WO2006056054A1 - Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels - Google Patents

Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels Download PDF

Info

Publication number
WO2006056054A1
WO2006056054A1 PCT/CA2005/001775 CA2005001775W WO2006056054A1 WO 2006056054 A1 WO2006056054 A1 WO 2006056054A1 CA 2005001775 W CA2005001775 W CA 2005001775W WO 2006056054 A1 WO2006056054 A1 WO 2006056054A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
clusterin
oligonucleotide
combination
agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2005/001775
Other languages
English (en)
French (fr)
Inventor
Martin Gleave
Gabriella Zupi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of British Columbia
Original Assignee
University of British Columbia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to SI200531838T priority Critical patent/SI1814595T1/sl
Priority to ES05810600.6T priority patent/ES2456017T3/es
Priority to DK05810600.6T priority patent/DK1814595T3/da
Priority to CA2584646A priority patent/CA2584646C/en
Priority to AU2005309274A priority patent/AU2005309274B2/en
Priority to US11/718,815 priority patent/US20080014198A1/en
Application filed by University of British Columbia filed Critical University of British Columbia
Priority to EP05810600.6A priority patent/EP1814595B1/en
Priority to JP2007541607A priority patent/JP4980919B2/ja
Priority to PL05810600T priority patent/PL1814595T3/pl
Publication of WO2006056054A1 publication Critical patent/WO2006056054A1/en
Anticipated expiration legal-status Critical
Priority to US12/886,027 priority patent/US20110142827A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered

Definitions

  • the present application relates to a method for treating cancer in a mammalian subject using a combination of therapeutic agents, one of which is an oligonucleotide effective to reduce the amount of clusterin, also known as testosterone-repressed prostate message-2 (TRPM-2) in the cancer cells, and the other of which is an agent that perturbs the EGF cell signaling pathway, and also stimulates the expression of clusterin as a consequence of its action on the target.
  • therapeutic agents one of which is an oligonucleotide effective to reduce the amount of clusterin, also known as testosterone-repressed prostate message-2 (TRPM-2) in the cancer cells
  • TRPM-2 testosterone-repressed prostate message-2
  • agents that perturb the EGF signaling pathway include agents that target HER-2.
  • Standard treatments include surgery, radiation, chemotherapy and hormonal therapies. Each of these treatments has drawbacks including loss of breast tissue, illness associated with radiation or chemotherapy, reproductive and hormonal side effects, and unreliable survival rates.
  • Clusterin or "TRPM-2" is a ubiquitous protein, with a diverse range of proposed activities. In prostate epithelial cells, expression of clusterin increases immediately following castration, reaching peak levels in rat prostate cells at 3 to 4 days post castration, coincident with the onset of massive cell death. These results have led some researchers to the conclusion that clusterin is a marker for cell death, and a promoter of apoptosis. On the other hand, Sertoli cells and some epithelial cells express high levels of clusterin without increased levels of cell death. Sensibar et al., (1 995)[1 ] reported on in vitro experiments performed to more clearly elucidate the role of clusterin in prostatic cell death.
  • TNFoO tumor necrosis factor a
  • the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer.
  • the combination comprises (i) an agent that has known therapeutic efficacy against the cancer to be treated and that perturbs the EGF signaling pathway and stimulates expression of clusterin as a secondary effect, and (ii) an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells.
  • the agent with known therapeutic efficacy against the cancer is one that perturbs the EGF cell signaling pathway is an agent that interacts with HER-2.
  • the agent may be an antibody specific for HER-2, a small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein.
  • the oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.
  • the combination of the invention is useful in a method for treating cancer in a mammalian subject, comprising administering to the subject the known therapeutic agent and an oligonucleotide effective to reduce the amount of clusterin in the cancer cells.
  • the cancer may be breast cancer, osteosarcoma, lung cancer, pancreatic cancer, salivary gland cancer, colon cancer, prostate cancer, endometrial cancer, and bladder, for example.
  • Figure I A shows a cytofluorimetric analysis of HER- 2 protein expression in BT474 cells untreated (gray area), and treated with 1 0 (thin line), 25 ⁇ g/ml (thick line) of trastuzumab for 48h, and negative control (dotted area);
  • Figure 1 B shows the number of adherent cells (black columns) and percentage of apoptotic cells (white columns) in BT474 cells, untreated and treated with 10 and 25 ⁇ g/ml of trastuzumab for 48h;
  • Figure 2 shows data for cells treated with 50OnM of either clusterin ASO or mismatch (MM) control oligodeoxynucleotide for 6h, followed by exposure to 25 ⁇ g/ml of trastuzumab or control medium, 48h after treatment;
  • Figure 3 is a histogram showing the relative percentages of cells in the different phases of cell cycle (measured using propidium iodide staining and flow cytometry) after treatment with 500 nM of either clusterin ASO or MM control oligonucleotide for 6h followed by exposure to 25 ⁇ g/ml of trastuzumab or control medium;
  • Figure 4 shows the cytofluorimetric analysis of annexin V/PI staining for cells that were treated with 500 nM of either clusterin ASO or MM control oligonucleotide for 6h, followed by exposure to 25 ⁇ g/ml of trastuzumab or control medium. Annexin V-positive cells are highlighted in the box; and
  • EGF cell signaling pathway refers to the intracellular pathway that is stimulated upon binding of a ligand to a member of the epidermal growth factor receptor (EGFr) family.
  • the EGFr family comprises EGFR, HER-2, HER-3 and HER-4.
  • the EGFr family lies at the beginning of a complex signal transduction/communication pathway that modulates cell proliferation, survival, migration and differentiation.
  • an agent that perturbs the EGF cell signaling pathway refers to any agent which is capable of disrupting the EGF cell signal, and includes an antibody specific for any of the members of the EGFr family, a small molecule inhibitor of normal binding to any member of the EGFr family, an antisense oligonucleotide that specifically inhibits expression of a member of the EGFr family, or a peptide agent capable of interfering with the signaling function of a member of the EGFr family.
  • clusterin refers to the glycoprotein originally derived from ram rete testes, and to homologous proteins derived from other mammalian species, including humans, whether denominated as clusterin or an alternative name.
  • sequences of numerous clusterin species are known.
  • the sequence of human clusterin is reported by Wong et a/., (1 994) [2], and in NCBI sequence accession number NM_001 831 and is set forth in Seq. ID No. 1 . In this sequence, the coding sequence spans bases 48 to 1 397.
  • the term “amount of clusterin” refers to the amount of clusterin which is present in a form which is functional to provide anti-apoptotic protection.
  • the effective amount of clusterin may be reduced through restricting production of clusterin (at the transcription or translation level) or by degrading clusterin at a rate faster than it is being produced. Further, it will be appreciated that inhibition occurs when the clusterin would otherwise be present if the antisense oligonucleotide had not been administered.
  • antisense oligonucleotide refers to stretches of single-stranded DNA, usually chemically modified, whose sequence (3' ⁇ 5') is complementary to the sense sequence of a molecule of mRNA. Antisense molecules thereby effectively inhibit gene expression by forming RNA/DNA duplexes, and offer a more targeted option for cancer therapy than chemotherapy or radiation. Antisense is believed work by a variety of mechanisms, including physically blocking the ability of ribosomes to move along the messenger RNA, and hastening the rate at which the mRNA is degraded within the cytosol. The abbreviation ASO may also be used to refer to an antisense oligonucleotide.
  • the term "combination" refers to an assemblage of reagents for use in therapy either by simultaneous or contemporaneous administration.
  • Simultaneous administration refers to administration of an admixture (whether a true mixture, a suspension, an emulsion or other physical combination) of the agent that perturbs the EGF cell signaling pathway and the oligonucleotide.
  • the combination may be the admixture or separate containers of the agent and the oligonucleotide that are combined just prior to administration.
  • Contemporaneous administration refers to the separate administration of the agent and the oligonucleotide at the same time, or at times sufficiently close together that a synergistic activity relative to the activity of either the agent or the oligonucleotide alone is observed.
  • the combination comprises separate containers of the agent and the oligonucleotide Agents that Perturb the EGF cell signaling pathway
  • the present invention makes use of an agent that perturbs the EGF cell signaling pathway.
  • This agent can be any agent which is capable of disrupting the EGF cell signal, and includes an antibody specific for any of the members of the EGFr family, a small molecule inhibitor of normal binding to any member of the EGFr family, an antisense oligonucleotide that specifically inhibits expression of a member of the EGFr family, or a peptide agent capable of interfering with the signaling function of a member of the EGFr family.
  • the agent is one that perturbs the EGF signalling pathway by interaction with HER-2.
  • HER-2 also known as ERBB2, or human epidermal growth factor receptor 2 helps control how cells grow, divide, and repair themselves.
  • ERBB2 human epidermal growth factor receptor 2
  • the HER-2 gene directs the production of special proteins, called HER-2 receptors.
  • HER-2 is overexpressed in about a third of all breast cancers and is the target of trastuzumab.
  • One type of agent that can be used to interact with the HER-2 receptor and perturb the EGF signaling pathway is a pharmaceutical monoclonal antibody.
  • the antibody may be specific for, and bind to, the HER-2 receptor. Alternately the antibody may bind to a related receptor and affect the HER-2 pathway in that way.
  • This antibody may be trastuzumab, which is believed to block the HER-2 receptors when there is overexpression, and thereby block tumor growth and development.
  • trastuzumab sold under the brand name HerceptinTM, is a recombinant monoclonal antibody administered intravenously to treat breast cancer. Trastuzumab is currently used in combination with paclitaxel and is indicated for treatment of patients with metastatic breast cancer whose tumors over-express the HER-2 protein.
  • HER-2 cell signaling pathway Other agents capable of perturbing the HER-2 cell signaling pathway include antisense agents capable of blocking HER-2 expression.
  • US Patent publication 20031 05051 discloses nucleic acid therapeutics for conditions related to levels of HER-2, and US patent nos. 5,910,583 and 6,365,345 disclose antisense nucleic acids for the prevention and treatment of disorders in which expression of c-erbB or erbB2 play a role
  • Small molecules capable of acting as the agent to interact with HER-2 and perturb EGF cell signaling include, for example, those disclosed in published patent documents US 5,721 ,237, WO 03035843, and EPI 1 31 304.
  • Peptides and peptide mimetics capable of acting as the agent to interact with HER-2 receptor and perturb the EGF signaling pathway include those such as adamanolol and disclosed in, for example, published patent documents CA2373721 and US2004006106.
  • ErbituxTM cetuximab
  • cetuximab is a known pharmaceutical monoclonal antibody that targets the EGF cell signalling pathways via EGFr in colon and head and neck carcinoma.
  • Antisense oligonucleotides are synthetic polymers made up of monomers of deoxynucleotides like those in DNA.
  • the term antisense oligonucleotides includes antisense oligodeoxynucleotides.
  • the antisense oligonucleotides for use in the combination and method of the invention for treatment of cancer in humans are complementary to the nucleotide sequence of human clusterin as set forth in Seq. ID No. 1 .
  • the antisense oligonucleotide may span either the translation initiation site or the termination site of clusterin.
  • the antisense oligonucleotide comprises and may consist essentially of an oligonucleotide selected from the group consisting of Seq. ID. Nos.: 2 to 19, or more specifically Seq. ID. No. 4, Seq. ID. No. 5 and Seq. ID. No.l 2.
  • the phrase "consist essentially of” means that the oligonucleotide contains just the bases of the identified sequence or such bases and a small number of additional bases that do not materially alter the antisense function of the oligonucleotide
  • antisense oligonucleotides and oligonucleotides are often chemically modified. For example, phosphorothioate oligodeoxynucleotides are stabilized to resist nuclease digestion by substituting one of the non-bridging phosphoryl oxygen of DNA with a sulfur.
  • Increased antisense oligonucleotide stability can also be achieved using molecules with 2-methoxyethyl (MOE) substituted backbones as described generally in US Patent No. 6,451 ,991 , incorporated by reference in those jurisdictions allowing such incorporation, and US published patent application US-2003-01 58143-Al .
  • the antisense oligonucleotide may be modified to enhance in vivo stability relative to an unmodified oligonucleotide of the same sequence.
  • the modification may be a (2'-O-(2-methoxyethyl)) modification.
  • the oligonucleotide may have a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1 -4 and 1 8-21 may bear 2'-O-methoxyethyl modifications and the remaining nucleotides may be 2'-deoxynucleotides.
  • the antisense oligonucleotide may be a 5-10-5 gap-mer methoxyl ethyl modified (MOE) oligonucleotide corresponding to SEQ ID NO.:5 below.
  • the antisense oligonucleotide may be from 1 0-25 bases in length, or from 1 5-23 bases in length, or from 1 8-22 bases in length, or 21 bases in length.
  • a particularly preferred antisense oligonucleotide is a 21 mer oligonucleotide (CAGCAGCAGAGTCTTCATCAT; SEQ ID NO.: 4) targeted to the translation initiation codon and next 6 codons of the human clusterin sequence with a 2'-MOE modification.
  • this oligonucleotide has a phosphorothioate backbone throughout.
  • the sugar moieties of nucleotides 1 -4 and 1 8-21 bear 2'-O- methoxyethyl modifications and the remaining nucleotides (nucleotides 5- 1 7; the "deoxy gap”) are 2'-deoxynucleotides.
  • Cytosines in the wings i.e., nucleotides 1 , 4 and 1 9) are 5-methylcytosines.
  • RNAi oligonucleotides [Para 47] Reduction in the amount of clusterin may also be achieved using RNA interference or "RNAi".
  • RNAi is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression[3]. Double stranded RNA, or dsRNA directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates. RNAi involves mRNA degradation, but many of the biochemical mechanisms underlying this interference are unknown. The use of RNAi has been further described[3,4].
  • RNAi The initial agent for RNAi is a double stranded RNA molecule corresponding to a target nucleic acid.
  • the dsRNA is then thought to be cleaved in uvVo into short interfering RNAs (siRNAs) which are 21 -23 nucleotides in length (1 9-21 bp duplexes, each with 2 nucleotide 3' overhangs).
  • siRNAs short interfering RNAs
  • RNAi may be effected via directly introducing into the cell, or generating within the cell by introducing into the cell a suitable precursor (e.g. vector, etc.) of such an siRNA or siRNA-like molecule.
  • An siRNA may then associate with other intracellular components to form an RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • RNA molecules used in embodiments of the present invention generally comprise an RNA portion and some additional portion, for example a deoxyribonucleotide portion.
  • the total number of nucleotides in the RNA molecule is suitably less than 49 in order to be effective mediators of RNAi.
  • the number of nucleotides is 1 6 to 29, more preferably 1 8 to 23, and most preferably 21 -23.
  • the siRNA or siRNA- like molecule is less than about 30 nucleotides in length.
  • the siRNA or siRNA-like molecules are about 21 -23 nucleotides in length.
  • siRNA or siRNA-like molecules comprise and 19-21 bp duplex portion, each strand having a 2 nucleotide 3' overhang.
  • the siRNA or siRNA- like molecule is substantially identical to a clusterin-encoding nucleic acid or a fragment or variant (or a fragment of a variant) thereof.
  • a variant is capable of encoding a protein having clusterin-like activity.
  • the sense strand of the siRNA or siRNA-like molecule being to the same target region as to the antisense species of SEQ ID NO: 4 or a fragment thereof (RNA having U in place of T residues of the DNA sequence).
  • the RNAi sequence consists of Seq. Id. No. 41 or 43.
  • United States published patent application 2004096882 discloses RNAi therapeutic probes targeting clusterin.
  • the combination of the present application is useful in the treatment of a variety of cancers in which EGFr inhibition is significant. These cancers include breast cancer, osteosarcoma, lung cancer, pancreatic cancer, salivary gland cancer, colon cancer, prostate cancer, endometrial cancer, and bladder cancer.
  • Her-2/neu has also been shown to be a target in ovarian cancer, Xu (2003) [1 1 ]; salivary gland cancer, Scholl (200I )[I 2]; endometrial cancer Cianciulli (2003)[l 3] and Slomovitz (2004)[14]; pancreatic cancer Baxevanis (2004)[l 5]; colon and colorectal cancer, Park (2004)[1 6], Half (2004) [1 7] and Nathanson (2003)[l 8]; and bladder cancer , Bellmunt (2OO3)[l 9].
  • lipid carriers for antisense delivery are disclosed in US Patent Nos. 5,855,91 1 and 5,41 7,978.
  • the antisense is administered by intravenous, intraperitoneal, subcutaneous or oral routes, or direct local tumor injection.
  • the amount of antisense oligonucleotide administered is one effective to reduce the expression of clusterin in cancer cells, particularly and surprisingly when in combination with an agent that perturbs the HER- 2 cell signaling pathway. It will be appreciated that this amount will vary both with the effectiveness of the antisense oligonucleotide employed, and with the nature of any carrier used. The determination of appropriate amounts for any given composition is within the skill in the art, through standard series of tests designed to assess appropriate therapeutic levels.
  • the antisense oligonucleotide is administered to a human patient in an amount of between 40-640 mg, or more particularly, from 300-640 mg.
  • the antisense oligonucleotide is administered according to the weight of the subject in need of the treatment.
  • the antisense oligonucleotide may be provided at a dosage of from 1 to 20 mg/kg of body weight.
  • the monoclonal trastuzumab is available as a powder in a vial containing 440 mg of drug. It must be mixed with a liquid before intravenous injection, often with an initial dose of 4 mg per kilogram of body weight followed by a weekly dose of 2 mg per kilogram of body weight. See, for example, Slamon, DJ et al., 2001 [5]
  • the method for treating cancer in accordance with one embodiment of the invention may further include administration of chemotherapy agents or other agents useful in breast cancer therapy and/or additional antisense oligonucleotides directed at different targets in combination with the therapeutic effective to reduce the amount of active clusterin.
  • antisense clusterin oligonucleotide may be used in combination with more conventional chemotherapy agents such as taxanes (paclitaxel or docetaxel), mitoxanthrone, doxorubicin, gemcitabine, cyclophosphamide, decarbazine, topoisomerase inhibitors), angiogenesis inhibitors, differentiation agents and signal transduction inhibitors.
  • the BT474 human breast carcinoma cell line was cultured in DMEM supplemented with 1 0% fetal calf serum, glutamine, penicillin and streptomycin sulfate at 37°C under 5% CO2-95% air.
  • Cell culture reagents were purchased from Invitrogen (Milan, Italy).
  • Trastuzumab (Herceptin ® , purchased from Roche, Monza, Italy) was stored at 4 0 C and adjusted to the final concentration with culture medium.
  • Phosphorothioate oligonucleotides used in this study were purchased from La JoIIa Pharmaceuticals Co. (La JoIIa, CA, USA) or provided by OncoGenex Technologies Inc., Vancouver, Canada.
  • the sequence of the clusterin ASO used corresponded to the human clusterin translation initiation site (5 '-CAGCAGCAGAGTCTTCATCAT-B') (SEQ ID NO.:4).
  • a 2- base clusterin mismatch oligonucleotide (5'-CACCAGCAG AGTATT 7ATCAT- 3') (SEQ ID NO.: 20) was used as control.
  • Oligonucleotides were delivered into cells in form of complexes with the LipofectinTM transfection reagent (Invitrogen).
  • oligonucleotides were incubated with different concentrations of oligonucleotides and LipofectinTM for 6 hours in OPTIMEMTM medium (Gibco). At the end of oligonucleotide treatment, the medium was replaced with fresh growth medium containing 2% of fetal calf serum and at different time points, cells were processed according to the various analyses to be performed.
  • Apoptosis was detected by flow cytometric analysis of sub-Gl peaks, and also analyzed by Annexin V-FlTC versus Pl assay (VybrantTM Apoptosis Assay, V-I 3242, Molecular Probes, Eugene, OR, USA). Briefly, adherent cells were harvested, suspended in the annexin-binding buffer (1 xl 0 6 cells/ml) and incubated with the annexin V-FITC and Pl for 1 5 min, at room temperature in the dark, then immediately analyzed by flow- cytometry. The data are presented as bi-parametric dot plots showing the annexin V-FITC green fluorescence versus the Pl red fluorescence.
  • Figure I A shows a cytofluori metric analysis of HER-2 protein expression in BT474 cells untreated (gray area), and treated with 10 (thin line), 25 ⁇ g/ml (thick line) of trastuzumab for 48h, and negative control (dotted area).
  • trastuzumab-mediated reduction of HER-2 protein expression was accompanied by inhibition of BT474 cell growth without affecting apoptosis (Fig 1 B).
  • the simultaneous analysis of number of viable and apoptotic cells demonstrated that the treatment with trastuzumab significantly decreased cell growth in a dose- dependent effect, since the number of cells was reduced from about 1 xl O 6 to 8x10 5 and 6x1 O 5 in the BT474 cells treated with 10 and 25 ⁇ g/ml of trastuzumab, respectively.
  • trastuzumab treatment even at the highest dose of 25 ⁇ g/ml induced little or no increase in the percentage of apoptotic cells (less than 1 0%).
  • BT474 cells were transfected with 300 or 500 nM clusterin ASO (Seq. ID No. 4 with MOE modifications)(or the same concentrations of its mismatch oligonucleotide as control, as described supra), and clusterin expression was analyzed by Western blot 48h after treatment.
  • Treatment of BT474 with 1 00 or 500 nM clusterin ASO for 6h reduced clusterin protein expression by about 30 and 50% compared to mismatch control, respectively.
  • BT474 cells were treated with 500 nM clusterin ASO or MM control oligonucleotide and then exposed to 25 ⁇ g/ml trastuzumab for 48h.
  • Figure 2 shows the number of cells in the BT474 untreated and treated with trastuzumab alone and in combination with clusterin ASO or MM control oligonucleotide.
  • Trastuzumab reduced the growth of BT474 by about 50%, while treatment with clusterin ASO did not show any effect on cell proliferation.
  • the combination of trastuzumab with clusterin ASO, but not with the MM control oligonucleotide significantly enhanced chemosensitivity of cells, with reduction of cell proliferation of up to 85%.
  • FIG. 94 Apoptosis was evaluated in BT474 cells exposed to the different treatments.
  • Figure 4 shows the cytofluorimetric analysis of the annexin V versus Pl staining performed in the BT474 untreated and treated with trastuzumab alone and in combination with Clusterin ASO or MM control oligonucleotide.
  • apoptosis shown as the annexin V+/PI- region of the dot plot panels
  • the percentage of annexin V + /Ph cells was about 40% in the trastuzumab/clusterin combination and was less than 10% in all the other treatments.
  • Cianciulli et al. 2003. Her-2/neu oncogene amplification and chromosome 1 7 ane ⁇ somy in endometrial carcinoma: correlation with oncoprotein expression and conventional pathological parameters. J. Exp. Clin. Cancer Res. 22: 265-71 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
PCT/CA2005/001775 2004-11-23 2005-11-22 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels Ceased WO2006056054A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP05810600.6A EP1814595B1 (en) 2004-11-23 2005-11-22 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels
ES05810600.6T ES2456017T3 (es) 2004-11-23 2005-11-22 Tratamiento del cáncer con una combinación de un agente que perturba la ruta de señalización de EGF y un oligonucleótido que reduce los niveles de clusterina
DK05810600.6T DK1814595T3 (da) 2004-11-23 2005-11-22 Behandling af cancer med en kombination af et middel, som forstyrrer EGF-signalvejen og et oligonucleotid, som reducerer clusterinniveauerne
CA2584646A CA2584646C (en) 2004-11-23 2005-11-22 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels
AU2005309274A AU2005309274B2 (en) 2004-11-23 2005-11-22 Treatment of cancer with a combination of an agent that perturbs the EGF signaling pathway and an oligonucleotide that reduces clusterin levels
SI200531838T SI1814595T1 (sl) 2004-11-23 2005-11-22 Zdravljenje raka s kombinacijo sredstva, ki moti EGF signalno pot, in oligonukleotida, ki zniĹľuje nivoje klusterina
PL05810600T PL1814595T3 (pl) 2004-11-23 2005-11-22 Leczenie raka za pomocą kombinacji czynnika zakłócającego ścieżkę sygnalizacyjną EGF oraz oligonukleotydu obniżającego poziom klusteryny
US11/718,815 US20080014198A1 (en) 2004-11-23 2005-11-22 Treatment of Cancer With a Combination of an Agent that Perturbs the EGF Signaling Pathway and an Oligonucleotide that Reduces Clusterin Levels
JP2007541607A JP4980919B2 (ja) 2004-11-23 2005-11-22 Efgシグナル伝達経路を混乱させる薬剤とクラステリンレベルを減少させるオリゴヌクレオチドとの併用による癌の治療
US12/886,027 US20110142827A1 (en) 2004-11-23 2010-09-20 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US52294804P 2004-11-23 2004-11-23
US60/522,948 2004-11-23
US52296004P 2004-11-24 2004-11-24
US60/522,960 2004-11-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/886,027 Continuation US20110142827A1 (en) 2004-11-23 2010-09-20 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels

Publications (1)

Publication Number Publication Date
WO2006056054A1 true WO2006056054A1 (en) 2006-06-01

Family

ID=36497699

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2005/001775 Ceased WO2006056054A1 (en) 2004-11-23 2005-11-22 Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels

Country Status (11)

Country Link
US (2) US20080014198A1 (https=)
EP (1) EP1814595B1 (https=)
JP (1) JP4980919B2 (https=)
AU (1) AU2005309274B2 (https=)
CA (1) CA2584646C (https=)
DK (1) DK1814595T3 (https=)
ES (1) ES2456017T3 (https=)
PL (1) PL1814595T3 (https=)
PT (1) PT1814595E (https=)
SI (1) SI1814595T1 (https=)
WO (1) WO2006056054A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013123588A1 (en) * 2012-02-22 2013-08-29 Alethia Biotherapeutics Inc. Co-use of a clusterin inhibitor with an egfr inhibitor to treat cancer
MD20140101A2 (ro) * 2013-02-22 2015-02-28 Alethia Biotherapeutics Inc. Utilizarea concomitentă a unui inhibitor al clusterinei cu un inhibitor al EGFR pentru tratamentul cancerului
US9074209B2 (en) 1999-02-26 2015-07-07 The University Of British Columbia TRPM-2 antisense therapy
US9457045B2 (en) 2011-03-15 2016-10-04 The University Of British Columbia Combination of anti-clusterin oligonucleotide with Hsp90 inhibitor for the treatment of prostate cancer
US9512211B2 (en) 2009-11-24 2016-12-06 Alethia Biotherapeutics Inc. Anti-clusterin antibodies and antigen binding fragments and their use to reduce tumor volume

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7569551B2 (en) * 2000-02-25 2009-08-04 The University Of British Columbia Chemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides
US8710020B2 (en) * 2004-04-02 2014-04-29 The University Of British Columbia Clusterin antisense therapy for treatment of cancer
CA2584646C (en) * 2004-11-23 2015-11-03 The University Of British Columbia Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels
ES2543341T3 (es) 2005-09-13 2015-08-18 National Research Council Of Canada Métodos y composiciones para modular la actividad de células tumorales

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000049937A2 (en) 1999-02-26 2000-08-31 The University Of British Columbia Trpm-2 antisense therapy
US6383808B1 (en) 2000-09-11 2002-05-07 Isis Pharmaceuticals, Inc. Antisense inhibition of clusterin expression

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5721237A (en) * 1991-05-10 1998-02-24 Rhone-Poulenc Rorer Pharmaceuticals Inc. Protein tyrosine kinase aryl and heteroaryl quinazoline compounds having selective inhibition of HER-2 autophosphorylation properties
US5646042A (en) * 1992-08-26 1997-07-08 Ribozyme Pharmaceuticals, Inc. C-myb targeted ribozymes
US5417978A (en) * 1993-07-29 1995-05-23 Board Of Regents, The University Of Texas System Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
ATE234919T1 (de) * 1993-12-23 2003-04-15 Biognostik Ges Antisense nukleinsäuren zur vorbeugung und behandlung von beschwerden in welchen die exprimierung von c-erbb-2 eine rolle spielt
AUPM672594A0 (en) * 1994-07-08 1994-08-04 Royal Children's Hospital Research Foundation A method for the prophylaxis and/or treatment of proliferative and/or inflammatory skin disorders
US5789389A (en) * 1995-03-17 1998-08-04 Board Of Trustees Of University Of Illinois BCL2 derived genetic elements associated with sensitivity to chemotherapeutic drugs
US5855911A (en) * 1995-08-29 1999-01-05 Board Of Regents, The University Of Texas System Liposomal phosphodiester, phosphorothioate, and P-ethoxy oligonucleotides
NZ331217A (en) * 1996-02-14 2000-02-28 Novartis Ag Sugar-modified gapped oligonucleotides for eliciting RNase H activity for strand cleavage in an opposing strand
US5910583A (en) * 1996-11-04 1999-06-08 Duke University Antisense oligonucleotides against ERBB-2
US6335194B1 (en) * 1998-09-29 2002-01-01 Isis Pharmaceuticals, Inc. Antisense modulation of survivin expression
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6900187B2 (en) * 1999-02-26 2005-05-31 The University Of British Columbia TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
US5998148A (en) * 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US7569551B2 (en) * 2000-02-25 2009-08-04 The University Of British Columbia Chemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides
WO2002097114A2 (en) * 2001-05-29 2002-12-05 Sirna Therapeutics, Inc. Nucleic acid treatment of diseases or conditions related to levels of ras, her2 and hiv
WO2003062421A1 (en) * 2002-01-17 2003-07-31 The University Of British Columbia Bispecific antisense olignucleotides that inhibit igfbp-2 and igfbp-5 and methods of using same
US7019017B2 (en) * 2002-05-14 2006-03-28 Baylor College Of Medicine Small molecule inhibitors of HER2 expression
SI1530636T1 (sl) * 2002-08-21 2010-12-31 Stry Liaison Ofiice The University Of British Columbia Umiversity Indu Zdravljenje melanoma z zniĹľanjem nivojev klusterina
KR101238701B1 (ko) * 2002-08-21 2013-03-05 더 유니버시티 오브 브리티쉬 콜롬비아 암-관련 단백질을 표적으로 하는 알엔에이아이 프로브
US20040224914A1 (en) * 2003-04-18 2004-11-11 The University Of British Columbia Method for treatment of angiogenic disorders
US20040220131A1 (en) * 2003-04-18 2004-11-04 The University Of British Columbia Method for treatment of cancerous angiogenic disorders
US8710020B2 (en) * 2004-04-02 2014-04-29 The University Of British Columbia Clusterin antisense therapy for treatment of cancer
CA2584646C (en) * 2004-11-23 2015-11-03 The University Of British Columbia Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000049937A2 (en) 1999-02-26 2000-08-31 The University Of British Columbia Trpm-2 antisense therapy
US20020128220A1 (en) 1999-02-26 2002-09-12 Martin Gleave TRPM-2 antisense therapy
US6383808B1 (en) 2000-09-11 2002-05-07 Isis Pharmaceuticals, Inc. Antisense inhibition of clusterin expression

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BIROCCIO A. ET AL: "Antisense clusterin oligodeoxynucleotides increase the response of HER-2 gene amplified breast cancer cells to Trastuzumab", J CELL PHYSIOL, vol. 204, no. 2, August 2005 (2005-08-01), pages 463 - 469, XP002517624 *
BIROCCIO A. ET AL: "The future of antisense therapy: combination with anticancer treatments", ONCOGENE, vol. 22, 2003, pages 6579 - 6588, XP008118435 *
CHUNG J. ET AL: "Enhanced chemosensitivity of bladder cancer cells to cisplatin by suppression of clusterin in vitro", CANCER LETT, vol. 203, no. 2, January 2004 (2004-01-01), pages 155 - 161, XP008118434 *
CIARDIELLO F., TORTORA G.: "A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor", CLIN CANCER RES, vol. 7, no. 10, October 2001 (2001-10-01), pages 2958 - 2970, XP001153753 *
See also references of EP1814595A4
TROUGAKOS I.P. ET AL: "Silencing expression of the clusterin/apolipoprotein J gene in human cancer cells using small interfering RNA induces spontaneous apoptosis, reduced growth ability, and cell sensitization to genotoxic and oxidative stress", CANCER RES., vol. 64, no. 5, 1 March 2004 (2004-03-01), pages 1834 - 1842, XP002517626 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9074209B2 (en) 1999-02-26 2015-07-07 The University Of British Columbia TRPM-2 antisense therapy
US9512211B2 (en) 2009-11-24 2016-12-06 Alethia Biotherapeutics Inc. Anti-clusterin antibodies and antigen binding fragments and their use to reduce tumor volume
US9457045B2 (en) 2011-03-15 2016-10-04 The University Of British Columbia Combination of anti-clusterin oligonucleotide with Hsp90 inhibitor for the treatment of prostate cancer
WO2013123588A1 (en) * 2012-02-22 2013-08-29 Alethia Biotherapeutics Inc. Co-use of a clusterin inhibitor with an egfr inhibitor to treat cancer
CN104159611A (zh) * 2012-02-22 2014-11-19 阿莱斯亚生物疗法股份有限公司 共使用簇集蛋白抑制剂和egfr抑制剂以治疗癌症
US9822170B2 (en) 2012-02-22 2017-11-21 Alethia Biotherapeutics Inc. Co-use of a clusterin inhibitor with an EGFR inhibitor to treat cancer
MD20140101A2 (ro) * 2013-02-22 2015-02-28 Alethia Biotherapeutics Inc. Utilizarea concomitentă a unui inhibitor al clusterinei cu un inhibitor al EGFR pentru tratamentul cancerului

Also Published As

Publication number Publication date
PT1814595E (pt) 2014-04-02
DK1814595T3 (da) 2014-03-31
JP4980919B2 (ja) 2012-07-18
AU2005309274A1 (en) 2006-06-01
EP1814595B1 (en) 2014-01-08
CA2584646A1 (en) 2006-06-01
EP1814595A1 (en) 2007-08-08
US20080014198A1 (en) 2008-01-17
SI1814595T1 (sl) 2014-06-30
ES2456017T3 (es) 2014-04-21
CA2584646C (en) 2015-11-03
JP2008520591A (ja) 2008-06-19
PL1814595T3 (pl) 2014-08-29
EP1814595A4 (en) 2009-04-15
AU2005309274B2 (en) 2011-07-21
US20110142827A1 (en) 2011-06-16

Similar Documents

Publication Publication Date Title
Faltus et al. Silencing of the HER2/neu gene by siRNA inhibits proliferation and induces apoptosis in HER2/neu-overexpressing breast cancer cells
US20110142827A1 (en) Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels
Kunisue et al. Anti-HER2 antibody enhances the growth inhibitory effect of anti-oestrogen on breast cancer cells expressing both oestrogen receptors and HER2
US8541390B2 (en) Treatment of cancer by inhibition of IGFBPs and clusterin
Singh et al. Nuclear factor-κB activation: A molecular therapeutic target for estrogen receptor–negative and epidermal growth factor receptor family receptor–positive human breast cancer
Hu et al. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo
WO2008001219A2 (en) Cancer therapy using bcl-xl-specific sina
Thybusch-Bernhardt et al. Ribozyme targeting of HER-2 inhibits pancreatic cancer cell growth in vivo
EP3468564A1 (en) Methods for diagnosing and treating metastatic cancer
KR101913693B1 (ko) SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
WO2010065437A1 (en) Modulation of olfml-3 mediated angiogenesis
CN101821410B (zh) 印迹位点调节物兄弟(boris)的基因沉默
DK2257299T3 (en) Modulation of SRPX2-mediated angiogenesis
Deezagi et al. Assessment of the synergic effect of Avastin and VEGF siRNA on inhibition of cell proliferation and angiogenic factor expression of human breast cancer cells
KR20230069219A (ko) HER2를 표적화하여 합성된 miRNA를 함유하는 엑소좀 및 약물 조성물
EP2012823A2 (en) Combination therapy product and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2005309274

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2584646

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2005810600

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2005309274

Country of ref document: AU

Date of ref document: 20051122

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005309274

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 11718815

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2007541607

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWP Wipo information: published in national office

Ref document number: 2005810600

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 11718815

Country of ref document: US