WO2006069160A2 - Engineering resistance to pierce's disease by expression of a xylella fastidiosa heca-like hemagglutinin protein - Google Patents

Engineering resistance to pierce's disease by expression of a xylella fastidiosa heca-like hemagglutinin protein Download PDF

Info

Publication number
WO2006069160A2
WO2006069160A2 PCT/US2005/046395 US2005046395W WO2006069160A2 WO 2006069160 A2 WO2006069160 A2 WO 2006069160A2 US 2005046395 W US2005046395 W US 2005046395W WO 2006069160 A2 WO2006069160 A2 WO 2006069160A2
Authority
WO
WIPO (PCT)
Prior art keywords
xylella fastidiosa
hemagglutinin
nucleic acid
heca
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/046395
Other languages
French (fr)
Other versions
WO2006069160A3 (en
Inventor
Bruce C. Kirkpatrick
Magalie R. R. Guilhabert
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to US11/793,916 priority Critical patent/US8124837B2/en
Publication of WO2006069160A2 publication Critical patent/WO2006069160A2/en
Anticipated expiration legal-status Critical
Publication of WO2006069160A3 publication Critical patent/WO2006069160A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria

Definitions

  • This invention is in the field of pest resistance. Specifically the invention relates to the resistance of plants against the bacterium Xylella fastidiosa, achieved by expression in plants of a gene encoding a bacterial HecA-like hemagglutinin.
  • Xylella fastidiosa is a Gram-negative, xylem-limited bacterium that is transmitted from plant to plant by several xylem-feeding insect vectors. (Hopkins, 1989) Strains of Xylella fastidiosa cause diseases in many economically important plants including grapevines (Pierce's Disease), citrus (Citrus Variegated Chlorosis), peach, plum, oleander, elm, sycamore, oak, maple, and coffee (De Lima et al., 1998; Purcell, 1997).
  • the present invention meets these needs by providing transgenic plants or genetically engineered plant endophytes that express a Hec A-like hemagglutinin, or a fragment thereof, which inhibits the growth and spread of Xylella fastidiosa, thereby providing resistance to Pierce' s Disease and other diseases caused by Xylella fastidiosa.
  • the Hec A-like hemagglutinin proteins include the amino acid sequences NPNL (amino acids 114 through 117 of SEQ ID NO: 6) and NPYGI (amino acids 154 through 158 of SEQ ID NO: 6) and may be from Xylella fastidiosa.
  • the Hec A-like hemagglutinin may be expressed in various plants such as grapevines, citrus, peach, plum, oleander, elm, sycamore, oak, maple and coffee or in plant endophytes growing in such plants.
  • the present invention is further directed to seeds produced by the transgenic plants of the invention, or seeds produced by plants infected with a transgenic endophyte.
  • the invention also provides for methods of generating such transgenic plants and plant endophytes.
  • the invention is further directed to recombinant HecA-like hemagglutinins or fragments thereof which confer resistance to Xylella fastidiosa when expressed in plants or plant microbial endophytes which are present in plants.
  • HecA-like hemagglutinins or fragments thereof which confer resistance to Xylella fastidiosa when expressed in plants or plant microbial endophytes which are present in plants.
  • Two examples of these proteins are HxfA and HxfB.
  • the invention is further directed to isolated nucleic acid sequences which encode recombinant Xylella fastidiosa HecA-like hemagglutinins or fragments thereof which confer resistance to Xylella fastidiosa when expressed in plants or plant endophytes present in plants.
  • the invention is further directed to recombinant constructs containing such isolated nucleic acids.
  • the recombinant constructs may further include a promoter.
  • the promoter may be a constitutive promoter, inducible promoter, tissue- or cell- specific promoter, or a developmentally-regulated promoter.
  • the promoters may be expressible in a plant, a bacteria and/or a plant endophyte.
  • the recombinant constructs may further be in a vector.
  • the vector may be a cloning, expression, transformation, or transfection vector.
  • the invention is further directed to isolated nucleic acids encoding HecA-like hemagglutinins and paralogs, homologs and orthologs of the protein.
  • the HecA-like hemagglutinin protein encoding nucleic acid sequence as defined herein refers to any sequence that hybridizes to the nucleic acid molecule encoding the HecA-like hemagglutinin, or the complement thereof under at least low stringency, preferably moderate, high or very high stringency conditions, or is about 85%, 90%, 95% or 97% identical in the nucleic acid sequence, or encodes a polypeptide with Hec-A like hemagglutinin activity having at least about 85%, 90%, 95% or 97% sequence identity to the HecA-like hemagglutinin protein, and confer resistance to disease caused by Xylellafastidiosa.
  • nucleic acids, vectors, or constructs may be introduced into a prokaryotic or eukaryotic host cell.
  • Preferred host cells include bacterial cells such as E. coli and plant endophytes from such genera as Pseudomonas, Agrobacterium, Bacillus, and others, yeast cells, and plant cells.
  • the nucleic acids, vectors and constructs may be introduced into the host cells so that the expression of the nucleic acid may be controlled or regulated.
  • the introduction of the construct into the host cell may be transient or stable.
  • the control or regulation may include tissue-specific promoters designed to express the isolated nucleic acids in given tissues. Such regulation may be directed to constitutive expression.
  • the regulation may be responsive to various biotic, abiotic and artificial stimuli, relative to the native promoter.
  • the invention is further directed to plants which contain the host cells.
  • Figure 1 shows Pierce' s disease symptoms in grapevines.
  • A shows mock inoculation of Chardonnay grapevines and B shows Chardonnay grapevines infected with the wild type strain Temecula showing a disease rating of 1, C shows a disease rating of 2, D shows a disease rating of 3, E shows a disease rating of 4, and F shows a disease rating of 5. Note the general health of the plants and the number of scorched leaves.
  • Figure 2 shows disease progression of various grapevine varieties inoculated with wild type or Tn5 mutants of Xylellafastidiosa.
  • Disease severity was based on a visual disease scale, from 0 to 5 and was assessed 10, 14, 16, 18, 20 and 32 weeks after inoculations.
  • the data is an average of two independent replications (6 plants total) for the inoculations in Chardonnay grapevines and one replication (3 plants total) for the inoculations in Chenin Blanc and Thompson seedless grapevines.
  • PspB Xylellafastidiosa mutant was lost in storage and was not inoculated in Chenin Blanc and Thompson seedless.
  • Figure 3 shows an alignment of the N-terminal region of the hemagglutinin-like proteins from X. fastidiosa and the hemagglutinin protein, HecA from E. chrysanthemi. Letters and numbers on the left indicate the name of the Xylella fastidiosa genes as described in the Xylella fastidiosa PD genome web site (University of Campinas, Brazil, Institute of Computing, Library for Bioinformatics).
  • HxfA and HxfB indicate the Xylella fastidiosa hemagglutinin proteins, PD2118 (SEQ ID NO: 5, GenBank accession number NP 780288) and PD1792 (SEQ ID NO: 3, GenBank accession number NP 779977), respectively.
  • HecA indicates the name of the hemagglutinin protein from E. chrysanthemi (GenBank accession number AF501263). Numbers on the right indicate amino acid residues.
  • NPNL amino acids 114 through 117 of SEQ ID NO: 6
  • NPYGI amino acids 154 through 158 of SEQ ID NO: 6
  • N, P, L, G and I indicate asparagine, proline, leucine, glycine and isoleucine, respectively.
  • Tps proteins including HecA, harbor a CXXC motif (SEQ ID NO: 33), which is absent in others.
  • cysteines (C) are not essential for secretion (Schonherr et al., 1993).
  • An asterisk (*) indicates that Tps secretion domains were conserved in those amino acid sequences.
  • Figure 4 shows Lipopolysaccharide (LPS) profiles of strains of Xylella fastidiosa as revealed by SDS-PAGE and silver staining.
  • lane 1 is wild type strain and lane 2 is XF 1542 mutant strain.
  • Figure 5 shows the growth of Xylella fastidiosa wild type and Tn5 mutants in liquid PD3 medium. Growth curves were determined based on OD 6O0 . Data are average of two experiments with two repetitions each.
  • Figure 6 shows HxfA-dependent aggregation of Xylella fastidiosa cells in vitro and in planta. Panels A, C, E and G show Xylella fastidiosa wild type cells; Panels B, D, F and H show Xylella fastidiosa hxfA mutant cells. Panels A and B show wild type and hxfA mutant cells, respectively, inoculated into PD3 medium in a 125 ml flask and placed on a shaker.
  • Panels C and D show wild type and hxfA mutant cells, respectively, plated onto PD3 medium plates. The colony morphology was examined after 10 days of incubation.
  • Panels E and F show wild type and hxfA cells in xylem vessels. Note the lack of a three dimension array in the HxfA mutant compare to wild type.
  • Panels G and H show higher magnification of wild type and hxfA cells in a biofilm. Note the wild type cells typically aggregated together side to side while the hxfA mutant cells did not aggregate in this manner. Scale bar equivalent to 5 microns in every panel.
  • Figure 7 shows a model of possible mechanisms involved in X. fastidiosa adhesion to xylem vessels of grapevines. Rods me X. fastidiosa cells.
  • A shows how Xylella fastidiosa bacteria attach to the surface using most likely non-fimbrial adhesins, other than hemagglutinins (Tables 4; Feil et al., 2003);
  • B shows how HxfA, HxfB and other adhesins mediate secondary contact between Xylella fastidiosa cells allowing in C, which shows microcolony formation.
  • hemagglutinins appear to be important mediators for cell-cell aggregation; D shows bacterial cells finally aggregating to each other via hemagglutinins HxfA and HxfB, fimbriae and exopoly saccharides (EPS) to form matured biofilms within the xylem vessels (Tables 2 and 4, Figures 6; Feil et al., 2003).
  • EPS exopoly saccharides
  • SEQ ID NO: 1 is the amino acid sequence of PD2116, a Xylella fastidiosa hemagglutinin-like protein.
  • SEQ ID NO: 2 is the amino acid sequence of PD2110, a Xylella fastidiosa hemagglutinin-like protein.
  • SEQ ID NO: 3 is the amino acid sequence of PD1792, a Xylella fastidiosa hemagglutinin-like protein, also referred to as HxfB.
  • SEQ ID NO: 4 is the amino acid sequence of PD 1246, aXylellafastidiosa hemagglutinin-like protein.
  • SEQ ID NO: 5 is the amino acid sequence of PD2118, aXylellafastidiosa hemagglutinin-like protein, also referred to as HxfA.
  • SEQ ID NO: 6 is the amino acid sequence of HecA, a hemagglutinin protein from E. chrysanthemi.
  • SEQ ID NO: 7 is the amino acid sequence of PD0988, aXylellafastidiosa hemagglutinin-like protein.
  • SEQ ID NO: 8 is the amino acid sequence of PD0986, annotated as a Xylella fastidiosa hemagglutinin-like protein (Van Sluys et al. 2003).
  • SEQ ID NO: 9-32 are sequences of primers used herein.
  • the present invention provides transgenic plants or genetically engineered plant endophytes that are present in plants that express a HecA-like hemagglutinin, or a fragment thereof, which inhibits the growth and spread of Xylella fastidiosa, thereby providing resistance to Pierce' s Disease and other diseases caused by Xylella fastidiosa.
  • the HecA-like hemagglutinin may be isolated from Xylella fastidiosa
  • Promoter A regulatory nucleic acid sequence, typically located upstream (5') of a gene or protein-coding sequence that, in conjunction with various cellular proteins, is responsible for regulating the expression of the gene or protein-coding sequence.
  • the promoters suitable for use in the heterologous nucleic acids of this invention are functional in plants and in other host organisms used for expressing the inventive polynucleotides.
  • Many plant promoters are publicly known. These include constitutive promoters, regulated promoters, inducible promoters, root-, tissue- and cell-specific promoters, and developmentally-regulated promoters. Exemplary promoters and fusion promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference.
  • the promoters may be those normally associated with a transgene of interest, or heterologous promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi. Those skilled in the art will be able without undue experimentation to select promoters that are suitable for use in practicing the subject invention.
  • Regulated promoter As used herein, this term refers to any promoter functional in a plant that provides differential expression levels in response to stimuli internal to the plant such as developmental signals. This includes both promoters that increase expression and promoters that decrease expression in response to stimuli or changed external conditions. Many promoters that are regulated promoters are also inducible promoters. For example, promoters that are responsive to auxin are both because they will change levels of expression in response to developmental changes in auxin levels and in response to externally supplied auxin.
  • regulated promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
  • exemplary promoters include the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051, both herein incorporated by reference), glob-1 promoter, and gamma-zein promoter.
  • An exemplary promoter for leaf- and stalk-preferred expression is MS8-15 (see U.S. Pat. No. 5,986,174, herein incorporated by reference).
  • seed- preferred promoters included, but are not limited to, 27 kDa gamma zein promoter and waxy promoter (Boronat et al.
  • Promoters that express in the embryo, pericarp, and endosperm are disclosed in U.S. applications Ser. No. 60/097,233 filed Aug. 20, 1998 and U.S. applications Ser. No. 60/098,230 filed Aug. 28, 1998 both of which are hereby incorporated by reference.
  • the operation of a promoter may also vary depending on its location in the genome. Thus, a developmentally regulated promoter may become fully or partially constitutive in certain locations. A developmentally regulated promoter can also be modified, if necessary, for weak expression.
  • tissue specific promoter As used herein, this term refers to any promoter functional in a plant that provides differential expression levels in different tissues within the plant. Such promoters may provide tissue specific expression in one or several tissues. Many promoters that are tissue specific are also regulated promoters. For example, some promoters specifically express in plant seeds only during certain stages of the seeds growth cycle. Examples of tissue specific promoters include those listed above that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers. Examples from above include anther specific promoters, leaf- and stalk-specific promoters, seed-specific promoters, embryo-specific promoters, pericarp-specific promoters, and endosperm-specific promoters. Additionally, as discussed above under localization, tissue specific expression occurs when there is on average a skewed expression in one or more tissues of a plant when compared to the average expression in the other tissues in such plant.
  • Sequence Identity Sequences that show similarity to those described in this application can be identified by computer-based methods, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others).
  • Similarity searches retrieve and align sequences for comparison with a target sequence to be analyzed (i.e., a query sequence).
  • a target sequence to be analyzed i.e., a query sequence.
  • the optimal alignment between local regions of the compared sequences is known as a local alignment.
  • Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.
  • Polynucleotide and polypeptide sequences may be aligned, and percentage of identical residues in a specified region may be determined against other polynucleotide and polypeptide sequences, using computer algorithms that are publicly available. The percentage identity score is dependent on the length of the overlap region of the sequences being compared.
  • sequence identity or, for proteins, also in terms of sequence similarity. Sequence identity is frequently measured in terms of percentage identity; the higher the percentage, the more similar the two sequences are.
  • homologs and variants of the HecA-like hemagglutinin-encoding nucleic acid molecules may be used in the present invention. Homologs and variants of these nucleic acid molecules will possess a relatively high degree of sequence identity when aligned using standard methods. Such homologs and variants will hybridize under high stringency conditions to one another.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et ah, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. It can be accessed at the NCBI Website. A description of how to determine sequence identity using this program is available at the NCBI website.
  • Homologs of the disclosed protein sequences are typically characterized by possession of at least 40% sequence identity counted over the full length alignment with the amino acid sequence of the disclosed sequence using the NCBI Blast 2.0, gapped blastp set to default parameters.
  • the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
  • Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% sequence identity.
  • Homologs of the disclosed nucleic acid sequences are typically characterized by possession of at least 40% sequence identity counted over the full length alignment with the amino acid sequence of the disclosed sequence using the NCBI Blast 2.0, gapped blastn set to default parameters.
  • such sequences hybridize to homologous sequences under high stringency conditions.
  • a preferred method utilizes the BLASTN module of WU-BLAST-2 (Altschul et ah, 1996); set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.
  • Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% sequence identity.
  • the alignment may include the introduction of gaps in the sequences to be aligned.
  • the percentage of sequence identity will be determined based on the number of identical amino acids in relation to the total number of amino acids.
  • sequence identity of sequences shorter than that shown in the figures as discussed below will be determined using the number of amino acids in the longer sequence, in one embodiment.
  • percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as, insertions, deletions, substitutions, etc.
  • identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of "0", which obviates the need for a weighted scale or parameters as described herein for sequence similarity calculations.
  • Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the "shorter" sequence in the aligned region and multiplying by 100. The "longer" sequence is the one having the most actual residues in the aligned region.
  • Proteins can be classified according to their sequence relatedness to other proteins in the same genome (paralogs) or a different genome (orthologs).
  • Ortholog genes are genes that evolved by speciation from a common ancestral gene. These genes normally retain the same function as they evolve.
  • Paralog genes are genes that are duplicated within a genome. These genes may acquire new specificities or modified functions which may be related to the original one.
  • Phylogenetic analysis methods are well-known to those with ordinary skill in bioinformatics.
  • sequences of the present invention may contain sequencing errors. That is, there may be incorrect amino acid sequences, nucleotides, frameshifts, unknown nucleotides, or other types of sequencing errors in any of the sequences; however, the correct sequences will fall within the homology and stringency definitions herein for nucleic acids, and the protein homology described for proteins or polypeptides.
  • Stringency refers to hybridization conditions chosen to optimize binding of polynucleotide sequences with different degrees of complementarity. Stringency is affected by factors such as temperature, salt conditions, the presence of organic solvents in the hybridization mixtures, and the lengths and base compositions of the sequences to be hybridized and the extent of base mismatching, and the combination of parameters is more important than the absolute measure of any one factor.
  • Very High Stringency refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 ⁇ g/ml single stranded DNA at 55-65° C for 8 hours, and washing in 0.1 X SSC and 0.1% SDS at 60-65° C for thirty minutes.
  • SDS sodium dodecyl sulfate
  • High stringency refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 ⁇ g/ml single stranded DNA at 55- 65° C for 8 hours, and washing in 0.2 X SSC and 0.2% SDS at 60-65° C for thirty minutes.
  • SDS sodium dodecyl sulfate
  • Moderate stringency conditions refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 ⁇ g/ml single stranded DNA at 55-65° C for 8 hours, and washing in 0.2 X SSC and 0.2% SDS at 50-55° C for thirty minutes.
  • SDS sodium dodecyl sulfate
  • Low stringency refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS) 3 100 ⁇ g/ml single stranded DNA at 55- 65° C for 8 hours, and washing in 2.0 X SSC and 0.2% SDS at 50-55° C for thirty minutes.
  • SDS sodium dodecyl sulfate
  • construct refers to a recombinant genetic molecule comprising one or more isolated polynucleotide sequences of the invention.
  • Genetic constructs used for transgene expression in a host organism comprise a gene promoter sequence operably linked to an open reading frame coding for at least a functional portion of a polypeptide of the present invention and optionally a gene termination sequence 3' downstream of the open reading frame.
  • the open reading frame may be orientated in either a sense or anti-sense direction, depending upon the intended use of the gene sequence.
  • the construct may also comprise selectable marker gene(s) and other regulatory elements for gene expression.
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter controls the transcription or expression of the coding sequence.
  • operably linked DNA sequences are contiguous and, where necessary, join two protein-coding regions in the same reading frame.
  • polypeptides two polypeptide sequences may be operably linked by covalent linkage, such as through peptide bonds or disulfide bonds.
  • Vector refers to a nucleic acid molecule which is used to introduce a polynucleotide sequence into a host cell, thereby producing a transformed host cell.
  • a “vector” may comprise genetic material in addition to the above-described genetic construct, e.g., one or more nucleic acid sequences that permit it to replicate in one or more host cells, such as origin(s) of replication, selectable marker genes and other genetic elements known in the art (e.g., sequences for integrating the genetic material into the genome of the host cell, and so on).
  • a transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
  • transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, plant or animal cell, including transfection with viral vectors, transformation by Agrobacterium, with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration and includes transient as well as stable transformants.
  • Isolated An "isolated" biological component (such as a nucleic acid or protein or organelle) has been substantially separated or purified away from other biological components in the cell or the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles.
  • Nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods. The term embraces nucleic acids including chemically synthesized nucleic acids and also embraces proteins prepared by recombinant expression in vitro or in a host cell and recombinant nucleic acids as defined below.
  • a gene in a large genomic DNA fragment such as a contig is not sufficiently purified away from other biological components to be considered isolated due to the relatively large amount of extra DNA found in the average contig.
  • recombinant nucleic acids and “recombinant proteins” also are “isolated” as described above
  • Recombinant nucleic acid By “recombinant nucleic acid” herein is meant a nucleic acid that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of nucleic acids, e.g., by genetic engineering techniques, such as by the manipulation of at least one nucleic acid by a restriction enzyme, ligase, recombinase, and/or a polymerase.
  • a recombinant nucleic acid is replicated by the host cell; however, the recombinant nucleic acid once replicated in the cell remains a recombinant nucleic acid for purposes of this invention.
  • recombinant protein herein is meant a protein produced by a method employing a recombinant nucleic acid.
  • recombinant nucleic acids and “recombinant proteins” also are “isolated” as described above. A gene in a large fragment such as a contig would not be a "recombinant nucleic acid” given that such artificial combination does not relate to the gene.
  • cDNA A piece of DNA that is synthesized in the laboratory by reverse transcription of an RNA, preferably an RNA extracted from cells.
  • cDNA produced from mRNA may include 5' and/or 3' noncoding sequences (i.e., 5' UTR, 3' UTR) but typically lacks internal, non-coding segments (introns) and regulatory sequences, such as promoters, that determine transcription.
  • ORF Open reading frame
  • Transgenic plant As used herein, this term refers to a plant that contains recombinant genetic material not normally found in plants of this type, as well as recombinant genetic material normally found in such plants but in an abnormal position in the genome, and which has been introduced into the plant in question (or into progenitors of the plant) by human manipulation.
  • a plant into which recombinant DNA is introduced by transformation is a transgenic plant, as are all offspring of that plant that contain the introduced transgene (whether produced sexually or asexually). It is understood that the term transgenic plant encompasses the entire plant and parts of the plant, for instance grains, seeds, flowers, leaves, roots, fruit, pollen, stems etc.
  • Standard molecular biology methods and plant transformation techniques can be used to produce transgenic plants that produce plants having a recombinant gene or genes providing HecA-like hemagglutinin activity.
  • Ortholog Two nucleotide or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species, sub-species, or cultivars. Orthologous sequences are also homologous sequences. Orthologous sequences hybridize to one another under high- stringency conditions.
  • polynucleotide “oligonucleotide”, or “nucleic acid” refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • polynucleotide and “nucleotide” as used herein are used interchangeably.
  • Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • the following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • a "fragment” or “segment” of a nucleic acid is a small piece of that nucleic acid.
  • Gene refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
  • Primer refers to a short polynucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a polymerase and at a suitable temperature and pH.
  • the primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method.
  • PCR polymerase chain reaction
  • a “polymerase chain reaction” is a reaction in which replicate copies are made of a target polynucleotide using a "primer pair” or a “set of primers” consisting of an "forward” and a “reverse” primer, and a catalyst of polymerization, such as a DNA polymerase, and particularly a thermally stable polymerase enzyme.
  • Methods for PCR are taught in U.S. Patent Nos. 4,683,195 (Mullis) and 4,683,202 (Mullis et al.). All processes of producing replicate copies of the same polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "amplification” or "replication”.
  • HecA hemagglutinin-like gene has been identified in Xylella fastidiosa that has 80% amino acid homology with a hemagglutinin gene called HecA from Erwinia chrysanthemi (Rojas et al, 2002). HecA mediates surface attachment, cell aggregation and contributes to the virulence of E. chrysanthemi. Multiple pathogenicity testing of one Xylella fastidiosa HecA homolog, designated as HxfA, clearly shows the HxfA has an important role in Xylella fastidiosa virulence.
  • HxfA mutants no longer clump together in liquid culture, as do wild type Xylella fastidiosa cells.
  • Scanning electron microscopic examination of cell masses that attach to the inside of a glass flask show the HxfA cells are largely disordered and not attached together by the length of their cell surface like wild type cells (Guilhabert and Kirkpatrick, 2005).
  • This data indicates that HxfA is essentially a molecular "glue” that plays a very important role in cell-cell aggregation.
  • HxfB another HecA-like hemagglutinin in Xylella fastidiosa, designated HxfB, in which mutation also causes the phenotype above.
  • a HecA- like hemagglutinin is introduced and expressed to reasonable levels in the xylem fluid of plants such as grapevines.
  • the HecA-like hemagglutinin may be expressed by introducing the HecA-like hemagglutinin gene into the plant genome directly or by expressing the gene in a plant endophyte that has been introduced into the plant.
  • This protein should act as an adhesive to cause Xylella fastidiosa cells to aggregate and reduce the number of planktonic cells that could circulate freely in xylem vessels and initiate new xylem vessel infections by degrading pit membranes that separate xylem elements. If the HecA-like hemagglutinin also associated with the charged cellulose/pectin surfaces of the xylem secondary walls, it could further act as a cellular glue to immobilize and slow the systemic movement of Xylella fastidiosa.
  • Xylella fastidiosa may not have sufficient time to move back into permanent cordons and establish an overwintering systemic infection before a plant infected with a wild type Xylella fastidiosa cells was pruned off during the winter.
  • the end result could be a plant that was far less likely to support overwintering, systemic infections of Xylella fastidiosa than a non-engineered plant.
  • the present invention is directed to the observation, as more fully described in the examples below, that Xylella fastidiosa strains which lack expression of HxfA or HxfB are more virulent that wild type strains, due to increased motility (Guilhabert and Kirkpatrick, 2005). This suggests that expression of a HecA-like hemagglutinin (the product of the HxfA and HxfB genes) in plants would hinder Xylella fastidiosa movement and therefore inhibit infection.
  • the present invention is directed to transgenic plants which express a HecA-like hemagglutinin, and are therefore more resistant to disease caused by Xylella fastidiosa.
  • the present invention is directed to plant endophytes which express a HecA-like hemagglutinin, and which can be introduced into plants to provide resistance to disease caused by Xylella fastidiosa.
  • HecA like hemagglutinin The present invention includes various aspects of nucleic acid sequences encoding one or more proteins that provide HecA-like hemagglutinin activity.
  • One structural feature of HecA-like hemagglutinin proteins is the presence of conserved TPS (two partner secretion) domains, illustrated in Figure 3. There are two conserved sequence domains, NPNL (amino acids 114 through 117 of SEQ ID NO: 6) and NPYGI (amino acids 154 through 158 of SEQ ID NO: 6), which are found in HecA-like hemagglutinins.
  • a preferred embodiment of the nucleic acid of the present invention is an isolated nucleic acid encoding a HecA-like hemagglutinin protein or fragment thereof having cell clumping activity.
  • HecA-like hemagglutinin proteins include HxfA and HxfB.
  • nucleic acids examples include nucleic acids that hybridize to the HecA-like hemagglutinin encoding nucleic acid disclosed herein under low, moderate, high or very high stringency, nucleic acids with 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity to the HecA-like hemagglutinin encoding nucleic acids disclosed herein, and nucleic acids encoding a protein with 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity to the HecA-like hemagglutinin proteins disclosed herein.
  • nucleic acids may include nucleic acids that encode proteins that share conserved regions with other HecA-like hemagglutinin proteins when aligned with HecA-like hemagglutinin protein families. Such conserved regions may share 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity.
  • the present invention includes the above nucleic acid sequences operably linked to a promoter.
  • the preferred promoter is a heterologous promoter.
  • the choice of promoter will be dictated by the target cell, tissue, and/or development expression pattern in which the HecA-like hemagglutinin protein is to be expressed. Selection of an appropriate promoter functional in a desired target cell is routine in the art.
  • One of skill in the art can use, for example, a constitutive promoter, an inducible promoter or a regulated promoter depending upon the desired pattern of expression.
  • mutant promoters and artificial promoters created by splicing distinct regulatory elements may be used.
  • vectors including the nucleic acids and promoter linked constructs described above.
  • vectors can include, without limitation, expression vectors, cloning vectors, shuttle vectors, etc. which can include, but are not limited to, the following vectors or their derivatives: human, animal, or plant viruses such as vaccinia virus, adenovirus, cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid (e.g.
  • the Ti plasmid of Agrobacterium tumefaciens and cosmid DNA vectors, to name but a few. Selection of the appropriate vector will be dictated by the target cells, desired expression mode (e.g., transient expression versus permanent integration into the genome versus independently replicating vectors will cause one of skill in the art to select different vectors), and ease of recombinant manipulation. In some circumstances, one of skill in the art would use a shuttle vector that is functional in at least two organisms so that the nucleic acid may be manipulated in one organism and then transferred into the other.
  • vectors can be engineered which allow for the production of transgenic plants which express a HecA-like hemagglutinin.
  • Vectors can also be created which allow for the expression of a HecA-like hemagglutinin in a plant endophyte.
  • One approach described herein involves production of a transgenic plant that expresses anti-microbial peptides in hopes of eliminating or killing Xylellafastidiosa cells en planta.
  • the hemagglutinin-mediated resistance described herein more specifically targets Xylellafastidiosa and offers a transgenic resistance approach that may be more acceptable to regulatory agencies and the public.
  • the hemagglutinin gene is expressed at sufficient levels in rootstocks, such rootstocks may provide systemic protection to existing cultivars grafted on engineered rootstocks.
  • a plant which can be modified to express a HecA-like hemagglutinin is grapevines.
  • plants include but are not limited to: citrus, peach, plum, oleander, elm, sycamore, oak, maple, alfalfa, almond, pear, coffee, mulberry, sedges, periwinkle, and hemlock
  • Introduction of the selected construct into plants is typically achieved using standard transformation techniques.
  • the basic approach is to: (a) clone the construct into a transformation vector, which (b) is then introduced into plant cells by one of a number of techniques (e.g., electroporation, microparticle bombardment, Agrobacterium infection); (c) identify the transformed plant cells and regenerate whole plants from the identified plant cells, and (d) select progeny plants containing the introduced construct.
  • the transformation vector will stably integrate into the genome of the plant cell. That part of the transformation vector which integrates into the plant cell and which contains the introduced recombinant sequence may be referred to as the recombinant expression cassette.
  • Selection of progeny plants containing the introduced transgene may be made based upon the detection of the recombinant HecA-like hemagglutinin encoding gene in transgenic plants, upon the detection of the recombinant HecA-like hemagglutinin protein-coding sequence or upon enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a selectable marker gene incorporated into the transformation vector.
  • a chemical agent such as an antibiotic
  • Patent No.5,589,615 Provides for the Production of Transgenic Plants with Increased Nutritional Value Via the Expression of Modified 2S Storage Albumins
  • U.S. Patent No.5,750,871 Transformation and Foreign Gene Expression in Brassica Species
  • U.S. Patent No. 5,268,526 Overexpression of Phytochrome in Transgenic Plants”
  • U.S. Patent No. 5,780,708 Fertile Transgenic Cora Plants
  • U.S. Patent No. 5,538,880 Methodhod for Preparing Fertile Transgenic Corn Plants”
  • U.S. Patent No. 5,773,269 Fertile Transgenic Oat Plants”
  • transgene-expressing constructs of the present invention may be usefully expressed in a wide range of plants which are susceptible to diseases caused by Xylella fastidiosa.
  • Methods for the transformation and regeneration of monocotyledonous and dicotyledonous plant cells are known, and the appropriate transformation technique will be determined by the practitioner.
  • the choice of method will vary with the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types.
  • Suitable methods may include, but are not limited to: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG-mediated transformation); transformation using viruses; micro-injection of plant cells; micro-projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium-mQdiatQ ⁇ transformation. Typical procedures for transforming and regenerating plants are described in the patent documents listed above.
  • transformants are preferably selected using a dominant selectable marker.
  • a dominant selectable marker will confer antibiotic or herbicide resistance on the seedlings of transformed plants, and selection of transformants can be accomplished by exposing the seedlings to appropriate concentrations of the antibiotic or herbicide.
  • Suitable markers include, without limitation, those genes coding for resistance to the antibiotic spectinomycin or streptomycin (e.g., the aada gene), the streptomycin phosphotransferase (SPT) gene coding for streptomycin resistance, the neomycin phosphotransferase (NPTII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (HPT) gene coding for hygromycin resistance.
  • SPT streptomycin phosphotransferase
  • NPTII neomycin phosphotransferase
  • HPT hygromycin phosphotransferase
  • the plant can be assayed for expression of recombinant HecA-like hemagglutinin.
  • plants which can be transformed to express a HecA-like hemagglutinin gene include but are not limited to grapevine, citrus, peach, plum, oleander, elm, sycamore, oak, maple, alfalfa, almond, pear, coffee, mulberry, sedges, periwinkle, and hemlock.
  • Endophytes There are a number of bacterial endophytes that can colonize and multiply to reasonably high populations in the xylem of plants. Some of these endophytes such as Pseudomonas and Agrobacterium species are well studied and transformation systems for introducing any gene into these species are numerous and well documented. Genetically engineered bacterial endophytes could introduce significant levels of HecA-like hemagglutinin directly into the xylem fluids where Xylella fastidiosa resides and causes disease and possibly slow their colonization as described for transgenic grapevines expressing a HecA-like hemagglutinin.
  • Fungal endophytes can be transformed using a calcium chloride/polyethylene glycol (PEG) protocol as described in the following reference: Malardier L, Daboussi MJ, Julien J, Roussel F, Scazzocchio C, Brygoo Y., Cloning of the nitrate reductase gene (niaD) of Aspergillus nidulans and its use for transformation of Fusarium oxysporum. Gene. 1989 May 15; 78(l):147-56, which is hereby incorporated by reference in its entirety.
  • PEG calcium chloride/polyethylene glycol
  • Tn5 Xylella fastidiosa mutant was individually innoculated into Chardonnay, Chenin Blanc and Thompson seedless grapevines to assess pathogenicity. All 1,000 Tn5 Xylella fastidiosa mutants in Chardonnay were screened for altered symptom development. This screen identified 7 Xylella fastidiosa Tn5 mutants that showed a pronounced hypervirulence phenotype 21 weeks after inoculation (i.e. grapevines inoculated with these Tn5 mutants developed more severe disease symptoms than did vines inoculated with the wild type Temecula strain).
  • Example 2 Identification of genes associated with the hypervirulent phenotype and sequence analyses.
  • the transposon insertion sites of the mutants were identified using a combination of PCR and sequencing (Table 1). Six of the mutated genes corresponded to genes with assignable functions and one gave a significant match with a hypothetical conserved gene. Southern blot analysis of the hypervirulent Xylella fastidiosa mutants showed that the clones contained a single transposon insertion (data not shown). Regions flanking the Tn5 mutated gene sequences also were the same as the sequences of their respective regions in the wild type Xylella fastidiosa Temecula strain; thus confirming the position of the Tn5 insertion in the hypervirulent mutants.
  • Tn5 mutant was disrupted in PD2118, which putatively encodes a hemagglutinin-like secreted protein.
  • a second mutant was disrupted in PDl 542, which putatively encodes a dolichol-phosphate mannosyltransferase lipopolysaccharide, dmt, which might be involved in LPS biosynthesis by adding a sugar onto the O-polysaccharide chain.
  • TPS secretion pathway
  • Adhesins secreted through the TPS pathway (Tps proteins), share similar "secretion domains" despite their limited overall sequence similarities (Jacob-Dubuisson et al., 2001).
  • the secretion domain includes a 110-amino acid (aa) conserved region in the N-proximal region (Sch ⁇ nherr et al., 1993).
  • the Tsp secretion domains are conserved in HecA, a hemagglutinin protein in E.
  • chrysanthemi (GenBank accession number AF501263; Rojas et al., 2002) The first 200-aa were analyzed in the N-proximal region of the seven gene products that were annotated as hemagglutinin-like proteins in the PD genome sequence (Van Sluys et al., 2003). The putative seven Xylella fastidiosa hemagglutinin proteins were aligned with the hemagglutinin HecA of E. chrysanthemi ( Figure 3).
  • the PD Xylella fastidiosa product PD0986 did not possess any homology with putative hemagglutinin or adhesin proteins from other bacteria.
  • Tps secretion domains were only conserved in the last three Xylella fastidiosa hemagglutinin-like genes PD2118, PD1792 and PD 1246 ( Figure 3).
  • PD gene PD 1246 has a frameshift/point mutation in its sequence (Van Sluys et al., 2003); thus PD 1246 is most likely not functional in the Temecula strain.
  • PD2118 and PD 1792 gene products also possess 27% and 37% amino acid identities, respectively with the HecA protein from E. chrysanthemi.
  • HxfB was cloned in E. coli, disrupted by Tn5 mutagenesis, and the disrupted gene introduced back into X. fastidiosa.
  • the introduced construct replaced the wild type HxfB gene by homologous recombination (see Example 5).
  • the PD 1244 product had 82% and 74% amino acid identity with the putative hemagglutinin-like products Xf2196 from the CVC and PD2116 from the PD strain of Xylella fastidiosa, respectively (Simpson et al., 2000 and Van Sluys et al., 2003).
  • putative PD1244 gene predicts a 79-aa protein
  • genes Xf2196 and PD2116 predict a 3442-aa and 439-aa protein, respectively.
  • the amino acid identity between gene products PD 1244, Xf2196 and PD2116 is based only on a small region of the putative proteins.
  • the Tsp secretion domains noted in HecA were not identified in PD1244 or PD2116 products ( Figure 3). No conserved domains were identified in PD 1244 protein using the NCBI conserved domain database.
  • Example 3 Hypervirulent mutations altered Xylella fastidiosa growth rate and increased movement in planta.
  • Xylella fastidiosa growth curves and en planta bacterial population determinations were performed in 15 ml polystyrene tubes containing 3 ml of PD3 medium. A total of 14 tubes were prepared for the wild type and each Tn5 mutant, so as to allow destructive sampling of two tubes at every sampling time. Two independent growth curve determinations were performed. Due to the aggregate nature of Xylella fastidiosa liquid cultures, immediately after inoculation and after 2, 4, 6, 8, 12 and 16 days, the cultured cells were completely dispersed using a tissue homogenizer (Heidolph RzR 50) and the cell growth was monitored by measuring turbidity at OD 6 oonm. The doubling time of the bacterial populations was calculated using a standard equation (Madigan et al., 1970).
  • the bacterial populations (number of cells per gram of petiole tissue) of the XyIe Ha fastidiosa wild type and Tn5 mutants inoculated into Chardonnay vines were determined in the following manner: 14 weeks after inoculation, petiole tissues from each vine inoculated with either Tn5 mutant or wild-type Xylella fastidiosa cells were harvested at the point of inoculation and 25 centimeters above the point of inoculation.
  • Petiole tissues were surface sterilized (1 min in 10% sodium hypochlorite and 1 min in 80% ethanol), rinsed three times in sterile de-ionized water and ground in 2 ml of sterile PBS buffer using a grinding machine (Biorega AG, Switzerland). Serial dilutions were prepared and 3 replicates of 10 ⁇ l were plated on PD3 agar medium with or without kanamycin. After incubating 7-10 days at 28 0 C, the number of bacteria was quantified.
  • the doubling time of Tn5 mutants and wild type Xylella fastidiosa strain was also determined.
  • the doubling time of the wild type Xylella fastidiosa strain was 0.5 day.
  • the doubling times of 4 of the Tn5 mutants were longer than the wild type strain, whereas the doubling time of hxfA (PD2118) and PD 1244 mutants was faster than the wild type strain (Table 2).
  • the doubling time of PDl 198 Xylella fastidiosa mutant was not significantly different from the wild type strain.
  • HxfA and HxfB cells were examined on solid medium.
  • HxfA and HxfB mutants exhibited a homogenous distribution of cells, forming a continuous lawn of cells, whereas the wild type grew in separate clumps composed of small and medium-size individual colonies ( Figure 6C and D); thus further confirming the inability of HxfA cells to self-aggregate.
  • Example 5 Cloning of the hemagglutinin gene, HxfB (PD1792).
  • the PD 1792 gene of a grapevine strain causing Pierce' s disease (PD; Xylella fastidiosa Temecula isolate; Van Sluys et al., 2003) was amplified using the Expand Long Template PCR system (Roche, Mannhein, Germany) with primers PD1791 rev (5' GGAGCAAGACAGTCGCGGAT 3' (SEQ ID NO: 9)) and PD1793 forw (5' GATATCGTGAACGATTGCCGCCT 3' (SEQ ID NO: 10)), anneal to sequences that flank the ORF encoding the PD1792 gene.
  • the annealing temperature in both set of cycles was 58 0 C and the elongation times in the first and second set of cycle were 4' for 10 cycles and 4' + 20" per cycle for 25 cycles, respectively.
  • a PCR product of the expected 10,134 bp-size was obtained.
  • the PCR product was cloned into the pCR®-XL-TOPO® vector using the TOPO® XL PCR cloning kit (Invitrogen, Carlsbad, California) following the manufacturer recommendations. Cloning of the PD 1792 gene was confirmed by sequencing the end of the cloned PCR product using primers, Ml 3 forward and reverse (5' GTTTTCCC AGTC ACGA 3'(SEQ ID NO: 11) and 5' CAGGAAACAGCTATGAC 3' (SEQ ID NO: 12), respectively; Invitrogen, Carlsbad, California). The sequencing was performed in a "2X" Big Dye Terminator sequencing reactions (Applied Biosystems, Foster City, CA) by the Division of Biological Sciences DNA sequencing facility at UC Davis. The sequences of the cloned PCR product perfectly matched the sequence of the PD 1792 gene that is present in the PD genome sequence (Van Sluys et al., 2003).
  • a 680 bp region of Xylella fastidiosa Temecula genome including a small coding sequence of the PD 1792 gene was amplified using primers PD 1792 rev and PD 1792 forw and cloned into the pCR R 2.1 -TOPO vector (Invitrogen, Carlsbad, California).
  • the plasmid was then digested with EcdRl and the PD 1792 insert was ligated into ⁇ c ⁇ RI-digested pUC18 plasmid creating pXF012. Plasmid pXF012 was linearized at the unique restriction site BstBl of the cloned PCR-amplified PD 1792 fragment.
  • Disruption of the PD 1792 locus was confirmed by using the Expand Long Template PCR system (Roche, Mannhein, Germany) with primers PD 1791 rev and PD 1793 forw, binding to the flanking ORFs of the mutated PD 1792 gene. Briefly, the annealing temperature in both set of cycles was 58 0 C and the elongation times in the first and second set of cycle were 4' for 10 cycles and 4' + 20" per cycle for 25 cycles, respectively. The identity of the PCR product was confirmed by using the restriction enzyme Hindlll that cuts only once into the Tn903 kan-2 cassette.
  • Xylella fastidiosa genomic DNAs were isolated from the mutant strains as described (Zang et al., 1998). Genomic DNAs from the transformants obtained by random mutagenesis were individually digested by the two restriction enzymes, EcoRl and Eagl. In order to confirm the identity of the two random hemagglutinin PD2118 and PD 1246 mutant strains, their genomic DNAs were also digested with SaR aadXmnl. All digested DNAs were electrophoresed, alkali- denatured, and transferred to a nitrocellulose membrane as previously described (Guilhabert et al., 2001).
  • HxfB a mutant in the second hemagglutinin identified above, HxfB (PD 1792) was generated.
  • the disruption of gene hxJB was confirmed by a long PCR procedure (data not shown).
  • Example 7 Sequence analysis and subcloning of putative cell-cell binding domains of HxfA and HxfB.
  • HxfA and B Detailed sequence analysis of HxfA and B using revealed 7 (HxfA, PD2118) and 8 (HxfB, PD 1792) domains in the N-terminal region of the proteins that likely represent the Hxf cell-cell binding domains. This analysis was performed by using the Biozon database, developed by researchers at Cornell University, and accessible through the World Wide Web. Three DNA fragments (ADl, AD2 and AD3, all 1.0 to 1.2kb in size) were identified in each protein that contained 3 or 4 putative binding domains. The AD2 fragment from HxfA and B were most similar in sequence to each other and therefore chosen as a likely marker for both Hxf proteins. AD2 was PCR-amplified, cloned and expressed in a protein fusion vector in E.
  • AD2 fusion protein was purified by affinity chromatography.
  • the fusion protein was injected into rabbits and antibodies against AD2 were produced.
  • the AD2 antibodies are being used to determine the size and cellular location of native Hxf protein in X. fastidiosa and PD-affected grapevines.
  • AD2 antibodies and purified AD2 proteins are being used to determine if the AD2 domain is mediating X. fastidiosa cell-cell aggregation.
  • Hxf genes (10.2kb) is larger than desirable to transform and be expressed in either plants or grapevine endophytes
  • a 3.5 kb fragment that contains all three putative binding domains (AdI -AD3) from HxfA and HxfB were PCR- amplified and cloned in E. coli. These two 3.5kb fragments are being transformed into grapevine (V. vinifera), tobacco and Pseudomonas and Agrobacterium endophytes (D. Darjean- Jones, 2004) using appropriate technologies that have been previously discussed. Fusion protein derived from the 3.5kb fragments are being prepared and used as previously described for Hxf AD2. Using either individual Hxf AD domains or the 3.5kb to transform plant or endophytes will be more feasible than engineering the full-length Hxf gene and should confer the same desired resistance phenotype. Tables and Figures
  • Glucose kinase has a regulatory role in carbon catabolite repression in Streptomyces coelicolor. J. Bacteriol. 176:694-8.
  • HecA a member of a class of adhesins produced by diverse pathogenic bacteria, contributes to the attachment, aggregation, epidermal cell killing, and virulence phenotypes of Erwinia chrysanthemi EC 16 on Nicotiana clevelandii seedlings. Proc. Natl. Acad. Sci. USA 99:13142-13147.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Xylella fastidiosa (Xj), a Gram-negative, xylem-limited bacterium, is the causal agent of several economically important plant diseases, including Pierce's disease (PD) and Citrus Variegated Chlorosis (CVC). Identified is a HecA-like hemagglutinin gene in Xylella fastidiosa involved in the virulence of the pathogen.. In essence this protein is a 'molecular glue' that specifically attaches to the surface of Xylella fastidiosa causing Xylella fastidiosa cells to form aggregrates. If this protein is expressed in transgenic plants, this protein could cause greater aggregation of Xylella fastidiosa cells in planta, thus slowing down the movement of Xylellafastidiosa and decreasing disease symptoms. The protein can also be introduced into the plant by inoculation with a plant endophyte which expresses and secretes a HecA-like hemagglutinin. Thus plants containing increased levels of a Xylella fastidiosa HecA-like hemagglutinin protein could have an increased level of field resistance to disease caused by Xylella fastidiosa

Description

ENGINEERING RESISTANCE TO PIERCE'S DISEASE BY EXPRESSION OF A XYLELLA FASTIDLOSA HECA-LIKE HEMAGGLUTININ PROTEIN
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit under 35 USC §119(e) of U.S. Provisional Application 60/638,988, filed December 22, 2004.
GOVERNMENT RIGHTS
This invention was made with Government support from the California Department of Food and Agriculture (03-0287), USDA CSREES 2002-34442-12461 and UC Division of Agriculture and Natural Resources Pierce' s Disease Research Grant (SA6627). The Government may have certain rights in this invention.
FIELD OF THE INVENTION
This invention is in the field of pest resistance. Specifically the invention relates to the resistance of plants against the bacterium Xylella fastidiosa, achieved by expression in plants of a gene encoding a bacterial HecA-like hemagglutinin.
BACKGROUND OF THE INVENTION
Xylella fastidiosa (Xf) is a Gram-negative, xylem-limited bacterium that is transmitted from plant to plant by several xylem-feeding insect vectors. (Hopkins, 1989) Strains of Xylella fastidiosa cause diseases in many economically important plants including grapevines (Pierce's Disease), citrus (Citrus Variegated Chlorosis), peach, plum, oleander, elm, sycamore, oak, maple, and coffee (De Lima et al., 1998; Purcell, 1997). The major symptoms of most Xylella fastidiosa diseases are associated with water-stress, due to reduced xylem flow, which is thought to result from occlusion of the xylem vessels by bacterial aggregates that likely contain EPS (da Silva et al., 2001), gums and tyloses (Hopkins 1989). The onset of disease is as follows: leaf margins progressively dry inward, scorched leaf blades abscise and fall, leaving the petiole attached to the cane (match stick symptom). The canes then lignify irregularly, which produces patches of green tissues surrounded by mature, brown tissue (green island symptom). Finally the whole plant dies. Thus there is a tremendous need to develop plants that are resistant to Xylella fastidiosa infection. SUMMARY OF THE INVENTION
In one embodiment, the present invention meets these needs by providing transgenic plants or genetically engineered plant endophytes that express a Hec A-like hemagglutinin, or a fragment thereof, which inhibits the growth and spread of Xylella fastidiosa, thereby providing resistance to Pierce' s Disease and other diseases caused by Xylella fastidiosa. The Hec A-like hemagglutinin proteins include the amino acid sequences NPNL (amino acids 114 through 117 of SEQ ID NO: 6) and NPYGI (amino acids 154 through 158 of SEQ ID NO: 6) and may be from Xylella fastidiosa. The Hec A-like hemagglutinin may be expressed in various plants such as grapevines, citrus, peach, plum, oleander, elm, sycamore, oak, maple and coffee or in plant endophytes growing in such plants. In another embodiment, the present invention is further directed to seeds produced by the transgenic plants of the invention, or seeds produced by plants infected with a transgenic endophyte. In another embodiment the invention also provides for methods of generating such transgenic plants and plant endophytes.
In yet another embodiment, the invention is further directed to recombinant HecA-like hemagglutinins or fragments thereof which confer resistance to Xylella fastidiosa when expressed in plants or plant microbial endophytes which are present in plants. Two examples of these proteins are HxfA and HxfB.
In yet another embodiment, the invention is further directed to isolated nucleic acid sequences which encode recombinant Xylella fastidiosa HecA-like hemagglutinins or fragments thereof which confer resistance to Xylella fastidiosa when expressed in plants or plant endophytes present in plants.
In yet another embodiment, the invention is further directed to recombinant constructs containing such isolated nucleic acids. The recombinant constructs may further include a promoter. The promoter may be a constitutive promoter, inducible promoter, tissue- or cell- specific promoter, or a developmentally-regulated promoter. The promoters may be expressible in a plant, a bacteria and/or a plant endophyte. The recombinant constructs may further be in a vector. By way of example but not limitation, the vector may be a cloning, expression, transformation, or transfection vector.
In another embodiment, the invention is further directed to isolated nucleic acids encoding HecA-like hemagglutinins and paralogs, homologs and orthologs of the protein. The HecA-like hemagglutinin protein encoding nucleic acid sequence as defined herein refers to any sequence that hybridizes to the nucleic acid molecule encoding the HecA-like hemagglutinin, or the complement thereof under at least low stringency, preferably moderate, high or very high stringency conditions, or is about 85%, 90%, 95% or 97% identical in the nucleic acid sequence, or encodes a polypeptide with Hec-A like hemagglutinin activity having at least about 85%, 90%, 95% or 97% sequence identity to the HecA-like hemagglutinin protein, and confer resistance to disease caused by Xylellafastidiosa.
Yet another aspect of the present invention is a host cell containing any of the above nucleic acids, vectors, or constructs. Such nucleic acids, vectors and construct may be introduced into a prokaryotic or eukaryotic host cell. Preferred host cells include bacterial cells such as E. coli and plant endophytes from such genera as Pseudomonas, Agrobacterium, Bacillus, and others, yeast cells, and plant cells. The nucleic acids, vectors and constructs may be introduced into the host cells so that the expression of the nucleic acid may be controlled or regulated. The introduction of the construct into the host cell may be transient or stable. The control or regulation may include tissue-specific promoters designed to express the isolated nucleic acids in given tissues. Such regulation may be directed to constitutive expression. The regulation may be responsive to various biotic, abiotic and artificial stimuli, relative to the native promoter. In yet another embodiment, the invention is further directed to plants which contain the host cells.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows Pierce' s disease symptoms in grapevines. A shows mock inoculation of Chardonnay grapevines and B shows Chardonnay grapevines infected with the wild type strain Temecula showing a disease rating of 1, C shows a disease rating of 2, D shows a disease rating of 3, E shows a disease rating of 4, and F shows a disease rating of 5. Note the general health of the plants and the number of scorched leaves.
Figure 2 shows disease progression of various grapevine varieties inoculated with wild type or Tn5 mutants of Xylellafastidiosa. Disease severity was based on a visual disease scale, from 0 to 5 and was assessed 10, 14, 16, 18, 20 and 32 weeks after inoculations. The data is an average of two independent replications (6 plants total) for the inoculations in Chardonnay grapevines and one replication (3 plants total) for the inoculations in Chenin Blanc and Thompson seedless grapevines. PspB Xylellafastidiosa mutant was lost in storage and was not inoculated in Chenin Blanc and Thompson seedless. HxfB was only inoculated in Chardonnay grapevines, (a) = disease severity was rated as 0 (healthy) 10 weeks after inoculation, (b) = water control was not showing symptom during the course of disease progression (disease severity was 0). * = mutant values were not significantly different from wild type values at the 95% confidence level (p<0.05).
Figure 3 shows an alignment of the N-terminal region of the hemagglutinin-like proteins from X. fastidiosa and the hemagglutinin protein, HecA from E. chrysanthemi. Letters and numbers on the left indicate the name of the Xylella fastidiosa genes as described in the Xylella fastidiosa PD genome web site (University of Campinas, Brazil, Institute of Computing, Library for Bioinformatics). HxfA and HxfB indicate the Xylella fastidiosa hemagglutinin proteins, PD2118 (SEQ ID NO: 5, GenBank accession number NP 780288) and PD1792 (SEQ ID NO: 3, GenBank accession number NP 779977), respectively. HecA indicates the name of the hemagglutinin protein from E. chrysanthemi (GenBank accession number AF501263). Numbers on the right indicate amino acid residues. The two conserved secretion domains NPNL (amino acids 114 through 117 of SEQ ID NO: 6) and NPYGI (amino acids 154 through 158 of SEQ ID NO: 6), of proteins secreted through the two- partner secretion (TPS) pathway are underlined (Schonherr et al., 1993). N, P, L, G and I indicate asparagine, proline, leucine, glycine and isoleucine, respectively. Several Tps proteins, including HecA, harbor a CXXC motif (SEQ ID NO: 33), which is absent in others. These cysteines (C) are not essential for secretion (Schonherr et al., 1993). An asterisk (*) indicates that Tps secretion domains were conserved in those amino acid sequences.
Figure 4 shows Lipopolysaccharide (LPS) profiles of strains of Xylella fastidiosa as revealed by SDS-PAGE and silver staining. In lane 1 is wild type strain and lane 2 is XF 1542 mutant strain.
Figure 5 shows the growth of Xylella fastidiosa wild type and Tn5 mutants in liquid PD3 medium. Growth curves were determined based on OD6O0. Data are average of two experiments with two repetitions each. Figure 6 shows HxfA-dependent aggregation of Xylella fastidiosa cells in vitro and in planta. Panels A, C, E and G show Xylella fastidiosa wild type cells; Panels B, D, F and H show Xylella fastidiosa hxfA mutant cells. Panels A and B show wild type and hxfA mutant cells, respectively, inoculated into PD3 medium in a 125 ml flask and placed on a shaker. The degree of self-aggregation was visualized after 10 days of incubation. Panels C and D show wild type and hxfA mutant cells, respectively, plated onto PD3 medium plates. The colony morphology was examined after 10 days of incubation. Panels E and F show wild type and hxfA cells in xylem vessels. Note the lack of a three dimension array in the HxfA mutant compare to wild type. Panels G and H show higher magnification of wild type and hxfA cells in a biofilm. Note the wild type cells typically aggregated together side to side while the hxfA mutant cells did not aggregate in this manner. Scale bar equivalent to 5 microns in every panel.
Figure 7 shows a model of possible mechanisms involved in X. fastidiosa adhesion to xylem vessels of grapevines. Rods me X. fastidiosa cells. A shows how Xylella fastidiosa bacteria attach to the surface using most likely non-fimbrial adhesins, other than hemagglutinins (Tables 4; Feil et al., 2003); B shows how HxfA, HxfB and other adhesins mediate secondary contact between Xylella fastidiosa cells allowing in C, which shows microcolony formation. Based on the results, hemagglutinins appear to be important mediators for cell-cell aggregation; D shows bacterial cells finally aggregating to each other via hemagglutinins HxfA and HxfB, fimbriae and exopoly saccharides (EPS) to form matured biofilms within the xylem vessels (Tables 2 and 4, Figures 6; Feil et al., 2003).
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO: 1 is the amino acid sequence of PD2116, a Xylella fastidiosa hemagglutinin-like protein.
SEQ ID NO: 2 is the amino acid sequence of PD2110, a Xylella fastidiosa hemagglutinin-like protein.
SEQ ID NO: 3 is the amino acid sequence of PD1792, a Xylella fastidiosa hemagglutinin-like protein, also referred to as HxfB.
SEQ ID NO: 4 is the amino acid sequence of PD 1246, aXylellafastidiosa hemagglutinin-like protein.
SEQ ID NO: 5 is the amino acid sequence of PD2118, aXylellafastidiosa hemagglutinin-like protein, also referred to as HxfA.
SEQ ID NO: 6 is the amino acid sequence of HecA, a hemagglutinin protein from E. chrysanthemi.
SEQ ID NO: 7 is the amino acid sequence of PD0988, aXylellafastidiosa hemagglutinin-like protein.
SEQ ID NO: 8 is the amino acid sequence of PD0986, annotated as a Xylella fastidiosa hemagglutinin-like protein (Van Sluys et al. 2003).
SEQ ID NO: 9-32 are sequences of primers used herein.
DETAILED DESCRIPTION OF THE INVENTION
In one embodiment, the present invention provides transgenic plants or genetically engineered plant endophytes that are present in plants that express a HecA-like hemagglutinin, or a fragment thereof, which inhibits the growth and spread of Xylella fastidiosa, thereby providing resistance to Pierce' s Disease and other diseases caused by Xylella fastidiosa. The HecA-like hemagglutinin may be isolated from Xylella fastidiosa
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
Throughout this disclosure, various publications, patents and published patent specifications are referenced. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this invention pertains. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant breeding, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987); Plant Breeding: Principles and Prospects (Plant Breeding, VoI 1) M.D. Hayward, N. O. Bosemark, I. Romagosa; Chapman & Hall, (1993.); Coligan, Dunn, Ploegh, Speicher and Wingfeld, eds. (1995) CURRENT PROTOCOLS IN PROTEIN SCIENCE (John Wiley & Sons, Inc.); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (MJ. MacPherson, B.D. Hames and G.R. Taylor eds. (1995), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE R.I. Freshney, ed. (1987).
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Lewin, Genes V, published by Oxford University Press, 1994 (SBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (SBN 0- 632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology, a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081- 569-8); Ausubel et al. (1987) Current Protocols in Molecular Biology, Green Publishing; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York. Definitions of common terms in plant biology may be found in Esau, Plant Anatomy, published by John Wiley & Sons (1977) (ISBN 0-471-24520-8); and Solomon et al, Biology, published by Saunders College Publishing (1993).
Definitions
In order to facilitate review of the various embodiments of the invention, the following definitions are provided:
Promoter: A regulatory nucleic acid sequence, typically located upstream (5') of a gene or protein-coding sequence that, in conjunction with various cellular proteins, is responsible for regulating the expression of the gene or protein-coding sequence. The promoters suitable for use in the heterologous nucleic acids of this invention are functional in plants and in other host organisms used for expressing the inventive polynucleotides. Many plant promoters are publicly known. These include constitutive promoters, regulated promoters, inducible promoters, root-, tissue- and cell-specific promoters, and developmentally-regulated promoters. Exemplary promoters and fusion promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference. The promoters may be those normally associated with a transgene of interest, or heterologous promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi. Those skilled in the art will be able without undue experimentation to select promoters that are suitable for use in practicing the subject invention.
Regulated promoter: As used herein, this term refers to any promoter functional in a plant that provides differential expression levels in response to stimuli internal to the plant such as developmental signals. This includes both promoters that increase expression and promoters that decrease expression in response to stimuli or changed external conditions. Many promoters that are regulated promoters are also inducible promoters. For example, promoters that are responsive to auxin are both because they will change levels of expression in response to developmental changes in auxin levels and in response to externally supplied auxin.
Examples of regulated promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers. Exemplary promoters include the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051, both herein incorporated by reference), glob-1 promoter, and gamma-zein promoter. An exemplary promoter for leaf- and stalk-preferred expression is MS8-15 (see U.S. Pat. No. 5,986,174, herein incorporated by reference). Examples of seed- preferred promoters included, but are not limited to, 27 kDa gamma zein promoter and waxy promoter (Boronat et al. (1986); Reina et al. (1990); and Kloesgen et al. (1986)). Promoters that express in the embryo, pericarp, and endosperm are disclosed in U.S. applications Ser. No. 60/097,233 filed Aug. 20, 1998 and U.S. applications Ser. No. 60/098,230 filed Aug. 28, 1998 both of which are hereby incorporated by reference. The operation of a promoter may also vary depending on its location in the genome. Thus, a developmentally regulated promoter may become fully or partially constitutive in certain locations. A developmentally regulated promoter can also be modified, if necessary, for weak expression.
Tissue specific promoter: As used herein, this term refers to any promoter functional in a plant that provides differential expression levels in different tissues within the plant. Such promoters may provide tissue specific expression in one or several tissues. Many promoters that are tissue specific are also regulated promoters. For example, some promoters specifically express in plant seeds only during certain stages of the seeds growth cycle. Examples of tissue specific promoters include those listed above that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers. Examples from above include anther specific promoters, leaf- and stalk-specific promoters, seed-specific promoters, embryo-specific promoters, pericarp-specific promoters, and endosperm-specific promoters. Additionally, as discussed above under localization, tissue specific expression occurs when there is on average a skewed expression in one or more tissues of a plant when compared to the average expression in the other tissues in such plant.
Sequence Identity: Sequences that show similarity to those described in this application can be identified by computer-based methods, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others).
Similarity searches retrieve and align sequences for comparison with a target sequence to be analyzed (i.e., a query sequence). The optimal alignment between local regions of the compared sequences is known as a local alignment. Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.
Polynucleotide and polypeptide sequences may be aligned, and percentage of identical residues in a specified region may be determined against other polynucleotide and polypeptide sequences, using computer algorithms that are publicly available. The percentage identity score is dependent on the length of the overlap region of the sequences being compared.
The similarity between two nucleic acid sequences, or two amino acid sequences may be expressed in terms of sequence identity (or, for proteins, also in terms of sequence similarity). Sequence identity is frequently measured in terms of percentage identity; the higher the percentage, the more similar the two sequences are. As described herein, homologs and variants of the HecA-like hemagglutinin-encoding nucleic acid molecules may be used in the present invention. Homologs and variants of these nucleic acid molecules will possess a relatively high degree of sequence identity when aligned using standard methods. Such homologs and variants will hybridize under high stringency conditions to one another.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman (1981); Needleman and Wunsch (1970); Pearson and Lipman (1988); Higgins and Sharp (1988); Higgins and Sharp (1989); Corpet et a (1988); Huang et a (1992); and Pearson et ah (1994). Altschul et a (1994) presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et ah, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. It can be accessed at the NCBI Website. A description of how to determine sequence identity using this program is available at the NCBI website.
Homologs of the disclosed protein sequences are typically characterized by possession of at least 40% sequence identity counted over the full length alignment with the amino acid sequence of the disclosed sequence using the NCBI Blast 2.0, gapped blastp set to default parameters. The adjustable parameters are preferably set with the following values: overlap span 1, overlap fraction = 0.125, word threshold (T) - 11. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity. Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% sequence identity.
Homologs of the disclosed nucleic acid sequences are typically characterized by possession of at least 40% sequence identity counted over the full length alignment with the amino acid sequence of the disclosed sequence using the NCBI Blast 2.0, gapped blastn set to default parameters. In addition, such sequences hybridize to homologous sequences under high stringency conditions. A preferred method utilizes the BLASTN module of WU-BLAST-2 (Altschul et ah, 1996); set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% sequence identity. The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer amino acids than a HecA-like hemagglutinin from Xylella fastidiosa, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical amino acids in relation to the total number of amino acids. Thus, for example, sequence identity of sequences shorter than that shown in the figures as discussed below, will be determined using the number of amino acids in the longer sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as, insertions, deletions, substitutions, etc.
In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of "0", which obviates the need for a weighted scale or parameters as described herein for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the "shorter" sequence in the aligned region and multiplying by 100. The "longer" sequence is the one having the most actual residues in the aligned region.
Proteins can be classified according to their sequence relatedness to other proteins in the same genome (paralogs) or a different genome (orthologs). Ortholog genes are genes that evolved by speciation from a common ancestral gene. These genes normally retain the same function as they evolve. Paralog genes are genes that are duplicated within a genome. These genes may acquire new specificities or modified functions which may be related to the original one. Phylogenetic analysis methods are well-known to those with ordinary skill in bioinformatics.
As will be appreciated by those skilled in the art, the sequences of the present invention may contain sequencing errors. That is, there may be incorrect amino acid sequences, nucleotides, frameshifts, unknown nucleotides, or other types of sequencing errors in any of the sequences; however, the correct sequences will fall within the homology and stringency definitions herein for nucleic acids, and the protein homology described for proteins or polypeptides.
Stringency: Stringency refers to hybridization conditions chosen to optimize binding of polynucleotide sequences with different degrees of complementarity. Stringency is affected by factors such as temperature, salt conditions, the presence of organic solvents in the hybridization mixtures, and the lengths and base compositions of the sequences to be hybridized and the extent of base mismatching, and the combination of parameters is more important than the absolute measure of any one factor.
Very High Stringency: Very high stringency conditions refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 μg/ml single stranded DNA at 55-65° C for 8 hours, and washing in 0.1 X SSC and 0.1% SDS at 60-65° C for thirty minutes.
High Stringency: High stringency conditions refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 μg/ml single stranded DNA at 55- 65° C for 8 hours, and washing in 0.2 X SSC and 0.2% SDS at 60-65° C for thirty minutes.
Moderate Stringency: Moderate stringency conditions refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS), 100 μg/ml single stranded DNA at 55-65° C for 8 hours, and washing in 0.2 X SSC and 0.2% SDS at 50-55° C for thirty minutes.
Low Stringency: Low stringency conditions refers to hybridization to filter-bound DNA in 5 X SSC, 2% sodium dodecyl sulfate (SDS)3 100 μg/ml single stranded DNA at 55- 65° C for 8 hours, and washing in 2.0 X SSC and 0.2% SDS at 50-55° C for thirty minutes.
Construct: Unless otherwise stated, the term "construct" refers to a recombinant genetic molecule comprising one or more isolated polynucleotide sequences of the invention.
Genetic constructs used for transgene expression in a host organism comprise a gene promoter sequence operably linked to an open reading frame coding for at least a functional portion of a polypeptide of the present invention and optionally a gene termination sequence 3' downstream of the open reading frame. The open reading frame may be orientated in either a sense or anti-sense direction, depending upon the intended use of the gene sequence. The construct may also comprise selectable marker gene(s) and other regulatory elements for gene expression.
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter controls the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary, join two protein-coding regions in the same reading frame. With respect to polypeptides, two polypeptide sequences may be operably linked by covalent linkage, such as through peptide bonds or disulfide bonds.
Vector: The term "vector" refers to a nucleic acid molecule which is used to introduce a polynucleotide sequence into a host cell, thereby producing a transformed host cell. A "vector" may comprise genetic material in addition to the above-described genetic construct, e.g., one or more nucleic acid sequences that permit it to replicate in one or more host cells, such as origin(s) of replication, selectable marker genes and other genetic elements known in the art (e.g., sequences for integrating the genetic material into the genome of the host cell, and so on).
Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, plant or animal cell, including transfection with viral vectors, transformation by Agrobacterium, with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration and includes transient as well as stable transformants.
Isolated: An "isolated" biological component (such as a nucleic acid or protein or organelle) has been substantially separated or purified away from other biological components in the cell or the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term embraces nucleic acids including chemically synthesized nucleic acids and also embraces proteins prepared by recombinant expression in vitro or in a host cell and recombinant nucleic acids as defined below. As an example, a gene in a large genomic DNA fragment such as a contig is not sufficiently purified away from other biological components to be considered isolated due to the relatively large amount of extra DNA found in the average contig. As outlined below "recombinant nucleic acids" and "recombinant proteins" also are "isolated" as described above
Recombinant: By "recombinant nucleic acid" herein is meant a nucleic acid that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of nucleic acids, e.g., by genetic engineering techniques, such as by the manipulation of at least one nucleic acid by a restriction enzyme, ligase, recombinase, and/or a polymerase. Once introduced into a host cell, a recombinant nucleic acid is replicated by the host cell; however, the recombinant nucleic acid once replicated in the cell remains a recombinant nucleic acid for purposes of this invention. By "recombinant protein" herein is meant a protein produced by a method employing a recombinant nucleic acid. As outlined above "recombinant nucleic acids" and "recombinant proteins" also are "isolated" as described above. A gene in a large fragment such as a contig would not be a "recombinant nucleic acid" given that such artificial combination does not relate to the gene. However, if sequences around or within a gene in a contig have been manipulated for purposes relating to that gene (i.e., not merely because the gene is near the end of the contig), then such a gene in a contig would constitute a "recombinant nucleic acid" due to the relative proximity of the recombinant portion of the nucleic acid to the gene in question.
Complementary DNA (cDNA): A piece of DNA that is synthesized in the laboratory by reverse transcription of an RNA, preferably an RNA extracted from cells. cDNA produced from mRNA may include 5' and/or 3' noncoding sequences (i.e., 5' UTR, 3' UTR) but typically lacks internal, non-coding segments (introns) and regulatory sequences, such as promoters, that determine transcription.
Open reading frame (ORF): A continuous coding sequence of a gene flanked by a start and stop codon. An ORF lacks internal termination codons and can usually be translated into an amino acid sequence.
Transgenic plant: As used herein, this term refers to a plant that contains recombinant genetic material not normally found in plants of this type, as well as recombinant genetic material normally found in such plants but in an abnormal position in the genome, and which has been introduced into the plant in question (or into progenitors of the plant) by human manipulation. Thus, a plant into which recombinant DNA is introduced by transformation is a transgenic plant, as are all offspring of that plant that contain the introduced transgene (whether produced sexually or asexually). It is understood that the term transgenic plant encompasses the entire plant and parts of the plant, for instance grains, seeds, flowers, leaves, roots, fruit, pollen, stems etc.
Standard molecular biology methods and plant transformation techniques can be used to produce transgenic plants that produce plants having a recombinant gene or genes providing HecA-like hemagglutinin activity.
Ortholog: Two nucleotide or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species, sub-species, or cultivars. Orthologous sequences are also homologous sequences. Orthologous sequences hybridize to one another under high- stringency conditions. The term "polynucleotide", "oligonucleotide", or "nucleic acid" refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The terms "polynucleotide" and "nucleotide" as used herein are used interchangeably. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. A "fragment" or "segment" of a nucleic acid is a small piece of that nucleic acid.
Gene: A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
Primer: The terms "primer" and "nucleic acid primer" are used interchangeably herein. A "primer" refers to a short polynucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method.
Polymerase chain reaction: A "polymerase chain reaction" ("PCR") is a reaction in which replicate copies are made of a target polynucleotide using a "primer pair" or a "set of primers" consisting of an "forward" and a "reverse" primer, and a catalyst of polymerization, such as a DNA polymerase, and particularly a thermally stable polymerase enzyme. Methods for PCR are taught in U.S. Patent Nos. 4,683,195 (Mullis) and 4,683,202 (Mullis et al.). All processes of producing replicate copies of the same polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "amplification" or "replication".
Characterization of HecA-like Hemagglutinins
A hemagglutinin-like gene has been identified in Xylella fastidiosa that has 80% amino acid homology with a hemagglutinin gene called HecA from Erwinia chrysanthemi (Rojas et al, 2002). HecA mediates surface attachment, cell aggregation and contributes to the virulence of E. chrysanthemi. Multiple pathogenicity testing of one Xylella fastidiosa HecA homolog, designated as HxfA, clearly shows the HxfA has an important role in Xylella fastidiosa virulence. As explained in detail below, the HxfA mutants no longer clump together in liquid culture, as do wild type Xylella fastidiosa cells. Scanning electron microscopic examination of cell masses that attach to the inside of a glass flask show the HxfA cells are largely disordered and not attached together by the length of their cell surface like wild type cells (Guilhabert and Kirkpatrick, 2005). This data indicates that HxfA is essentially a molecular "glue" that plays a very important role in cell-cell aggregation. Also identified is another HecA-like hemagglutinin in Xylella fastidiosa, designated HxfB, in which mutation also causes the phenotype above.
It is known that one of the virulence determinants of Xylella fastidiosa is its ability to systemically colonize susceptible Vitis genotypes and more resistant genotypes have the ability to slow the movement of Xylella fastidiosa by producing gums and tyloses (Fry and Mollenhauer, 1990). Following the teachings of one embodiment of this invention, a HecA- like hemagglutinin is introduced and expressed to reasonable levels in the xylem fluid of plants such as grapevines. The HecA-like hemagglutinin may be expressed by introducing the HecA-like hemagglutinin gene into the plant genome directly or by expressing the gene in a plant endophyte that has been introduced into the plant. This protein should act as an adhesive to cause Xylella fastidiosa cells to aggregate and reduce the number of planktonic cells that could circulate freely in xylem vessels and initiate new xylem vessel infections by degrading pit membranes that separate xylem elements. If the HecA-like hemagglutinin also associated with the charged cellulose/pectin surfaces of the xylem secondary walls, it could further act as a cellular glue to immobilize and slow the systemic movement of Xylella fastidiosa. If this movement was slowed, Xylella fastidiosa may not have sufficient time to move back into permanent cordons and establish an overwintering systemic infection before a plant infected with a wild type Xylella fastidiosa cells was pruned off during the winter. The end result could be a plant that was far less likely to support overwintering, systemic infections of Xylella fastidiosa than a non-engineered plant.
In one embodiment, the present invention is directed to the observation, as more fully described in the examples below, that Xylella fastidiosa strains which lack expression of HxfA or HxfB are more virulent that wild type strains, due to increased motility (Guilhabert and Kirkpatrick, 2005). This suggests that expression of a HecA-like hemagglutinin (the product of the HxfA and HxfB genes) in plants would hinder Xylella fastidiosa movement and therefore inhibit infection. As such, in one embodiment, the present invention is directed to transgenic plants which express a HecA-like hemagglutinin, and are therefore more resistant to disease caused by Xylella fastidiosa. In another embodiment, the present invention is directed to plant endophytes which express a HecA-like hemagglutinin, and which can be introduced into plants to provide resistance to disease caused by Xylella fastidiosa.
Constructs
HecA like hemagglutinin The present invention includes various aspects of nucleic acid sequences encoding one or more proteins that provide HecA-like hemagglutinin activity. One structural feature of HecA-like hemagglutinin proteins is the presence of conserved TPS (two partner secretion) domains, illustrated in Figure 3. There are two conserved sequence domains, NPNL (amino acids 114 through 117 of SEQ ID NO: 6) and NPYGI (amino acids 154 through 158 of SEQ ID NO: 6), which are found in HecA-like hemagglutinins.
A preferred embodiment of the nucleic acid of the present invention is an isolated nucleic acid encoding a HecA-like hemagglutinin protein or fragment thereof having cell clumping activity. Such HecA-like hemagglutinin proteins include HxfA and HxfB. Examples of such nucleic acids include nucleic acids that hybridize to the HecA-like hemagglutinin encoding nucleic acid disclosed herein under low, moderate, high or very high stringency, nucleic acids with 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity to the HecA-like hemagglutinin encoding nucleic acids disclosed herein, and nucleic acids encoding a protein with 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity to the HecA-like hemagglutinin proteins disclosed herein. In addition, the nucleic acids may include nucleic acids that encode proteins that share conserved regions with other HecA-like hemagglutinin proteins when aligned with HecA-like hemagglutinin protein families. Such conserved regions may share 70%, 75%, 80%, 85%, 90%, 95%, or 97% identity.
In addition, the present invention includes the above nucleic acid sequences operably linked to a promoter. The preferred promoter is a heterologous promoter. The choice of promoter will be dictated by the target cell, tissue, and/or development expression pattern in which the HecA-like hemagglutinin protein is to be expressed. Selection of an appropriate promoter functional in a desired target cell is routine in the art. One of skill in the art can use, for example, a constitutive promoter, an inducible promoter or a regulated promoter depending upon the desired pattern of expression. In addition to natural promoters, mutant promoters and artificial promoters created by splicing distinct regulatory elements may be used.
Another aspect of the present invention is vectors including the nucleic acids and promoter linked constructs described above. There are a wide range of vectors available to one of skill in the art. Such vectors can include, without limitation, expression vectors, cloning vectors, shuttle vectors, etc. which can include, but are not limited to, the following vectors or their derivatives: human, animal, or plant viruses such as vaccinia virus, adenovirus, cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid (e.g. the Ti plasmid of Agrobacterium tumefaciens) and cosmid DNA vectors, to name but a few. Selection of the appropriate vector will be dictated by the target cells, desired expression mode (e.g., transient expression versus permanent integration into the genome versus independently replicating vectors will cause one of skill in the art to select different vectors), and ease of recombinant manipulation. In some circumstances, one of skill in the art would use a shuttle vector that is functional in at least two organisms so that the nucleic acid may be manipulated in one organism and then transferred into the other.
For example, vectors can be engineered which allow for the production of transgenic plants which express a HecA-like hemagglutinin. Vectors can also be created which allow for the expression of a HecA-like hemagglutinin in a plant endophyte.
Transgenic Plants
One approach described herein involves production of a transgenic plant that expresses anti-microbial peptides in hopes of eliminating or killing Xylellafastidiosa cells en planta. The hemagglutinin-mediated resistance described herein more specifically targets Xylellafastidiosa and offers a transgenic resistance approach that may be more acceptable to regulatory agencies and the public. For some plants, if the hemagglutinin gene is expressed at sufficient levels in rootstocks, such rootstocks may provide systemic protection to existing cultivars grafted on engineered rootstocks. One example of a plant which can be modified to express a HecA-like hemagglutinin is grapevines. Other examples of plants include but are not limited to: citrus, peach, plum, oleander, elm, sycamore, oak, maple, alfalfa, almond, pear, coffee, mulberry, sedges, periwinkle, and hemlock
Introduction of the selected construct into plants is typically achieved using standard transformation techniques. The basic approach is to: (a) clone the construct into a transformation vector, which (b) is then introduced into plant cells by one of a number of techniques (e.g., electroporation, microparticle bombardment, Agrobacterium infection); (c) identify the transformed plant cells and regenerate whole plants from the identified plant cells, and (d) select progeny plants containing the introduced construct.
Preferably all or part of the transformation vector will stably integrate into the genome of the plant cell. That part of the transformation vector which integrates into the plant cell and which contains the introduced recombinant sequence may be referred to as the recombinant expression cassette.
Selection of progeny plants containing the introduced transgene may be made based upon the detection of the recombinant HecA-like hemagglutinin encoding gene in transgenic plants, upon the detection of the recombinant HecA-like hemagglutinin protein-coding sequence or upon enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a selectable marker gene incorporated into the transformation vector.
Successful examples of the modification of plant characteristics by transformation with cloned nucleic acid sequences are replete in the technical and scientific literature. Selected examples, which serve to illustrate the knowledge in this field of technology include: U.S. Patent No.5,571, 706 ("Plant Virus Resistance Gene and Methods"); U.S. Patent No.5,677,175 ("Plant Pathogen Induced Proteins"); U.S. Patent No. 5,510,471 ("Chimeric Gene for the Transformation of Plants"); U.S. Patent No.5,750,386 ("Pathogen-Resistant Transgenic Plants"); U.S. Patent No.5,597,945 ("Plants Genetically Enhanced for Disease Resistance"); U.S. Patent No.5,589,615 ("Process for the Production of Transgenic Plants with Increased Nutritional Value Via the Expression of Modified 2S Storage Albumins"); U.S. Patent No.5,750,871 ("Transformation and Foreign Gene Expression in Brassica Species"); U.S. Patent No. 5,268,526 ("Overexpression of Phytochrome in Transgenic Plants"); U.S. Patent No. 5,780,708 ("Fertile Transgenic Cora Plants"); U.S. Patent No. 5,538,880 ("Method for Preparing Fertile Transgenic Corn Plants"); U.S. Patent No. 5,773,269 ("Fertile Transgenic Oat Plants"); U.S. Patent No. 5,736,369 ("Method for Producing Transgenic Cereal Plants"); U.S. Patent No. 5,610,049 ("Methods for Stable Transformation of Wheat"); U.S. Patent No. 6,235,529 ("Compositions and Methods for Plant Transformation and Regeneration"); Iocco et al. (2001); and Mezzetti et al. (2002) all of which are hereby incorporated by reference in their entirety. These examples include descriptions of transformation vector selection, transformation techniques and the construction of constructs designed to express an introduced transgene.
The transgene-expressing constructs of the present invention may be usefully expressed in a wide range of plants which are susceptible to diseases caused by Xylella fastidiosa.
Methods for the transformation and regeneration of monocotyledonous and dicotyledonous plant cells are known, and the appropriate transformation technique will be determined by the practitioner. The choice of method will vary with the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types. Suitable methods may include, but are not limited to: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG-mediated transformation); transformation using viruses; micro-injection of plant cells; micro-projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium-mQdiatQά transformation. Typical procedures for transforming and regenerating plants are described in the patent documents listed above.
Following transformation, transformants are preferably selected using a dominant selectable marker. Typically, such a marker will confer antibiotic or herbicide resistance on the seedlings of transformed plants, and selection of transformants can be accomplished by exposing the seedlings to appropriate concentrations of the antibiotic or herbicide. Suitable markers include, without limitation, those genes coding for resistance to the antibiotic spectinomycin or streptomycin (e.g., the aada gene), the streptomycin phosphotransferase (SPT) gene coding for streptomycin resistance, the neomycin phosphotransferase (NPTII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (HPT) gene coding for hygromycin resistance. After transformed plants are selected and grown the plant can be assayed for expression of recombinant HecA-like hemagglutinin. Examples of plants which can be transformed to express a HecA-like hemagglutinin gene include but are not limited to grapevine, citrus, peach, plum, oleander, elm, sycamore, oak, maple, alfalfa, almond, pear, coffee, mulberry, sedges, periwinkle, and hemlock.
Transgenic Plant Endophytes
In another embodiment, levels of Xylella fastidiosa (Xf) hemagglutinin (HA) protein may be increased in xylem fluids of plants by introducing and expressing a cloned Xylella fastidiosa HecA-like hemagglutinin gene in a bacterial/fungal endophyte that colonizes plant tissues such as xylem tissues.
Endophytes There are a number of bacterial endophytes that can colonize and multiply to reasonably high populations in the xylem of plants. Some of these endophytes such as Pseudomonas and Agrobacterium species are well studied and transformation systems for introducing any gene into these species are numerous and well documented. Genetically engineered bacterial endophytes could introduce significant levels of HecA-like hemagglutinin directly into the xylem fluids where Xylella fastidiosa resides and causes disease and possibly slow their colonization as described for transgenic grapevines expressing a HecA-like hemagglutinin.
Another strategy for elevating levels of Xylella fastidiosa HecA-like hemagglutinin in xylem fluids would be to introduce and express a cloned Xylella fastidiosa HecA-like hemagglutinin gene in an avirulent strain of Xylella fastidiosa. Such engineered avirulent strains of Xylella fastidiosa could be introduced into plants such as grapevines. This strategy could slow or inhibit the initiation or progression of Pierce' s disease by virulent stains of Xylella fastidiosa.
Also identified are other endophytes, such a Bacillus and a Cellulomonas spp. that may be more difficult to genetically manipulate. However, these two endophytes are naturally antagonistic XoXylellafastidiosa and they have provided some level of protection against the development of Pierce's disease when they are inoculated into grapevines that are later exposed to Xylella fastidiosa-ini ectious insect vectors. (D. Darjean, Chemical and Biological strategies for the management of Xylella fastidiosa, the causal agent of Pierce's disease of grapes, Ph.D. dissertation, University of California, Davis.) If HecA-like hemagglutinin could be expressed by a xylem-colonizing, Xylella fastidiosa-antagonisάc bacterial endophyte, the HecA-like hemagglutinin may aggregate and immobilize the Xylella fastidiosa cells and make them more susceptible to inhibitory substance(s) produced by these endophytic antagonists. It is also possible that endophyte expressed HecA-like hemagglutinin could act as an adhesion molecule that would associate Xylella fastidiosa cells and the antagonistic endophyte, thus potentially providing better suppression of Xylella fastidiosa populations in grapevines and possibly provide a control for diseases caused by Xylella fastidiosa such as Pierce's disease.
Any bacterial or fungal endophyte which can colonize plant tissues can be used. Examples of such fungal endophytes include Eutypella aequlinearis and Diatrypella spp.
Introduction of a HecA-like hemagglutinin into a plant endophyte Transformation of endophytes is well known in the art. Any endophyte which can be used to express a HecA-like hemagglutinin in a plant may be used. The following reference describes one method of genetic engineering of bacterial endophytes: Simon R, Priefer U, Pϋhler A. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology. 1983;1:784— 791, which is hereby incorporated by reference in its entirety.
One example of an endophyte which can be engineered to express a HecA-like hemagglutinin is Agrobacterium. Transformation of Agrobacterium is well known in the art. One transformation method which can be used is the freeze thaw method, in which a suspension containing a DNA construct and Agrobacterium cells grown in culture is frozen. After thawing, the transformed cells can be selected with the antibiotic whose resistance is carried in the DNA construct used. These transgenic endophytes can then be introduced into plants where they will express the HecA-like hemagglutinin, thereby conferring resistance to disease caused by Xylella fastidiosa.
Another endophyte which can be transformed with a HecA-like hemagglutinin is Pseudomonas. Methods of transformation of Pseudomonas are well known in the art. One example of a method of transforming Pseudomonas is by electroporation.
Another endophyte which can be transformed with a HecA-like hemagglutinin is aviralent Xylellafastidiosa. Methods of transformation of Xylella are well known in the art. One example of a method of transforming Xylella is by electroporation.
Fungal endophytes can be transformed using a calcium chloride/polyethylene glycol (PEG) protocol as described in the following reference: Malardier L, Daboussi MJ, Julien J, Roussel F, Scazzocchio C, Brygoo Y., Cloning of the nitrate reductase gene (niaD) of Aspergillus nidulans and its use for transformation of Fusarium oxysporum. Gene. 1989 May 15; 78(l):147-56, which is hereby incorporated by reference in its entirety.
The following reference provides a review of genetic engineering of fungal endophytes: B. Chai and M.B. Sticklen, 1998. Applications of biotechnology in turfgrass genetic improvement. Crop Science 38: 1320-1338, which is hereby incorporated by reference in its entirety.
Introduction of endophyte expressing a HecA-like hemagglutinin into plants Any method which is capable of introducing endophytes expressing a HecA-like hemagglutinin into a plant may be used.
The transgenic endophyte-infected plants may be established initially by methods which involve directly incorporating transgenic endophytes into seedlings or other appropriate plant tissues of naturally occurring plants. Once the plant tissues are infected, they can be used for the development of plants having endophyte-enhanced performance characteristics, namely, the resistance to disease caused by Xylellafastidiosa. These plants can then be used in more traditional plant-breeding procedures for producing further improved varieties.
Selected plants can be infected with transgenic endophytes as seedlings, as callus tissue, as plantlets derived from single meristems or as somatic embryos, using methods known to those of skill in the art of plant tissue culture. Methods of culturing plant tissues are well known to modern plant biologists.
Plant tissues may be inoculated with transgenic endophytes by placing the endophyte into a direct wound or cut made in the plant tissue. Where the plant tissues to be inoculated are plantlets from germinated seedlings or developed from plant meristems, the cut may be made directly into the stem of the plant. The inoculation can be carried out by placing a small amount of an endophyte directly on or into the cut. Likewise callus tissue may be cut and the endophyte applied directly to the wound.
Inoculated plant tissues are allowed to heal, and the tissues are allowed to develop into plants which can be further cultivated by methods appropriate for the tissue type initially inoculated. If plantlets have been inoculated, they can be grown in sterile culture for six to eight weeks before they are transferred to greenhouse and transplanted into soil.
If callus tissue has been inoculated with a transgenic endophyte, the tissue can be transferred into medium to allow the development of somatic embryos and plantlets.
Inoculated plants may be removed from the sterile growth medium using forceps and transferred into (non-sterile) greenhouse potting mixture. The plantlets may be grown in potting mix for 4 to 6 weeks until they are of sufficient size that a piece of the stem material can be excised and checked under the microscope for the presence of the endophyte.
Plants
In another embodiment, the present invention is directed to transgenic plants expressing a HecA-like hemagglutinin from Xylella fastidiosa, and plants containing transgenic endophytes which express a HecA-like hemagglutinin.
Plants which find use in the invention are those which are susceptible to infection by Xylella fastidiosa, for example grapevines, citrus, peach, plum, oleander, elm, sycamore, oak, maple, alfalfa, almond, pear and coffee. Also contemplated are other plants such as mulberry, sedges, periwinkle, and hemlock. Any plant which is discovered to be subject to disease caused by Xylella fastidiosa may be used in the invention. Both monocotyledonous and dicotyledonous plants may be used.
Uses
The transgenic plants expressing a HecA-like hemagglutinin and the plants harboring a plant endophyte expressing a HecA-like hemagglutinin will be more resistant to diseases caused by Xylella fastidiosa infection compared to wild type plants and plants not harboring an endophyte expressing a HecA-like hegagglutinin. Recombinant HecA-like hemagglutinin is therefore useful for expresstion in plants that are susceptible to Xylella fastidiosa infection. Such plants will innately inhibit Xylella fastidiosa infection without addition of antibiotics or exogenously added chemicals.
In addition, nucleic acids of the invention will be useful in generating the transgenic plants of the present invention. The HecA-like hemagglutinin encoding genes (such as HxfA and HxfB) may be used to identify such genes in other species. In addition, the HecA-like hemagglutinin encoding nucleic acid will be useful in designing probes that may be used to detect HecA-like hemagglutinin encoding nucleic acid expression levels and specific variants of HecA-like hemagglutinin genes. Such probes may be useful in breeding plants with particular HecA-like hemagglutinin genes or expression patterns.
Transformation or transfection of prokaryotic or eukaryotic host cells with the nucleic acid of the HecA-like hemagglutinin gene will be useful in expressing, amplifying, modifying, and transforming the HecA-like hemagglutinin gene into plants. The primers and vectors of the invention will be useful for the same purposes. Modification of the HecA-like hemagglutinin encoding nucleic acid and the HecA-like hemagglutinin amino acid sequence may entail truncation, mutagenesis, deletions, additions, fusions, or other alterations of various parts of the gene or protein in order to change its activity, thereby altering or retaining the activity of the HecA-like hemagglutinin protein. Such mutations, deletions, substitutions, additions, and fusions of the HecA-like hemagglutinin encoding nucleic acid and protein are within the scope of the invention. HecA-like hemagglutinin encoding nucleic acid fusions may include the use of heterologous promoters to alter the regulation of the HecA-like hemagglutinin gene.
In addition, the nucleic acids of the invention will be useful in generating plant endophytes which express a HecA-like hemagglutinin.
The following examples are provided to illustrate further embodiments of the invention-
Example 1: Pathogenicity assays and identification of Xylella fastidiosa hypervirulent mutants.
Materials and Methods Bacterial strains, growth conditions and primers. The PD Xylella fastidiosa strain Temecula was isolated and stored as previously described (Guilhabert et al., 2001). For all experiments, the wild type and Tn5 Temecula Xylella fastidiosa mutants were grown at 280C in PD3 medium (Davis et al., 1981) with or without 5 Dg/ml of kanamycin. For the growth, aggregation, adhesion and colony morphology assays, Xylella fastidiosa cells, previously seeded on PD3 plates, were harvested, transferred into two ml of PD 3 liquid medium and adjusted to OD6oo=0.25 (108cells ml"1). The adjusted Xylella fastidiosa suspension was diluted 1:100 with fresh PD3 medium, and used for all growth kinetics, adhesion and colony morphology assays. Culture volumes did not exceed 20% of the capacity of the flasks or tubes to ensure adequate aeration of the culture. The cultures were established in duplicate. All the primers used in this study are presented in Table 1.
Random transposon mutagenesis
Electrocompetent Xylella fastidiosa Temecula cells were prepared as previously described (Guilhabert and Kirkpatrick, 2003). The Xylella fastidiosa Temecula strain was mutagenized using the transposome protocol described (Guilhabert et al., 2001). A random insertion library of 1,000 Tn5 Xylella fastidiosa mutants was generated.
Pathogenicity assays. Each Tn5 Xylella fastidiosa mutant was individually innoculated into Chardonnay, Chenin Blanc and Thompson seedless grapevines to assess pathogenicity. All 1,000 Tn5 Xylella fastidiosa mutants in Chardonnay were screened for altered symptom development. This screen identified 7 Xylella fastidiosa Tn5 mutants that showed a pronounced hypervirulence phenotype 21 weeks after inoculation (i.e. grapevines inoculated with these Tn5 mutants developed more severe disease symptoms than did vines inoculated with the wild type Temecula strain). In order to confirm their hypervirulence phenotype, the 7 mutants and wild type controls were retested in a similar matter for i) earlier symptom development ii) more severe symptom development during a period of 32 weeks and iii) earlier death of the inoculated grapevines. The disease progression of the 7 mutants and wild type controls was performed in three plants each of Chardonnay, Chenin Blanc and Thompson seedless grapevines (9 plants total for each mutant). The, Xylella fastidiosa 1792 mutant strain was tested twice in a similar manner in three Chardonnay grapevines (6 plants total).
Results
In order to understand the mechanisms by which Xylella fastidiosa causes plant disease, a random transposition approach was taken to disrupt genes potentially involved in Xylella fastidiosa virulence and/or movement in grapevine plants. Seven putative hypervirulent Xylella fastidiosa mutants (i.e. grapevines inoculated with these Tn5 mutants developed more severe disease symptoms than did the wild type Temecula strain 21 weeks after inoculation), out of 1,000 that were screened, were selected and retested by inoculating three additional Chardonnay as well as three Chenin Blanc and Thompson seedless grapevines. All of the 7 Tn5 Xylella fastidiosa hypervirulent mutants tested showed i) earlier symptom development, ii) higher disease score over a period of 32 weeks and iii) earlier death of the inoculated grapevines than the wild type cells when inoculated into all grapevines (Figure 2); thus demonstrating that the hypervirulence phenotype is correlated with earlier symptom development and earlier vine death in multiple Vitis vinifera cultivars.
Example 2: Identification of genes associated with the hypervirulent phenotype and sequence analyses.
Materials and Methods
Identification of mutated genes and sequence analysis. All the Xylella fastidiosa mutants are described in Table 1.
After assessing pathogenicity in greenhouse-grown grapevines (see below), the site of Tn5 insertion of the mutants with enhanced virulence (hypervirulent Xylella fastidiosa mutants) was identified by a two-step procedure. The chromosomal region flanking the Tn5 element was first amplified using an oligonucleotide, Poforw that binds specifically to the transposon sequence in combination with a degenerate primer, Arbl that anneals to sequences flanking the Tn5 insertion. Then, following PCR amplification, direct sequencing was accomplished using a second oligonucleotide, kan-2 fp-1 that primes the PCR fragment downstream of Poforw near the right border of the transposon (Chun et al., 1997; Hermann et al., 2000). One colony of each Tn5 Xylella fastidiosa mutant was transferred into 10 μl of de- ionized water and 3 μl of the suspension was used as template in the PCR reaction. All PCR reactions were conducted with conditions described by Hermann et al., 2000, using a Taq DNA polymerase (Promega, Madison, WI) diluted in a TaqStar™ antibody (BD Biosciences Clontech, Palo Alto, CA). Only the first step of a modified two-step PCR protocol was used (Chun et al., 1997). Briefly, the first 12 cycles included an annealing step of 30 sec, initially at 360C, then increasing I0C per cycle; the last 25 cycles included a primer-annealing step of 30 sec at 650C. After amplification, the PCR products were purified using the "Qiaquick PCR purification kit" (Qiagen, Valencia, CA) and were sequenced in a "2X" Big Dye Terminator sequencing reactions (Applied Biosystems, Foster City, CA), using the outward primer kan-2 fp-1 by the Division of Biological Sciences DNA sequencing facility at UC Davis.
An additional hemagglutinin-like mutant strain, XfI 246 was also identified by sequencing the insertion sites of the random mutants from the library described above.
Six of the Tn5 insertion sites were confirmed using as forward primers kan-2 fp-1 and kan-2 rp-1 that bind close to the right and left borders of the transposome, respectively, and reverse primers derived from the sequences obtained in the mutated ORF. The identity of the two putative hemagglutinin mutated genes, xf2118 and xfl246 was further confirmed by Southern Blot analysis (see below). All PCR reactions were conducted and cycled with standard conditions (Smart et al., 1996). The 35 cycles of PCR included an annealing step of 1 minute at 580C. The resulting PCR products were sequenced to further confirm the location of the Tn5 insertion sites.
DNA sequences were analyzed with the program Bioedit version 5.0.6 (Tom Hall, North Carolina State University, Department of Microbiology) and database searches were performed with the BLAST program accessed through the National Center for Biotechnology Information (NCBI) website (Altschul et al., 1990). GenBank comparisons in the NCBI conserved domain were performed to identify conserved domains in hypothetical proteins. This was accomplished using tools available at the NCBI Structure group website on the Internet, which maintains the Molecular Modeling Database of macromolecular 3D structures. The protein alignments were performed using the CLUSTALW method, which is described in Thompson et al., 1994, and on the Internet at the website of the European Bioinformatics Institute.
Results
In order to determine the identity of the mutated gene, the transposon insertion sites of the mutants were identified using a combination of PCR and sequencing (Table 1). Six of the mutated genes corresponded to genes with assignable functions and one gave a significant match with a hypothetical conserved gene. Southern blot analysis of the hypervirulent Xylella fastidiosa mutants showed that the clones contained a single transposon insertion (data not shown). Regions flanking the Tn5 mutated gene sequences also were the same as the sequences of their respective regions in the wild type Xylella fastidiosa Temecula strain; thus confirming the position of the Tn5 insertion in the hypervirulent mutants.
One hypervirulent Tn5 mutant was disrupted in PD2118, which putatively encodes a hemagglutinin-like secreted protein. A second mutant was disrupted in PDl 542, which putatively encodes a dolichol-phosphate mannosyltransferase lipopolysaccharide, dmt, which might be involved in LPS biosynthesis by adding a sugar onto the O-polysaccharide chain. The five other Tn5 mutants were disrupted in PDl 198, PD0218, PD0681, PD0875 and PD 1244 genes, which putatively encode for a ferric enterobactin receptor bfe A, a serine protease, psp B, a glucose/galactose transporter, glu P, a coenzyme F390 synthetase, paa K and a hemagglutinin-like hypothetical protein, respectively (Table 1).
A number of large exoproteins, including hemagglutinins, are secreted by a two- partner secretion (TPS) pathway (Jacob-Dubuisson et al., 2001). Adhesins secreted through the TPS pathway (Tps proteins), share similar "secretion domains" despite their limited overall sequence similarities (Jacob-Dubuisson et al., 2001). The secretion domain includes a 110-amino acid (aa) conserved region in the N-proximal region (Schόnherr et al., 1993). The Tsp secretion domains are conserved in HecA, a hemagglutinin protein in E. chrysanthemi (GenBank accession number AF501263; Rojas et al., 2002) The first 200-aa were analyzed in the N-proximal region of the seven gene products that were annotated as hemagglutinin-like proteins in the PD genome sequence (Van Sluys et al., 2003). The putative seven Xylella fastidiosa hemagglutinin proteins were aligned with the hemagglutinin HecA of E. chrysanthemi (Figure 3).
Although the three Xylella fastidiosa hemagglutinin-like products PD2116, PD2110 and PD0988 showed 34%, 35% and 26% amino acid identity, respectively with a putative hemagglutinin-related protein from Ralstonia solanaceraum (GenBank accession number Np_522632.1), comparison of their N-proximal 250 aa sequences did not reveal the previously described Tps secretion domains (Figure 3). The putative hemagglutinin-related protein from Ralstonia solanaceraum mentioned above did not contain the Tps secretion domains. The PD Xylella fastidiosa product PD0986, annotated as a hemagglutinin-like protein (Van Sluys et al., 2003), did not possess any homology with putative hemagglutinin or adhesin proteins from other bacteria.
Further amino acid sequence analyses revealed that the Tps secretion domains were only conserved in the last three Xylella fastidiosa hemagglutinin-like genes PD2118, PD1792 and PD 1246 (Figure 3). Interestingly, PD gene PD 1246 has a frameshift/point mutation in its sequence (Van Sluys et al., 2003); thus PD 1246 is most likely not functional in the Temecula strain. In addition to the presence of the Tps secretion domains in their sequence, PD2118 and PD 1792 gene products also possess 27% and 37% amino acid identities, respectively with the HecA protein from E. chrysanthemi. Therefore, the PD2118 and PD 1792 gene products were named HxfA and HxfB, respectively (H indicates hemagglutinin, xf, Xylella fastidiosa, A and B for the two first hemagglutinins described in Xylella fastidiosa).
HxfB was cloned in E. coli, disrupted by Tn5 mutagenesis, and the disrupted gene introduced back into X. fastidiosa. The introduced construct replaced the wild type HxfB gene by homologous recombination (see Example 5).
GenBank comparisons of the hemagglutinin-like hypothetical PD 1244 ORF, identified in the mutant study (see above), revealed homology only with genes in various Xylella fastidiosa genome sequences. The PD 1244 product had 82% and 74% amino acid identity with the putative hemagglutinin-like products Xf2196 from the CVC and PD2116 from the PD strain of Xylella fastidiosa, respectively (Simpson et al., 2000 and Van Sluys et al., 2003). However, putative PD1244 gene predicts a 79-aa protein, whereas genes Xf2196 and PD2116 predict a 3442-aa and 439-aa protein, respectively. Therefore, the amino acid identity between gene products PD 1244, Xf2196 and PD2116 is based only on a small region of the putative proteins. In contrast to Xf2196, the Tsp secretion domains noted in HecA were not identified in PD1244 or PD2116 products (Figure 3). No conserved domains were identified in PD 1244 protein using the NCBI conserved domain database.
Example 3: Hypervirulent mutations altered Xylella fastidiosa growth rate and increased movement in planta.
Materials and Methods
Xylella fastidiosa growth curves and en planta bacterial population determinations. Growth curve determinations were performed in 15 ml polystyrene tubes containing 3 ml of PD3 medium. A total of 14 tubes were prepared for the wild type and each Tn5 mutant, so as to allow destructive sampling of two tubes at every sampling time. Two independent growth curve determinations were performed. Due to the aggregate nature of Xylella fastidiosa liquid cultures, immediately after inoculation and after 2, 4, 6, 8, 12 and 16 days, the cultured cells were completely dispersed using a tissue homogenizer (Heidolph RzR 50) and the cell growth was monitored by measuring turbidity at OD6oonm. The doubling time of the bacterial populations was calculated using a standard equation (Madigan et al., 1970).
The bacterial populations (number of cells per gram of petiole tissue) of the XyIe Ha fastidiosa wild type and Tn5 mutants inoculated into Chardonnay vines were determined in the following manner: 14 weeks after inoculation, petiole tissues from each vine inoculated with either Tn5 mutant or wild-type Xylella fastidiosa cells were harvested at the point of inoculation and 25 centimeters above the point of inoculation. Petiole tissues were surface sterilized (1 min in 10% sodium hypochlorite and 1 min in 80% ethanol), rinsed three times in sterile de-ionized water and ground in 2 ml of sterile PBS buffer using a grinding machine (Biorega AG, Switzerland). Serial dilutions were prepared and 3 replicates of 10 μl were plated on PD3 agar medium with or without kanamycin. After incubating 7-10 days at 280C, the number of bacteria was quantified.
Results
Growth curves of the Tn5 mutants and wild type Xylella fastidiosa strain showed that all the hypervirulent mutants reached the exponential and stationary phase in a manner similar to the wild type Xylella fastidiosa strain (Figure 5).
The doubling time of Tn5 mutants and wild type Xylella fastidiosa strain was also determined. The doubling time of the wild type Xylella fastidiosa strain was 0.5 day. In contrast, the doubling times of 4 of the Tn5 mutants were longer than the wild type strain, whereas the doubling time of hxfA (PD2118) and PD 1244 mutants was faster than the wild type strain (Table 2). The doubling time of PDl 198 Xylella fastidiosa mutant was not significantly different from the wild type strain.
In order to evaluate possible mechanisms that could explain the hypervirulence phenotype, bacterial populations and movement in infected grapevines was assessed for the seven mutants and wild type strain. The hypervirulent mutants moved faster in inoculated grapevines than the wild type at 25 cm above the point of inoculation 12 weeks post inoculation. In contrast, the population of the hypervirulent mutants was not significantly different than the wild type at the point of inoculation (Table 3). The data suggests that hypervirulent cells colonize more rapidly grapevine tissue than wild type cells.
Example 4: HxfA is involved in cell-cell aggregation in vitro and inplanta- Materials and Methods
Surface attachment, cell-cell aggregation and colony morphology assays. The Tn5 mutants or wild type Xylella fastidiosa cells were grown in 25 ml of PD3 broth medium in 125 ml glass Erlenmeyer flasks on an orbital shaker at 120 rpm to visualize the formation of bacterial cell clumps within the liquid medium and the formation of aggregated cells that attached to the inside of the flask (Marques et al., 2002).
Additional surface attachment and aggregation assays were performed in polystyrene (15 ml; Falcon 2051 tubes, Becton & Dickinson Labware), polypropylene (5 ml; Falcon 2063 tubes, Becton & Dickinson Labware) and borosilicate glass (10 ml) tubes containing PD3 medium. The cultures were incubated at 280C in a vertical position without shaking for 10 days. Attachment on the surface walls of the tubes was assessed by a crystal violet staining method (Espinosa-Urgel et al., 2000 and Leite et al., 2004). Briefly, after the incubation period, the PD3 medium was discarded and a 1% (wt/vol) solution of crystal violet was added to each tube and rinsed with de-ionized water. The remaining stain was eluted from the bacterial ring by ethanol. The absorbance of the ethanol-crystal violet solution was measured at 600 nm.
The cell-cell aggregation assay was performed as described by Burdman et al., (2000) and Leite et al., (2004). After 10 days of static incubation, the Xylella fastidiosa cultures were gently agitated and the aggregates allowed to settle for 20 min. The turbidity of the remaining upper culture medium, composed mostly of dispersed cells was measured using a spectrophotometer at 540 nm. The culture medium was returned to the original tube, the aggregate masses were dispersed using a tissue homogenizer (Heidolph RzR 50) for 1 min and the total cell culture was measured (ODt). Relative percentage of aggregated cells was estimated as follows: % aggregated
Figure imgf000033_0001
(ODt-ODs)/ODt x 100 (Burdman et al., 2000).
The colony morphology of the wild type or mutant cells was assessed by plating one hundred μl of a 108 cfu/ml solution onto 2 PD3 plates (4 plates total). Aberrant colony morphology of mutants was compared to wild type after 10 days growth on PD3 solid medium at 280C.
Scanning electron microscopy (SEM). The wild type and mutant cells of Xylella fastidiosa that were inoculated into grapevines or grown in PD3 broth were examined using scanning electron microscopy (SEM). Petiole samples were collected from symptomatic grapevines three months after inoculation. Petioles sections and bacterial aggregates, harvested by centrifugation from Xylella fastidiosa liquid cultures grown in a glass Erlenmeyer flask, were fixed overnight in a 2.4% glutaraldehyde, 0.3% paraformaldehyde solution. Fixed samples were then dehydrated by increasing concentrations of ethanol, critically-point dried in a Tousimis Samdri-780A, placed on aluminum specimen mounts with carbon conductive tabs, and sputter-coated with gold using a Denton Vacuum Desk II cold sputter-etch unit. The morphology of the mutant or wild type Xylella fastidiosa aggregates grown in grapevines or grown in PD3 broth was observed at 5-12 khz with a Hitachi S- 3500N SEM and images were recorded digitally.
Results
To evaluate whether the hypervirulence phenotype affected cell-cell attachment, the ability of each hypervirulent mutant to aggregate in culture was investigated. Cell-cell aggregation of each mutant was first visually assessed in 125 ml glass Erlenmeyer flasks placed on an orbital shaker. The wild type Xylella fastidiosa strain and 6 of the Tn5 mutants formed large aggregates when grown in vitro (Figure 6A, Table 2). In contrast, the hxfA mutant was impaired in its ability to form cell-cell aggregates in liquid culture (Figure 6B3 Table 2).
The colony morphology of wild type, HxfA and HxfB cells were examined on solid medium. HxfA and HxfB mutants exhibited a homogenous distribution of cells, forming a continuous lawn of cells, whereas the wild type grew in separate clumps composed of small and medium-size individual colonies (Figure 6C and D); thus further confirming the inability of HxfA cells to self-aggregate.
An optical density assay (Burdman et al., 2000) was used to quantify the effect of the HxfA mutation on cell-cell aggregation. This assay further confirmed that cell-cell aggregation of HxfA mutant was decreased (Table 4).
The aggregates of wild type and hxfA mutant cells grown in PD3 medium and in planta were observed by scanning electron microscopy. Wild type cells, grown in vitro were aggregated together typically by cell-cell contact along the length of the cells (data not shown). The hxfA mutant cells did not appear to be aggregated in such a manner (data not shown). This result was further observed in planta (Figure 6). Figure 6F and H shows that HxfA cells did not form large clumps in the plants but rather hxfA cells typically formed a mono-layer of cells on the surface of the xylem vessels. In contrast, wild type cells formed a multiple-layer of cells that clearly aggregated to each others (Figure 6E and G). Example 5: Cloning of the hemagglutinin gene, HxfB (PD1792). The PD 1792 gene of a grapevine strain causing Pierce' s disease (PD; Xylella fastidiosa Temecula isolate; Van Sluys et al., 2003) was amplified using the Expand Long Template PCR system (Roche, Mannhein, Germany) with primers PD1791 rev (5' GGAGCAAGACAGTCGCGGAT 3' (SEQ ID NO: 9)) and PD1793 forw (5' GATATCGTGAACGATTGCCGCCT 3' (SEQ ID NO: 10)), anneal to sequences that flank the ORF encoding the PD1792 gene. Briefly, the annealing temperature in both set of cycles was 580C and the elongation times in the first and second set of cycle were 4' for 10 cycles and 4' + 20" per cycle for 25 cycles, respectively. A PCR product of the expected 10,134 bp-size was obtained.
The PCR product was cloned into the pCR®-XL-TOPO® vector using the TOPO® XL PCR cloning kit (Invitrogen, Carlsbad, California) following the manufacturer recommendations. Cloning of the PD 1792 gene was confirmed by sequencing the end of the cloned PCR product using primers, Ml 3 forward and reverse (5' GTTTTCCC AGTC ACGA 3'(SEQ ID NO: 11) and 5' CAGGAAACAGCTATGAC 3' (SEQ ID NO: 12), respectively; Invitrogen, Carlsbad, California). The sequencing was performed in a "2X" Big Dye Terminator sequencing reactions (Applied Biosystems, Foster City, CA) by the Division of Biological Sciences DNA sequencing facility at UC Davis. The sequences of the cloned PCR product perfectly matched the sequence of the PD 1792 gene that is present in the PD genome sequence (Van Sluys et al., 2003).
Example 6: Site-directed mutagenesis of hxfB and confirmation of the observed hxfA phenotypes.
Materials and Methods
Site-directed mutagenesis. A 680 bp region of Xylella fastidiosa Temecula genome including a small coding sequence of the PD 1792 gene was amplified using primers PD 1792 rev and PD 1792 forw and cloned into the pCRR 2.1 -TOPO vector (Invitrogen, Carlsbad, California). The plasmid was then digested with EcdRl and the PD 1792 insert was ligated into ϋcøRI-digested pUC18 plasmid creating pXF012. Plasmid pXF012 was linearized at the unique restriction site BstBl of the cloned PCR-amplified PD 1792 fragment. Two annealed 5stBI-adaptors carrying a Mfel restriction site (5'CAATTGACGT 3' (SEQ OD NO: 13)) were ligated in iføBI-digested pXF012. The Tn903 kanamycin resistance gene (Guilhabert et al., 2001) was cloned into pXF012 cut with Mfel to make pXF013. Insert and junction sequences of pXF013 were determined. Two μg of pXF013 plasmid DNA was electroporated into Xylella fastidiosa, and transformants were selected as described (Guilhabert et al., 2001). Disruption of the PD 1792 locus was confirmed by using the Expand Long Template PCR system (Roche, Mannhein, Germany) with primers PD 1791 rev and PD 1793 forw, binding to the flanking ORFs of the mutated PD 1792 gene. Briefly, the annealing temperature in both set of cycles was 580C and the elongation times in the first and second set of cycle were 4' for 10 cycles and 4' + 20" per cycle for 25 cycles, respectively. The identity of the PCR product was confirmed by using the restriction enzyme Hindlll that cuts only once into the Tn903 kan-2 cassette.
Southern blot analysis of putative X. fastidiosa mutants. Xylella fastidiosa genomic DNAs were isolated from the mutant strains as described (Zang et al., 1998). Genomic DNAs from the transformants obtained by random mutagenesis were individually digested by the two restriction enzymes, EcoRl and Eagl. In order to confirm the identity of the two random hemagglutinin PD2118 and PD 1246 mutant strains, their genomic DNAs were also digested with SaR aadXmnl. All digested DNAs were electrophoresed, alkali- denatured, and transferred to a nitrocellulose membrane as previously described (Guilhabert et al., 2001). The Tn5 DNA, used as a probe in the hybridization analyses of restriction digested genomic DNAs from the Xylella fastidiosa mutants, was PCR amplified and purified (Guilhabert et al., 2001), and 25 ng was labeled with fluorescein dye using the "Gene Images™ random prime labeling module kit" (Amersham Biosciences, UK). Hybridizations and detection were carried out according to the recommendations of the "Gene Images™ CDP-Star™ detection module kit" (Amersham Biosciences, UK). Stringent post- hybridization wash conditions (15 min per wash) were once in IX SSC-0.1% SDS at 6O0C and once in 0.5X SSC-0.1% SDS at 680C.
Results
To confirm that hemagglutinins are involved in Xylella fastidiosa virulence and cell- cell aggregation, a mutant in the second hemagglutinin identified above, HxfB (PD 1792) was generated. The disruption of gene hxJB was confirmed by a long PCR procedure (data not shown). The mutant strain XfI 792 was inoculated twice in three Chardonnay grapevines and it consistently showed i) earlier symptom development, ii) higher disease score over a period of 32 weeks and iii) earlier death of the inoculated grapevines the wild type cells (Figure 2); thus confirming that hemagglutinins are involved in attenuating Xylella fastidiosa pathogenicity. An optical density assay (Burdman et al., 2000) was used as described above to quantify the effects of the HxfB mutation on cell-cell aggregation. This assay further confirmed that hemagglutinins are involved in Xylella fastidiosa cell-cell aggregation (Table 4).
Example 7: Sequence analysis and subcloning of putative cell-cell binding domains of HxfA and HxfB.
Detailed sequence analysis of HxfA and B using revealed 7 (HxfA, PD2118) and 8 (HxfB, PD 1792) domains in the N-terminal region of the proteins that likely represent the Hxf cell-cell binding domains. This analysis was performed by using the Biozon database, developed by researchers at Cornell University, and accessible through the World Wide Web. Three DNA fragments (ADl, AD2 and AD3, all 1.0 to 1.2kb in size) were identified in each protein that contained 3 or 4 putative binding domains. The AD2 fragment from HxfA and B were most similar in sequence to each other and therefore chosen as a likely marker for both Hxf proteins. AD2 was PCR-amplified, cloned and expressed in a protein fusion vector in E. coli and the AD2 fusion protein was purified by affinity chromatography. The fusion protein was injected into rabbits and antibodies against AD2 were produced. The AD2 antibodies are being used to determine the size and cellular location of native Hxf protein in X. fastidiosa and PD-affected grapevines. AD2 antibodies and purified AD2 proteins are being used to determine if the AD2 domain is mediating X. fastidiosa cell-cell aggregation.
Because the full-length Hxf genes (10.2kb) is larger than desirable to transform and be expressed in either plants or grapevine endophytes, a 3.5 kb fragment that contains all three putative binding domains (AdI -AD3) from HxfA and HxfB were PCR- amplified and cloned in E. coli. These two 3.5kb fragments are being transformed into grapevine (V. vinifera), tobacco and Pseudomonas and Agrobacterium endophytes (D. Darjean- Jones, 2004) using appropriate technologies that have been previously discussed. Fusion protein derived from the 3.5kb fragments are being prepared and used as previously described for Hxf AD2. Using either individual Hxf AD domains or the 3.5kb to transform plant or endophytes will be more feasible than engineering the full-length Hxf gene and should confer the same desired resistance phenotype. Tables and Figures
Table 1-PCR primers and strains used in this study
Source
Primers used to sequence the Tn5 insertion sites kan-2 fp-1 ACCTACAACAAAGCTCTCATCAACC (SEQ ID NO 14) Epicentre Technology
Arbl GGCCACGCGTCGACTAGTAC1ΛGATAT (SEQ ID HO IS) Caetano-Anoles, 1993
Poforw CTGGCAGAGCATTACGCTGAC (SEQ ID NO i 16) This study
Primers used to confirm the random Tn5 insertion sites Used to confirm putative mutated gene kan-2 rp-1 GCAATGTAACATCAGAGATTTTGAG (SEQ ID NO 17) Epicentre Technology kan-2 fp-f ACCTACAACAAAGCTCTCATCAACC (SEQ ID NO 18) Epicentre Technology
6191 2 forw TGCAACCACGCTGAACA (SEQ ID NO 19) glucose/galactose transporterg/wP This study
6211 2 rev GGCATCGACCTCATT (SEQ ID NO 20) glucose/galactose transportergώP This study
PD0219 forw GCTGCACTCCAGATTGAACACTGT £jEQ 2™ serine protease,/wpB This study
PD0217 forw ACCTACACCTACACCACTGGA iSEQ 22° N0 serine protease,/λspB This study
23531 2 forw GATCTACCTGCTGTTGC (SEQ ID NO 23) hypothetical protein, PD1244 This study
23551 2 rev GTGAGGATTATTACGGGTGGTG IT\1° hypothetical protein, PD1244 This study
22281 2 forw CGCGTGCTCGCTCTTCAAT(SEQ ID NO 25) coenzyme F390 synthetase^ K This study
22311 2 rev TACCGAATGTGGCTTG (SEQ ID NO 26) coenzyme F390 synthetasepααK This study
11001 2 forw ATTCACGCTCCATACG (SEQ ID NO 27) iron receptor, bfe A This study
11021 2 rev ATGTCGAGTCCTGTTGTG (SEQ ID NO 28) iron receptor, bfe A This study
13991 2 rev AACAGAGTGCTAGTCACC (SEQ ID NO 29) mannosyltransferase,cføtf This study
24521 2 forw ACGACTTGCATAGCAGTAGC (SES 3HO mannosyltransferase,cta This study
Primers used for the site-directed mutagenesis
PD1792 rev TTGTCCTGACGGTCG (SEQ ID NO 3D This study
PDl 792 forw CCACCATTGACAACC (SEQ ID NO 32) This study
PD1791 rev GGAGCAAGACAGTCGCGGAT (SEQ ID NO 9) This study
PDl 793 forw GATATCGTGAACGATTGCCGCCT (SEQ ID NO 10) This study
Xf mutants Relevant characteristics Putative gene function
XG118 PD21184 EZ TN™<Kan-2>Tnp5 hemagglutinm-hke secreted protein, HxfA This study
XfI 542 PDl 542 EZ TNrM<Kan-2>Tnp mannosyltransferase (lps biosynthesis), Dmt This study
XfI 198 PDl 198 EZ TO^Kan^Tnp ferric enterobacym receptor, BfeA This study
XfD218 PD0218 EZ TrfM<Kan-2>Tnp serine protease, PspB This study
XfO681 PD0681 EZ TN™<Kan-2>Tnp glucose/galactose transporter, GIuP This study
XfO875 PD0875 EZ TN^Kan^Tnp coenzyme F390 synthetase, PaaK This study
Xfl244 PD1244 EZ T>f*<Kan-2>Tnp hypothetical protein (hemagglutimn-like) This study
Xfl792 PD1792 Tn903 kan-2 hemagglutinin-hke secreted protein, HxfB This study
XΩ246 PD1246 EZ Trf <Kan-2>Tnp hemagglutinin-like secreted protein This study primer sequences are presented 5' to 3' primer kan-2 fp-1 was used to sequence and to confirm the Tn5 insertion sites putative function of ORF based on homology between regions flanking the Tn5 insertion and other Xf gene sequences identification number of open reading frame (ORF) in PD strain cXf
Tn5 derivative (Epicentre Technologies, Madison, WI) 6 Tn903 kan-2= kanamycin resistance cassette from EZ τW<Kan-2>Tnp (Epicentre Technologies, Madison, WI) Table 2- Physiological properties of the Xf Tn5 mutants and wild type strain
Phenotypes
Doubling time Attachment assay:0
(in days):a'b Cell/cell aggregation Surface attachment
Genotype:
Wild type 0.50+/-0.018 +++ +++
HxfA 0.45+/-0.005 ++
Dmt 0.93+/-0.01 +++ +++
BfeA 0.48+/-0.003 +++ +++
PspB NDd +++ +++
GIuP 0.88+/-0.13 +++ +++
PaaK 1.14+/-0.224 +++ +++ hypothetical 0.24+/-0.003 +++ +++
a: doubling time calculated as described by Madigan et al., 1970. : significant difference indicated in bold; significance defined as p<0.01 c: frequency of attachment: -, absent; +, low; ++, moderate; +++, high. d: Not determined (PspB mutant lost in storage)
Table 3- Bacterial populations of Thompson seedless grapevines 12 weeks after inoculation with wild-type or Tn5 Xf cells
ffi bacterial populations (cfu/g of tissue)
At the point 25 cm above the point
Genotype: of inoculation of inoculation8
Wild type 10.6 (+/- 15) X lO6 0
HxfA 6 (+/- 7) x lO6 5.3 (+/- 8) x 10s
Dmt 36.6 (+/-5.2) x lO6 3.6 (+/- 1.8) x 105
BfeA 4.3 (+/- 4.6) x l O6 4.6 (+/- 4.4) x 104
Glue 2.8 (+/-2.6) x lO6 1.4 (+/-0.9) x 107
PaaK 25 (+/-10) x l06 1.8 (+/-0.1) x 107 hypothetical 6.3 (+/- 4.5) x lO6 2.4 (+/- 16) x 104
significance indicated in bold type; significance defined as p<0.01 Table 4- Cell-cell aggregation and cell-surface attachment of Xf wild type, hx/A and hxfB Tn5 mutants
Cell-cell aggregation3 Cell-surface attachment on:
Genotype: Glass surface Polystyrene surface Polypropylene surface
Wild type 36.2+A8.9 0.9+/-0.7 0.07+/-0.020 .25+/-0.04 HxfA 8.9+/-6.5c 0.5+/-0.3 0.06+/-0.010 .20+/-0.03 Hxffi 9.2+/-1.0 NDd ND ND a: percentage of cell-cell aggregation was assessed as described in Burdman et al., 2000 b: cell-surface attachment was assessed by the crystal violet staining method as in Espinosa-Urgel et al., 2000 c: numbers in bold type are significantly different than wild type. Significance was defined as p<0.01 d: not determined
References
The following references are hereby incorporated by reference in their entirety.
Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. MoI. Biol. 215:403-410
Bayot, R. G., and S. M. Ries. 1986. Role of motility in apple blossom infection by Erwinia amylovora and studies of fire blight control with attractant and repellent compounds. Phytopathology 76:441-445.
Beattie, G. A., and S. E. Lindow. 1994. Epiphytic fitness of phytopathogenic bacteria: physiological adaptations for growth and survival. Curr Top Microbiol Immunol. 192:1-27.
Bhattacharyya, A., S. Stilwagen, G. Reznik, H. Feil, W. S. Feil, I. Anderson, A. Bernal, M. D'Souza, N. Ivanova, V. Kapatral, N. Larsen, T. Los, A. Lykidis, E. Jr. Selkov, T. L. Walunas, A. Purcell, R. A. Edwards, T. Hawkins, R. Haselkorn, R. Overbeek, N. C. Kyrpides, and P. F. Predki. 2002. Draft sequencing and comparative genomics of Xylella fastidiosa strains reveal novel biological insights. Genome Research 10:1556-1563.
Burdman, S., E, Jurkevirtch, M. Soria-Diaz, A. M. Serrano, and Y. Okon. 2000. Extracellular polysaccharide composition of Azospirillum brasilense and its relation with cell aggregation. FEMS Microbiol. Lett 189:259-264.
Caetano-Anoles G. 1993. Amplifying DNA with arbitrary oligonucleotide primers. PCR Methods Appl. 3:85-94.
Chun, K. T., H. J. Edenberg, M. R. Kelley, and M. G. Goebl. 1997. Rapid amplification of uncharacterized transposon-tagged DNA sequences from genomic DNA. Yeast 13:233-40.
Cotter, P. A., M. H. Yuk, S. Mattoo, B. J. Akerley, J. Boschwitz, D. A. Relman, and J. F. Miller. 1998. Filamentous hemagglutinin oϊBordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infect Imuran. 66:5921-9.
Cunningham, M. L., R. G. Titus, S. J. Turco, and S. M. Beverley. 2001. Regulation of differentiation to the infective stage of the protozoan parasite Leishmania major by tetrahydrobiopterin. Science 292:285-287.
da Silva, F. R., A. L. Vettore, E. L. Kemper, A. Leite, and P. Arruda. 2001. Fastidian gum: the Xylella fastidiosa exopolysaccharide possibly involved in bacterial pathogenicity. FEMS Microbiol Lett. 203:165-71
de Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. M. Yanai, N. H. Muto, R. C. de Oliveira, L. R. Nunes, and M. A. Machado. 2004. Gene expression profile of the plant pathogen Xylella fastidiosa during biofϊlm formation in vitro. FEMS Microbiol. Lett. 237:341-53.
Davis, M. J., W. J. French, and N. W. Schaad. 1981. Axenic culture of the bacteria associated with phony peach disease of peach and plum leaf scald. Curr. Microbiol. 6:309- 314. De Lima, J. E. O., V. S. Miranda, J. S. Hartung, R. H. Brlansky, A. Coutinho, S. R. Roberto, and E. F. Carlos. 1998. Coffee leaf scorch bacterium: Axenic culture, pathogenicity, and comparison with Xylella fastidiosa of citrus. Plant Disease 82:94-97.
DeLoney, C. R., T. M. Bartley, and K. L. Visick. 2002. Role for phosphoglucomutase in Vibrio fischeri-Euprymna scolopes symbiosis. J. Bacteriol. 184:5121-5129.
Dow, J. M., B. R. Clarke, D. E. Milligan, J. L. Tang, and M. J. Daniels. 1990. Extracellular proteases from Xαnthomonαs cαmpestris pv. cαmpestris, the black rot pathogen. Appl. Environ. Microbiol. 56:2994-2998.
Erbs, G. and M.-A. Newman. 2003. The role of lipopolysaccharides in induction of plant defense. MoI. Plant Pathol. 4:421-425.
Espinoas-Urgel, M., A. Salido, and J. L. Ramos. 2000. Genetic analysis of functions involved in adhesion of Pseudomonαs putidα to seeds. J. Bacteriol. 182:2363-2369.
Feil, H., W. S. Feil, J. C. Detter, A. H. Purcell, and S. E. Lindow. 2003. Site-directed disruption of thefimA andfimB fimbrial genes of Xylella fαstidiosα. Phytopathology. 93:675- 682.
Fernandez, L., I. Marquez, and J. A. Guijarro. 2004. Identification of specific in vivo- induced (ivi) genes in Yersinia ruckeri and analysis of ruckerbactin, a catecholate siderophore iron acquisition system. Appl. Environ. Microbiol. 70:5199-5207.
Guilhabert, M. R., L. M. Hoffman, D. A. Mills, B. C. and Kirkpatrick. 2001. Transposon mutagenesis of Xylella fastidiosa by electroporation of Tn5 synaptic complexes. MoI. Plant-Microbe Interact. 14:701-706. Guilhabert, M. R., and B. C. Kirkpatrick. 2003. Transformation of Xylella fastidiosa with broad host range RSFlOlO plasmids. MoI. Plant Pathol. 4:279-285.
Guilhabert, M. R., and B. C. Kirkpatrick, 2005. Identification of Xylella fastidiosa Antivirulence genes: hemagglutinin adhesions contribute to X. fastidiosa biofilm maturation and colonization and attenuate virulence. Molecular Plant Microbe Interactions 18: 856-868.
Hatterman, D. R., and S. M. Ries. 1989. Motility of P seiidomonas syringae pv. glycinea and its role in infection. Phytopathology 79:284-289.
Hawes, M. C, and L. Y. Smith. 1989. Requirement for chemotaxis in pathogenicity of Agrobacterium tumefaciens on roots of soil-grown pea plants. J. Bacteriol. 171:5668-5671
Hermann, S. R., J. A. Miller, S. O'Neill, T. T. Tsao, R. M. Harding, and J. L. Dale. 2000. Single-primer amplification of flanking sequences. Biotechniques 29:1176-8, 1180.
Hill, B. L., and A. H. Purcell. 1995. Multiplication and movement of Xylella fastidiosa within grapevine and four other plants. Phytopathology 85:1368-1372.
Hopkins, D. L. 1989. Xylem-limited bacterial pathogen of plants. Ann. Rev. Phytopathol. 27:271-290.
Inzana, T. J., and M. A. Apicella. 1999. Use of a bilayer stacking gel to improve resolution of lipopolysaccharides and lipooligosaccharides in polyacrylamide gels. Electrophoresis. 20:462-465.
Iocco, P.,T. Franks, and M.R. Thomas. 2001. Genetic transformation of major wine grape cultivars of Vitis vinifera L. Transgenic Research 10(2):105-l 12. Jacob-Dubuisson, F., C. Locht, and R. Antoine. 2001. Two-partner secretion in Gram- negative bacteria: a thrifty, specific pathway for large virulence proteins. MoI Microbiol. 40:306-313
Kang Y., H. Liu, S. Genin, M. A. Schell, and T. P. Denny. 2002. Ralstonia solanacearum requires type 4 pili to adhere to multiple surfaces and for natural transformation and virulence. MoI. Microbiol. 46:427-37
Kannenberg, E. L., S. Peroτto, V. Bianciotto, E. A. Rathbun, and N. J. Brewin. 1994. Lipopolysaccharide epitope expression of Rhizobium bacteroids as revealed by in situ immunolabelling of pea root nodule sections. J. Bacteriol. 176:2021-32.
Kwakman, J. H., and P. W. Postma. 1994. Glucose kinase has a regulatory role in carbon catabolite repression in Streptomyces coelicolor. J. Bacteriol. 176:694-8.
Leite, B., P. C. Andersen, and M. L. Ishida. 2004. Colony aggregation and biofilm formation in xylem chemistry-based media for Xylella fastidiosa. FEMS Microbiol. Lett. 230:283-290.
Li, W-B., C. H. Zhou, W. D. Pria, D. C. Teixeira, V. S. Miranda, E. O. Pereira, A. J. Ayres, C. X. He, P. L. Costa, and J. S. Hartung. 2002. Citrus and coffee strains of Xylella fastidiosa induce Pierce's disease in grapevines. Plant Disease 86:1206-1211.
Locht, C, R. Antoine, and F. Jacob-Dubuisson. 2001. Bordetella pertussis, molecular pathogenesis under multiple aspects. Curr. Opin. Microbiol. 4:82-89.
Lyon, W. R., and M. G. Caparon. 2004. Role for serine protease HtrA (DegP) of Streptococcus pyogenes in the biogenesis of virulence factors SpeB and the hemolysin streptolysin S. Infect Immun. 72:1618-1625. Madigan, M. T., J. M. Martinko, and J. Parker. 1970. Brock biology of microorganisms. Prentice Hall, Upper Saddle River, N. J.
Marques, L. L. R., H. Ceri, G. P. Manfio, D. M. Reid, and M. E. Olson. 2002. Characterization of biofilm formation by Xylella fastidiosa in vitro. Plant Disease. 86:633- 638.
Matthysse, A. G. and S. McMahan. 1998. Root colonization by Agrobacterium tumefaciens is reduced in eel, atiB, atfD, and attR mutants. Appl. Environ. Microbiol. 64:2341-2345.
Mezzetti, B., T. Pandolfmi, O. Navacchi, and L. Landi. 2002. Genetic transformation of Vitis vinifera via organogenesis, BMC Biotechnology 2:18.
Mouslim, C, F. Hubert, H. Huang, and E. A. Groisman. 2002. Conflicting needs for a Salmonella hypervirulence gene in host and non-host environments. MoI. Microbiol. 45:1019-1027
Newman, M. A., E. von Roepenack-Lahaye, A. Parr, M. J. Daniels, and J. M. Dow. 2002. Prior exposure to lipopolysaccharide potentiates expression of plant defenses in response to bacteria. Plant J. 29:487-495.
Ojanen-Reuhs, T., N. Kalkkinen, B. Westerlund-Wikstrom, J. van Doom, K. Haahtela, E. L. Nurmiaho-Lassila, K. Wengelnik, U. Bonas, and T. K. Korhonen. 1997. Characterization of the fim A gene encoding bundle-forming fimbriae of the plant pathogen Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 179:1280-90
Otteman, K. M., and J. F. Miller. 1997. Roles for motility in bacterial-host interactions. MoI. Microbiol. 24:1109-1117
Panapoulos, N. J., and M. N. Schroth. 1974. Role of flagellar motility in the invasion of bean leaves by Pseudomonas phaseolicola. Phytopathology 64:1389-1397.
Park, J. Y., N. Takahara, A. Gabriele, E. Chou, K. Naruse, K. Suzuma, T. Yamauchi, S. W. Ha, M. Meier, C. J. Rhodes, and G. L. King. 2000. Induction of endothelin-1 expression by glucose: an effect of protein kinase C activation. Diabetes 49:1239-48.
Pennings, J. L., J. T. Keltjens, and G. D. Vogels. 1998. Isolation and characterization of Methanobacterium thermoautotrophicum DeltaH mutants unable to grow under hydrogen- deprived conditions. J. Bacteriol. 180:2676-81.
Purcell, A. H. 1997. Xylellafastidiosa, a regional problem or global threat? J. Plant. Pathol. 79:99-105.
Purcell, A. H. and S. R. Saunders. 1999. Fate of Pierce's disease strains of Xylella fastidiosa in common riparian plants in California. Plant Disease 83:825-830.
Purcell, A., H. and D. L. Hopkins. 1996. Fastidious xylem-limited bacterial plant pathogens. Annu. Rev. Phytopathol. 34:131-51.
Qin X., and J. S. Hartung. 2001. Construction of a shuttle vector and transformation of Xylellafastidiosa with plasmid DNA. Curr. Microbiol. 43:158-62
Ray, S., K., R. Rajeshwari, Y. Sharma, and R. V. Sonti. 2002. A high-molecular- weight outer membrane protein of Xanthomonas oryzae pv. oiyzae exhibits similarity to non- fimbrial adhesins of animal pathogenic bacteria and is required for optimum virulence. MoI. Microbiol. 46:637-47. Rojas, C. M., J. H. Ham, W.-L. Deng, and J. J. Doyle. 2002. HecA, a member of a class of adhesins produced by diverse pathogenic bacteria, contributes to the attachment, aggregation, epidermal cell killing, and virulence phenotypes of Erwinia chrysanthemi EC 16 on Nicotiana clevelandii seedlings. Proc. Natl. Acad. Sci. USA 99:13142-13147.
Romantschuk, M., and D. H. Bamford. 1986. The causal agent of halo blight in bean, Pseudomonas syringae pv. phaseolicola, attaches to stomata via its pili. Microb. Pathog. 1:139-48
Schonherr R, R. Tsolis, T. Focareta, and V. Braun. 1993. Amino acid replacements in the Serratia marcescens haemolysin ShIA define sites involved in activation and secretion. MoI. Microbiol. 9:1229-1237.
Simpson, A. J. G. et al. 2000. The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406:151-157.
Skurnik, M. and P. Toivanen. 1993. Yersinia enterocolitica lipopoly saccharide: genetics and virulence. Trends Microbiol. 1:148-152.
Smart C. D., B. Schneider, C. L. Blomquist, L. J. Guerra, N. A. Harrison, U. Ahrens, K. H. Lorenz, E. Seemuller, and B. C. Kirkpatrick. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl Environ Microbiol. 62:2988- 2993.
Sohel, L, J. L. Puente, W. J. Murray, J. Vuopio-Varkila, and G. K. Schoolnik. 1993. Cloning and characterization of the bundle-forming pilin gene of enteropathogenic Escherichia coli and its distribution in Salmonella serotypes. MoI. Microbiol. 7:563-575.
Spath, C, A. Rraus, and W. Hillen. 1997. Contribution of glucose kinase to glucose repression of xylose utilization in Bacillus megaterium. J. Bacterid. 179:7603-7605.
Strom, M. S. and S. Lory, S. 1993. Structure-function and biogenesis of the type IV pili. Annu. Rev. Microbiol. 47:565-96.
Tans-Kersten, J., H. Huang, and C. Allen. 2001. Ralstonia solanacearum needs motility for invasive virulence on tomato. J. Bacteriol. 183:3597-3605
Thompson, J.D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
Tsai C. M., and C. E. Frasch. 1982. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119:115-9
van Doom, J., P. M. Boonekamp, and B. Oudega, B. 1994. Partial characterization of fimbriae of Xanthomonas campestris pv. hyacinthi. MoI. Plant Microbe Interact. 7:334-344.
Van Sluys, M. A., et al., 2003. Comparative analyses of the complete genome sequences of Pierce's disease and citrus variegated chlorosis strains of Xylella fastidiosa. J. Bacteriol. 185:1018-1026.
VandeBroek, A., and J. Vanderleyden. 1995. The role of bacterial motility, chemotaxis, and attachment in bacteria-plant interactions. MoI. Plant-Microbe Interact. 8:800-810.
Wagner, E., S. Marcandier, O. Egeter, J. Deutscher, F. Gotz, and R. Bruckner. 1995. Glucose kinase-dependent catabolite repression in Staphylococcus xylosus. J. Bacteriol. 177:6144-6152. Zhang, Y. P., J. K. Uyemoto, and B. C. Kirkpatrick. 1998. Small-scale procedure for extracting nucleic acids from woody plants infected with various phytopathogens for PCR assay. J. Virol. Methods 71:45-50.

Claims

We claim:
1. A construct comprising a nucleic acid molecule encoding a recombinant HecA-like hemagglutinin or fragment thereof which confers resistance to Xylella fastidiosa infection when expressed in plants.
2. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 85% identity to HxfA.
3. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 85% identity to HxfB.
4. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 90% identity to HxfA.
5. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 90% identity to HxfB.
6. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 95% identity to HxfA.
7. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 95% identity to HxfB.
8. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 97% identity to HxfA.
9. The construct of claim 1 wherein the nucleic acid molecule encodes a polypeptide with at least about 97% identity to HxfB.
10. The construct of claim 1 where the nucleic acid molecule encodes HxfA.
11. The construct of claim 1 where the nucleic acid molecule encodes HxfB.
12. The construct of claim 1 wherein the nucleic acid molecule hybridizes under high stringency conditions to the nucleic acid molecule of claim 10.
13. The construct of claim 1 wherein the nucleic acid molecule hybridizes under high stringency conditions to the nucleic acid molecule of claim 11.
14. The construct of claim 1 wherein said nucleic acid molecule is operably linked to a promoter.
15. The construct of claim 14 wherein the promoter is selected from the group consisting of constitutive promoters, inducible promoters, tissue- and cell-specific promoters, and developmentally-regulated promoters.
16. A host cell expressing a construct comprising a nucleic acid molecule encoding a recombinant HecA-like hemagglutinin or fragment thereof which confers resistance to Xylella fastidiosa infection when expressed in plants.
17. The host cell of claim 16, wherein said host cell is selected from the group consisting of Pseudomonas, Agrobacterium, and avirulent Xylella fastidiosa.
18. A plant containing the host cell of claim 16.
19. A transgenic plant expressing a recombinant HecA-like hemagglutinin or fragment thereof wherein said transgenic plant is more resistant to Xylella fastidiosa infection as compared to a corresponding plant not expressing said recombinant HecA-like hemagglutinin or fragment thereof.
20. The transgenic plant of claim 19 wherein the plant is selected from the group consisting of grapevines, citrus, peach, plum, oleander, elm, sycamore, oak, maple and coffee.
21. The transgenic plant of claim 20 where the plant is a grapevine.
22. A seed produced by the transgenic plant of claim 19.
PCT/US2005/046395 2004-12-22 2005-12-20 Engineering resistance to pierce's disease by expression of a xylella fastidiosa heca-like hemagglutinin protein Ceased WO2006069160A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/793,916 US8124837B2 (en) 2004-12-22 2005-12-20 Engineering resistance to Pierce's disease by expression of a Xyella fastidiosa HecA-like hemagglutinin protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63898804P 2004-12-22 2004-12-22
US60/638,988 2004-12-22

Publications (2)

Publication Number Publication Date
WO2006069160A2 true WO2006069160A2 (en) 2006-06-29
WO2006069160A3 WO2006069160A3 (en) 2007-11-15

Family

ID=36602290

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/046395 Ceased WO2006069160A2 (en) 2004-12-22 2005-12-20 Engineering resistance to pierce's disease by expression of a xylella fastidiosa heca-like hemagglutinin protein

Country Status (2)

Country Link
US (1) US8124837B2 (en)
WO (1) WO2006069160A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4385997A1 (en) 2022-12-16 2024-06-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Chitinopeptins, their use and recombinant synthesis in organisms for plant protection

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GUILHABERT ET AL.: 'Identification Ox Xylella Fastidiosa Antivirulence Genes: Hemagglutinin Adhesins Contribute A Biofilm Maturation To X. Fastidios And Colonization And Attenuate Virulence' MOLECULAR PLANT-MICROBE INTERACTIONS vol. 18, no. 8, 2005, pages 856 - 868 *
ROJAS C.M.: 'Hera, A Member Of A Class Of Adhesins Produced By Diverse Pathogenic Bacteria, Contributes To The Attachment, Aggregation, Epidermal Cell Killing, And Virulence Phenotypes Of Erwinia Chrysanthemi EC16 On Nicotiana Clevelandii Seedling' PNAS vol. 99, no. 20, October 2002, pages 13142 - 13147 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4385997A1 (en) 2022-12-16 2024-06-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Chitinopeptins, their use and recombinant synthesis in organisms for plant protection
WO2024126813A1 (en) 2022-12-16 2024-06-20 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Chitinopeptins, their use and recombinant synthesis in organisms for plant protection

Also Published As

Publication number Publication date
WO2006069160A3 (en) 2007-11-15
US8124837B2 (en) 2012-02-28
US20090217421A1 (en) 2009-08-27

Similar Documents

Publication Publication Date Title
Jun et al. Overexpression of GbRLK, a putative receptor-like kinase gene, improved cotton tolerance to Verticillium wilt
EP3167051B1 (en) Phytophthora resistant plants belonging to the solanaceae family
Piazza et al. The Arabidopsis pattern recognition receptor EFR enhances fire blight resistance in apple
CN109777810B (en) Application of PUB41 gene as a negative regulator in improving tomato resistance to gray mold and bacterial wilt
CN118791577B (en) Application of tomato phoma stolonifera virus coat protein SlAV-CP in improving plant defense capacity
Kanda et al. Ectopic expression of Ralstonia solanacearum effector protein PopA early in invasion results in loss of virulence
WO2009003412A1 (en) Bacillus thuringiensis stain, cry8g genes, proteins, which are all highly toxic to order coleoptera insect pests, and uses thereof
HUE031986T2 (en) Stress-resistant plants and their production
Kanda et al. Type III secretion machinery-deficient mutants of Ralstonia solanacearum lose their ability to colonize resulting in loss of pathogenicity
WO2009018739A1 (en) Bacillus thuringiensis strain, cry8h genes, proteins, which are all highly toxic to order coleoptera insect pests, and uses thereof
Mondal et al. Xanthomonas axonopodis pv. punicae depends on multiple non-TAL (Xop) T3SS effectors for its coveted growth inside the pomegranate plant through repressing the immune responses during bacterial blight development
CN108103042B (en) Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof
CN120683129B (en) Application of GmFLZ protein or coding gene thereof in drought tolerance of plants
CN103937819B (en) A kind of lilium regale wilson glutathione S-transferase gene LrGSTL1 and application thereof
CN105753951A (en) Bt insect-resistant gene, protein coded by Bt insect-resistant gene and application of Bt insect-resistant gene
Park et al. Avirulence gene diversity of Xanthomonas axonopodis pv. glycines isolated in Korea
US8124837B2 (en) Engineering resistance to Pierce&#39;s disease by expression of a Xyella fastidiosa HecA-like hemagglutinin protein
CN109295068B (en) A kind of Panax notoginseng sweet protein gene PnTLP2 and its application
EP2740351A1 (en) Gene and method for increasing disease resistance in perennial plants
CN106834337B (en) Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene
CN112322651B (en) Application of tomato autophagy gene in improving plant root-knot nematode resistance
CN111635905B (en) Jujube witches broom phytoplasma effector gene Zaofeng6 and application
CN116574755A (en) Application of PtTINY Gene in Regulating Plant Salt Stress Tolerance
CN106676114B (en) Rice gene OsUEP3 and application of disease-resistant regulation function
Sönmez et al. Transgenic Nicotiana tabacum cultivar Samsun plants carrying the wild sugar beet Hs1pro1 gene have resistance to root-knot nematodes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05857165

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 11793916

Country of ref document: US