WO2006057466A1 - Beta-casein gene targeting vector using homologous recombination - Google Patents

Beta-casein gene targeting vector using homologous recombination Download PDF

Info

Publication number
WO2006057466A1
WO2006057466A1 PCT/KR2004/003034 KR2004003034W WO2006057466A1 WO 2006057466 A1 WO2006057466 A1 WO 2006057466A1 KR 2004003034 W KR2004003034 W KR 2004003034W WO 2006057466 A1 WO2006057466 A1 WO 2006057466A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cell
vector
beta
factor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2004/003034
Other languages
French (fr)
Inventor
Yong-Mahn Han
Kyung-Kwang Lee
Mira Chang
Deog-Bon Koo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority to PCT/KR2004/003034 priority Critical patent/WO2006057466A1/en
Priority to CNA2005800036604A priority patent/CN1914324A/en
Priority to US10/574,747 priority patent/US8030538B2/en
Priority to JP2006546862A priority patent/JP2007510437A/en
Priority to PCT/KR2005/003923 priority patent/WO2006057499A1/en
Priority to EP05823897A priority patent/EP1704238A1/en
Priority to AU2005256120A priority patent/AU2005256120B2/en
Priority to CA002547572A priority patent/CA2547572A1/en
Publication of WO2006057466A1 publication Critical patent/WO2006057466A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C12N15/877Techniques for producing new mammalian cloned embryos
    • C12N15/8771Bovine embryos
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/101Bovine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present invention relates to beta-casein gene targeting vectors that function through homologous recombination, animal cells that are gene-targeted with the said vectors and embryos that are nuclear-transferred with the said animal cells.
  • the present invention also relates to methods for producing desired proteins from the milk of the transgenic animals that are prepared by implanting the said embryos .
  • Transgenic animals have been created great commercial value in industries such as biomedicine and agriculture.
  • Various techniques such as microinjection, viral transfection, sperm vector, application of embryonic stem(ES) cells and somatic cell nuclear transfer (SNCT) have also been developed to prepare transgenic animals oi- so called genetically-modified animals.
  • the microinjection method which injects a DNA molecule into the male or female pronucleus of fertilized eggs (Harbers et al., Nature., 293(5833); 540-2, 1981; Brinster et al., Cell., 27/223-231, 1981; Gordon et al., Proc Natl Acad Sci USA., 77 (12);7380-7384; Costantini et al., Nature., 294 (5836) ; 92-94) , has been widely employed to produce transgenic animals (Hammer et al., Nature., 315(6021) ; 680-683, 1985; van Berkel et al.
  • the retrovirus-mediated method is also widely used in order to genetically manipulate animals (Soriano et al., Genes Dev., 1 (4) ;366-375, 1987; Hirata et al. , Cloning Stem Cells., 6(1) ; 31-36, 2004) .
  • the desired gene sequences are introduced into the animal genomes by using virus-mediated vectors.
  • viral transformation is more efficient than pronuclear injection, random insertion of the foreign genes and mosaicism are entailed due to multiple integrations (Piedrahita et al., Theriogenology, 53 (1) ; 105-116, 2000) .
  • the maximum size of the introduced genes is usually limited to approximately 7 kb and there is concerning of the potential interference caused by virally encoded proteins (Wei et al., Annu Rev Pharmacol Toxicol., 37; 119-141, 1997; Yanez et al., Gene Ther., 5 (2) ; 149-159, 1998) .
  • a gene targeting technique that can insert or remove a DNA segment at a specific location was developed.
  • the gene targeting technique was first applied to the mouse embryonic stem cells to study gene function.
  • Mouse embryonic stem cells are now being used to introduce predetermined genetic modifications into embryos.
  • a number of specific gene- targeted mice have been produced through the manipulation of mouse embryonic stem cells using the technique (Brandon et al., Curr Biol., 5 (6) ; 625-634, 1995; Capecchi et al., Science, 244 (4910) ; 1288-1292, 1989; Thompson et al., Cell, 56(2) ;313-321, 1989; Hamanaka et al.
  • Cow's milk is composed of approximately 88% water, 3.3% protein and the remaining carbohydrates and fat.
  • the caseins comprising 80% milk protein, are divided into four groups, alpha Sl, alpha S2, beta and kappa casein. Beta casein is the most abundant protein in milk and is expressed in a concentration of 10mg/ml in bovine milk (Brophy et al., Nat Biotechnology., 21 (2) ; 157-162, 2003) .
  • the SCNT technique is more efficient way to make transgenic animals compared to the microinjection method because almost all of the cloned animals derived from transformed somatic cells are transgenic animals (Brink et al., Theriogenology, 53;139-148, 2000) . It is also possible to predetermine the sex of animals and create a genetically homogeneous herd in order to produce a uniform product (Lubo et al., Transgenic Res., 9 (4-5) ; 301-304, 2000; van Berkel et al., Nat Biotechnol., 20(5) ;484- 487, 2002) .
  • ES cells and vector constructs for targeting a specific gene have been considered as prerequisite elements to generate gene-targetted animals.
  • ES- like cells in pig and cattle (Doetschman et al., Dev Biol., 127 (1) ;224-227, 1988; Stice et al., Biol Reprod., 54 (1) /100-110, 1996; Sukoyan et al., MoI Reprod Dev., 36(2) /148-158, 1993; Iannaccone et al., Dev Biol., 163 (1) /288-292, 1994; Pain et al., Development, 122 (8) ;2339-2348, 1996; Thomson et al.
  • Gene-targeting known as the introduction of site-specific modification into a genome by homologous recombination event, is a powerful tool for tissue-specific expression of recombinant proteins (Muller et al., Mech Dev. , 82(l-2);3- 21, 1999; Clark et al., J Mammary Gland Biol Neoplasia., 3(3) ;337-350, 1998) .
  • a first knock-in ovine has opened the door to make it possible to produce therapeutic foreign protein-targeted large animals (McCreath et al. , Nature. ⁇ 405 (6790) ;1066-1069, 2000) .
  • the COLT-2 targeting vector which has homology regions for COLlAl gene that is highly expressed in fibroblasts was developed, allowing the promoter-trap enrichment of gene-targeting events.
  • AATC2 trasgene comprised of human ⁇ l-antitrypsin (AAT) complementary DNA within an ovine beta-lactoglobulin (BLG) expression vector was designed to direct expression in the mammary gland, having separate transcription unit.
  • AAT secreted from targeted lambs was 37-fold more than that from the sheep with multiple and random integration of the genes (McCreath et al., Nature, 405 (6790) ; 1066-1069, 2000) .
  • gene targeting is now regarded to be the most powerful method to produce large amount of therapeutic protein.
  • the application of the promoter-trap targeting vector is limited to transcriptionally active genes in the somatic cells.
  • transcriptionally active genes are more amendable to gene targeting than silent genes because they have a higher frequency of homologous recombination (Kuroiwa et al., Nat Genet., 36 (7) ;775-780, 2004) .
  • Milk proteins are expressed in a tissue-specific manner in the mammary gland. An over-expression of foreign protein is possible without causing lethality in embryonic or post-natal development by manipulating a gene coding of the milk proteins.
  • beta-casein would be one of the best candidates since it is expressed abundantly.
  • the bovine beta-casein exists as a single copy gene in total genome and is not known to be expressed in the somatic cells except for those in the mammary gland.
  • the targeting of foreign genes into the beta-casein gene which is not expressed in the normal somatic cells, cannot be carried out by vectors utilizing the promoter trap.
  • the present inventors have created targeting vector cassettes specific for the beta- casein gene, vectors inserted with a foreign gene using the said cassette, animal cells introduced with said vectors, and nuclear-transferred embryo with the said animal cells.
  • the present inventors found that the foreign genes were correctly targeted to the beta casein gene of genomic DNA.
  • beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins / (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid seguences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5' -3' arrangement of beta-casein gene.
  • FIG. 1 depicts 18.8kb pBCKI I vector cassette targeting the bovine beta-casein gene, derived from a pBluescript Il SK(+) plasmid.
  • the vector also includes Sac II, Not I , and BamH I restriction sites in front of neo gene and BamH I site at the back of short arm region.
  • FIG. 2 depicts 14.8 kb pBCKI Il vector cassette targeting the bovine beta-casein gene, derived from a pGEM7Zf(+) plasmid.
  • FIG. 3 shows homologous recombination between pBCKI I vector and beta-casein gene in genome. Double crossover results in the replacement of the endogenous beta-casein gene with the sequences in the vector cassette .
  • FIG . 4 shows homologous recombination between pBCKI I l vector and beta-casein gene in genome.
  • a partial sequence of beta casein gene locus in genome is replaced with a partial sequence in vector cassette as result of a double crossover event.
  • FIG. 5 shows PCR screening strategy used to identify gene targeting events at the bovine beta-casein locus and the DNA sequences spanning the junctions of the targeted beta-casein locus and the restriction sites in the targeting vector cassettes.
  • the upper portion shows the approximate position of two primers used to amplify the 4 kb fragment, from the neo gene region unique to the beta- casein gene targeting vectors to the region endogenous beta-casein locus which is not used in the vector cassettes.
  • Sequence A shows a portion of DNA sequence spanning the junction between the long arm region and the neo gene.
  • Sequence B shows a portion of DNA sequence spanning the junction between the neo gene and the short arm region.
  • the position and orientation of the 5' PCR primer is shown.
  • Sequence C shows a portion of DNA sequence spanning the junction between the short arm region and the endogenous beta-casein gene locus which is excluded from the BCKI I and BCKlII vectors.
  • FIG. 6 shows the pBClO vector constructed in our previous study (Kim et a 1., J Biochem (Tokyo) . , 126(2) ;320-5, 1999) .
  • the pBClO vector is based on a pBluescript Il SK vector backbone and includes the bovine beta-casein promoter region, which is 10kb in length.
  • the promoter region contains 8 kb of the 5'-flanking sequence of gene, the untranslated exon 1 and 2 (vertical open boxes), and 2 kb of intron 1 of bovine beta-casein gene.
  • the promoter has restriction enzyme sites for Sac I , Aatll , and Sac II , but there is no recognition sequences of other restriction enzymes such as Sraa I , BamH I , Sal I , Spe I and CIa I .
  • FIG. 7 shows the isolated 10 kb DNA fragment from the pBClO vector digested with Sac I and Sac Il restriction enzymes.
  • the isolated 10 kb DNA fragment is used for long arm of the pBCKI I vector cassette.
  • FIG. 8 shows the isolated 6 kb DNA fragment from thv ⁇ pBClO vector digested with Aatll and Sac Il restriction enzymes.
  • the isolated 6 kb DNA fragment is used for long arm of the pBCKIII vector cassette.
  • FIG. 9 shows construction procedures of the pBC3.1 vector applied for the short arm of pBCKI I and pBCKI Il vector cassettes.
  • the 3.2 kb DNA fragment including exon 5, 6, 7 and 8 of a bovine beta-casein gene was prepared by PCR amplification using the primer set which has Xho I and Sal I sites (bold characters) from the bovine chromosomal DNA.
  • the amplified PCR fragment was digested with Xho I and Sal I restriction enzymes and then ligated into the Sal I restriction enzyme site of pGEM-T vector (Promega) .
  • the 3.2 kb DNA fragment in the pGEM-T vector was digested with Hincll and Sal I restriction enzymes and then ligated into Sai l site of pBluescript Il SK(+) vector.
  • FIG. 10 shows the procedure obtaining the neo gene including the SV40 ori, the early promoter, the neomycin resistance gene, the SV40 early splicing region and polyadenylation site from a pMAMneo vector (CLONTECH) .
  • the 2.7 kb neo gene fragment digested with BamH I restriction enzyme was ligated into BamH I site of pBluescript Il SK(+) vector.
  • the 2 kb DNA fragment of the neo gene in a pBluescript Il SK(+) vector was digested with BgIlI and BamH I restrction enzymes and ligated into BgI Il site of pSP73 vector (Promega) .
  • the 2 kb fragment of a pSP73 vector digested with BgIlI and EcoRV restriction enzymes was then re-ligated into BgIlI and EcoRV sites of the pBluescript Il SK(+) vector containing the 0.7 kb neo gene to generate the pneo2.7 vector construct.
  • FIG. 11 shows the construction procedures of the
  • the DNA fragments corresponding to a positive selection marker and short arm in pBluescript IISK(+) were digested with respective restriction enzymes, and then ligated into the BamH I , EcoRY and Sai l site of pBluescript Il SK (+) vector harboring pBClO DNA fragment.
  • the resultant pBCKI I vector includes the 10 kb long arm, the selection marker gene and the short arm.
  • the DNA fragment digested with Aatll and Sal I restriction enzymes was ligated into Aatll and Xho I sites of pGEM7Zf(+) vector.
  • the resultant pBCKIII vector includes the 6 kb long arm, the neo gene, and the short arm.
  • FIG. 12 shows introduction of a valuable gene into the pBCKI I vector.
  • human thrombopoietin (hTPO) cDNA was inserted into the invented pBCKI I vector cassettes.
  • the 1.0 kb of the hTPO cDNA coding for the full length form was amplified by PCR in our previous study, and the poly(A) additional signal sequence of the bovine growth hormone (bGH) gene, which is 300bp in length, was ligated into the Kpn I site to downstream of the hTPO cDNA fragment (Sohn, DNA Cell Biol., 18 (11) ;845-852, 1999) .
  • the 1.3 kb DNA fragment including hTPO cDNA and bGH gene was inserted into Sac Il and Not I sites of the pBCKI I vectors, generating the 20.1 kb pBCTPOKI I vector construct.
  • FIG. 13 shows introduction of the hTPO cDNA into pBCKIII vector cassette.
  • the resultant 16.1 kb pBCTPOKI Il construct was generated and the procedures were the same as described in FIG. 12.
  • FIG. 14 shows the linearized pBCTPOKI I vector to be used for transfection after Sal I digestion.
  • FIG. 15 shows the linearized pBCTPOKI Il vector to be used for transfection after Aat Il digestion.
  • FIG. 16 is photographs showing morphologies of bovine embryonic fibroblasts (bEF) and bovine ear skin fibroblasts (bESF) .
  • a and B are non-transfected (normal) cells, bEF and bESF, respectively, cultured to confluence.
  • C and D show the colony formed after transfection of the targeting vector into bEF and bESF, respectively.
  • the targeting vector which has antibiotic resistance gene, neo gene is introduced into bEF and bESF using the LipofectamineTM 2000 reagent (Invitrogen) method, the transfected cells were treated with G418 (Gibco, Invitrogen corporation) and then only the survived colonies were subject to analyses of the inserted foreign genes.
  • FIG. 17 shows PCR analysis of the survived colonies after pBCKI Il transfection. The positive signals for the
  • pBCTPOKI Il vector of the present invention 500 bp PCR fragment indicated by an arrow represent transfected cell clones, were denoted as ⁇ +" and the negative signals were denoted as "-”.
  • the pBCTPOKI Il vector of the present invention was used as a positive control and the PCR was amplified with the primers specific for hTPO gene.
  • FIG. 18 and FIG. 19 depict construction procedures of the piieoBC3.7 vector to be used as the control for long- range PCR analysis.
  • the 591bp DNA fragment harboring intron 8 and exon 9 corresponding to bases 7888 to 8479 of bovine beta-casein gene was prepared separately by PCR amplification using a primer set from the bovine chromosomal DNA.
  • the 3' primer has Xho I site depicted as bold characters.
  • the amplified PCR fragment was ligated into pGEM-T vector to generate the pBC591 vector construct.
  • the pBC591 vector was digested with Sal I and Xho I restriction enzymes, and then the resultant DNA fragment was ligated into Sal I site of the BC3.1 vector.
  • the pneo2.7 vector digested with BamH I and ECORV restriction enzymes was ligated into the BC3.1 vector digested with BamH I and EcoRV restriction enzymes to generate the pneoBC3.7 vector.
  • the arrows show primer set for 4 kb long-range PCR analysis.
  • FIG. 20 shows the results of long-range PCR analyses of the colonies transfected with BCTPOKlII .
  • the positive signals for the 4 kb indicated by arrows represent targeted cell clones, were detected in two colonies, "81" and "89", and the other colonies showed negative signals (-) .
  • the prieoBC3.7 vector was used as a positive control.
  • FIG. 21 shows strategy for Southern blot analysis to identify the targeted nucleic acid sequences.
  • the BCTPOKIlI vector and purified genomic DNAs from transfected cell clones were digested with EcoRI.
  • the size of DNA fragments from BCTPOKIlI vector (A) and genomic DNA (B) digested with the EcoR I restriction enzyme are 9.2 kb and 9.9 kb, respectively.
  • the bar under the hTPO gene represents the locus of the probe used for Southern analysis. 500 bp fragments of hTPO cDNA used for the probe were amplified by
  • FIG. 22 shows identification of targeted colonies by Southern blot analysis.
  • the targeted colonies represented the 9.9 kb fragment and the other colonies, 97, 47, 43 and 34, did not show any signal.
  • the bovine genomic DNAs was used at the various concentrations as a negative control and the 9.2kb fragments derived from the BCTPOKI Il vector on various concentrations were used as a positive control.
  • FIG. 23 shows PCR analysis of nuclear-transferred embryos from 81 cell clone.
  • the positive (+) signals, 356 bp in length, implied that the cloned embryos derived from the somatic cells that were targeted with the vector of the present invention.
  • the pBCTPOKlll vector was used as a positive control.
  • nested PCR was also performed to re ⁇ confirm the positive signals.
  • FIG. 24A is a photograph showing a 89 cell clone derived fetus enclosed with a fetal membrane collected at 36 days of gestation.
  • FIG. 24B and 24C are photographs showing the fetal membrane-removed fetus and cells derived from the fetal membrane, respectively.
  • FIG. 24D shows the result of the long-range PCR 01 cells derived from the fetal membrane.
  • the positive signals for the 4 kb indicate that cells, genetically identical to the cloned fetus, were targeted with the vector of the present invention.
  • the pneoBC3.7 vector was used as a positive control.
  • the present invention relates to a beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins; (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid sequences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5' -3 r arrangement of beta-casein gene.
  • gene targeting vector means a vector that can remove or insert a desired gene to a specific-genomic locus and that includes a nucleic acid sequence homologous to a particular gene for homologous recombination.
  • a gene targeting vector of the present invention is a beta-casein targeting vector which inserts nucleic acid sequences coding desired proteins to beta- casein gene in genome in the 5' -3' arrangement.
  • vectors and vector cassettes are used herewith interchangeably, and the vectors can be either circular or linear form.
  • the beta-casein targeting vector of the present invention comprises a first region and a second region that are homologous to the sequences of the beta-casein gene that are located before and after the cloning site.
  • the first region corresponds to the long arm and the second region corresponds to the short arm.
  • a first region of herein, is characterized by having a length of 5 to 12kb which has a DNA sequences homologous to the promoter and its flanking sequences of beta-casein gene.
  • Bovine beta-casein gene promoter has been known to be a good promoter to induce high expression of a foreign protein (Kim et al., J Biochem(Tokyo) ., 126 (2) ; 320-325, 1999) .
  • the length of a first region is an important parameter to determine the gene targeting efficiency. Preferably, it is of 5.5 kb to 10 kb, and more preferably, it is 6 kb.
  • the first region is located upstream to the second region in the 5' -3' arrangement of beta-casein gene.
  • the targeted beta-casein genes are not particularly limited but preferably are those of bovine, sheep, goats, pigs, horses, rabbits, dogs or monkeys, and more preferably a bovine beta-casein gene.
  • homology means the degree of similarity between nucleic acid sequences of the first region or a second region and the endogenous beta-casein gene sequences corresponding to these first and second regions.
  • the sequences are homologous to each other when the sequences exhibit at lest 90%, preferably at Ieast95% sequence identity.
  • (multiple) cloning site means a nucleic acid sequence comprising at least two distinct nucleotide sequence specifically recognized and digested by restriction enzymes to permit insertion of nucleic acid sequence coding desired proteins.
  • a desired protein which can inserted to the MCS on a vector of the present invention, may includes all proteins having medical or industrial application, such as hormones, cytokines, enzymes, coagulation factors, carrier proteins, receptors, regulatory proteins, structural proteins, transcription factors, antibodies, antigens, etc.
  • the desired proteins include, but not limited to, thrombopoietin, human growth hormone, growth hormone releasing hormone, growth hormone releasing peptide, interferons, interferon receptors, colony- stimulating factor, glucagon-like peptides, G-protein- coupled receptor, interleukins, interleukin receptors, enzymes, interleukin binding proteins, cytokine binding proteins, macrophage activating factor, macrophage peptide, B cell factor, T cell factor, protein A, suppressive factor of allergy, cell necrosis glycoprotein, immunotoxin, lymphotoxin, tumor necrosis factor, tumor inhibitory factor, transforming growth factor, alpha-1 antitrypsin, albumin, alpha-lactalbimin, apolipoprotein-E, erythroprotein, hyper- glycosylated erythroprotein, angiopoietins, hemoglobin, thrombin, thrombin receptor activating peptide, thrombomodulin , factor
  • selection marker is required for selecting transformed cell with the vector.
  • the selection marker gene confers resistances to drugs, nutritional requirement and cytotoxic drugs, or induces * selectable phenotype such as fluorescence and a color deposit.
  • Positive selection marker makes cell expressing positive selection markers to survive against selective agent, so that be capable of conferring positive selection characteristic for the cell expressing that marker.
  • the positive selection marker includes, but not limited to, neomycin, hygromycin, histidinol dehydrogenase, guanine phosphosribosyltransferase, and so on.
  • the positive selection marker of the invention has independent promoter and poly A.
  • the promoter regions include, but not limited to, simian virus 40 (SV40) , mouse mammary tumor virus (MMTV) , human immunodeficiency virus (HIV), particularly, long terminal repeat (LTR) region promoter, moloney virus, cytomegalovirus (CMV) , epstein- barr virus (EBV) , and respiratory syncytial virus (RSV) promoter, beta-actin promoter and promoter derived from human hemoglobin, human muscle creatine, and human metallothionein.
  • SV40 simian virus 40
  • MMTV mouse mammary tumor virus
  • HBV human immunodeficiency virus
  • LTR long terminal repeat
  • moloney virus moloney virus
  • CMV cytomegalovirus
  • EBV epstein- barr virus
  • RSV respiratory syncytial virus
  • the vector of the invention could comprise negative selection marker as additional component.
  • Negative selection marker removes cells with random-integration, so that be capable of conferring negative selection characteristic for the cell expressing that marker.
  • the negative selection marker includes, but not limited to, herpes simplex virus-thymidine kinase (HSV-tk) , hypoxanthine phosphoribosyl transferase (Hprt) , cytosine deaminase, diphtheria toxin, and so on.
  • HSV-tk herpes simplex virus-thymidine kinase
  • Hprt hypoxanthine phosphoribosyl transferase
  • cytosine deaminase diphtheria toxin, and so on.
  • the negative selection marker locates at the 5' terminus of a first DNA sequence or the 3' terminus of the second DNA sequence.
  • the nucleic acid coding the desired protein is integrated to a beta-casein gene locus of cellular genomic DNA in host cell by homologous recombination, and is expressed in the cell instead of the endogenous beta-casein protein.
  • the present invention maximized the efficiency by optimizing the position and length of homologous region of the first and second regions. Indeed, the present vector system induced homologous recombination events even in the somatic cells that are transcriptionally silent, leading to the stable integration of the foreign protein gene into a beta-casein gene locus .
  • BCKI I and BCKlII were prepared as targeting vectors.
  • pBCKI I vector about 18.8kb in length, was derived from pBluescript Il SK(+) plasmid.
  • the first region of pBCKI I vector is about 10kb in length and it includes 8 kb sequences harboring bovine beta-casein promoter, exon 1, intron 1 and exon 2 of the bovine beta-casein gene.
  • a second region of pBCKI I vector is about 3.1 kb in length and it includes exons 5-8, introns 5-7 and a portion of intron 4 and 8 as shown in Fig. 2.
  • the pBCKI I vector includes a neo gene as a selection marker, SV40 early promoter and polyA sequences.
  • the pBCKI I vector includes three restriction enzymes sites (Sac II, Not I and BamH I), for the insertion of nucleic acid coding desired proteins as shown in Fig. 1.
  • pBCKll vector about 14.8kb in length, was derived from pGEM7Zf(+) plasmid.
  • the first region of pBCKI Il is about 6kb in length and it includes bovine beta-casein promoter having a length of about 4kb and axon 1, intron 1 and exon 2 of the bovine beta-casein.
  • a second region of pBCKI Il vector is about 3.1 kb in length and includes exons 5-8, introns 4-7 and a portion of intron 4 and 8 as shown in Fig. 2.
  • the pBCKI Il vector includes a neo gene as a selection marker gene, SV40 early promoter and polyA.
  • the pBCKI Il vector includes three restriction enzymes sites (Sac II, Not I and BamH I), for the insertion of nucleic acid coding desired proteins as shown in Fig. 1.
  • the targeting vectors according the present invention can be prepared using general DNA recombination techniques. Site-specific cleavage and ligation can be accomplished by using the enzymes known to the art.
  • human thrombopoietin (TPO) gene was inserted into BCKI l and BCKlII (Fig 3 and 4) .
  • the 1 kb human TPO cDNA fragment flanked by 0.3 kb fragment of bovine growth hormone (bGH) gene was constructed (Sohn et al., DNA Cell Biol., 18 (11) ;845-852, 1999) .
  • the bGH gene was inserted to encode s stable messenger RNA.
  • Human thrombopoietin is one of the major hemopoietic regulators participating in series of megakaryocytopoiesis, that is, proliferation and differentiation of megakaryocytes inducing production of platelets. As a primary physiological regulator of platelet production, it plays a pivotal role in promoting the proliferation and maturation of megakaryocytes.
  • Severe neutropenia and thrombocytopenia are seen in patients undergoing aggressive chemotherapy and bone marrow transplantation for hematologic malignancies and solid turners (Lok et al., Stem Cells, 12 (6) /586-598, 1994; Kaushansky et al., Stem Cells, 15 (1) ; 97-102, 102-103, 1997; Kaushansky et al., Ann Intern Med., 126 (9) ;731-733, 1997; Kaushansky et al. , Leukemia, 11 (3) ;426-427, 1997; Kaushansky et al., Annu Rev Med., 48;1-11, 1997) .
  • TPO has ability to ameliorate thrombocytopenia in animal models so that showed the potential use for therapeutic purpose.
  • the safety and efficacy of TPO was approved in Phase I clinical trials (Fanucchi et al., N Engl J Med., 336 (6) ;404-409, 1997; Basser et al., Lancet., 348 (9037) ;1279-1281, 1996; O'Malley et al. , Blood, 88 (9) ; 3288-3298, 1996) . It also appears that TPO could be used to enhance the recovery of platelet production in myelosuppressed patients undergoing cancer chemotherapy.
  • pBCKI II vectors harboring the first region having a length of 6kb are more efficient in targeting to the beta-casein gene in genome.
  • the present invention relates to an animal cell which is gene-targeted with the above vectors.
  • a cell targeted with a vector of the present invention is derived from eukaryotes, and can be primary, secondary, or permanent cells.
  • the cells are derived from cattle, sheep, goats, pigs, horses, rabbits, dogs, monkeys, and so on, but not limited to.
  • Useful tissues capable of detaching or activating cells are, but not limited to, livers, kidneys, spleens, bones, marrows, thymuses, hearts, muscles, lungs, brains, seminal glands, ovaries, islets, intestines, ears, skins, pancreatic tissues, prostate glands, bladders, embryos, immune systems, hematopoiesis systems, and so on.
  • cell types are, but not limited to, fibroblasts, epithelial cells, nerve cells, embryonic cells, liver cells, ovarian follicle cells, and so on.
  • a transfection method of the vector includes any method of introducing a nucleic acid into the cell, and the transfection can be carried out using an appropriate technigue well known in this art.
  • the transfection methods include, but not limited to, electroporation, calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran, cationic liposome transfections and so on.
  • electroporation calcium phosphate co-precipitation
  • retroviral infection retroviral infection
  • microinjection microinjection
  • DEAE-dextran cationic liposome transfections and so on.
  • a linear form of vectors which is digested with a restriction enzymes, is more preferable than a circular form vectors, is exemplary.
  • a beta-casein targeting-vector inserted with a human thrombopoietin was introduced into bovine embryonic fibroblasts (bEF) and bovine ear skin fibroblasts (bESF) using LipofectamineTM 2000 reagent (Invitrogen) .
  • Cationic liposome interacts efficiently with negative charged DNA and the DNA-liposome complexes are associated with the cell membrane, thereby leading to DNA internationalization.
  • Insertion of the gene-targeting vector into a specific gene was detected and confirmed by a long range PCR and a southern blot assay from the colonies survived after the treatment with antibiotics.
  • clones derived from bESF cells targeted witl: hTPO at the beta-casein gene were obtained.
  • An exemplary clone was deposited with the international depositary authority as KCTC 10720BP.
  • the present invention relates to an embryo which is nuclear-transferred with the said animal cell.
  • Nuclear transfer is a process that genetic material of the nuclear donor cells is transferred into the enucleated oocytes.
  • the nuclear transfer technique makes it possible to produce genetically identical animal clones because genetic material of the same donor cell is transferred into the recipient cytoplast.
  • the present invention relates to a method for producing a nuclear-transferred embryo, which comprises the steps of introducing the vector according to the present invention into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; and introducing the gene-targeted cell into a nuclear-removed animal embryo to produce nuclear-transferred embryo with the gene-targeted cell.
  • a gene-targeted somatic cell is introduced into a nuclear-removed animal embryo by using the techniques such as cell fusion method and intracytoplasmic cell injection (ICCI), etc.
  • the cell fusion method is simple and useful for large production of embryos.
  • the ICCI method permits maximum exposure of a nucleus isolated from donor cells to the cytosol in recipient cytoplasts.
  • somatic cell and enucleated oocyte are accomplished by changing charges on cell surface by electric pulse. It is convenient to use an electro-cell manipulator that the pulse length and voltage are easily controllable.
  • the present invention relates to a method for producing a desired protein from milk, which comprises the steps of introducing the vector according to the present invention into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; introducing the gene-targeted cell into a nuclear-removed animal embryo; implanting the embryo into a milk-producing animal to produce a transgenic animal; and producing milk from the transgenic animal.
  • the nuclear-transferred embryos are activated and developed in vitro to the blastocyst stage and then and then implanted to recipients .
  • the activation of cloned embryo induces reinitiation of cell cycle, which is temporarily quiescent, whereby the cleavage of embryo is possible.
  • cell cycle arrest factors such as maturation-promoting factor (MPF) , mitogen-activated protein (MAP) kinase, and so on
  • MPF maturation-promoting factor
  • MAP mitogen-activated protein
  • the activation of cell can be accomplished by the dramatic increase of calcium influx induced by electro ⁇ stimulation or chemical treatment such as ionomycin, 6- dimethylaminopurine (6-DMAP), and so on, wherein the above methods can be used independently or together.
  • the reconstructed embryos were treated with ionomycine+6-DMAP and developed in vitro to a blastocyst stage.
  • desired proteins can be obtained in large quantity from the milk without causing severe lethality during the embryonic or post-natal development.
  • the desired proteins expressed in milk can be purified using conventional methods such as salting out
  • bovine beta-casein gene promoter locus which direct expression of foreign therapeutic genes in the milk.
  • the pBC 10 vector construct (FIG. 6) as previously described (Sohn et al., J Biotechnol., 103 (1) ; 11-19, 2003) contains a 8 kb promoter of 5' -flanking sequence, the entire exon 1 and 2 kb intron 1 and 5'-UTR of exon 2 of the bovine beta casein in a pBluescript Il SK(+) plasmid
  • the beta-casein gene region of the pBC 10 vector was used as a long arm (a first DNA region) of two invented vector cassettes, BCKI I and BCKIlI . As shown in
  • FIG. 7 a 10 kb beta-casein gene could be digested with Sac I and Sac Il restriction enzymes and it was used as a long arm (a first DNA sequence) of the BCKI I vector cassette (FIG. 11) .
  • a 6 kb beta-casein promoter region (FIG. 8) digested with Aatll and Sac Il restriction enzymes, including 4 kb promoter, untranslated exon 1, 2 and intron 1 of the bovine beta-casein gene, was used as a long arm (a first DNA sequence) of BCKlII (FIG. 11) .
  • the BC3.1 vector (FIG. 9) was constructed to utilize as a short arm of the vector cassettes of the invention.
  • the 3.2 kb DNA fragments of the bovine beta-casein gene sequence (4676 to 7898), containing exons 5, 6, 7, 8 and introns 5, 6, 7 and partial introns 4 and 8, was amplified by PCR using bovine genomic DNA as the template. Sequences of the primers used for the PCR reaction are as follows:
  • Reverse primer 5' - catatgtcgactgtgagattgtattttgact - 3'
  • the PCR product (FIG. 9) was digested with Xho I and Sal I restriction enzymes and ligated into the Sal I site of pGEM-T (Promega) .
  • the 3.2 kb bovine beta-casein gene fragment in pGEM-T was digested with Hincll and Sal I restriction enzymes.
  • the resultant 3.1 kb fragment was ligated into Sal I site of pBluescript Il SK(+) to generate the BC3.1 vector.
  • the neo gene fragment utilized as a selection marker also was inserted into pBClO vector.
  • a pMAMneo vector (CLONTHECH) was digested with Bam H ) restriction enzyme (FIG. 10) .
  • Bam H Bam H restriction enzyme
  • the 2 kb neo gene fragment in the ligated vector was digested with BgI Il and Bam H I restriction enzymes and then ligated into BgIlI site of the pSP73 (Promega) .
  • the 2 kb neo gene fragment in the pSP73 was digested with BgIlI and EcoRV restriction enzymes and then re-ligated into the BgIlI and EcoRV sites of the pBluescript Il SK(+) harboring the 0.7 kb pMAMneo gene fragment.
  • pBCKI I and pBCKI Il vector cassettes were accomplished by assembling pneo2.7 and pBC3.1 gene fragments into the pBClO vector.
  • the neo gene in pBluescript Il SK(+) was digested with Bam H I and EcoRV restriction enzymes and then ligated into Bam H I and EcoRV sites of the pBClO vector.
  • the pBC3.1 vector was digested with EcoRV and Sal I restriction enzymes and then ligated into EcoRVand Sal I sites of the pBClO vector including the ligated pMAMneo gene fragment to generate the pBCKI I vector cassette.
  • the pBCKI I vector cassette was digested with Aatll and Sal I restriction enzymes and ligated into Aatll and Xho I sites of the pGEM-7Zf (Promega) to generate the pBCKlll vector cassette. Therefore, the pBCKI I and pBCKIII vector cassettes were constructed.
  • the 1 kb Human TPO cDNA plus 300bp bovine growth hormone was inserted pBCKI I and pBCKlll vector cassettes.
  • the 1.3 kb foreign gene harboring Sac Il and Not I sites was ligated into the Sac Il and Not I sites of the pBCKI 1 and pBCKI I) vectors, respectively, thereby generating the targeting vectors, named as pBCTPOKI I and pBCTPOKI Il .
  • the plasmid DNAs, pBCTPOKI I and pBCTPOKlll, were purified by using "QIAfilter Plasmid Midi kits" (Qiagen) and then closed circular DNAs were isolated by an equilibrium centrifugation in CsCl-ethidium bromide gradient.
  • the isolated pBCTPOKI I and pBCTPOKlll plasmids were linearized by digestion of Sal I (FIG. 14) and Aatll
  • FIG. 15 restriction enzymes, respectively, and then purified by ethanol precipitation. Finally, the concentrations of the purified DNAs were determined by using a spectrophotometer.
  • the linearized pBCTPOKI I and pBCTPOKlll constructs were introduced into the bEF and bESF at passage 2 or 3 by using Lipofectamine 2000 reagent (Invitrogen) .
  • bEF we tested three different transfection reagent volumes such as 2, 4 and 10 ⁇ l, and two different DNA concentrations such as 2 and 4 ⁇ g.
  • 2, 4 and 10 ⁇ l transfection reagent volumes and 1, 2 and 4 ⁇ g DNA concentrations were tested.
  • the somatic cells were exposed to the transfection reagent-DNA complexes for 24 h.
  • the somatic cells were cultured in Dulbecco Modified Eagle Medium (Gibco, Invitrogen corporation) supplemented with 10% FBS (Hyclone), 0.001% Gentamicine . (Gibco, Invitrogen corporation) and 1% MEM Non-Essential Amino Acid (Gibco, Invitrogen corporation) and the culture medium was exchanged everyday.
  • the cells were incubated at 37 ° C , 5% CO 2 in air.
  • the volume of cell culture medium war different depending on the plate types used as shown below.
  • the cells grown to confluence were treated with 1 x Trypsin-EDTA (Gibco, Invitrogen corporation) solution at 37 ° C for 3 min and then washed twice with Dulbecco' ' s Phosphate-Buffered Saline (Gibco, Invitrogen corporation) .
  • Cell colonies detached by 1 X Trypsin-EDTA treatment were dissociated by gentle pipetting and then transferred into the more wider plates for proliferation.
  • the volumes of 1 XTrypsin-EDTA solution used depends on cell culture plate types as shown below
  • the cells grown until confluent in 96-well plates were transferred to 48 well culture plates and then were gradually expanded in 24 well, 12 well, 6 well and 100 mm culture plates.
  • Genomic DNAs were purified from half of the cells in 6 well plates using "AccuPrep Genomic DNA Extraction Kit” (Bioneer) and PCR was carried out using "AccuPower PCR Premix” (Bioneer) .
  • Primer sets for human TPO cDNA and thermal cycling conditions are shown below:
  • Genomic DNAs from each transgenic cell clone were purified using "AccuPrep Genomic DNA Extraction Kit” (Bioneer) and PCR was performed using "AccuPower HL PCR Premix” (Bioneer) .
  • the 5' primer was designed to bind at the 3' end of neo gene within the transfected vector constructs and the 3' primer to bind at the intron 8 of bovine beta casein gene which exists in the endogenous region, not in the vector construct.
  • the gene targeted cell clones showed represented 4 kb PCR products on 1% agarose gel.
  • the sequences of a primer set and thermal cycling conditions are shown below:
  • Two clones identified as gene-targeted by the PCR reactions were analyzed again by the southern blotting.
  • the two cell clones were transferred to two 100 mm culture dishes respectively. Cells were harvested from one of the two dishes, and at least 10 micrograms DNA from each clone was extracted and digested with EcoRl for 16hr at 37 ° C . EcoR I -digested DNA was separated by electrophoresis through a 0.75% agarose gel at 50V in 1 X TAE buffer for 16hr. The DNA was transferred onto nylon membranes positively charged (Boehringer Mannheim) and hybridized with the probe targeting human TPO cDNA in the vector constructs (see FIG. 21) .
  • the probes for southern blotting were prepared with primers of SEQ ID N03 and 4 following the guidelines (Roche) .
  • the PCR reaction was carried out using "PCR DIG labeling mix” (Roche) and "Taq DNA polymerase” (QIAGEN) . Thermal cycling conditions were as below:
  • the gene targeting of the previously identified two clones were confirmed again by the southern blotting (FIG. 22) .
  • the two targeted cell clones are number 81 and number 89 cell lines.
  • the number 81 cell clone was designated as BCTPOKIbESF81 and deposited with the Korean Collection for Type Cultures (KCTC) located in #52, Oun-dong, Yusong-ku, Taejon 305-333, Republic of Korea on Nov 10 2004, under the accession number KCTC-10720BP.
  • KCTC Korean Collection for Type Cultures
  • bEF bovine ear skin fibroblasts
  • the minced tissues were incubated in 10 ml of 0.05% (w/v) trypsin/0.53 mM EDTA solution in an incubator at 38.5"C for 30 min. Trypsin was inactivated by adding an equal volume of cell culture medium supplemented with 10% FBS.
  • the cell culture medium was composed of Dulbecco modified Eagle medium supplemented with 10% FBS, 1000 units of penicillin and 1000 ⁇ g/ml of streptomycin (Gibco BRL) . After vigorous pipetting, the supernatant was centrifuged at 150 Xg for 5 min.
  • the cells were suspended and adjusted to a final concentration of 2 X 10 6 cells/ml, and then were cultured in 10ml culture medium at 37 " C in 5% CO 2 in air in 175-cm 2 tissue culture flasks (Nunc, Roskilde, Denmark) until confluent.
  • the bEF and bESF cells were frozen down in cold Dulbecco' s Phosphate-Buffered Saline solution supplemented with 20% FBS and 10% Dimethyl sulphoxide and frozen at -TO"C for 16hr. The cells were stored in liquid nitrogen until transfection experiment.
  • BCTPOKI I and BCTPOKI Il vectors were introduced into two types of somatic cells: bEF and bESF. It was reported that ovine post-natal fibroblasts persist through longer periods maintaining a relatively stable chromosomal karyotype in culture than in ovine fetal fibroblasts (Williams et al., MoI Reprod Dev. , 66(2);115- 125, 2003) . In this invention, the bESF sustained much longer normal morphologies in in vitro culture than bEF (Table 2) .
  • Example 8 Freezing and thawing of frozen gene-targeted cells
  • the cell freezing medium consisted of DMEM supplemented with 20% FBS and 10% dimethyl sulphoxide (DMSO) .
  • the solution was transferred into 15 ml of tube containing 9 ml of cell culture medium and centrifuged 1000 rpm for 3 min .
  • the cell pellet was resuspended in 3 ml culture medium, plated on 6-well culture plate containing 3 ml of culture medium, and then cultured at 37 ° C in 5% CO 2 in air prior to nuclear transfer .
  • Bovine oocytes obtained from slaughterhouse ovaries were cultured in the maturation medium at 38 . 57 "C in 5% COz in humidified air .
  • the maturation medium consisted of TCM- 199 ( Sigma Chemical Co . ) with Eagle salts and L-glutamine supplemented with 10% (v/v) FBS (Gibco BRL, Grand Island, NY) , 1 ⁇ g/ml estradiol , 1 ⁇ g/ml FSH-P ( Schering-Plough Animal Health Corp . , Kenilworth, NJ) , and 25 mM NaHCO 3 .
  • the oocytes were transferred to 500 ⁇ l of TL-Hepes supplemented with 0 .
  • 1% hyaluronidase and then cumulus of the oocytes were removed by mechanical pipetting .
  • the zonae pellucida of denuded oocytes were partially dissected using a fine glass needle (Tsunoda et al . , J Exp Zool . , 240 ( 1 ) / 119-125 , 1986 ) .
  • Oocytes manipulations such as enucleation and cell inj ection were performed using a micromanipulator equipped with an inverted microscope (Leitz , Ernst Leitz Wetzlar GmbH, Germany) .
  • the medium used for manipulation was TL-Hepes containing 7 . 5 ⁇ g/ml cytochalasin B .
  • a first polar body and partial cytoplasm presumptively containing metaphase Il chromosomes were removed together by using a micropipette with an inner diameter of 20 ⁇ m.
  • Single gene-targeted cells were individually transferred to the perivitelline space of the recipient cytoplast.
  • the cell-cytoplast complexes were equilibrated in a 50 ⁇ l drop of cell fusion medium for 10- 20 sec and then transferred to a fusion chamber with two electrodes lmm apart overlaid with cell fusion medium.
  • the cell fusion medium consisted of 0.3 M mannitol, 0.5 mM Hepes, 0.01% BSA, 0.1 mM CaCl 2 , and 0.1 mM MgCl 2 .
  • the cell- cytoplast complexes were induced to fuse with a single pulse of direct current of 1.6 kV/cm for 20 ⁇ sec by an Electro Cell Manipulator 2001 (BTX, San Diego, CA) . These procedures were performed at room temperature. Reconstructed embryos without visible somatic cells were determined as fused eggs 1 h after the fusion pulse.
  • the fused eggs were activated with 5 ⁇ M ionomycin for 5 min, followed by treatment with 2.5 mM ⁇ -dimethyl-aminopurine in CRlaa medium (Rosenkrans et al., Biol Reprod., 49 (3) ; 459-462, 1993) supplemented with 10% FBS for 3.5 h at 38.5 ° Cin 5% CO 2 In air.
  • the reconstructed embryos were cultured in CRlaa medium supplemented with 1 mM glutamine and 1 X Eagle essential amino acids solution (Gibco BRL) . After culture for 3 days, cleaved embryos were further cultured in each well of a 4-well culture plate containing 750 ⁇ l CRlaa on a mouse embryonic fibroblasts monolayer (with 10% FBS) for 4 days at 38.5 ° Cin 5% CO 2 in air (Park et al., Anim Reprod Sci., 59(1-2) /13-22, 2000) . After 7 days of culture, blastocyst formation was observed.
  • lysis buffer which consisted of 50 mM KCl, 1.5 i ⁇ MgCl 2 , 10 mM Tris-HCl pH8.5. 0.5% Nonidet P40, 0.5% Tween and 400 ⁇ g/ml Proteinase K, and incubated at 65 ° Cfor 30 min. Proteinase K was inactivated at 95 ° C for 10 min (McCreath et al., Nature, 405 (6790) ;1066-1069, 2000) .
  • the first PCR was carried out with primers of SEQ IN Nos 3 and 4 using the "AccuPower PCR Premix" (Bioneer) and then the nested PCR was performed using 1 ⁇ l of the first PCR product.
  • the primers of IN Nos 3 and 7 were used and thermal cycling conditions were as follows:
  • Reverse primer 5' -gagacggacctgtccagaaagctg-3'
  • Figure 23 shows the PCR analysis result of nuclear- transferred embryos from cell clone 81 (FIG. 23)
  • Example 12 Long-range PCR analysis of a fetal membrane derived from a cloned fetus.
  • Reconstructed embryos at the blastocyst stages were transferred to recipients by a non-surgical method.
  • a fetus and fetal membrane were flushed from the uterus of the cow non-surgically using a Foley catheter (Agtech, Manhatan, KS) .
  • the extracted fetus and fetal membrane derived from the fetus were cultured in vitro as described in example 7.
  • the procedures of genomic DNA extraction and long-range PCR analysis are the same as described in example 5 .
  • the transgenic animal which is prepared by implanting a nulear-transf erred embryo introduced with a cell targeted with beta-casein gene targeting vector, can produce biomedically or biotechnically valuable proteins in their milk without lethality during embryonic or post-natal developmental stage by unregulated expression of the foreign proteins .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins; (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid sequences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5'-3' arrangement of beta-casein gene, animal cells which are gene-targeted with the said vector and embryos which are nuclear-transferred with the said animal cells. The present invention also relates to a method for obtaining a desired protein from the milk of transgenic animal which is prepared by implanting the said embryos.

Description

BETA-CASEIN GENE TARGETING VECTOR USING HOMOLOGOUS
RECOMBINATION
Technical Field The present invention relates to beta-casein gene targeting vectors that function through homologous recombination, animal cells that are gene-targeted with the said vectors and embryos that are nuclear-transferred with the said animal cells. The present invention also relates to methods for producing desired proteins from the milk of the transgenic animals that are prepared by implanting the said embryos .
Background Art Our continuous efforts in animal genomics to identify genes and their functions have made it possible to generate transgenic animals. Transgenic animals have been created great commercial value in industries such as biomedicine and agriculture. Various techniques such as microinjection, viral transfection, sperm vector, application of embryonic stem(ES) cells and somatic cell nuclear transfer (SNCT) have also been developed to prepare transgenic animals oi- so called genetically-modified animals.
The microinjection method, which injects a DNA molecule into the male or female pronucleus of fertilized eggs (Harbers et al., Nature., 293(5833); 540-2, 1981; Brinster et al., Cell., 27/223-231, 1981; Gordon et al., Proc Natl Acad Sci USA., 77 (12);7380-7384; Costantini et al., Nature., 294 (5836) ; 92-94) , has been widely employed to produce transgenic animals (Hammer et al., Nature., 315(6021) ; 680-683, 1985; van Berkel et al. , Nat Biotechnol., 20 (5) ,-484-487, 2002; Damak et al., Biotechnology(NY) , 14 (2) ; 185-186, 1996) . However, the efficiency of this technique in the production of transgenic animals is very low in that only 2-3% of the injected eggs give rise to transgenic offspring (Clark et al., Transgenic Res., 9;263- 275, 2000) . The production of transgenic animals using the microinjection method is also a labor-intensive and costly procedure requiring large numbers of animals and facilities (Brink et al., Theriogenology, 53;139-148, 2000) . Another disadvantage of this technique is that it cannot control the integration sites and the copy numbers of the inserted genes. The resulting random integration sometimes leads to a low or nonspecific expression of the transgenes. It was further reported that the unregulated expression of certain transgenes sometimes cause lethality in the embryonic development (Wei et al., Annu Rev Pharmacol Toxicol., 37;119-141, 1997).
The retrovirus-mediated method is also widely used in order to genetically manipulate animals (Soriano et al., Genes Dev., 1 (4) ;366-375, 1987; Hirata et al. , Cloning Stem Cells., 6(1) ; 31-36, 2004) . Under this technique, the desired gene sequences are introduced into the animal genomes by using virus-mediated vectors. Although viral transformation is more efficient than pronuclear injection, random insertion of the foreign genes and mosaicism are entailed due to multiple integrations (Piedrahita et al., Theriogenology, 53 (1) ; 105-116, 2000) . Additionally, the maximum size of the introduced genes is usually limited to approximately 7 kb and there is concerning of the potential interference caused by virally encoded proteins (Wei et al., Annu Rev Pharmacol Toxicol., 37; 119-141, 1997; Yanez et al., Gene Ther., 5 (2) ; 149-159, 1998) .
To circumvent the problems referred to .above, a gene targeting technique that can insert or remove a DNA segment at a specific location was developed. The gene targeting technique was first applied to the mouse embryonic stem cells to study gene function. Mouse embryonic stem cells are now being used to introduce predetermined genetic modifications into embryos. A number of specific gene- targeted mice have been produced through the manipulation of mouse embryonic stem cells using the technique (Brandon et al., Curr Biol., 5 (6) ; 625-634, 1995; Capecchi et al., Science, 244 (4910) ; 1288-1292, 1989; Thompson et al., Cell, 56(2) ;313-321, 1989; Hamanaka et al. , Hum MoI Genet., 9(3) ,-353-361, 2000; Thomas et al, Cell, 51 (3) ; 503-512, 1987; te Riele et al., Proc Natl Acad Sci USA, 89(11);5182- 5132, 1992; Mansour et al., Nature, 336(6197), 348-352, 1988; Luo et al. , Oncogene, 20 (3) ;320-328, 2001) . The extension of this gene targeting method to other mammalian species, particularly livestock, could bring numerous biomedical benefits such as mass production of pharmaceutical proteins and animal disease models.
Until now, most recombinant therapeutic proteins have been produced by cell culture systems, which use cells such as yeast, bacteria or animal cells. However, it is difficult to produce proteins in large scale using cell culture systems because of the limited capacity and high cost. Furthermore, for some proteins, additional steps are required to introduce proper posttranslational modifications such as glycosylation, γ-carboxylation, hydroxylation and so on (Houdebine et al., Transgenic Res., 9 (4-5) ;305-320, 2000; Lubo et al., Transgenic Res., 9(4- 5) ;301-304, 2000) .
Animal bioreactors that produce valuable or therapeutic proteins have been evaluated as efficient and cost-effective expression systems. In particular, the large-scale production of therapeutic recombinant proteins from transgenic animals is much more cost-effective compared to the cell culture system (van Berkel et al., Nat Biotechnol., 20 (5) ; 484-487, 2002) . Recombinant proteins produced in animal milk were known to be post- translationally modified in a way very similar to the human counterpart proteins (Edmunds et al., Blood, 91(12) ;4561- 4571, 1998; Velander et al., Proc Natl Acad Sci USA., 89 (24) ,-12003-12007, 1992; van Berkel et al, Nat Biotechnol., 20(5) ;484-487, 2002) . Cow's milk is composed of approximately 88% water, 3.3% protein and the remaining carbohydrates and fat. The caseins, comprising 80% milk protein, are divided into four groups, alpha Sl, alpha S2, beta and kappa casein. Beta casein is the most abundant protein in milk and is expressed in a concentration of 10mg/ml in bovine milk (Brophy et al., Nat Biotechnology., 21 (2) ; 157-162, 2003) .
The SCNT technique is more efficient way to make transgenic animals compared to the microinjection method because almost all of the cloned animals derived from transformed somatic cells are transgenic animals (Brink et al., Theriogenology, 53;139-148, 2000) . It is also possible to predetermine the sex of animals and create a genetically homogeneous herd in order to produce a uniform product (Lubo et al., Transgenic Res., 9 (4-5) ; 301-304, 2000; van Berkel et al., Nat Biotechnol., 20(5) ;484- 487, 2002) .
Until now, ES cells and vector constructs for targeting a specific gene have been considered as prerequisite elements to generate gene-targetted animals. However, there is a limitation in the use of ES cells from large livestocks, although some studies have developed ES- like cells in pig and cattle (Doetschman et al., Dev Biol., 127 (1) ;224-227, 1988; Stice et al., Biol Reprod., 54 (1) /100-110, 1996; Sukoyan et al., MoI Reprod Dev., 36(2) /148-158, 1993; Iannaccone et al., Dev Biol., 163 (1) /288-292, 1994; Pain et al., Development, 122 (8) ;2339-2348, 1996; Thomson et al. , Proc Natl Acad Sci USA., 92 (17) ,-7844-7848, 1995; Wheeler et al., Reprod Fertil Dev., 6(5) ;563-568, 1994) . Instead, the use of normal somatic cells as nuclear donor cells has been suggested as an efficient and practical method to produce transgenic cattle (Brophy et al., Nat Biotechnol., 21 (2) /157-162, 2003; Cibelli et al., Science, 280 (5367);1256-1258, 1998; Campbell et al. , Nature, 380 (6569) ; 64-66, 1996; Wilmut et al., Experientia, 47 (9) ;905-912, 1997; Denning et al. , Cloning stem cells, 3 (4) ,-221-231, 2001), suggesting the possibility that somatic cells instead of embryonic stem cells can be used for targeting specific genes. With the application of SCNT technique, promoter regions of milk protein genes have been used to direct the expression of recombinant protein in the milk of transgenic large animals (Schnieke et al. Science, 278 (5346) /2130-2133, 1997; Baguisi et al., Nat Biotechnol . , 17 (5) ; 456-461, 1999; Brophy et al., Nat Biotechnol., 21 (2) ; 157-162, 2003) . However, the use of this technique in farm animals is still not practical unless the problems of low expression and/or ectopic expression due to the random insertion of genes are solved. The ectopic expression of foreign protein causes early embryonic lethality and is particularly severe in nervous system, as most nervous system structures develop in late embryonic and early postnatal stages (Gao et al., Neurochem Res., 24 (9) ; 1181-1188, 1999) . To eliminate or reduce these side-effects, a new method that allows the foreign protein to be expressed only during the lactation period and strictly in the mammary gland have been invented
(Houdebine et al., Transgenic Res., 9 (4-5) ; 305-320, 2000) .
Gene-targeting, known as the introduction of site-specific modification into a genome by homologous recombination event, is a powerful tool for tissue-specific expression of recombinant proteins (Muller et al., Mech Dev. , 82(l-2);3- 21, 1999; Clark et al., J Mammary Gland Biol Neoplasia., 3(3) ;337-350, 1998) .
The generation of a first knock-in ovine has opened the door to make it possible to produce therapeutic foreign protein-targeted large animals (McCreath et al. , Nature.■ 405 (6790) ;1066-1069, 2000) . The COLT-2 targeting vector which has homology regions for COLlAl gene that is highly expressed in fibroblasts was developed, allowing the promoter-trap enrichment of gene-targeting events. AATC2 trasgene comprised of human αl-antitrypsin (AAT) complementary DNA within an ovine beta-lactoglobulin (BLG) expression vector was designed to direct expression in the mammary gland, having separate transcription unit. The amount of AAT secreted from targeted lambs was 37-fold more than that from the sheep with multiple and random integration of the genes (McCreath et al., Nature, 405 (6790) ; 1066-1069, 2000) . Thus, gene targeting is now regarded to be the most powerful method to produce large amount of therapeutic protein. However, the application of the promoter-trap targeting vector is limited to transcriptionally active genes in the somatic cells. In general, transcriptionally active genes are more amendable to gene targeting than silent genes because they have a higher frequency of homologous recombination (Kuroiwa et al., Nat Genet., 36 (7) ;775-780, 2004) .
Milk proteins are expressed in a tissue-specific manner in the mammary gland. An over-expression of foreign protein is possible without causing lethality in embryonic or post-natal development by manipulating a gene coding of the milk proteins. Among such proteins, beta-casein would be one of the best candidates since it is expressed abundantly. The bovine beta-casein exists as a single copy gene in total genome and is not known to be expressed in the somatic cells except for those in the mammary gland. The targeting of foreign genes into the beta-casein gene, which is not expressed in the normal somatic cells, cannot be carried out by vectors utilizing the promoter trap.
Based on this background, the present inventors have created targeting vector cassettes specific for the beta- casein gene, vectors inserted with a foreign gene using the said cassette, animal cells introduced with said vectors, and nuclear-transferred embryo with the said animal cells. The present inventors found that the foreign genes were correctly targeted to the beta casein gene of genomic DNA.
Summary of the Invention
It is an object of the present invention to provide a beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins/ (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid seguences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5' -3' arrangement of beta-casein gene.
It is another object of the present invention to provide an animal cell which is gene-targeted with the above beta-casein gene targeting vector.
It is another object of the present invention to provide an embryo which is nuclear-transferred with the above animal cell.
It is another object of the present invention to provide a method for preparing a nuclear-transferred embryo,, which comprises the steps of introducing the above vector into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; and introducing the gene-targeted cell into a nuclear-removed animal embryo to produce nuclear-transferred embryo with the gene-targeted cell.
It is yet another object of the present invention to provide a method for preparing a desired protein from milk, which comprises the steps of introducing the above vector into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; introducing the gene-targeted cell into a nuclear-removed animal embryo; implanting the embryo into a milk-producing animal to produce a transgenic animal; and producing milk from the transgenic animal.
Brief Description of Drawings
FIG. 1 depicts 18.8kb pBCKI I vector cassette targeting the bovine beta-casein gene, derived from a pBluescript Il SK(+) plasmid. The vector also includes Sac II, Not I , and BamH I restriction sites in front of neo gene and BamH I site at the back of short arm region. FIG. 2 depicts 14.8 kb pBCKI Il vector cassette targeting the bovine beta-casein gene, derived from a pGEM7Zf(+) plasmid.
FIG. 3 shows homologous recombination between pBCKI I vector and beta-casein gene in genome. Double crossover results in the replacement of the endogenous beta-casein gene with the sequences in the vector cassette .
FIG . 4 shows homologous recombination between pBCKI I l vector and beta-casein gene in genome. A partial sequence of beta casein gene locus in genome is replaced with a partial sequence in vector cassette as result of a double crossover event.
FIG. 5 shows PCR screening strategy used to identify gene targeting events at the bovine beta-casein locus and the DNA sequences spanning the junctions of the targeted beta-casein locus and the restriction sites in the targeting vector cassettes. The upper portion shows the approximate position of two primers used to amplify the 4 kb fragment, from the neo gene region unique to the beta- casein gene targeting vectors to the region endogenous beta-casein locus which is not used in the vector cassettes. Sequence A shows a portion of DNA sequence spanning the junction between the long arm region and the neo gene. Sequence B shows a portion of DNA sequence spanning the junction between the neo gene and the short arm region. The position and orientation of the 5' PCR primer is shown. Sequence C shows a portion of DNA sequence spanning the junction between the short arm region and the endogenous beta-casein gene locus which is excluded from the BCKI I and BCKlII vectors. The position and orientation of the 3' PCR primer is shown.
FIG. 6 shows the pBClO vector constructed in our previous study (Kim et a 1., J Biochem (Tokyo) . , 126(2) ;320-5, 1999) . The pBClO vector is based on a pBluescript Il SK vector backbone and includes the bovine beta-casein promoter region, which is 10kb in length. The promoter region contains 8 kb of the 5'-flanking sequence of gene, the untranslated exon 1 and 2 (vertical open boxes), and 2 kb of intron 1 of bovine beta-casein gene. The promoter has restriction enzyme sites for Sac I , Aatll , and Sac II , but there is no recognition sequences of other restriction enzymes such as Sraa I , BamH I , Sal I , Spe I and CIa I .
FIG. 7 shows the isolated 10 kb DNA fragment from the pBClO vector digested with Sac I and Sac Il restriction enzymes. The isolated 10 kb DNA fragment is used for long arm of the pBCKI I vector cassette.
FIG. 8 shows the isolated 6 kb DNA fragment from thvϋ pBClO vector digested with Aatll and Sac Il restriction enzymes. The isolated 6 kb DNA fragment is used for long arm of the pBCKIII vector cassette.
FIG. 9 shows construction procedures of the pBC3.1 vector applied for the short arm of pBCKI I and pBCKI Il vector cassettes. The 3.2 kb DNA fragment including exon 5, 6, 7 and 8 of a bovine beta-casein gene was prepared by PCR amplification using the primer set which has Xho I and Sal I sites (bold characters) from the bovine chromosomal DNA. The amplified PCR fragment was digested with Xho I and Sal I restriction enzymes and then ligated into the Sal I restriction enzyme site of pGEM-T vector (Promega) . The 3.2 kb DNA fragment in the pGEM-T vector was digested with Hincll and Sal I restriction enzymes and then ligated into Sai l site of pBluescript Il SK(+) vector.
FIG. 10 shows the procedure obtaining the neo gene including the SV40 ori, the early promoter, the neomycin resistance gene, the SV40 early splicing region and polyadenylation site from a pMAMneo vector (CLONTECH) . The 2.7 kb neo gene fragment digested with BamH I restriction enzyme was ligated into BamH I site of pBluescript Il SK(+) vector. The 2 kb DNA fragment of the neo gene in a pBluescript Il SK(+) vector was digested with BgIlI and BamH I restrction enzymes and ligated into BgI Il site of pSP73 vector (Promega) . The 2 kb fragment of a pSP73 vector digested with BgIlI and EcoRV restriction enzymes was then re-ligated into BgIlI and EcoRV sites of the pBluescript Il SK(+) vector containing the 0.7 kb neo gene to generate the pneo2.7 vector construct.
FIG. 11 shows the construction procedures of the
BCKI I and BCKIlI vector cassettes. The DNA fragments corresponding to a positive selection marker and short arm in pBluescript IISK(+) were digested with respective restriction enzymes, and then ligated into the BamH I , EcoRY and Sai l site of pBluescript Il SK (+) vector harboring pBClO DNA fragment. The resultant pBCKI I vector includes the 10 kb long arm, the selection marker gene and the short arm. To shorten long arm length of the pBCKI I , the DNA fragment digested with Aatll and Sal I restriction enzymes was ligated into Aatll and Xho I sites of pGEM7Zf(+) vector. The resultant pBCKIII vector includes the 6 kb long arm, the neo gene, and the short arm.
FIG. 12 shows introduction of a valuable gene into the pBCKI I vector. As an example of the genes for therapeutic proteins, human thrombopoietin (hTPO) cDNA was inserted into the invented pBCKI I vector cassettes. The 1.0 kb of the hTPO cDNA coding for the full length form was amplified by PCR in our previous study, and the poly(A) additional signal sequence of the bovine growth hormone (bGH) gene, which is 300bp in length, was ligated into the Kpn I site to downstream of the hTPO cDNA fragment (Sohn, DNA Cell Biol., 18 (11) ;845-852, 1999) . The 1.3 kb DNA fragment including hTPO cDNA and bGH gene was inserted into Sac Il and Not I sites of the pBCKI I vectors, generating the 20.1 kb pBCTPOKI I vector construct.
FIG. 13 shows introduction of the hTPO cDNA into pBCKIII vector cassette. The resultant 16.1 kb pBCTPOKI Il construct was generated and the procedures were the same as described in FIG. 12.
FIG. 14 shows the linearized pBCTPOKI I vector to be used for transfection after Sal I digestion.
FIG. 15 shows the linearized pBCTPOKI Il vector to be used for transfection after Aat Il digestion.
FIG. 16 is photographs showing morphologies of bovine embryonic fibroblasts (bEF) and bovine ear skin fibroblasts (bESF) . A and B are non-transfected (normal) cells, bEF and bESF, respectively, cultured to confluence. C and D show the colony formed after transfection of the targeting vector into bEF and bESF, respectively. After the targeting vector which has antibiotic resistance gene, neo gene, is introduced into bEF and bESF using the Lipofectamine™ 2000 reagent (Invitrogen) method, the transfected cells were treated with G418 (Gibco, Invitrogen corporation) and then only the survived colonies were subject to analyses of the inserted foreign genes.
FIG. 17 shows PCR analysis of the survived colonies after pBCKI Il transfection. The positive signals for the
500 bp PCR fragment indicated by an arrow represent transfected cell clones, were denoted as λλ+" and the negative signals were denoted as "-". The pBCTPOKI Il vector of the present invention was used as a positive control and the PCR was amplified with the primers specific for hTPO gene.
FIG. 18 and FIG. 19 depict construction procedures of the piieoBC3.7 vector to be used as the control for long- range PCR analysis. The 591bp DNA fragment harboring intron 8 and exon 9 corresponding to bases 7888 to 8479 of bovine beta-casein gene was prepared separately by PCR amplification using a primer set from the bovine chromosomal DNA. The 3' primer has Xho I site depicted as bold characters. The amplified PCR fragment was ligated into pGEM-T vector to generate the pBC591 vector construct. The pBC591 vector was digested with Sal I and Xho I restriction enzymes, and then the resultant DNA fragment was ligated into Sal I site of the BC3.1 vector. At the same time, the pneo2.7 vector digested with BamH I and ECORV restriction enzymes, and then the resultant DNA fragment was ligated into the BC3.1 vector digested with BamH I and EcoRV restriction enzymes to generate the pneoBC3.7 vector. The arrows show primer set for 4 kb long-range PCR analysis.
FIG. 20 shows the results of long-range PCR analyses of the colonies transfected with BCTPOKlII . The positive signals for the 4 kb indicated by arrows represent targeted cell clones, were detected in two colonies, "81" and "89", and the other colonies showed negative signals (-) . The prieoBC3.7 vector was used as a positive control.
FIG. 21 shows strategy for Southern blot analysis to identify the targeted nucleic acid sequences. The BCTPOKIlI vector and purified genomic DNAs from transfected cell clones were digested with EcoRI. The size of DNA fragments from BCTPOKIlI vector (A) and genomic DNA (B) digested with the EcoR I restriction enzyme are 9.2 kb and 9.9 kb, respectively. The bar under the hTPO gene represents the locus of the probe used for Southern analysis. 500 bp fragments of hTPO cDNA used for the probe were amplified by
FIG. 22 shows identification of targeted colonies by Southern blot analysis. Two colonies, 81 and 89, were identified to be targeted at the endogenous bovine beta- casein gene locus with the vector of the present invention. The targeted colonies represented the 9.9 kb fragment and the other colonies, 97, 47, 43 and 34, did not show any signal. The bovine genomic DNAs was used at the various concentrations as a negative control and the 9.2kb fragments derived from the BCTPOKI Il vector on various concentrations were used as a positive control.
FIG. 23 shows PCR analysis of nuclear-transferred embryos from 81 cell clone. The positive (+) signals, 356 bp in length, implied that the cloned embryos derived from the somatic cells that were targeted with the vector of the present invention. The pBCTPOKlll vector was used as a positive control. And nested PCR was also performed to re¬ confirm the positive signals.
FIG. 24A is a photograph showing a 89 cell clone derived fetus enclosed with a fetal membrane collected at 36 days of gestation.
FIG. 24B and 24C are photographs showing the fetal membrane-removed fetus and cells derived from the fetal membrane, respectively. FIG. 24D shows the result of the long-range PCR 01 cells derived from the fetal membrane. The positive signals for the 4 kb indicate that cells, genetically identical to the cloned fetus, were targeted with the vector of the present invention. The pneoBC3.7 vector was used as a positive control.
Detailed Description of the Invention
In an aspect, the present invention relates to a beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins; (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid sequences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5' -3r arrangement of beta-casein gene.
The term "gene targeting vector", as used herein, means a vector that can remove or insert a desired gene to a specific-genomic locus and that includes a nucleic acid sequence homologous to a particular gene for homologous recombination. A gene targeting vector of the present invention is a beta-casein targeting vector which inserts nucleic acid sequences coding desired proteins to beta- casein gene in genome in the 5' -3' arrangement. The terms, vectors and vector cassettes are used herewith interchangeably, and the vectors can be either circular or linear form.
The beta-casein targeting vector of the present invention comprises a first region and a second region that are homologous to the sequences of the beta-casein gene that are located before and after the cloning site. The first region corresponds to the long arm and the second region corresponds to the short arm. "A first region" of herein, is characterized by having a length of 5 to 12kb which has a DNA sequences homologous to the promoter and its flanking sequences of beta-casein gene. Bovine beta-casein gene promoter has been known to be a good promoter to induce high expression of a foreign protein (Kim et al., J Biochem(Tokyo) ., 126 (2) ; 320-325, 1999) . The length of a first region is an important parameter to determine the gene targeting efficiency. Preferably, it is of 5.5 kb to 10 kb, and more preferably, it is 6 kb. "A second region" of herein, characterized by having a length of 2 to 4kb which is homologous to a DNA sequence of beta-casein gene. 2.5 kb to 3.5 kb is preferable as a length. The first region is located upstream to the second region in the 5' -3' arrangement of beta-casein gene. The targeted beta-casein genes are not particularly limited but preferably are those of bovine, sheep, goats, pigs, horses, rabbits, dogs or monkeys, and more preferably a bovine beta-casein gene.
The term "homology", as used herein, means the degree of similarity between nucleic acid sequences of the first region or a second region and the endogenous beta-casein gene sequences corresponding to these first and second regions. The sequences are homologous to each other when the sequences exhibit at lest 90%, preferably at Ieast95% sequence identity.
The term " (multiple) cloning site", as used herein, means a nucleic acid sequence comprising at least two distinct nucleotide sequence specifically recognized and digested by restriction enzymes to permit insertion of nucleic acid sequence coding desired proteins.
A desired protein, which can inserted to the MCS on a vector of the present invention, may includes all proteins having medical or industrial application, such as hormones, cytokines, enzymes, coagulation factors, carrier proteins, receptors, regulatory proteins, structural proteins, transcription factors, antibodies, antigens, etc.
Specific examples of the desired proteins include, but not limited to, thrombopoietin, human growth hormone, growth hormone releasing hormone, growth hormone releasing peptide, interferons, interferon receptors, colony- stimulating factor, glucagon-like peptides, G-protein- coupled receptor, interleukins, interleukin receptors, enzymes, interleukin binding proteins, cytokine binding proteins, macrophage activating factor, macrophage peptide, B cell factor, T cell factor, protein A, suppressive factor of allergy, cell necrosis glycoprotein, immunotoxin, lymphotoxin, tumor necrosis factor, tumor inhibitory factor, transforming growth factor, alpha-1 antitrypsin, albumin, alpha-lactalbimin, apolipoprotein-E, erythroprotein, hyper- glycosylated erythroprotein, angiopoietins, hemoglobin, thrombin, thrombin receptor activating peptide, thrombomodulin , factor VII , factor Vila, factor VIII, factor IX, factorX III, plasminogen activator, fibrin binding protein, urokinase, steptokinase, hirudin, protein C, C- reactive protein, renin inhibitor, collagenase inhibitor, superoxide dismutase, leptin, platelet derived growth hormone, epithelial growth factor, epidermal growth factor, angiostatin, angiotensin, osteogenic growth factor, osteogenesis stimulating protein, calcitonin, insulin, atriopeptin, cartilage inducing factor, elcatonin, connective tissue activator protein, tissue factor pathway inhibitor, follicle stimulating hormone, luteinizing hormone, FSH releasing hormone, nerve growth hormone, parathyroid hormone, relaxin, secretin, somatomedin, insulin-like growth factor, adrenocorticotrophic hormone, glucagon, cholecystokinin, pancreatic polypeptide, gastrin releasing peptide, corticotropin releasing factor, thyroid stimulating hormone, autotaxin, lactoferrin, myostatin, receptor, receptor antagonist, cell surface antigen, virus- derived vaccine antigen, monoclonal antibody, polyclonal antibody, and so on.
The term "selection marker", as used herein, is required for selecting transformed cell with the vector. The selection marker gene confers resistances to drugs, nutritional requirement and cytotoxic drugs, or induces* selectable phenotype such as fluorescence and a color deposit. There is a positive selection marker and a negative selection marker. "Positive selection marker" makes cell expressing positive selection markers to survive against selective agent, so that be capable of conferring positive selection characteristic for the cell expressing that marker. The positive selection marker includes, but not limited to, neomycin, hygromycin, histidinol dehydrogenase, guanine phosphosribosyltransferase, and so on.
The positive selection marker of the invention has independent promoter and poly A. The promoter regions include, but not limited to, simian virus 40 (SV40) , mouse mammary tumor virus (MMTV) , human immunodeficiency virus (HIV), particularly, long terminal repeat (LTR) region promoter, moloney virus, cytomegalovirus (CMV) , epstein- barr virus (EBV) , and respiratory syncytial virus (RSV) promoter, beta-actin promoter and promoter derived from human hemoglobin, human muscle creatine, and human metallothionein.
The vector of the invention could comprise negative selection marker as additional component. "Negative selection marker" removes cells with random-integration, so that be capable of conferring negative selection characteristic for the cell expressing that marker. The negative selection marker includes, but not limited to, herpes simplex virus-thymidine kinase (HSV-tk) , hypoxanthine phosphoribosyl transferase (Hprt) , cytosine deaminase, diphtheria toxin, and so on. The negative selection marker locates at the 5' terminus of a first DNA sequence or the 3' terminus of the second DNA sequence.
The nucleic acid coding the desired protein is integrated to a beta-casein gene locus of cellular genomic DNA in host cell by homologous recombination, and is expressed in the cell instead of the endogenous beta-casein protein.
The efficiency of gene integration of the nucleic acid coding a desired protein into a beta-casein gene locus of cellular genomic DNA has been shown to have relation with the targeting vector system, especially with the degree of similarity and length of nucleic acid sequences of homologous regions (Scheerer et al., MoI Cell Biol., 14(10)6663-6673, 1994/ Thomas et al. , Cell, 51 (3) ;503-512, 1987; Hasty et al. , MoI Cell Biol., 11 (11) ; 5586-5591, 1991; Lu et al., Blood, 102 (4);1531-1533, 2003) . The present invention maximized the efficiency by optimizing the position and length of homologous region of the first and second regions. Indeed, the present vector system induced homologous recombination events even in the somatic cells that are transcriptionally silent, leading to the stable integration of the foreign protein gene into a beta-casein gene locus .
In a preferred embodiment of this invention, BCKI I and BCKlII were prepared as targeting vectors. pBCKI I vector, about 18.8kb in length, was derived from pBluescript Il SK(+) plasmid. The first region of pBCKI I vector is about 10kb in length and it includes 8 kb sequences harboring bovine beta-casein promoter, exon 1, intron 1 and exon 2 of the bovine beta-casein gene. A second region of pBCKI I vector is about 3.1 kb in length and it includes exons 5-8, introns 5-7 and a portion of intron 4 and 8 as shown in Fig. 2. The pBCKI I vector includes a neo gene as a selection marker, SV40 early promoter and polyA sequences. The pBCKI I vector includes three restriction enzymes sites (Sac II, Not I and BamH I), for the insertion of nucleic acid coding desired proteins as shown in Fig. 1. pBCKll vector, about 14.8kb in length, was derived from pGEM7Zf(+) plasmid. The first region of pBCKI Il is about 6kb in length and it includes bovine beta-casein promoter having a length of about 4kb and axon 1, intron 1 and exon 2 of the bovine beta-casein. A second region of pBCKI Il vector is about 3.1 kb in length and includes exons 5-8, introns 4-7 and a portion of intron 4 and 8 as shown in Fig. 2. The pBCKI Il vector includes a neo gene as a selection marker gene, SV40 early promoter and polyA. The pBCKI Il vector includes three restriction enzymes sites (Sac II, Not I and BamH I), for the insertion of nucleic acid coding desired proteins as shown in Fig. 1.
The targeting vectors according the present invention can be prepared using general DNA recombination techniques. Site-specific cleavage and ligation can be accomplished by using the enzymes known to the art. In a specific embodiment, human thrombopoietin (TPO) gene was inserted into BCKI l and BCKlII (Fig 3 and 4) . The 1 kb human TPO cDNA fragment flanked by 0.3 kb fragment of bovine growth hormone (bGH) gene was constructed (Sohn et al., DNA Cell Biol., 18 (11) ;845-852, 1999) . The bGH gene was inserted to encode s stable messenger RNA.
Human thrombopoietin is one of the major hemopoietic regulators participating in series of megakaryocytopoiesis, that is, proliferation and differentiation of megakaryocytes inducing production of platelets. As a primary physiological regulator of platelet production, it plays a pivotal role in promoting the proliferation and maturation of megakaryocytes. Severe neutropenia and thrombocytopenia are seen in patients undergoing aggressive chemotherapy and bone marrow transplantation for hematologic malignancies and solid turners (Lok et al., Stem Cells, 12 (6) /586-598, 1994; Kaushansky et al., Stem Cells, 15 (1) ; 97-102, 102-103, 1997; Kaushansky et al., Ann Intern Med., 126 (9) ;731-733, 1997; Kaushansky et al. , Leukemia, 11 (3) ;426-427, 1997; Kaushansky et al., Annu Rev Med., 48;1-11, 1997) . It was confirmed that recombinant TPO has ability to ameliorate thrombocytopenia in animal models so that showed the potential use for therapeutic purpose. The safety and efficacy of TPO was approved in Phase I clinical trials (Fanucchi et al., N Engl J Med., 336 (6) ;404-409, 1997; Basser et al., Lancet., 348 (9037) ;1279-1281, 1996; O'Malley et al. , Blood, 88 (9) ; 3288-3298, 1996) . It also appears that TPO could be used to enhance the recovery of platelet production in myelosuppressed patients undergoing cancer chemotherapy. Among the above two vectors, pBCKI II vectors harboring the first region having a length of 6kb are more efficient in targeting to the beta-casein gene in genome.
In another aspect, the present invention relates to an animal cell which is gene-targeted with the above vectors.
A cell targeted with a vector of the present invention is derived from eukaryotes, and can be primary, secondary, or permanent cells. Preferably, the cells are derived from cattle, sheep, goats, pigs, horses, rabbits, dogs, monkeys, and so on, but not limited to. Useful tissues capable of detaching or activating cells are, but not limited to, livers, kidneys, spleens, bones, marrows, thymuses, hearts, muscles, lungs, brains, seminal glands, ovaries, islets, intestines, ears, skins, pancreatic tissues, prostate glands, bladders, embryos, immune systems, hematopoiesis systems, and so on. And cell types are, but not limited to, fibroblasts, epithelial cells, nerve cells, embryonic cells, liver cells, ovarian follicle cells, and so on.
A transfection method of the vector includes any method of introducing a nucleic acid into the cell, and the transfection can be carried out using an appropriate technigue well known in this art. The transfection methods include, but not limited to, electroporation, calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran, cationic liposome transfections and so on. When transfection, a linear form of vectors, which is digested with a restriction enzymes, is more preferable than a circular form vectors, is exemplary.
In particular, a beta-casein targeting-vector inserted with a human thrombopoietin (hTPO) was introduced into bovine embryonic fibroblasts (bEF) and bovine ear skin fibroblasts (bESF) using Lipofectamine™ 2000 reagent (Invitrogen) . Cationic liposome interacts efficiently with negative charged DNA and the DNA-liposome complexes are associated with the cell membrane, thereby leading to DNA internationalization. Insertion of the gene-targeting vector into a specific gene was detected and confirmed by a long range PCR and a southern blot assay from the colonies survived after the treatment with antibiotics. Using the procedures, clones derived from bESF cells targeted witl: hTPO at the beta-casein gene were obtained. An exemplary clone was deposited with the international depositary authority as KCTC 10720BP.
In another aspect, the present invention relates to an embryo which is nuclear-transferred with the said animal cell.
"Nuclear transfer" is a process that genetic material of the nuclear donor cells is transferred into the enucleated oocytes. The nuclear transfer technique makes it possible to produce genetically identical animal clones because genetic material of the same donor cell is transferred into the recipient cytoplast.
In another aspect, the present invention relates to a method for producing a nuclear-transferred embryo, which comprises the steps of introducing the vector according to the present invention into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; and introducing the gene-targeted cell into a nuclear-removed animal embryo to produce nuclear-transferred embryo with the gene-targeted cell.
To remove the genetic materials of the oocytes, various methods such as physical enucleation, chemical treatment and centrifugation with Cytochalasin B treatment are employed (Tatham et al., Hum Reprod., 11 (7) ; 1499-1503, 1996) . In this invention, the physical enucleation method using a glass micropipette was used.
A gene-targeted somatic cell is introduced into a nuclear-removed animal embryo by using the techniques such as cell fusion method and intracytoplasmic cell injection (ICCI), etc. The cell fusion method is simple and useful for large production of embryos. The ICCI method permits maximum exposure of a nucleus isolated from donor cells to the cytosol in recipient cytoplasts.
The fusion of somatic cell and enucleated oocyte is accomplished by changing charges on cell surface by electric pulse. It is convenient to use an electro-cell manipulator that the pulse length and voltage are easily controllable.
In another aspect, the present invention relates to a method for producing a desired protein from milk, which comprises the steps of introducing the vector according to the present invention into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; introducing the gene-targeted cell into a nuclear-removed animal embryo; implanting the embryo into a milk-producing animal to produce a transgenic animal; and producing milk from the transgenic animal.
The nuclear-transferred embryos are activated and developed in vitro to the blastocyst stage and then and then implanted to recipients .
The activation of cloned embryo induces reinitiation of cell cycle, which is temporarily quiescent, whereby the cleavage of embryo is possible. To activate a cloned embryo, the activation of cell cycle arrest factors, such as maturation-promoting factor (MPF) , mitogen-activated protein (MAP) kinase, and so on, should be suppressed, wherein for the suppression of the activation, the increase of intracellular calcium ion in a cloned embryo is necessary. The activation of cell can be accomplished by the dramatic increase of calcium influx induced by electro¬ stimulation or chemical treatment such as ionomycin, 6- dimethylaminopurine (6-DMAP), and so on, wherein the above methods can be used independently or together. In the present invention, the reconstructed embryos were treated with ionomycine+6-DMAP and developed in vitro to a blastocyst stage.
As a result, cloned offspring which can express desired proteins during lactation period are generated. Using the transgenic animals produced by the targeting vector systems of the present invention, desired proteins can be obtained in large quantity from the milk without causing severe lethality during the embryonic or post-natal development. The desired proteins expressed in milk can be purified using conventional methods such as salting out
(examples: ammonium sulfate precipitation; sodium phosphate precipitation), solvent precipitation (example: protein fraction precipitation using acetone, ethanol and so on) , dialysis, gel filtration, ion exchange, column chromatography such as reverse column chromatography, ultra filtration, combinations thereof, and so on (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA(1990))
Hereinafter, the present invention will be described in detail referring to the following examples. However, the examples according to the present invention can be modified in other forms, and the scope of the present invention is not limited to the following examples.
Example 1 - Gene targeting vector construction
In this invention, we employed a bovine beta-casein gene promoter locus which direct expression of foreign therapeutic genes in the milk.
The pBC 10 vector construct (FIG. 6) as previously described (Sohn et al., J Biotechnol., 103 (1) ; 11-19, 2003) contains a 8 kb promoter of 5' -flanking sequence, the entire exon 1 and 2 kb intron 1 and 5'-UTR of exon 2 of the bovine beta casein in a pBluescript Il SK(+) plasmid
(Stratagene) . The beta-casein gene region of the pBC 10 vector was used as a long arm (a first DNA region) of two invented vector cassettes, BCKI I and BCKIlI . As shown in
FIG. 7, a 10 kb beta-casein gene could be digested with Sac I and Sac Il restriction enzymes and it was used as a long arm (a first DNA sequence) of the BCKI I vector cassette (FIG. 11) . A 6 kb beta-casein promoter region (FIG. 8) digested with Aatll and Sac Il restriction enzymes, including 4 kb promoter, untranslated exon 1, 2 and intron 1 of the bovine beta-casein gene, was used as a long arm (a first DNA sequence) of BCKlII (FIG. 11) .
The BC3.1 vector (FIG. 9) was constructed to utilize as a short arm of the vector cassettes of the invention. The 3.2 kb DNA fragments of the bovine beta-casein gene sequence (4676 to 7898), containing exons 5, 6, 7, 8 and introns 5, 6, 7 and partial introns 4 and 8, was amplified by PCR using bovine genomic DNA as the template. Sequences of the primers used for the PCR reaction are as follows:
SEQ ID No 1:
Forward primer : 5 ' - attcagtcgagtggaacataaactttcagcc - 3 '
SEQ ID No 2 :
Reverse primer: 5' - catatgtcgactgtgagattgtattttgact - 3'
Bold characters of the primer sequences depict that some bases were changed to generate Xho I and Sal I restriction enzyme sites.
The PCR product (FIG. 9) was digested with Xho I and Sal I restriction enzymes and ligated into the Sal I site of pGEM-T (Promega) . To generate enzyme sites to insert into pBClO vector, the 3.2 kb bovine beta-casein gene fragment in pGEM-T was digested with Hincll and Sal I restriction enzymes. The resultant 3.1 kb fragment was ligated into Sal I site of pBluescript Il SK(+) to generate the BC3.1 vector.
The neo gene fragment utilized as a selection marker also was inserted into pBClO vector. To obtain the neo gene fragments including the SV40 ori, early promoter, the SV40 early splicing region and polyadenylation regions, a pMAMneo vector (CLONTHECH) was digested with Bam H ) restriction enzyme (FIG. 10) . First, the resultant 2.7 kb DNA fragment was ligated into Bam H I site of the pBluescript Il SK(+} . Second, the 2 kb neo gene fragment in the ligated vector was digested with BgI Il and Bam H I restriction enzymes and then ligated into BgIlI site of the pSP73 (Promega) . Finally, the 2 kb neo gene fragment in the pSP73 was digested with BgIlI and EcoRV restriction enzymes and then re-ligated into the BgIlI and EcoRV sites of the pBluescript Il SK(+) harboring the 0.7 kb pMAMneo gene fragment. These DNA digestion and ligation steps were required for inserting the 2.7 kb neo gene fragment into the pBClO vector (FIG. 10) .
As shown in FIG. 11, pBCKI I and pBCKI Il vector cassettes were accomplished by assembling pneo2.7 and pBC3.1 gene fragments into the pBClO vector. The neo gene in pBluescript Il SK(+) was digested with Bam H I and EcoRV restriction enzymes and then ligated into Bam H I and EcoRV sites of the pBClO vector. The pBC3.1 vector was digested with EcoRV and Sal I restriction enzymes and then ligated into EcoRVand Sal I sites of the pBClO vector including the ligated pMAMneo gene fragment to generate the pBCKI I vector cassette. The pBCKI I vector cassette was digested with Aatll and Sal I restriction enzymes and ligated into Aatll and Xho I sites of the pGEM-7Zf (Promega) to generate the pBCKlll vector cassette. Therefore, the pBCKI I and pBCKIII vector cassettes were constructed.
The fidelity of the targeting-vector cassettes was confirmed again by DNA sequencing and enzyme mapping on a1,1 regions of synthetic DNAs and all junctions of the ligated DNA fragments. Example 2 - Construction of pBCTPOKI I and pBCTPOKlll
As shown in FIG. 12 and 13, the 1 kb Human TPO cDNA plus 300bp bovine growth hormone was inserted pBCKI I and pBCKlll vector cassettes. The 1.3 kb foreign gene harboring Sac Il and Not I sites was ligated into the Sac Il and Not I sites of the pBCKI 1 and pBCKI I) vectors, respectively, thereby generating the targeting vectors, named as pBCTPOKI I and pBCTPOKI Il .
Example 3 - Transfection of BCTPOKI I and BCTPOKIlI vector constructs into bovine embryonic fibroblasts (bEF) and bovine ear skin fibroblasts (bESF)
The plasmid DNAs, pBCTPOKI I and pBCTPOKlll, were purified by using "QIAfilter Plasmid Midi kits" (Qiagen) and then closed circular DNAs were isolated by an equilibrium centrifugation in CsCl-ethidium bromide gradient. The isolated pBCTPOKI I and pBCTPOKlll plasmids were linearized by digestion of Sal I (FIG. 14) and Aatll
(FIG. 15) restriction enzymes, respectively, and then purified by ethanol precipitation. Finally, the concentrations of the purified DNAs were determined by using a spectrophotometer.
The linearized pBCTPOKI I and pBCTPOKlll constructs were introduced into the bEF and bESF at passage 2 or 3 by using Lipofectamine 2000 reagent (Invitrogen) . For bEF, we tested three different transfection reagent volumes such as 2, 4 and 10 μl, and two different DNA concentrations such as 2 and 4 μg. For bESF, 2, 4 and 10 μl transfection reagent volumes and 1, 2 and 4 μg DNA concentrations were tested. The somatic cells were exposed to the transfection reagent-DNA complexes for 24 h.
The somatic cells were cultured in Dulbecco Modified Eagle Medium (Gibco, Invitrogen corporation) supplemented with 10% FBS (Hyclone), 0.001% Gentamicine . (Gibco, Invitrogen corporation) and 1% MEM Non-Essential Amino Acid (Gibco, Invitrogen corporation) and the culture medium was exchanged everyday. The cells were incubated at 37 °C , 5% CO2 in air. The volume of cell culture medium war different depending on the plate types used as shown below.
96 well 48 well 24 well 12 well 6 well 100 mm dish
0. 2 ml 0. 5 ml 1. 0 ml 1. 5 ml 3 ml 10 ml
The cells grown to confluence were treated with 1 x Trypsin-EDTA (Gibco, Invitrogen corporation) solution at 37 °C for 3 min and then washed twice with Dulbecco'' s Phosphate-Buffered Saline (Gibco, Invitrogen corporation) . Cell colonies detached by 1 X Trypsin-EDTA treatment were dissociated by gentle pipetting and then transferred into the more wider plates for proliferation. The volumes of 1 XTrypsin-EDTA solution used depends on cell culture plate types as shown below
Figure imgf000034_0001
The procedure of the experiment is shown below: Day 1 5.5 XlO5 bEF cells and 3.6X105 bESF cells at passage 2 or 3 onto 6-well culture plates were transfected with the linearised BCTPOKI I and BCTPOKI Il DNAs using Lipofectamine 2000 reagent (Invitrogen) in 2rαl of OPTI- MEM I Reduced Serum Medium (Gibco, Invitrogen corporation) according to the procedure recommended by the manufacturers.
Day 2 Transfected cells were split into two 100 mm culture dish and further cultured .
Day 3 0.8 -1.5 mg/ml G418 (Gibco, Invitrogen coporation) was added to the culture medium.
Day Colonies of, approximately, 2-3 mm in diameter were 4-14 picked and individually replated into wells of 96 well culture plates.
The cells grown until confluent in 96-well plates were transferred to 48 well culture plates and then were gradually expanded in 24 well, 12 well, 6 well and 100 mm culture plates.
In 6 well plates, approximately half of the transfected cells were picked for PCR reactions and the other was transferred into two wells of a β well culture plate.
Example 4 - Identification of the transfected cell clones by PCR analysis
To screen transgenic cell lines, G418 resistant- colony cells were analyzed by PCR. Genomic DNAs were purified from half of the cells in 6 well plates using "AccuPrep Genomic DNA Extraction Kit" (Bioneer) and PCR was carried out using "AccuPower PCR Premix" (Bioneer) . Primer sets for human TPO cDNA and thermal cycling conditions are shown below:
SEQ ID No 3 Forward primer GGA GCT GAC TGA ATT GCT CCT CGT SEQ ID No 4 Reverse primer CCT GAC GCA GAG GGT GGA CCC TCC
Figure imgf000036_0001
As results of the PCR, most cell clones resistant to G418 identified as transgenic dell (FIG. 17) .
Example 5 - Long-range PCR to detect targeted cell clones
Long-range PCR was employed to determine the gene- targeted cell clones among transgenic cell clones. Genomic DNAs from each transgenic cell clone were purified using "AccuPrep Genomic DNA Extraction Kit" (Bioneer) and PCR was performed using "AccuPower HL PCR Premix" (Bioneer) .
As shown in FIG 5, the 5' primer was designed to bind at the 3' end of neo gene within the transfected vector constructs and the 3' primer to bind at the intron 8 of bovine beta casein gene which exists in the endogenous region, not in the vector construct. The gene targeted cell clones showed represented 4 kb PCR products on 1% agarose gel. The sequences of a primer set and thermal cycling conditions are shown below:
SEQ ID No 5 Forward primer: 5' -ccacacaggcatagagtgtctgc- 3' SEQ ID No 6 Reverse primer: 5' -ccacagaattgactgcgactgg- 3'
Figure imgf000037_0001
As result of the long-range PCR, two cell clones were identified to be gene-targeted (FIG. 20) .
As shown in examples 3 and A, 41 single colonies were isolated after the transfection of the BCTPOKI I vector into the somatic cells. Among these cells, 38 colonies (93%) were identified to be transgenic, but no targeted colonies
(0%) were detected. 31 single colonies were isolated after transfection of the BCTPOKlII vector into the somatic cells.
Among these, 29 colonies (94%) were identified as transgenic cells, and 2 colonies (7%) were identified to be gene targeted with BCTPOKI Il vector at the endogenous bovine beta-casein gene locus in genome (Table 1 & FIG 22) .
Table 1. Transfection efficiency of BCTPOKI I and BCTPOKlII vectors Cell
BCTPOKI I BCTPOKI Il types
No. of bEF 23 2 analyzed 41 31 colonies bESF 18 29
No. of bEF 22 (96%) 1 (50%) transgenic 38 (93%) 29 (94%) colonies bESF 16 (89%) 28 (97%)
No. of bEF 0 (0%) 0 targeted 0 (0%) 2 (7%) colonies bESF 0 (0%) 2
Example 6 - Southern blot analysis to reconfirm targeted cell clones
Two clones identified as gene-targeted by the PCR reactions were analyzed again by the southern blotting. The two cell clones were transferred to two 100 mm culture dishes respectively. Cells were harvested from one of the two dishes, and at least 10 micrograms DNA from each clone was extracted and digested with EcoRl for 16hr at 37°C . EcoR I -digested DNA was separated by electrophoresis through a 0.75% agarose gel at 50V in 1 X TAE buffer for 16hr. The DNA was transferred onto nylon membranes positively charged (Boehringer Mannheim) and hybridized with the probe targeting human TPO cDNA in the vector constructs (see FIG. 21) . The probes for southern blotting were prepared with primers of SEQ ID N03 and 4 following the guidelines (Roche) . The PCR reaction was carried out using "PCR DIG labeling mix" (Roche) and "Taq DNA polymerase" (QIAGEN) . Thermal cycling conditions were as below:
Figure imgf000039_0001
The gene targeting of the previously identified two clones were confirmed again by the southern blotting (FIG. 22) . The two targeted cell clones are number 81 and number 89 cell lines.
The number 81 cell clone was designated as BCTPOKIbESF81 and deposited with the Korean Collection for Type Cultures (KCTC) located in #52, Oun-dong, Yusong-ku, Taejon 305-333, Republic of Korea on Nov 10 2004, under the accession number KCTC-10720BP.
Example 7 - Preparation of bovine somatic cells
Experiments were conducted according to the Animal
Care and Use Committee guidelines of the National Livestock
Research Institute of Korea. Bovine embryonic fibroblasts
(bEF) were isolated from fetus at Day 45 of gestation and prepared as described previously (Koo et al., Biol Reprod., 63(4) ; 986-992, 2000) . The head of the fetus was removed using iris scissors, and soft tissues such as liver and intestine were also discarded by scooping out with two watchmarker' s forceps. Bovine ear skin fibroblasts (bESF) were isolated from the ear skin of a 2-years-old bovine which produce over 12,000kg milk a year. After twice washing with PBS (Gibco BRL) , the bEF and bESF were minced with a surgical blade on a 100 mm culture dish. These procedures were performed at room temperature. The minced tissues were incubated in 10 ml of 0.05% (w/v) trypsin/0.53 mM EDTA solution in an incubator at 38.5"C for 30 min. Trypsin was inactivated by adding an equal volume of cell culture medium supplemented with 10% FBS. The cell culture medium was composed of Dulbecco modified Eagle medium supplemented with 10% FBS, 1000 units of penicillin and 1000 μg/ml of streptomycin (Gibco BRL) . After vigorous pipetting, the supernatant was centrifuged at 150 Xg for 5 min. The cells were suspended and adjusted to a final concentration of 2 X 106 cells/ml, and then were cultured in 10ml culture medium at 37"C in 5% CO2 in air in 175-cm2 tissue culture flasks (Nunc, Roskilde, Denmark) until confluent. The bEF and bESF cells were frozen down in cold Dulbecco' s Phosphate-Buffered Saline solution supplemented with 20% FBS and 10% Dimethyl sulphoxide and frozen at -TO"C for 16hr. The cells were stored in liquid nitrogen until transfection experiment.
To obtain the gene-targeted cell lines, DNA- transfected cells should survive for a long period of culture in vitro without morphological modification and apoptosis. In this invention, BCTPOKI I and BCTPOKI Il vectors were introduced into two types of somatic cells: bEF and bESF. It was reported that ovine post-natal fibroblasts persist through longer periods maintaining a relatively stable chromosomal karyotype in culture than in ovine fetal fibroblasts (Williams et al., MoI Reprod Dev. , 66(2);115- 125, 2003) . In this invention, the bESF sustained much longer normal morphologies in in vitro culture than bEF (Table 2) .
Table 2. Cell survival rate on passage 4 and passage 8
Figure imgf000041_0001
51 (17%) of 304 bESF colonies on passage 4 were expanded by passage 8, showing normal morphologies. However, in case of bEF cells, only 6% clones were cultured by passage 8. In this experiment, we obtained two gene- targeted clones from bESF cells.
Example 8 - Freezing and thawing of frozen gene-targeted cells
When the gene-targeted cells were grown to confluent in two 100mm culture dishes, cells of one plate were subjected to Southern blot analysis. And half of the other plate cells were further expanded and the other half stored in liquid nitrogen after freezing at -70°C for 16hr. The procedures of cell sub-culturing and storing were repeated to obtain a lot of cells for use as donor cells. The cell freezing medium consisted of DMEM supplemented with 20% FBS and 10% dimethyl sulphoxide (DMSO) .
After thawing one vial of frozen gene-targeted cells as soon as possible, the solution was transferred into 15 ml of tube containing 9 ml of cell culture medium and centrifuged 1000 rpm for 3 min . The cell pellet was resuspended in 3 ml culture medium, plated on 6-well culture plate containing 3 ml of culture medium, and then cultured at 37 °C in 5% CO2 in air prior to nuclear transfer .
Example 9 - Nuclear Transfer
Bovine oocytes obtained from slaughterhouse ovaries were cultured in the maturation medium at 38 . 57 "C in 5% COz in humidified air . The maturation medium consisted of TCM- 199 ( Sigma Chemical Co . ) with Eagle salts and L-glutamine supplemented with 10% (v/v) FBS (Gibco BRL, Grand Island, NY) , 1 μg/ml estradiol , 1 μg/ml FSH-P ( Schering-Plough Animal Health Corp . , Kenilworth, NJ) , and 25 mM NaHCO3. After in vitro maturation, the oocytes were transferred to 500 μl of TL-Hepes supplemented with 0 . 1% hyaluronidase and then cumulus of the oocytes were removed by mechanical pipetting . The zonae pellucida of denuded oocytes were partially dissected using a fine glass needle (Tsunoda et al . , J Exp Zool . , 240 ( 1 ) / 119-125 , 1986 ) . Oocytes manipulations such as enucleation and cell inj ection were performed using a micromanipulator equipped with an inverted microscope (Leitz , Ernst Leitz Wetzlar GmbH, Germany) . The medium used for manipulation was TL-Hepes containing 7 . 5 μg/ml cytochalasin B . A first polar body and partial cytoplasm presumptively containing metaphase Il chromosomes were removed together by using a micropipette with an inner diameter of 20 μm. Single gene-targeted cells were individually transferred to the perivitelline space of the recipient cytoplast. The cell-cytoplast complexes were equilibrated in a 50 μl drop of cell fusion medium for 10- 20 sec and then transferred to a fusion chamber with two electrodes lmm apart overlaid with cell fusion medium. The cell fusion medium consisted of 0.3 M mannitol, 0.5 mM Hepes, 0.01% BSA, 0.1 mM CaCl2, and 0.1 mM MgCl2. The cell- cytoplast complexes were induced to fuse with a single pulse of direct current of 1.6 kV/cm for 20 μsec by an Electro Cell Manipulator 2001 (BTX, San Diego, CA) . These procedures were performed at room temperature. Reconstructed embryos without visible somatic cells were determined as fused eggs 1 h after the fusion pulse. At 4 h after electrofusion, the fused eggs were activated with 5 μM ionomycin for 5 min, followed by treatment with 2.5 mM β-dimethyl-aminopurine in CRlaa medium (Rosenkrans et al., Biol Reprod., 49 (3) ; 459-462, 1993) supplemented with 10% FBS for 3.5 h at 38.5°Cin 5% CO2 In air.
Example 10 - Culture of reconstructed embryos
The reconstructed embryos were cultured in CRlaa medium supplemented with 1 mM glutamine and 1 X Eagle essential amino acids solution (Gibco BRL) . After culture for 3 days, cleaved embryos were further cultured in each well of a 4-well culture plate containing 750 μl CRlaa on a mouse embryonic fibroblasts monolayer (with 10% FBS) for 4 days at 38.5°Cin 5% CO2 in air (Park et al., Anim Reprod Sci., 59(1-2) /13-22, 2000) . After 7 days of culture, blastocyst formation was observed. Example 11 - PCR analysis of cloned embryos
Each embryo was transferred into 20 μl of lysis buffer, which consisted of 50 mM KCl, 1.5 iΛ MgCl2, 10 mM Tris-HCl pH8.5. 0.5% Nonidet P40, 0.5% Tween and 400 μg/ml Proteinase K, and incubated at 65°Cfor 30 min. Proteinase K was inactivated at 95°C for 10 min (McCreath et al., Nature, 405 (6790) ;1066-1069, 2000) . For the each lysed embryo, the first PCR was carried out with primers of SEQ IN Nos 3 and 4 using the "AccuPower PCR Premix" (Bioneer) and then the nested PCR was performed using 1 μl of the first PCR product. The primers of IN Nos 3 and 7 were used and thermal cycling conditions were as follows:
Nested PCR
SEQ ID No 7
Reverse primer: 5' -gagacggacctgtccagaaagctg-3'
Figure imgf000044_0001
It was analyzed by PCR at various different developmental stages whether the cloned embryos were transgenic or not (Table 3) .
Table 3. PCR analysis of reconstructed embryos at various different developmental stages
Figure imgf000045_0001
As a result, 33 (100%) of 33 cloned embryos were transgenic. The results indicate that the present invention could produce the gene-targeted cloned animals by using the gene-targeted somatic cells.
Figure 23 shows the PCR analysis result of nuclear- transferred embryos from cell clone 81 (FIG. 23)
Example 12 - Long-range PCR analysis of a fetal membrane derived from a cloned fetus.
Reconstructed embryos at the blastocyst stages were transferred to recipients by a non-surgical method. At 36 days of gestation, a fetus and fetal membrane were flushed from the uterus of the cow non-surgically using a Foley catheter (Agtech, Manhatan, KS) . The extracted fetus and fetal membrane derived from the fetus were cultured in vitro as described in example 7. The long-range PCR result, showing 4kb band, confirmed that cultured cells derived from the fetal membrane were accurately targeted into a beta-casein gene in genome with the vector of the present invention (FIG. 24) . The procedures of genomic DNA extraction and long-range PCR analysis are the same as described in example 5 .
Industrial Applicability
As described herein, the transgenic animal , which is prepared by implanting a nulear-transf erred embryo introduced with a cell targeted with beta-casein gene targeting vector, can produce biomedically or biotechnically valuable proteins in their milk without lethality during embryonic or post-natal developmental stage by unregulated expression of the foreign proteins .
I BUPAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOS IT
OF MICROORGANISMS FOR THE PURPOSE OF PATENT PROCEDURE INTERNATIONAL FORM
RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 71
TO HAN, Yond-Mahn
Hanul Apt 110-305,
Sinsong-dong, Yuseon.g-gu Daejeon. 305-345,
Republic of Korea
Figure imgf000047_0001
Form BP/4 (KCTC For m17 ) sole PBBC

Claims

claimes
1. A beta-casein gene targeting vector comprising (1) a first region having a length of 5 to 12 kb which is homologous to the promoter and its flanking nucleic acid sequences of beta-casein gene; (2) a region for cloning a nucleic acid coding for desired proteins; (3) a region for coding a positive selection marker; (4) a second region having a length of 2 to 4 kb which is homologous to the nucleic acid sequences of beta-casein gene; wherein the nucleic acid segment corresponding to the first region is located upstream to the nucleic acid segment corresponding to the second region in the 5'-3' arrangement of beta- casein gene.
2. The vector according to claim 1, wherein the length of the first region is 5.5 to 10kb.
3. The vector according to claim 1, wherein the length of the second region is 2.5 to 3.5kb.
4. The vector according to claim 1, wherein the beta-casein gene originates from cattle, sheep, goats, pigs, horses, rabbits, dogs or monkeys.
5. The vector according to claim 1, wherein the first region includes bovine beta-casein exon 1, exon 2 and intron 1 loci.
6. The vector according to claim 1, wherein the positive selection marker is selected from the group consisting of neomycin (Neo) , hygromycin (Hyg) , histidinol dehydrogenase gene (hisD) and guanine phosphosribosyltransferase (Gpt) .
7. The vector according to in claim 1, wherein the desired proteins are selected from the group consisting of thrombopoietin; human growth hormone; growth hormone releasing hormone; growth hormone releasing peptide; interferons, interferon receptors; colony-stimulating factor, glucagon-like peptides; G-protein-coupled receptor; interleukins; interleukin receptors; enzymes; interleukin binding proteins; cytokine binding proteins, macrophage activating factor; macrophage peptide; B cell factor; T cell factor; protein A; suppressive factor of allergy; cell necrosis glycoprotein; immunotoxin; lymphotoxin; tumor necrosis factor; tumor inhibitory factor; transforming growth factor; alpha-1 antitrypsin; albumin; alpha-- lactalbimin; apolipoprotein-E; erythroprotein; hyper- glycosylated erythroprotein; angiopoietins; hemoglobin; thrombin; thrombin receptor activating peptide; thrombomodulin; factor VII , factor Vila, factor VIII, factor IX, factorXIII; plasminogen activator; fibrin binding protein; urokinase; steptokinase; hirudin; protein C; C-reactive protein; renin inhibitor; collagenase inhibitor; superoxide dismutase; leptin; platelet derived growth hormone; epithelial growth factor; epidermal growth factor; angiostatin; angiotensin; osteogenic growth factor; osteogenesis stimulating protein; calcitonin; insulin; atriopeptin; cartilage inducing factor; elcatonin; connective tissue activator protein; tissue factor pathway inhibitor; follicle stimulating hormone; luteinizing hormone; FSH releasing hormone; nerve growth hormone; parathyroid hormone; relaxin; secretin; somatomedin; insulin-like growth factor; adrenocorticotrophic hormone; glucagon; cholecystokinin; pancreatic polypeptide; gastrin releasing peptide; corticotropin releasing factor; thyroid stimulating hormone; autotaxin; lactoferrin; myostatin; receptor; receptor antagonist; cell surface antigen; virus- derived vaccine antigen; monoclonal antibody; and polyclonal antibody.
8. The vector according to claim 1, wherein the vector further comprises a region for negative selection marker.
9. The vector according to claim 1, wherein the vector is pBCKI II as presented in FIG. 2.
10. An animal cell which is gene-targeted with the vector as claimed in claim 1.
11. The cell as claimed in claim 10, wherein the cell is deposited under the Deposition No. KCTC 10720BP.
12. An embryo which is nuclear-transferred with the animal cell according to claim 10.
13. A method for producing a nuclear-transferred embryo, which comprises the steps of introducing the vectoi according to claim 1 into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; and introducing the gene-targeted cell into a nuclear-removed animal embryo to produce nuclear- transferred embryo with the gene-targeted cell.
14. A method for producing a desired protein from milk, which comprises the steps of introducing the vector according to claim 1 into an animal somatic cell; selecting the cell targeted with a desired gene by homologous recombination; introducing the gene-targeted cell into a nuclear-removed animal embryo; implanting the embryo into a milk-producing animal to produce a transgenic animal; and producing milk from the transgenic animal
PCT/KR2004/003034 2004-11-23 2004-11-23 Beta-casein gene targeting vector using homologous recombination Ceased WO2006057466A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
PCT/KR2004/003034 WO2006057466A1 (en) 2004-11-23 2004-11-23 Beta-casein gene targeting vector using homologous recombination
CNA2005800036604A CN1914324A (en) 2004-11-23 2005-11-18 Bovine β-casein Gene Targeting Vector Using Homologous Recombination
US10/574,747 US8030538B2 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination
JP2006546862A JP2007510437A (en) 2004-11-23 2005-11-18 Bovine β-casein gene targeting vector using homologous recombination
PCT/KR2005/003923 WO2006057499A1 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination
EP05823897A EP1704238A1 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination
AU2005256120A AU2005256120B2 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination
CA002547572A CA2547572A1 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2004/003034 WO2006057466A1 (en) 2004-11-23 2004-11-23 Beta-casein gene targeting vector using homologous recombination

Publications (1)

Publication Number Publication Date
WO2006057466A1 true WO2006057466A1 (en) 2006-06-01

Family

ID=36498182

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2004/003034 Ceased WO2006057466A1 (en) 2004-11-23 2004-11-23 Beta-casein gene targeting vector using homologous recombination
PCT/KR2005/003923 Ceased WO2006057499A1 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2005/003923 Ceased WO2006057499A1 (en) 2004-11-23 2005-11-18 Cattle beta-casein gene targeting vector using homologous recombination

Country Status (7)

Country Link
US (1) US8030538B2 (en)
EP (1) EP1704238A1 (en)
JP (1) JP2007510437A (en)
CN (1) CN1914324A (en)
AU (1) AU2005256120B2 (en)
CA (1) CA2547572A1 (en)
WO (2) WO2006057466A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006057466A1 (en) 2004-11-23 2006-06-01 Korea Research Institute Of Bioscience And Biotechnology Beta-casein gene targeting vector using homologous recombination
CN102080101B (en) * 2010-11-25 2013-01-09 北京济福霖生物技术有限公司 Targeted exogenous gene integration method
CN110177878B (en) * 2016-12-29 2023-11-03 Asc治疗公司 Transgenic animals and biological production methods
CN113907044A (en) * 2021-11-09 2022-01-11 福建省连江县刘氏兔业养殖场 Breeding method and application of disease-resistant pig strain
IL316038A (en) 2022-04-04 2024-11-01 Univ California Genetic complementation compositions and methods

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5741957A (en) * 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
US20030024002A1 (en) * 1999-03-04 2003-01-30 Alan Colman Method of preparing a somatic cell for nuclear transfer
US6713662B1 (en) * 1994-07-27 2004-03-30 Pharming Intellectual Property B.V. Production of collagen in the milk of transgenic mammals
US20040168208A2 (en) * 2001-12-21 2004-08-26 Nexia Biotechnologies, Inc. Production of butyrylcholinesterases in transgenic animals

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5843705A (en) * 1995-02-21 1998-12-01 Genzyme Transgenic Corporation Transgenically produced antithrombin III
KR100221124B1 (en) * 1996-09-23 1999-10-01 한상기 Novel casein and method for producing the same
NZ522971A (en) 2000-05-05 2005-02-25 Gtc Biotherapeutics Inc Transgenically produced decorin in the mammary gland of a transgenic animal
KR101025707B1 (en) 2002-11-23 2011-03-30 재단법인서울대학교산학협력재단 Transformed clones producing human alpha1-antitrypsin and methods for producing them
US7807862B2 (en) * 2003-09-30 2010-10-05 Sterrenbeld Biotechnologie North America, Inc. Transgenic bovine comprising human growth hormone in its serum and methods of making
WO2006057466A1 (en) 2004-11-23 2006-06-01 Korea Research Institute Of Bioscience And Biotechnology Beta-casein gene targeting vector using homologous recombination

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5741957A (en) * 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
US6713662B1 (en) * 1994-07-27 2004-03-30 Pharming Intellectual Property B.V. Production of collagen in the milk of transgenic mammals
US20030024002A1 (en) * 1999-03-04 2003-01-30 Alan Colman Method of preparing a somatic cell for nuclear transfer
US20040168208A2 (en) * 2001-12-21 2004-08-26 Nexia Biotechnologies, Inc. Production of butyrylcholinesterases in transgenic animals

Also Published As

Publication number Publication date
AU2005256120B2 (en) 2008-02-14
CN1914324A (en) 2007-02-14
US20090013419A1 (en) 2009-01-08
JP2007510437A (en) 2007-04-26
EP1704238A1 (en) 2006-09-27
WO2006057499A1 (en) 2006-06-01
AU2005256120A1 (en) 2006-06-08
US8030538B2 (en) 2011-10-04
CA2547572A1 (en) 2006-05-23

Similar Documents

Publication Publication Date Title
US20030014770A1 (en) Alpha (1,3) galactosyl transferase negative swine
AU2004271200A1 (en) Method for the production of fusion proteins in transgenic mammal milk
AU652355B2 (en) Improved expression of polypeptides
CN102124109B (en) Gene of porcine alpha-S1 casein, a promoter of the same and use thereof
US20040025193A1 (en) Method for the rapid selection of homozygous primary cell lines for the production of transgenic animals by somatic cell nuclear transfer
EP3562944B1 (en) Transgenic rabbits and method for bioproduction
AU2005256120B2 (en) Cattle beta-casein gene targeting vector using homologous recombination
CN106978416B (en) Gene positioning integration expression system and application thereof
KR101068479B1 (en) Alpha 1,3-galactosyltransferase gene targeting vector and uses thereof
KR100754114B1 (en) Bovine beta-casein gene targeting vector using homologous recombination
NZ546197A (en) Cattle beta-casein gene targeting vector using homologous recombination
CN100469876C (en) Production method of animal cells transfected with human lactoferrin gene
Gong et al. Production of transgenic calves by somatic cell nuclear transfer
JP6267785B2 (en) CMP-acetylneuraminic acid hydroxylase targeting vector, transgenic animal for xenotransplantation into which the vector is introduced, and method for producing the same
EP2085476A1 (en) Method of enabling stable expression of transgene
Rexroad Jr History of genetic engineering of laboratory and farm animals
Chang et al. Knocking-in of the human thrombopoietin gene on beta-casein locus in bovine fibroblasts
Beaton GGTA-1 targeting efficiency with a xenograft transgene
HK40008868A (en) Transgenic rabbits and method for bioproduction
HK40008868B (en) Transgenic rabbits and method for bioproduction
AU7933601A (en) alpha(1,3)-galactosyltransferase negative swine
WO2006062507A1 (en) Methods of prescreening cells for nuclear transfer procedures

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 04800120

Country of ref document: EP

Kind code of ref document: A1