP (Rice Genome Reasearch Program; http: / 1 rgp.dna.afflx.go.jp/publicdata/caps/index.html). The marker RM5303 is disclosed on the GRAMENE website (http: 〃 dev.gramene.org/micro sat / ssr.html).

[0121] The molecular marker map published by the Rice Genome Project uses a cross population of "Nippon Hare" and "Kasaras". Since these are crosses of different ecological rice, Japanese rice and Indian rice, polymorphism detection is detected rather than a population based on crosses between Japanese rices (differs in nucleotide sequences are detected. This makes it easy to determine the force from which parent a specific part of the genome is derived from. A part of Kasara's genome sequence is published in the Rice Genome Project, and new molecular markers can be created easily. Based on the above, Kasalath was used as a pollen parent for map group creation in this example.

[0122] (b) Map-based cloning of Lsil gene

In order to create a highly accurate genetic map of the Lsil gene region, linkage analysis was further performed using F2 population individuals (5000 individuals). In this analysis, SSR marker and CAPS (Cleaved Amplified Polymorphic Sequence) marker were used. Then, for each individual in the F2 population, the amount of absorption of key was measured, and inferior homozygous individuals (total of 807 individuals) that did not absorb key were selected. Thereafter, using the SSR marker (RM5303) and the PCR-based marker (E60168) present on both sides of the Lsil gene, chromosome recombination individuals in the vicinity of the Lsil gene were selected. As a result, 170 recombinant individuals were selected.

[0123] (c) Selection of Lsil gene

Next, a detailed linkage map with the following markers was created using the recombinant individuals selected in (b).

[0124] That is, a novel PCR polymorphism marker and a CAPS marker were created using the nucleotide sequence between the marker RM5303 and the marker E60618 existing in the vicinity of the Lsil locus. Then, using these markers, the recombinant individuals selected in (b) were selected to narrow down candidate regions for the Lsil gene. As a result, the Lsil gene was identified by the marker AP5297-8U (5′-CCCATTGATTAGTTCCCTGA-3 ′; SEQ ID NO: 26) / AP5297-8L (5′-CCGCAT ATGTCCTCCATGAC-3,; SEQ ID NO: 27) and marker AP4114- 3U (5,-ATCT GGGTCTATCATCCTGG-3,; SEQ ID NO: 28) / AP4114- 3L (5, -ACTGGTGCACTAT AATGCGC-3 '; SEQ ID NO: 29) It was revealed that it exists in the approximately 24.9 kb genomic region.

[0125] It also became apparent that the two PAC clones (AP5297 and AP4114) contain the Lsil locus.

[0126] In this way, the locus position of the Lsil gene was identified.

[0127] (d) Identification of Lsil gene by nucleotide sequence analysis

Based on the nucleotide sequence information between the marker AP5297-86962 / 87135L and the marker AP4114- 3U / 3L, PCR polymorphism markers and CAPS markers were prepared, and the Lsil gene was further narrowed down. As a result, a recombinant individual containing only the Lsil gene was obtained.

[0128] Next, the base sequence analysis of the candidate genome region was performed for a recombinant individual containing only the Lsil gene. Nucleotide sequence analysis was performed by designing primers that can amplify the relevant part from the already obtained Nipponbare base sequence information, and cloning genomic PCR and RT-PCR products. Table 1 and SEQ ID NOs: 6 to 25 show the positions of the designed primers and the corresponding base sequence of Nipponbare (PAC4114). The rice PAC clone is obtained by inserting a genomic DNA fragment of the rice cultivar “Nippon Hare” into P1 phage. PAC4114 is one of them, and the Lsil genome sequence shown in SEQ ID NO: 5 is inserted. That is, “PAC4114” in Table 1 is the one obtained by inserting the genomic sequence of the Nipponbare Lsil gene of SEQ ID NO: 5 into an artificial chromosome derived from P1 phage.

[0129] [Table 1]

Nipponbare base sequence

Ho. Primer Name Array

Location of PAC4114

1.GR48U 5 'CGGCATGGAAAACGTACGTA 3' 54098-54117

2.GR48L 5 'CCGTAGTACATGGTAGGCAT 3' 54888-54907

3. G 1-8U 5 'A6AAGGTGAGGAGTCTGGAG 3' 54949-54968

4.11U 5 'TTCAGGTATGCAGATGCAGC 3' 55316 ~ 55335

5. G 1-6L 5 'GCCGAAGTAGTGCATGGCTT 3' 55429- 55448

6. 20U 5 'TTCAGTCTAGCTTATGTCGC 3'

7.11L 5 'GGCTCCAGCTAGCTAGACAA 3' 56098 ~ 56117

8.22U 5 'CAAGTGTCCGTAGCGATACA 3' 56516-56535

9.20L 5 'ATAGCGGCAACTAGCTTAGC 3' 56688 One 56707

10.GR1-9U 5 'GGCTTCAACAGAGACATCTC 3' 56789-56808

11. CU 5 'GTCGAGGTCATCGTGACGTT 3' 57055— 57074

12.GR1-1L 5 'AACGTCACGATGACCTCGAC 3' 57055-57074

13.GR1-2L 5 'GCGTGACGAACATCATGTTG 3' 57075-57094

14. DL 5 'ATCGACGACAAGGAGGTGAA 3' 57140— 57159

15.GR1-7L 5 'TGGTCTTGCTACTAGCTCCA 3' 57395-57414

16. GR1-10U 5 'AAAAGTCAAACTAACCTGGC 3' 57467- 57486

17.BL 5 'TTCTCCATCTCGTCGACGTC 3' 57868-57887

18. AL 5 'TCACACTTGGATGTTCTCCA 3'

19. CL 5 'AGTGATGACGAGACCGAGAT 3' n 5 i7955—57974

20. GR1-8L 5 'TCAGGTCAACCAAGCTCTAT 3' 5839 o9— 58418

s

[0130] As a result of comparing the nucleotide sequences of the obtained clone (mutant) gene and the Nipponbare (wild type) gene, one base substitution was found. This substitution was present in the third exon (symbol 3 in FIG. 2) in the genomic structure of the Lsil gene shown in FIG. That is, as shown in FIG. 2, in the 104036th basic mutant in which the third exon on the genome is present, wild type guanine was replaced with adenine. This substitution was made by replacing the wild-type (SEQ ID NO: 3) G (guanine) at the 512th base of the Lsil gene cDNA sequence with a mutant (SEQ ID NO: 1) A (adenine).

[0131] By this base substitution, the amino acid encoded by these genes is substituted from the wild type (SEQ ID NO: 4) alanine to the mutant type (SEQ ID NO: 2) threonine.

[0132] In order to narrow down the cDNA sequence, first, the region containing the Lsil gene was narrowed down using the F2 population, and then the RiceGAAS (Rice Genome Automated Annotation system: http: // ri cegaas.dna.affrgo. Gene prediction was performed using jp /). As a result, two genes were predicted in that region. For these two genes, Nipponbare base sequence and 93 Using the markers created based on the base sequence data of 11 (a kind of indy varieties), it was narrowed down by using the markers until it finally became one gene

[0133] And KOME (Knowledge-based Oryza Molecular biology Encyclopedia: http://cdna01.dna.affix.go.jp/cDNA/) The rice genome sequence was obtained from RGP (Rice Genome Reasearch Program: http: 〃 rgp.dna.alfrc.go.jp/) of the National Institute of Agricultural Resources and Bioresources. From the result of comparing these two sequences, the sequence shown in SEQ ID NO: 1 was determined to be the full-length cDNA sequence of the Lsil gene.

[0134] When this nucleotide sequence was searched from a database, it became clear that it had homology with the water channel of corn.

Industrial applicability

[0135] The polynucleotide of the present invention is a gene involved in absorption of silicon, which was first identified in plants. Decreasing the amount of accumulated silicon softens hard plants. An increase in the amount of accumulated potassium confers resistance (resistance) to various stresses such as disease and insect damage, and promotes growth. Therefore, the present invention can be suitably used particularly in agriculture and the food industry.

Claims

The scope of the claims

[1] A polynucleotide involved in the absorption of silicon,

The following (a) to (d) !, any polynucleotide:

(a) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1;

(i) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1; or

(c) a polynucleotide comprising the base sequence represented by SEQ ID NO: 3;

(iii) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 3; or

(iv) a polynucleotide having a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 3;

[2] A polypeptide involved in the absorption of silicon,

The following (a) to (d) !, any polypeptide:

(a) the amino acid sequence shown in SEQ ID NO: 2;

(b) a polypeptide having an amino acid sequence ability in which one or several amino acids are substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 2;

(c) the amino acid sequence shown in SEQ ID NO: 4; or

[3] The polypeptide according to claim 2, wherein the hydrophobic amino acid encoded by the third exon in the second chromosome of rice is substituted with a hydrophilic amino acid.

[4] The polypeptide according to claim 3, wherein in the amino acid sequence shown in SEQ ID NO: 4, the 132rd amino acid is substituted from alanine to threonine.

[5] A polynucleotide that encodes the polypeptide according to claim 2!

[6] A marker gene for selecting a transformant comprising the polynucleotide according to claim 1 or 5.

[7] A recombinant expression vector comprising the polynucleotide according to claim 1 or 5.

[8] A transformant into which the polynucleotide according to claim 1 or 5 or the recombinant expression vector according to claim 7 has been introduced, and which expresses a polypeptide involved in the absorption of silicon. .

[9] A food comprising the transformant according to claim 8.

[10] A transformation kit comprising at least the polynucleotide according to claim 1 or 5 or the recombinant expression vector according to claim 7.