WO2006054792A1 - Springiness and stiffness improving agent for hair and cosmetic preparation for hair - Google Patents

Abstract

This invention provides a springiness and stiffness improving agent for hair comprising as an active ingredient at least one compound selected from the group consisting of N-acetyl-DL-serine, O-acetyl-L-serine, N-acetylglycine, O-phospho-L-serine, phosphoglyceric acid, glycylserine, and pharmaceutically acceptable salts thereof, and a cosmetic preparation for hair.

Description

Hair paste · Strain improver and hair cosmetics

 The present invention relates to a drug for improving hair tension and hair and a cosmetic for hair containing the drug. More specifically, the present invention relates to a hair-related gene by activating cells of hair and capsule. The present invention relates to a drug that improves hair tension and stiffness by increasing the expression of hair, and a cosmetic for hair containing the drug. Background art

 Concerns about hair include those related to the health of the roots and hair follicles, such as thin hair and hair loss, and those related to the physical properties of the hair such as hard, soft, non-sticky, split, comb hair, and passac. In addition, even if it is a problem related to the physical properties of the hair, damage caused by external factors such as perm and bleach treatment, exposure to ultraviolet light, exposure to air pollutants, combing friction, etc. It can be considered that the damage is caused by internal damage and the internal factors in the hair shaft formation.In the latter case, not only the hair quality is improved, but also the hair root and the hair follicle itself. Care is required to improve the health condition, so even if the hair quality of a mouthful is not good, there are various ways to care for it.

The hair itself is made up of a cuticle that covers the surface of the hair, fur that occupies the majority of the hair, and the medulla of the center. It has been shown that cutil contributes greatly to the firmness of hair (K. Sogabe et al., J. Soc. C C he m. J apan, V ol. 3 6, No. 3 (2 0 0 2) pp. 2 0 7-2 1 6 "Study on physical properties of hair 1 — Measurement of short diameter and long diameter of hair ¾ Bending stress evaluation method "). Cuticles are acidic hair keratins Hal, Ha2, basic keratins Hbl, Hb2, and other fiber proteins and modifying enzymes such as transglutaminase, peptidylarginine diminase, and even the granule component trichohyalin It consists of various components such as S100. However, the relationship between each of these components and hair quality, such as hair tension and hair, has not been fully elucidated. If the mechanism that influences the hair quality is fully elucidated at the biochemical and molecular biology levels, it will be possible to provide products that have a more remarkable effect than existing hair improvers.

 Examples of conventional hair cosmetics that are supposed to impart hair and sash to hair include, for example, a silyl group having a reactive functional group bonded thereto as described in JP-A No. 1 1-3 0 2 1 2 9. A hair treatment composition containing a copolymer having a group, which forms a siloxane bond S i 10—S i by hydrolysis on the hair, thereby cross-linking the copolymer molecules. There are some that give firmness and firmness to the hair. However, these conventional hair cosmetics are coated on the surface of the hair and penetrate into the hair or are absorbed by the hair follicle to activate the cells of the hair and hair follicle. Doing so does not improve hair tension.

On the other hand, a cell activator containing taurine as an active ingredient is disclosed in Japanese Patent Application Laid-Open No. 2 0 2-9 7 1 1 6, and a cell activator containing N-methyl taurine as an active ingredient and a hair scalp / stiffener are internationally available. Each is described in the published WO 2 0 0 2/0 3 4 2 5 3 publication. The effects of these drugs include hair cell control and hair growth through activation of cell proliferation. Hair extension and hair improvement are described, but the effect of hair extension and hair improvement is still evaluated by the physical property test (torsion torque) of hair. . Therefore, there is a need for a new hair squeeze and hair improver that can be used to evaluate activity at the biochemical and molecular biology levels. Disclosure of the invention

 It is an object of the present invention to provide a novel hair squeeze / strain improving agent based on activity evaluation at the biochemical / molecular biological level.

 The present inventor has investigated the correlation between hair tension (hardness as a scale, more specifically, Young's modulus) and expression of hair-related genes, and found that hair keratin genes, particularly hair keratin H a 2 genes, hair keratin H b 2 gene and / or keratin-related protein KA P 5.1 1-5, more preferably the expression of keratin H a 2 gene, KA P 5.1 gene, We found that the higher the expression of the KA P5.2 gene or KAP5.4 gene, the higher the Young's modulus of the hair, that is, that the hair felted and felt stiff, and the `` hair keratin gene was used as an index. A Japanese patent application has been filed for “a method for evaluating hair quality” (Japanese Patent Application No. 2000- 1 6 4 5 9 6).

 The present inventor has recently constructed a new assembly system for evaluating the effects of various drugs on the expression of hair-related genes. Using this assembly system, various compounds affect the expression of hair-related genes. As a result of intensive studies on the effect, it was found that certain drug compounds have the effect of increasing the expression of hair-related genes, and the present invention has been completed.

That is, the present invention relates to 0-phosphoserine, phosphodaricelic acid, selenium ester, benzyloxycarbonylserine, O-benzene. Lucerin, Glycylselin, Acetyldaricin, Glycylglycine, Hipotaurine, Thiotaurine, Methionine methyl ester, Bibutamin U, 2 —Amino 6 — (Methylsulfonyl) benzothiazole, N— (2 —Case 1) 2-aminoaminosulfonic acid, dimethyl 41- (acetylamino) cyclohexane 1,3-dicarboxylate, taurocyanine, thiazolidine 1-2 mono-rubonic acid, 3- (2-benzo) Thiazolylthio) ― 1 monopropans, sodium sulfonate, L-homocerine, N-benzyl-L-serine, H- Ser — V a 1-OH, 2 — amaminobenzothiazole, (2 — Amino 4-Achiazolyl) Acetic acid, Celin, Acetyl serine, Serine methyl ester, Glycine, Cystine, Cystine, Acetyl cis Selected from the group consisting of tin, homocystic acid, methionine, dalyuthione, folic acid, vitamin B6, bivitamin B12, adenosine, dibutyl cAMP and their pharmaceutically acceptable salts The present invention relates to an agent for improving hair tension and strain, which comprises one or more compounds as active ingredients.

The present invention also includes: o phosphoserine, phosphodariceric acid, cerethyl ester, benzyloxycarbonyl serine, o-benzyl serine, glycyl serine, acetyl daricin, glycyl glycine, hypotaurine, titaurine, metholine Nin methyl ester, bi-amino M, 2 —amino 6- (methylsulfonyl) benzothiazol, N-(2 —acetamido) 1 2-amino ether sulfonic acid, dimethyl 4 _ (acetylamino) Cyclohexane 1,3 —dicarboxylate, taurocyanine, thiazolidine one 2 —powered rubonic acid, 3 — (2-benzothiazolylthio) 1 1 sodium propanesulfonate, L—homoserine, N—be Njiru L—Serine, H—Ser — V a 1 1 OH, 2 —Aminobenzothiazol, (2 —Amino — 4 Thia Zoriru) acetic acid, serine, Asechiruseri down, serine methyl ester, Glycine, cystine, cystine, acetyl cystine, homocysteic acid, methionine, dalbution thione, folic acid, vitamin B 6, bibutamin B 12, adenosine, dibutyl c AMP and their pharmaceutically acceptable The present invention relates to a cosmetic for hair comprising one or more compounds selected from the group consisting of salts.

 The present invention also provides: o Phosphoserine, phosphoglycerin acid, selenium ester, benzyloxycarbonyl seleline, O-benzylserine, glycylserine, acetylidaricin, glycylglycine, hypotaurine, thiotaurine, methionine Methyl ester, biminine U, 2 —amino-6 — (methylsulfonyl) benzothiazol, N— (2 —acetamido) 1-2 —aminobenzene sulfonic acid, dimethyl 4 mono (acetylylamino) cycloto Xanthone 1,3 —dicarboxylate, taurocyanine, thiazolidine one 2 —strong rubonic acid, 3 — (2 —benzothiazolylthio) 1-1 sodium propanesulfonate, L monohomoserine, N— Benjirou L-Serine, H—Ser — V a 1 1 OH, 2 —amino, benzothiazol, (2 — 4) 1 thiazolyl) Acetic acid, selenium, acetyl selenium, selenium methyl ester, glycine, cystine, cystine, acetyl cystine, homocysteic acid, methionine, dartathione, folic acid, vitamin B 6, vitamin Applying to the hair or scalp a hair cosmetic comprising at least one compound selected from the group consisting of Min B12, adenosine, dibutyl cAMP and pharmaceutically acceptable salts thereof. The present invention relates to a method for improving hair sticking.

The present invention also includes: o phosphoserin, phosphodariceric acid, selenium ester, benzyloxycarbonyl selenium, O-benzylserine, glycylserine, acetylidaricin, glycylglycine, hypotaurine, titaurine, methacryline ONIN METHYL ESTER U, 2 —amino 6 — (methylsulfonyl) benzothiazol, N-(2 —acetamido) 1 2 —amino sulfonic acid, dimethyl 41 (acetylamino) cyclohexane 1 , 3-dicarboxylate, taurocyanine, thiazoline 1 2 —carboxylic acid, 3 — (2 monobenzothiazolylthio) -1 sodium propanesulfonate, L 1 homoselin, N—benzyl 1 L 1 , H—Ser — V a 1 —〇H, 2 —aminobenzothiazol, (2 —amino _ 4 _thiazolyl) acetic acid, selenium, acetylsylline, selenium methyl ester, glycine, cystine , Cystine, acetyl cystine, homocystic acid, methionine, glutathione, folic acid, vitamin B 6, bivitamin B 12, adenosine, dibutyl cAMP and their pharmaceuticals About acceptable method for producing a hair cosmetic, characterized in that one or more compounds selected from the group consisting of salt added to the aqueous phase or oil phase to produce a hair cosmetic.

 The hair patch / scrubbing improver and the cosmetic for hair containing the pharmaceutical compound of the present invention are used in the hair or scalp, so that they penetrate into the hair or are absorbed into the hair follicle, and keratin-related protein KAP in the cell. Increases the expression of 5 and improves hair tension. Brief Description of Drawings

 Figure 1 shows a comparison of the amino acid sequences of putative code proteins of human KAP 5.1-5.1 genes.

 FIG. 2 shows the expression regulation of the K A P5 gene group.

 FIG. 3 shows the relationship between the expression level of the hair keratin H a 1 gene and the Young's modulus of the hair.

FIG. 4 shows the relationship between the expression level of the hair keratin Ha 2 gene and the Young's modulus of the hair. FIG. 5 shows the relationship between the expression level of the hair keratin Hb2 gene and the Young's modulus of the hair.

 Figure 6 shows the relationship between the expression level of KAP5.2 gene and the Young's modulus of hair. .

 FIG. 7 shows the relationship between the expression level of KAP 5.1 and KAP 5.4 genes and the Young's modulus of hair.

 Figure 8 shows the construction and configuration of KA P5.1 Repo overnight plasmid. Figure 8 — A shows PCR amplification of DNA fragment containing KA P 5.1 gene and KA P 5.2 gene, and Figure 8 — B shows report of amplified DNA fragment, plasmid vector p GL— 3 Indicates closing to basic.

 Fig. 9 is a construction diagram of the KA P5.1 repo overnight plasmid following Fig. 8, showing deletion of the KAP 5.1 gene translation region (after the start codon) by subcloning. Best Mode for Carrying Out the Invention

 TECHNICAL FIELD The present invention relates to a drug and a cosmetic for hair that improve hair lashes and hair by activating cells of hair and hair follicles, and more specifically, by increasing expression of hair-related genes. Based on the activity evaluation at the biochemical and molecular biology level, more specifically, a novel hair squeeze / scrubbing improver and hair cosmetics based on the expression control effect of the keratin-related protein KAP 5 gene It is to be provided.

The present inventor has already filed Japanese Patent Application No. 2 0 0 4-1 6 4 5 9 6 "Hair quality evaluation method using hair keratin gene as an index" and various genes extracted from hair hardness and hair In order to investigate the correlation, the Young's modulus, which is an index of hair hardness, is measured. The relationship between gene expression and RT-PCR expression levels was analyzed statistically using Spearman's forward phase relation number (Zar, JHJ Amer. Stat. A ssoc. 67: 578-580, 1970 “S As a result, if the Young's modulus of the hair is high expression level of hair keratin Ha 2, KAP 5.1, KAP 5.2, KAP 5.4 gene It was found that the increase was statistically significant (for details of the results, see “Relationship between hair keratin gene and hair quality” in Examples of the present specification). It was also found that when the expression level of the hair keratin Hb2 gene is high, the Young's modulus of hair is increased, although not statistically significant. On the other hand, there was no correlation with the hardness of the hair for other constituent proteins of fur, such as hair keratin Ha1. Therefore, it was suggested that cuticle constituent proteins and related genes are more likely to be involved in hair hardness than fur.

 The hair keratin Ha 2 gene (NCBI GenBANK Source “X90761”) codes for an acidic protein that is a member of the keratin gene family. Hair keratin H a 2 is type I keratin, and heterodimerizes with type II keratin to form hair, nails and the like. Type I keratin is located in chromosome 17Q12-Q21.

 The hair keratin H b 2 gene (NCBI GenBANK Source “Y19207”) encodes a basic protein that is a member of the keratin gene family. Hair keratin H b 2 is type II keratin, which is heterodimerized with type I keratin to form hair and nails. Type II keratin is located in chromosome 12cil3 region.

 Human keratin-related protein (KA P) 5 family 5 K A P 5.1-5 gene (laying IJ number 1-5) (Homo sapiens genomic

DNA, chromosome 11 clone: RP11-684B2, complete sequences. AC CESSION: AP000867) is a human EST whose base sequence is already known, and no function has been reported. The relationship between increased KAP 5.1-5 gene expression and hair firmness was unclear. Although not particularly bound by any theory, for example, the putative protein encoded by the KA.P5.2 gene is a cystine-rich (about 35.5%) and is a low molecular amino acid, glycine. Rich in syn and selenium (18.8% and 24.2%, respectively) Since it consists of 1 86 amino acids, it does not form a secondary structure such as a-helix and easily enters between keratin fibers It is also possible to form a large number of hydrogen bonds by the OH group of a large number of cerine residues, which may greatly contribute to the mechanical strength of the hair. The other KAP 5 genes are also rich in cystine, glycine and serine, and the expression product has the same structure as KAP 5.2, which is considered to contribute greatly to the mechanical strength of hair. Table 1 below shows the partial amino acid composition of the KAP 5.1 to 5 gene predicted code protein. Table 1 Human KAP ⁵ .x characteristics of

 .contents

 aa residues MW (kDa) pi Cys Ser Glv Pro

 KAP5.1 164 15.0 8.06 59 35 37 8

 36.0% 21.3% 12.6% 4.9%

 KAP5.2 186 17.4 8.30 66

 35.5%

 KAP5.3 168. 16.1 8.34 60 39 27 10

 35.7% 23.2% 16.1% 6.0%

 KAP5.4 201 17.9 8.20 66 37 59 8

 • 32.8% 18.4% 29.4% 4.0%

 KAP5.5 155 14.5 8.17 55 35 30 8

 35.5% 22.6% 19.4% 5.5%.

The KAP δ .1 to 5.5 genes (SEQ ID NOs: 1 to 5) are a group of genes having a relatively high homology to each other belonging to the family KAP5 family of keratin-related proteins. The high degree of homology between the amino acid sequences of the putative proteins encoded by each gene is shown in Fig. 1 and Table 2 below. it is obvious.

 ■ ϊ Table 2 Human KAP5.X—Amino Acid Sequence Homology—

 KAP5.1 KAP5.2 AP5.3 KAPS.4

 KAP5.2 86-

KAP5.3 72 74

 KAP5.4 69 68 52

 AP5.5 81 70 72 63

The present inventor has found that keratin H a 2, H b 2 gene, hyal keratin related protein KAP 5.1, KAP 5.2, A Among the Ρδ.4 genes, a reporter assembly system was newly constructed to evaluate the effect of various drugs on the expression of hair-related genes, especially for the Κ Κ δδ.1 gene. Using this Atsy system, we examined the effects of various compounds on the expression of Κ Α Ρ 5.1 genes. As a result, it was found that certain pharmaceutical compounds have the effect of increasing the expression of the KA 51 gene.

 As described above, the K A P 5.1 to 5.5 genes (SEQ ID NOs: 1 to 5) are a group of genes having a relatively high homology with each other belonging to the human keratin-related protein K A P 5 family. In addition, as can be seen from Fig. 2, the promoter region sequence of the KAP 5.1 gene and the promoter region sequences of other KAP δ. 2-5.5 genes are very close to each other. It is likely that they are equivalent. Therefore, it is highly likely that a drug that enhances the expression of the K A Ρ5.1 gene also enhances the expression of other K A P5 genes.

Furthermore, as described above, the higher the expression level of the KAP 5.1 gene, the statistically significant increase in the Young's modulus of the hair. 1. Drugs that increase gene expression increase hair hardness and improve hair tension.

 In the present invention, the hair cosmetics and hair cosmetics that are expected to have an effect of improving the hair are agents that have been found to have an effect of enhancing the expression of hair-related genes in the examples described later. These are: (1) Serine, Glycine Cystine and its derivatives, precursors; (2) other sulfur-containing amino acids; (3) other sulfur-containing compounds; (4) vitamins; (5) adenylate cyclase activator Can be classified as:

Among the pharmaceutical compounds of the present invention, (1) Serine, glycine, cystine and its derivatives, and precursors belong to the following: Phospho L-serine), Phosphoglycerin acid, Phosphohydroxypyruvate, Selenium ester, Benzyloxycarboxylated serine derivatives (Z-serine derivatives), Benzylinserine (H-Ser -OB z 1), glycycylline, acetylidaricin (N-acetylidylicin), glycylglycine, pharmaceutically acceptable salts thereof, such as barium phosphoglycerate, acetylsylline (N-acetyl) DL selenium, O-acetyl L-serine), selenium methyl ester, cystine, acetyl cysteine, homocysteic acid, pharmaceutically acceptable Such as DL-cystine hydrochloride, glycine basic salt (A 1), acetylmethyl ester hydrochloride, dihydrochloric acid-D-cystine, dihydrochloric acid-L monocystine, L-cystine hydrochloride, D-cystine hydrochloride , O-acetylyl L-serine hydrochloride, and the like. Examples of benzyloxycarbonylated selenium derivatives (Z—Ser derivatives) include benzyloxycarbonylselin (Z—Ser—〇H), benzyloxycarbonyl mono-N-methylserine (Z—). N—M e —S er —OH), benzyloxyloxyl 0-benzylserine (Z—Ser —〇 B z 1) , Taurocyanine, thiazolidin mono-2-carboxylic acid, 3-(2-benzothiazolylthio) mono-propane monosulphonate sodium, L-homocerine, N-benzilup L-serine, H—Ser —Val —〇 H, 2-aminobenzothiazol, (2-amino-4thiazolyl) acetic acid These include pharmaceutically acceptable salts thereof.

 Among these, preferable drugs to be included in hair cosmetics are:

—Phosphoserine, phosphodariseric acid, phosphohyde, do □ xypyruvic acid, selenium ester, benzyloxycarboxylin (Z

-S e r-O H), O 1 benzylserine (H _ S e r 10 B z 1)

Glycylacerine, acetylidaricin, glycyl U-sin, pharmaceutically acceptable salts thereof such as benzylserine inn salt (H-

Ser-OB zl · HC 1), phosphoglycerin ha, Um, serine, acetyl selenium, serine methyl ester, dalysin, cystine, cystine, acetyl cystine, homocystic acid, methionine, dartathione, folic acid Vitamin B 6, vitamin B 12, adenosine, dibutyl cAMP and the like.

 Among the pharmaceutical compounds of the present invention, (2) those belonging to other sulfur-containing anoic acids include methionine, hypotaurine, thiothurine, methionine methyl ester, and vitamin U (methylmethionine sulfonium salt, for example, Methyl methionine sulfone chloride, bromide, iodide), and pharmaceutically acceptable salts thereof, such as methionine methyl ester hydrochloride.

 Among these, preferable drugs to be included in hair cosmetics are methionine, hypotaurine, thiotaurine, methionine methyl ester, vitamin U chloride (methylmethionine sulfochloride).

And pharmaceutically acceptable salts thereof.

Among the pharmaceutical compounds of the present invention, (3) those belonging to other sulfur-containing compounds For example, daryuthion, 2-ananobenzothiazole, 2-amino- 6- (methylsulfonyl) benzothiazole, N-I- (amino acid sulfone), 2-aminoaminosulfonic acid, 2-(Aminnochi)

(4) Among the pharmaceutical compounds of the present invention, which include sulfonic acid, and pharmaceutically acceptable salts thereof, (4) those belonging to the biminines include folic acid, vitamin Β6 (pyridoxine, Doxal, pyridoxamin), vitamin B 12 (also called balamin, including cyanocobalamin, methylcobalamin, adenosylcobalamin, etc.), pharmaceutically acceptable salts thereof such as sodium folate Rium salt, pyridoxine hydrochloride, etc. are included.

 Among the pharmaceutical compounds of the present invention, those belonging to (5) adenylate cyclase activation substance include adenosine, dibutyl c A Μ Ρ, dimethyl 4- (acetylamino) cyclohexane 1,3-dicarboxylate, and these pharmaceuticals Pharmaceutically acceptable salts such as dibutyl cAMP sodium phosphate. Among these, preferable drugs to be included in hair cosmetics are dibutyl C. AMP, dimethyl 4- (acetylamino) cyclohexane-1,3-dicarboxylate, and its pharmaceutically acceptable drugs. Salt.

 “Pharmaceutically acceptable salt” refers to a salt that retains substantially the same biological activity as a drug compound and is not toxic. Examples of such salts include, but are not limited to, (1) a hydrogen ion of an acid group such as a strong lpoxyl group, a phosphoric acid group, etc. contained in a drug compound, sodium, strong rhodium, calcium Salts substituted with cations such as metal ions such as magnesium ions and aluminum ions, (2) inorganic acids

(For example, acid addition salts formed with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.) (3) Acetic acid, oxalic acid, tartaric acid, succinic acid, phosphorus And salts formed with organic acids such as oxalic acid, fumaric acid, maleic acid, ascorbic acid, benzoic acid, and the like (4) hydrates. Examples of pharmaceutically acceptable salts include barium phosphodariselic acid, selethyl ester hydrochloride, methysine ester ester hydrochloride, 〇-benzylserine hydrochloride (H-Ser —〇 B z 1 · HC 1), benzoxycarbonoline benzene selenium hydrochloride (Z—Ser OB zl 'HC l), etc. ,

 The drug compound of the present invention may be an optical isomer when an optical isomer exists. The drug compound of the present invention can include any of L-form, D-form, a mixture thereof and a racemic mixture. In addition, enantiomeric isomers can exist when one or more chiral centers are present in a pharmaceutical compound, and diastereoisomers can exist when two or more chiral centers exist. The pharmaceutical compounds of the present invention can include any of the enantiomers, diastereoisomers, mixtures thereof and racemic mixtures.

 The dosage form of the hair cosmetic composition containing the pharmaceutical compound of the present invention is not particularly limited, and may be any form commonly used for improving hair stiffness. Examples include liquid, emulsion, emulsified cream, cream, jewel, wax, mist, foam, aerosol and the like. The cosmetic for hair of the present invention can be applied as products such as hair liquid, hair tonic, hair cream, moose, treatment, hair restorer, shampoo, rinse, cream, milky lotion, pack, and the like.

 The compounding amount of the pharmaceutical compound of the present invention depends on the dosage form of the hair cosmetic, but is generally from 0.001 to 20% by mass, preferably from 0.01 to 5% by mass in the total amount of the hair cosmetic. %.

The hair cosmetic composition of the present invention contains, as necessary, general cosmetic ingredients of cosmetics, quasi-drugs, and pharmaceuticals as long as the effects of the present invention are not impaired. Can be prepared by conventional methods. General ingredients include, for example, powder components, liquid fats and oils, solid fats and oils, waxes, hydrocarbon oils, higher fatty acids, higher alcohols, ester oils, silicone oils, anionic surfactants, cationic surfactants, amphoteric surfactants, Nonionic surfactant, moisturizer, water-soluble polymer, thickener, film agent, UV absorber, sequestering agent, lower alcohol, polyhydric alcohol, sugar, amino acid, organic amine, polymer emulsion PH preparation agent, skin nutrition, agent, vitamin, antioxidant, antioxidant aid, fragrance, water, etc.

 The example of the component which can be specifically mix | blended is as follows. Hair cosmetics are produced by a conventional method according to the intended dosage form by blending one or more of the following ingredients as required.

 Inorganic powders: talc, kaolin, mica, sericite (sericite), muscovite, phlogopite, synthetic mica, saucite, biotite, permquilite, magnesium carbonate, calcium carbonate, aluminum silicate, silicate Calcium, calcium silicate, magnesium silicate, strontium silicate, metal tungstate, magnesium, silica, zeolite, barium sulfate, calcined calcium sulfate (baked gypsum), phosphoric acid power, ruthenium, fluorine apatite, Droxyapatite, ceramic powder, metal sarcophagus (zinc myristate, calcium palmitate, aluminum stearate), boron nitride.

 Organic powder: Polyamide resin powder (Nylon powder), Polyethylene powder, Polymethylmethyl methacrylate powder, Polystyrene powder, Copolymer resin powder of styrene and acrylic acid, Benzoguanamine resin powder, Polytetrafluoroethylene Powder, cellulose powder.

Inorganic pigments: Inorganic white pigments (titanium dioxide, zinc oxide), inorganic red pigments {iron oxide (bengala), iron titanate}, inorganic brown pigments (Ύ iron monoxide), inorganic yellow pigments (yellow iron oxide, Ocher), inorganic black pigment (Black iron oxide, low-order titanium oxide), inorganic purple pigment (mango violet, cobalt violet), inorganic green pigment (chromium oxide, chromium hydroxide, cobalt titanate), inorganic blue pigment (ultraviolet) Pearl pigments (titanium oxide coating strength, titanium oxide coating bismuth chloride chloride, titanium oxide coating talc, colored oxide coating strength, bismuth oxide chloride, fish scale foil).

, Metal powder pigment (Aluminum powder, Kappa powder).

 Organic pigment: Red 2 01, Red 2 02, Red 2 04, Red 2 05, Red 2 2 0, Red 2 2 6, Red 2 2 8, Red 4 0 5 , Orange 20 3, orange 2 0 4, yellow 2 0 5, yellow 4 0 1, and blue 4 0 4, red 3, red 1 0 4, red 1 0 6, red 2 2 7, Red 2 30, Red 4 0 1, Red 5 0 5, Orange 2 0 5, Yellow 4, Yellow 5, Yellow 2 0 2, Yellow 2 0 3, Green 3 No., Blue No. 1, Natural pigment (Chlorophyll, _Carotene).

 Liquid oils and fats: Apogade oil, camellia oil, Yuichi Toru oil, Macadamiana oil, corn oil, mink oil, olive oil, rapeseed oil, egg yolk oil, sesame oil, Pacific oil, wheat germ oil, Southern Power oil, Castor oil, Amani oil, Safflower oil, Cottonseed oil, Eno oil, Soybean oil, Peanut oil, Teaseed oil, Kaya oil, Rice bran oil, Sinagiri oil, Nippon Kiri oil, Jojoba oil, Germ oil , Triglycerin.

 Solid fats: cocoa butter, coconut oil, horse fat, hardened coconut oil, palm oil, beef tallow, sheep fat, hardened beef tallow, palm kernel oil, pork tallow, beef bone fat, mallow wax core oil, hardened oil, cattle Leg fat, mole, hardened castor oil.

Wax: beeswax, candelilla wax, cotton wax, carnauba wax, beveri wax, warts evening wax, whale wax, montan wax, nukarou, lanolin, kapok wax, lanolin acetate, liquid lanolin, sugarcane wax, ranoli Fatty acid isopropyl, lauryl hexyl, reduced Norin, jojoba wax, rigid lanolin, shellac wax, polyoxyethylene (hereinafter referred to as “P0 E”) lanolin alcohol ether, P0 E lanolin alcohol acetate, P0 E cholesterol ether Lanolin fatty acid polyethylene lenglycol, POE hydrogenated lanolin alcohol ether.

 Hydrocarbon oil: Fluid paraffin, ozokerite, squalene, pristane, noraffine, ceresin, squalene, ヮ, selenium, microcrystalline wax.

 Higher fatty acids: lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, oleic acid, undecylenic acid, tall oil fatty acid, isostearic acid, linoleic acid, linoleic acid, eicosapentaene Acid (EPA), docosahexaenoic acid (DHA).

 Higher alcohols: straight chain alcohols (lauryl alcohol, cetyl alcohol, stearyl alcohol, behenyl alcohol, myristyl alcohol, old rail alcohol, cetostearyl alcohol), branched chain alcohol (batyl alcohol, 2-decyltetradecinol) , Lanolin alcohol, cholesterol, phytosterol, hexyl dodecanol, isostearyl alcohol, octyldodecanol).

Ester oil: isopropyl myristate, cetyl octanoate, octyldodecyl myristate, isopropyl palmitate, ptyl stearate, hexyl laurate, myristyl myristate, decyl oleate, hexyldecyl dimethyloctanoate, Cetyl lactate, myristyl lactate, lanolin acetate, isocetyl stearate, isocetyl isostearate, cholesteryl hydroxosterate, ethylene glycol di-2-ethylhexylate, dipentaerythritol Fatty acid ester, N-alkyl monoisostearate Glycol, neopentyldarlicol dicaprate, disostearyl phosphonate, G 2 -glycerin heptylundecanoate, tri 2 -trimethylolpropane triethyl stearate, trimethylolpropane triisostearate, Tetra-2--ethylhexanoic acid pen erythritol, tri--2-ethyl glycerin triethylhexanoate, glyceryl trioctanoate, glycerin triisopalmitate, trimethylolpropane trisisosterate , Cetyl, 2-ethyl hexanoyl ester, 2-ethyl hexyl palmitate, trimyristylate glycerin, tri-2-heptylundecanoate glyceride, castor oil fatty acid methyl ester, oleate oleate, Casetoglyceride, palmitic acid 2_heptyl Undecyl, diisoptyl adipate, N-lauroyl- L monoglutamate-2-octyldodecyl ester, adipic acid 2 — heptylundecyl, ethyl laurate, disebacate di-2-ethyl hexyl, myristic acid 2_ Xyldecyl, palmitic acid 2 — hexyldecyl, adipic acid 2 — hexyldecyl, sebacic acid-diisopropyl, succinic acid 2 — ethylhexyl, triethyl citrate.

 Silicone oil: Chain polysiloxane (dimethylpolysiloxane, methylphenylpolysiloxane, diphenylpolysiloxane), cyclic polysiloxane (octamethylcyclotetrasiloxane, decamethylcyclopentasiloxane, dodecamethylcyclohexylsiloxane) ), 3D network silicone resin, silicone rubber, modified polysiloxane (amino modified polysiloxane, polyether modified polysiloxane, alkyl modified polysiloxane, fluorine modified polysiloxane).

Anionic surfactant: Fatty acid soap (sodium laurate, sodium palmitate), higher alkyl sulfate (lauri) Sodium sulfate, potassium lauryl sulfate), alkyl ether sulfate ester (POE—triethanolamine lauryl sulfate, PE—sodium lauryl sulfate), N-acyl sarcosinic acid (lauracyl sarcosine) Trimethyl), higher fatty acid amidsulfonates (N-trimethyl-Toly-N—methyl tauronium sodium, palm oil fatty acid methyl tauronium donatium, lauryl methyl trivalent sodium), phosphorus Acid ester salt (POE—Nayl rail ether phosphate), POE—Oleyl ether phosphate, POE—Stearyl ether phosphate, Sulfoconate (di-2-ethylhexyl sulphosuccinate) Sodium, mono-lauroyl monoethanolamide sodium ethylenesulfosuccinate, (Ulyl polypropylene glycol sodium succinate), alkyl benzene sulfonate (linear sodium dodecylbenzene sulfonate, linear dodecyl benzene sulfonate triethanolamine, linear dodecyl benzene sulfonate), higher fatty acid ester Sulfuric acid ester salt (hardened palm oil fatty acid glycerin-sodium sulfate), N-acylglutamate (N-lauroylglutamate mono-ammonium, N-stearoylglutamate dinatrium, N-myristoyl- L_glutamate mono- sodium), sulfated oil (lotter oil), POE-alkyl ether carboxylic acid, P_E_alkyl allyl ether carboxylate, eleven-year-old refin sulfonate, higher fatty acid ester .Sulfonate, secondary alcohol Sulfuric acid ester salts, higher fatty acid alkylol Ami de sulfate, lauroyl monoethanol amine Dokohaku Sanna Application Benefits © beam, N- palmitic Toys Rua Supara Gin di preparative Rietanoruami emissions; casei N'nato potassium.

Cationic surfactant: Alkyltrimethylammonium salt (stearyltrimethylammonium chloride, lauryltrimethylan chloride) ), Alkylpyridinium salts (cetylpyridinium chloride), distearyldimethylammonium dimethylammonium chloride, poly (N, N'-dimethyl-3,5-methylenepiperidinium), quaternary alkyls Ammonium salt, alkyldimethyl benzylammonium salt, alkylisoquinoline salt, dialmolyphonium salt, P〇E —alkylamine, alkylamine salt, polyamine fatty acid derivative, amyl alcohol fatty acid derivative, benzalkonium chloride, chloride Benzetonium.

Amphoteric surfactants: Imidazoline-based amphoteric surfactants (2 —undesyl, N, N, N — (hydroxyxetylcarboxymethyl) 1 2 —Imidazolin sodium, 2 —cocoyl 1 2 —imidazolinini Umhi de loxyside— 1 devoted lupoxychyloxy 2 sodium salt), betaine surfactant (2 — heptodecyl N — carboxymethyl N — hydroxicheil midazolinium Lauryl dimethylaminoacetic acid, alkyl betaine, amide, sulfone. -Lipophilic nonionic surfactant: sorbitan fatty acid ester (sorbitan monooleate, sorbitan monoisostearate, sorbitan monomonolate, sorbitan monopalmitate, sorbitan monomonostearate, sorbitan monostearate, sorbitan monostearate, sorbitanate Liooleate, Penyu—2-Ethylhexyl diglyceride sorbitan, tetra-2-ethyl hexyl diglycerol sorbitan, glycerin polyglycerin fatty acid (mono cottonseed oil fatty acid glycerin, monoel glycerin monophenol) Glycerin sesquioleate, glycerin monostearate,, '— oleic acid pyroglutamate glycerin monostearate glycerin phosphonate), propylene glycol fatty acid ester (monostearin) Propylene glycol), Hardened castor oil derivative, glycerin alkyl ether.

Hydrophilic nonionic surfactants: P〇 E—Sorbi evening fatty acid ester (POE—Sorby evening mono-oleate, POE—Sorby evening mono-stearate, P〇 E—Sorbi evening mono-oleate, P〇 E—Sorbi evening mono-oleate) ), POE sorbite fatty acid ester (POE 1 sorbite monolaurate, P0E—Sorbit monolayer, P0E_Sorbiten pen oleate, P0E—sorbite mono stearate), POE—glycerin Fatty acid esters (P0E—glycerin monostearate 卜, POE—glycerin monoisostere— 卜, POE—glycerin tristearate, etc.), POE—fatty acid ester (P0E — Distearate, POE—monodiolate, ethylene glycol distearate), POE—alkyl ether P〇 E-lauryl ether, P〇 E-year-old rail ether, POE-stearyl ether, P〇 E-benenyl ether, P〇 E-2 octyldodecyl ether, P〇 E-coreless evening ether) Nick), Ρ〇 Ε · Ρ〇 Ρ— Alkyl ether (Ρ Ο Ε · POP—cetyl ether, P E E, POP— 2 — decylte tradecyl ether, POE · POP—monobutyl ether, Ρ〇 Ε · Ρ 〇 Ρ—Hydrogenated lanolin, Ρ〇 Ε · Ρ〇 Ρ— Glycerine ether), Tetra Ρ〇 Ε · Tetra POP—ethylenediamine condensate (Tetronic), POE—castor oil-hardened castor oil derivative (POE— Castor oil, POE—hardened castor oil, POE—hardened castor oil monoisostearate, POE—hardened castor oil triisostearate, P0 E—hardened castor oil monopyrodaltamate monoisostearate -Phosphate diester, P_〇 E- hardened castor oil maleic phosphate, POE - hardened castor oil succinate), POE- beeswax * Rano Li down derivative (P_〇 E- Sorubi' Tomitsurou), Al force Noruami de (coconut oil fatty Acid diethanolamide, lauric acid monoethanol amide, lauric acid diethanol amide, fatty acid isopropanol amide), P0 E-propylene glycol fatty acid ester, P0 E-alkylamine, POE-fatty acid amide, sucrose fatty acid ester , Alkyl ethoxydimethyl amine, trioleyl phosphate.

 Moisturizer: Polyethylene glycol, propylene glycol, glycerin, 1,3-butylene glycol, xylitol, sorbitol, maltitol, chondroitin sulfate, hyaluronic acid, mucoitin sulfate, caronic acid, atelocollagen , Cholesteryl 1 1 2 — Hydroxylate stearate, sodium lactate, bile salt, dl —pyrrolidone carboxylate, short chain soluble collagen, diglycerin (E〇) PO adduct, Isaiyobara extract , Sawtooth extract, melilot extract.

 Natural water-soluble polymers: Plant-based polymers {Gum Arabic, Tragacan Gum, Galactan, Guagam, Charab gum, Cara gum, Carrageenan, Pectin, Kanten, Quince seed (Malmo mouth), Argecoloy (Katsusowes) ), Starch (rice, corn, potato, wheat), glycyrrhizic acid}, microbial polymers (xanthan gum, dextran, succinoglucan, bullulan), animal polymers (collagen, casein, albumin, gelatin) )

Semi-synthetic water-soluble polymers: starch polymers (carboxymethyl starch, methylhydroxypropyl starch), cellulose polymers (methylcellulose, ethylcellulose, methylhydroxypropylcellulose, hydroxyxetylcellulose, cellulose sulfate) Sodium, hydroxypropylcellulose, carboxymethylcellulose, carboxymethylcellulose sodium, crystalline cellulose, cellulose powder), alginic acid polymer (sodium alginate, Propylene glycol ester alginate).

 Synthetic water-soluble polymers: Vinyl polymers (Polyvinyl alcohol, Polyvinyl methyl ether, Polyvinylpyrrolidone, Carboxyvinyl polymer), Polyoxyethylene polymers (Polyethylene glycol 20, 0 00, Polyoxyethylene polyoxypropylene copolymer of 40, 0 0 0, 60 0, 0 0), acrylic polymer (poly (sodium acrylate), poly (ethylene chloride), poly (acrylic amide)), polyethylene Imin, a cationic polymer.

 Thickeners: gum arabic, carrageenan, cara gum, gum tragacanth, carob gum, quince seed (malmite), casein, dextrin, gelatin, sodium pectate, sodium aradate, methylcellulose , Ethylcellulose, CMC, Hydroxy Shetylcellulose, Hydroxypropylcellulose, PVA, PVM, PVP, Sodium polyacrylic acid, Carpoxyvinyl polymer, Mouth candy Bean gum, Guar gum, Evening marine Amber gum, dialkyldimethylammonium cellulose sulfate, xanthan gum, magnesium aluminum silicate, bentonite, hectolite, kalic acid Al Mg (veegum), labonite, anhydrous key acid.

UV absorbers: Benzoic acid UV absorbers {Paraaminobenzoic acid (hereinafter abbreviated as PABA), PABA monoglycerin ester, N, N-dipropoxy PABA ethyl ester, N, N-diethoxy PABA ethyl ester, N, N-dimethyl PABA ethyl ester , N, N-dimethyl PABA butyl ester, N, N-dimethyl PABA ethyl ester}, anthranilic acid UV absorber (homomethyl-N_acetyl anthranilate), salicylic acid UV absorber (amyl salicylate, menthyl salicylate) , Homomentil salicylate, Octyl salicylate, Phenyl salicylate, P-isopropanol phenyl salicylate

), Cinnamic acid UV absorbers (octylcinnamate, ethyl 4-monoisopropyl cinnamate, methyl-2,5-diisopropylcinnamate, ethyl-2,4-diiso-oral pilcinnamone, methyl

-2, 4 — Diisopropyl pine cinnamon — 卜, propyl p 1 meth oxy cinname — 卜, iso pill-P-methoxicin name h, isoamyl-P meth oxycin name, octyl p-methoxicin name 2 2ethyl hexyl 1 P _ 卜 シ ン シ ン 、 、 2 ェ 卜 シ ェ シ ェ — — — シ ン シ ン チ ル 、 シ ク ロ 一 — p p p p p p p チ ル 0 0 0 0 シ β β β β β β β 2 1-hexylhexyl — a — cyano — 3 — phenyl cinnamate 1 glyceryl mono 2 1 hexyl hexanol 1 dipuffeme xy cinnamate 1), benzophenone UV absorber (2, 4-dihydrate Nzophenone, 2, 2'-dihydroxyl 4-methyl benzophenone, 2, 2'-dihydroxyl 4, 4,- Main Bok shore benzophenone, 2, 2: 4, 4 'over Te Bok Rahi mud carboxymethyl benzophenanthridine Bruno down, 2-arsenide de port carboxymethyl - 4 - Main Bok xylene benzo phenol emissions, 2 arsenide de □

,

4-methyloxyphenoxy, 4-methylbenzophenone, 2-hydroxy 4 monomethybenzophenone, 5-sulphonate, 4-phenylbenzophenone, 2-ethyl hexyl-1, 4-phenyl-benzopheno 1-2-Carboxylic acid, 2-Hydoxyl 4 1 n-Oxoxybenzophenone, 4-Hydroxy 3 -Carboxybenzophenone), 3 1 (4, -Methylbenzylidene) _ d 1, 1 force Npha 1, 3-benzylidene-d, 1 1 force Npha, 2-phenol-5-methylbenzoxazol, 2, 2 '-hydroxyl 5-methylphenylbenzoyl azol, 2 -(2 'One hydride xy 5-t One-year-old cutylphenyl) benzolylazole, 2-(2, ー π pi 5 '1-methylphenylbenzotriazole, dibenzalazine, di-iso-methane, 4-methyloxy 4' 1-t-butyl dibenzoylmethane, 5-((3,3-dimethyl-2-norbornylidene) 3—Ben evening 1—On.

 Sequestrants: 1—Hydroxetane-1 1-diphosphoshonic acid, 1-Hydroxetane 1, 1 —Diphosphonic acid tetrasodium salt, Nedatium edetate, Trina edetate 3 h U Kum, edet Tetrasodium acid, sodium citrate, sodium polyphosphate, sodium metal phosphate, gluconic acid, phosphoric acid, citrate, ascorbic acid

, Succinic acid, edosuccinic acid, ethylenediamine oral quichetil triacetic acid

3 sodium.

 Lower alcohol: ethanol, pouch panol, isoppo panol

, Isobutyl alcohol, t-butyl alcohol

Polyhydric alcohol: Dihydric alcohol (ethylenic U coal, propylene glycol, trimethylene glycol, 12-butylene glycol, 1,3_butylene glycol, teramethylene glycol, 2, 3—butylene glycol, Pentamethylene glycol, 2-butene-1,4-diol, hexylene glycol 31, octylene glycol, trihydric alcohol (glycerin, U methylol bread), tetrahydric alcohol (pen erythritol (1 , 2, 6-hexanetriol)}, pentahydric alcohol (xylitol), hexahydric alcohol (sorbitol J, mannitol), polyhydric alcohol polymer (diethylene glycol, dipropylene glycol, triethylene glycol, Polypropylene glycol, tetraethylene Recalls, Jiguriseri down, polyethylene glycol, Application Benefits glycerin, Te Bok Raguriseri emissions, poly glycerin), a dihydric alcohol alkyl E one ether (ethylene glycol monomethyl ether, Echirendari Coal monoethyl ether, ethylene glycol monobutyl ether, ethylene glycol monophenyl ether, ethylene glycol monohexyl ether, ethylene glycol mono 2-methylhexyl ether, ethylene glycol isoamyl ether, ethylene glycol benzyl Ether, ethylene glycol alcohol, methyl ether, ethylene glycol jetyl ether, ethylene glycol glycol ether, dihydric alcohol alkyl ether (diethylene alcohol monomethyl ether, diethylene glycol monoethyl ether, Siethylene glycol monobutyl ether, diethylene glycol dimethyl ether, diethylene glycol monomethyl ether Diethylene glycol butyl ether, diethylene glycol methyl ether, triethylene glycol monomethyl ether, polyethylene glycol monoethyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether, propylene glycol Recall monopropylene., Tert-propylene glycol isopropyl ether, dipropylene glycol methyl ether, dipropylene glycol ether ether, propylene glycol butyl ether), dihydric alcohol ether ester (ethylene glycol ester) Methyl ether acetate, ethylene glycol monoethyl ether acetate, ethylene glycol monobutyl ether acetate, ethylene glycol Phenyl ether acetate, ethylene glycol diazate, ethylene glycol disuccinate, diethylene glycol monoethyl ether acetate, diethylene glycol monobutyl ether acetate, propylene glycol monomethyl Ether acetate, Propylene glycol monoethyl ether ether acetate, Propylene glycol monopropyl ether Seth 卜, Propylene Glycol Monophenol 1

), Darice U monoalkyl ether (xyl alcohol, ceryl alcohol, batyl alcohol) Sugar alcohol (sorbitol)

, Maltose, maltotriose man, hose, sucrose, utrile, glucose, fructose, tempolytic sugar, maltose, xylose, starch-reducing sugar reduced alcohol ), Dali Solid, Tetra High Drofurfuryl Alcohol P 0 E—Tetrahy Drofur U U Alcohol, P 0 P—Butyl Ether, P 0 E · P

〇 P-butyl ether, tripolyoxy □ Pyrene glycerin ether, P 〇 P monoglycerin ether, P o P-glycerin ether phosphoric acid, P 〇 E · P〇 P-Penn evening ellis U mono ether, poly glycerin

 Monosaccharides: ―Mountain

 Ash sugar (D—Glyceryl Aldehi F, Sidroxylase N) Four-necked mouth (D—Erythrose, D—Ye U-Rulose, D—Treose, Erythritol) Five-carbon sugar (L-arabinosis, D—Xylose, L—Liquisose D—Aarabinose, D—Liposose, D—Librose, D—Xylulose, L—Xylulose, Hexet Sugar (D—Glucose, D—Even Loose, D—Bucose, D— Galactose, D—fructose, L—galac sucrose, L mannose, D—evening mothose) pentose sugar (aldoheptose, heprose) octose sugar (kullose), deoxysugar (2—deoxy D—lipose 6—Deoxy: L monogalactose, 6—Deoxy: L monomannose, amino sugar (D—Darcosamine, D—Galactosamine, Sialic acid Amino Nouron acid, muramic acid), Uron acid (D - glucuronic acid, D- Ma N'nuron acid, L Gururon acid, D- Garakurron acid L- Izuron acid).

Origo sugar: sucrose, danthianose, umbelliferose, lac Tooth, Planteose, Isolicnose,, a- 卜 Rehalose, Raffinose, Lyquinose, Unpilycin, Stachiosperno 'course.

 Polysaccharides: Cellulose, quinceid, chondroitin sulfate, denpung, galactan, dermatan sulfate, glycogen, gum arabic, heparan sulfate, hyaluronic acid, tragacanth gum, keratan sulfate, chondroitin, xanthan gum, mucoitin sulfate, guagam Dex キ ス orchid, keratosulfate, Locus 卜 Bingham, succinoglucan, carolinic acid.

 Amino acid: Neutral amino acid (threonine), basic amino acid (hydroxylidine).

 Amino acid derivatives: Facilsarcocinium (Lauroylsarcocinnatrium), Acylglutamate, Facil β-Aranine, Pyrrolidonecarboxylic acid.

 Organic amines: monoethanolamine, jejunolamine, triethanolamine, morpholine, trisopropanolamine, 2-amino-2-methyl-1,3-propanediol, 2-amino One 2-Methyl-1-propanol.

 Polymer emulsion: Acrylic resin emulsion, Polyacrylic acid ethyl emulsion, Acrylic resin solution, Polyacrylic alkyl ester emulsion, Polyvinyl acetate resin emulsion, Natural rubber latex.

 ρ Η Preparation agent: Sodium lactate monolactate, sodium citrate succinate, sodium succinate-succinate.

Vitamin: vitamin A, vitamin B1, vitamin B2, vitamin C, vitamin E, derivatives thereof, pantothenic acid and derivatives, biotin, nicotinic acid amide. Antioxidants: Tocopherol, dibutylhydroxytoluene, butylhydroxyanisole, gallic acid ester.

 Antioxidant auxiliaries: phosphoric acid, citrate, ascorbic acid, maleic acid, malonic acid, succinic acid, fumaric acid, kefaline, hexamate phosphate, phytic acid, ethylenediaminetetraacetic acid.

 Preservative: Paraxybenzoic acid ester.

 Hair dye: Acrylic resin alkanolamine liquid. ,

 Propellant: Various liquefied petroleum gas (LPG), such as liquefied gas such as LPG, dimethyl ether, liquefied oil gas and dimethyl ether, mainly composed of propane, buvene, isobutane, nitrogen gas and carbon dioxide gas Compressed gas.

 Other ingredients that can be added: Preservatives (Ethylparaben, Butylparaben), Anti-inflammatory agents (Darityrrhizic acid derivative, Glycyrrhetinic acid derivative)

, Salicylic acid derivatives, hinokitiol, zinc oxide, alanine)

, Whitening agent (placenta extract, saxifrage extract, alptin), various extracts (opac, oo-ren, sicon, peonies, sempri, ba

 ,,, ヽ

Ji, Sage, Bean, Ninno, Aloe, Zeaoi, Iris, Budow, Yokuinin, Hechima, Yuri, Saffron, 'Senkiyu, Shokiyu, Otogirisou, Ononis, Niniku, Pepper, Chimpi

, Toki, seaweed), activator (Mouth jar jelly-, photosensitizer, cholesterol mouth derivate), blood circulation promoter (nonyl acid amide amide, nicotinic acid benzyl ester, ditinic acid jS-buzuki Shechilester, Kabu Saishin, Jingelon, Kang Yue Listinki ', Ikuyu Mall, Yunic Acid, Iponeol, Tocopherol, Trichotate, Inositol Hexanicotine, Syclan Alley, Cinnaridin Lazoline, Acetylcholine, Verapamil, Cephalanthin, Aoriza Antiseborrheic (sulfur, thianthol), Anti-inflammatory (Traneki) Samic acid). -Hereinafter, the present invention will be described more specifically with specific examples. In addition, this invention is not limited by this. Example

Relationship between hair keratin gene and hair quality

 1. Measurement method of gene expression level

CDNA preparation method for extracted hair samples

The hair was removed, and the roots of about 1 cm were frozen in liquid nitrogen and left in liquid nitrogen. Five frozen roots were collected and placed in a 1.5 ml tube containing 1 ml of RNA extract I S0GEN (Nibonbon Gene) and stirred thoroughly with a vortex mixer. Chloroform 200 1 was added and sufficiently stirred again with a Portex mixer, and then centrifuged (15000 rm, 15 minutes) with a small microcentrifuge to recover about 500 1 of an aqueous phase containing RNA. To the collected solution, 50 × 1 3M sodium acetate and 1 etaprecipitate (Nibonbon Gene) were added and stirred thoroughly. Furthermore, 1 ml of isopropanol was added and stirred, and then centrifuged (15000 rm, 20 minutes) with a small microcentrifuge to precipitate total RNA. After discarding the supernatant, 75% ethanol was added, and the mixture was again centrifuged (15000 rm, 10 minutes) with a small microcentrifuge. The supernatant was discarded and the precipitate was air-dried and dissolved in 50 1 nuclease free water. DNasel treatment removed the mixed genomic DNA, and the total RNA was collected again by ethanol precipitation and dissolved in 201 nuclease free water. Among these, the concentration of RNA was measured by NanoDrop (Technologies, Inc.) using 1.1. CDNA was synthesized from 100 ng of the obtained total RNA and used for quantification of the expression level of each gene by PCR. Quantification of gene expression by real-time PCR

Detection and quantification are performed by mixing the synthesized cDNA, a primer specific to the gene to be detected and quantified, and real-time PCR reagent (Roche), and performing real-time PCR at 350S in the light cycler system. A gene fragment was amplified. In this case, a known concentration of the same gene fragment (PCR product Ι ί Ι Ο ^{1 1} copy equivalent) similarly to the width increase of Ri by the real-time PCR to prepare a calibration curve, detection and quantification contained in the sample The expression level of the gene to be converted was calculated as the number of copies per unit (lg) of RNA.

 The following combinations of primers were used as primers specific to each gene and not amplifying genomic MA.

 Human hair keratin Ha l

 Sense GGAATGCCAGAGGAGCA (SEQ ID NO: 6) Antisense CAGAGAGTTCTCTGGGTGA (SEQ ID NO: 7) Human hair keratin Ha2

 Sense AACACGCTGGAGATCGA (SEQ ID NO: 8)

 7 intense CACAGGTGGTGCAGGAA (SEQ ID NO: 9) Human hair keratin Hb2

 Sense CCCGTGAATAKTCAGTGA (SEQ ID NO: 10) Antisense CAAGGAGGGAACACTGGA (SEQ ID NO: 1 1) Human KAP5.2

 Sense ACTGTAGCTGTGTCCTGA (SEQ ID NO: 14) Antisense GATGAAGATGAAGGGTGGA (SEQ ID NO: 15)

2. Measurement of hair hardness (Young's modulus)

Preparation of sample for measurement

For each hair, attach water-resistant paper tags to both ends (3cm spacing). Enter the number. After lightly washing with a shampoo, washing with water and immersing in ion-exchanged water, it was air-dried in a constant temperature and constant temperature room (25 ° C, humidity 50%). Measurement of hair diameter

 Constant temperature 'In a constant humidity chamber (25 ° C, humidity 50%), the hair diameter measuring device SK-2000 (Kato Tech / Shiseido) using laser light is used to measure the long and short diameters of hair samples by 2πιπι intervals. Was measured over a length of 20 mm, and the average value of these was taken as the major axis and minor axis of the hair sample. Bending stress measurement

 The bending stress of hair samples was measured in a constant temperature and humidity chamber (25 ° C, humidity 50%) using a torque sensing type bending stress measuring device KES-SH (Kato Tech). The bending speed was set to 0. Scnf i / sec., And the bending stress (M) of each hair sample at the curvature (p) ± 1.0 to 2.0 cm-1 was measured. Calculation of Young's modulus

 The hair diameter and bending stress were measured for each hair sample, and the Young's modulus (E) of each hair sample was calculated by the following formula using the second moment of inertia (I).

 E = M-p / 1

 In this case, assuming that the hair cross section approximates an ellipse, and that the hair bends on the minor axis side, the cross section second moment (I) is expressed by the following equation.

Ι = π /-a ³ · b (a is the short radius of hair, b is the long radius of hair)

For comparison with gene expression, Young's modulus was calculated for each of the 5 hair samples that were RNA extracted together, and the average value was used. Hair keratin H a 1遗伝Ko, hair keratin H a 2 gene, Heake keratin H b 2 gene, and KA P 5. 2 gene, respectively expression levels ^':', Figure 3 the relationship between the Young's modulus of hair her hair It is shown in 6. Further, the following table shows the Spearman rank correlation coefficient r _s of each gene expression level and hair Young's modulus of. Table 3 Young's modulus and rank correlation coefficient of each gene expression r _s

Regressor Rank correlation coefficient r _s

 Hair keratin H a 1 gene -0.134

 Hair keratin H a 2 gene 0.459 *

 Hair keratin Hb 2 gene 0.427

 KA P5.2 gene 0.487 *

! Two-sided probability * Minimum r _s = 0.447 for P <0.05 (Spearman test table)

From the above experiment, in the hair test by 20 panelists, hair hardness (hang rate), hair keratin Ha 2 gene and human K A P 5

There was a significant correlation between the expression of the two genes o In addition, the expression level of the hekeratin H b molecule was high, although not significantly different from the expression of the hair hardness hekeratin H b 2 gene. It was also found that the hair became significantly harder. There was no correlation between hair hardness and expression of the hekeratin H a 1 gene.

3. Examination of the relationship between the hair bang rate and the expression of Κ A P 5.1 and 54 genes

 Panel 1 Measure the hardness (Young's modulus) of one person's hair as described above.

, Young's modulus 11.4 or more "High Young's modulus hair J, in other words" Hari

• ¾, hair with J I, less than 10.2 is low tang hair, in other words

Group the hairs without “Harishi • Shishi 咸” and each group The expression levels of KA P5.1 and KA P5.4 genes were examined by real-time PCR as described above.

 The plies used are as follows:

 Hit KAP5.1

 Sense TCTCTTCCCA AGTCAACTGC (SEQ ID NO: 12) Antisense AGAGTGTTGG ACAGGCAAAG (SEQ ID NO: 13) Human KAP5.4

 Sense GTGCAGTTTG GCTCAGA (SEQ ID NO: 18) Antisense TTCTCCAGCT CATCATCCAT (SEQ ID NO: 19) The results are shown in FIG. Figure 7 (a) shows the average value and standard deviation (p <0.05) of “high Young's modulus hair” (High) and “low Young's modulus hair” (Low).

) Shows the figure above, according to the above grouping,

“Δτ indicates that there is a sigh difference in the gang rate between the group and the“ low bang rate hair ”group. Fig. 7 (b) shows the Γ high Young's modulus hair ”(High) and“ Low Yang's hair J (Low)

) Shows the difference in the expression level. It is clear that the expression of KAP5.1 gene is increased in hair with high hang rate compared to hair with low Young's modulus. Figure 7 (c) shows the difference in the amount of expression between “high Young's modulus hair” (High) and “low Young's modulus hair” (Low) for the KAP 5 and 4 genes. It is clear that the expression of KAP5.4 gene is increased in hair with high Young's modulus compared with that with low Young's modulus, and in comparison with Fig. 7 (b), high and low Young's modulus The difference in the expression level of KAP5.4 gene in hair was also significant compared to that of KAP5.1 gene. From the above results, in hair with a high Young's modulus, that is, hair with a stiff feel, the expression of KA P 5.1 and KA P 5.4 genes, especially KA P 5.4 gene, is significantly increased. Became clear. Therefore, KAP 5. Measurements of 1 and KA P5.4 gene expression were also significant. As described above, the KA P5.1 to 5.5 genes (SEQ ID NOs: 1 to 5) belong to the keratin-related protein KA P5 family and are relatively high homology genes. The high degree of homology between the amino acid sequences of the putative proteins encoded by each gene is apparent from FIG. 1 and Table 1 described above.

 In addition, as described above, each putative protein encoded by the KAP 5.1-5 gene is all cysteine-rich and contains abundant low-molecular amino acids glycine and serine. It can easily penetrate between keratin fibers without forming secondary structures such as ox, and it is also possible to form many hydrogen bonds due to the セ group of many cerine residues. It is thought that it greatly contributes to the mechanical strength. ΚΑ Ρ 5. A portion of the 1-5 gene predicted coding protein The amino acid composition is as shown in Table 2.

 Therefore, from the above results obtained for ΚΑ ΚΑ 5.1, 5.2 and 5.4, based on the high degree of homology between genes and the structural similarity between coding proteins in ΚΑ Ρ 5 gene family, ΚΑ Ρ It can be analogized that the hair quality can also be evaluated by examining the expression of 5.3 and 5.5.

4. Identification of human KAP5 gene expression site by in situ hybridization method (ISH method)

 Preparation of KAP5.1-5 lipoprobe

For each of the cDNA prepared from the extracted hair and KAP5.1, KAP5.2, KAP5.3, KAP5.4, and KAP5.5, use the primers shown in Table 4 below. Thus, each gene fragment of ΚΑΡ5 was amplified in the form of T7 polymerase promoter sequence added to the antisense side. '

Translation domain Probe domain in ISH (3 'non-translation domain)

 這 子 子 名

 Primer-one position and sequence

 (Molecular name) Position Size Size

Start s top DNA (bp) fiS & St Mw (kDa) Forard Reverse bp AP5. 1 55 198 55695 498 164 55881 tctcttcccaagtcaactgc 55900 56086 agagtgttggacaggcaaaq 56067 206

 (SEQ ID NO: 12) (SEQ ID NO: 13)

 AP5. 2 65953 66516 564 186 66570 actgtagctgtgtcctga 66587 66902 g tgaagatgaaggg gga 66884 332

 (SEQ ID NO: 14) (SEQ ID NO: 15)

 — 0

 KAP5. 3 76555 77064 510 168 76933 caatccagctgctgcaa 76949 77302 gtgcagtttggctcaga 77286 370

 (SEQ ID NO: 16) (SEQ ID NO: 17)

 KAP5 .4 93485 94093 609 201 17 .9 94198 ttctccagctcatcatccat 94217 94416 ggtcagaccttgcatctcag 94397 219

 (SEQ ID NO: 18) (SEQ ID NO: 19)

 AP5 .5 110734 X10264 471 155 110205 ctctgaatcagttcatcccaca 110184 109831 aaggagaccttcttgctcacag 109852 375

(SEQ ID NO: 20) (SEQ ID NO: 21)

Each amplified gene fragment was purified with a commercially available kit (Wizard SV Gel and PCR clean-up System: Promega) and then specific for each KAP5 gene using T7 polymerase and DI G RNA labeling kit (Roche). A lipoprobe was prepared. . Identification of the expression site of each KAP gene

 Neutral formalin fixation of scalp tissue · Paraffin-embedded sample is sliced into 5 m with a microtome to produce tissue sections (slide glass) containing hair follicles. (Ben Yuna HX System Discovery) and in situ hybridization reagent ribomap kit (Ben Yuna) were used to react with each KAP5 gene-specific lipoprobe (200 ng per slide). Furthermore, the tissue section reacted with the probe was reacted with an alkaline phosphatase-labeled anti-DIG antibody (Roche) on an automatic staining apparatus. Remove slide glass with tissue section from automatic staining device, wash with Tris-HCl buffer (pH 9.0), react with thigh-purple (Roche) for about 5 hours, and each KAP5 gene expression site Was visualized as a dark purple stained site. As a result, it was confirmed that all of the KAP5.1, KAP5.2, KAP5.3, KAP5.4, and KAP5.5 genes exist specifically at the cuticle site. Experiment 1

 K A P 5.1 Construction of repo overnight

 For K A P 5.1, which was found to correlate with hair hardness (Young's modulus), the transcription regulatory region was amplified by the PCR method, and a repo overnight brass medium was constructed.

 A. PCR amplification of DNA fragments

Approximately 15 kb D containing KAP 5.1 gene and KA P5.2 gene The NA fragment is composed of NM—F 1 primer (SEQ ID NO: 2 2) and R 2 ^ primer (SEQ ID NO: 2 3) with recognition sites for restriction enzymes Not I and M 1 u I at the 5 ′ end. A commercially available human genomic DNA (obtained from Pr. Omega) was used as a saddle and was amplified by PCR (Fig. 8-A).

 The conditions for the P C R reaction are as shown in the following table.

 Table 5,

94 ° C 2 minutes

 9 ° C for 10 seconds

 65 ° C 30 seconds 10 cycles

 68 ° C 8 minutes

 94 ° C 10 seconds

 65 ° C 30 seconds 20 cycles

68¾ 8 minutes + 10 seconds (increased by 10 seconds per cycle)

 68 ° C 8 minutes

The NM—F 1 primer (SEQ ID NO: 2 2) and R 2 primer (SEQ ID NO: 2.3) are as shown in the table below. The numbers shown in the table indicate the position of the sequence number of HO sapiens genomic DNA, chromosome 11c 1 one: RP 11-684B2, coniplete sequences. ACCESSI ON: AP000867.5.

 Table 6

 . Sequence 22:

 TTTGCGGCCGCACGCGTTTTCAGTAATGTGCCCCTCTTATGCT

 Specific sequence of the 5 'upstream region of the Notl Mjurt KAP5.1 gene

 51039 TTTCAGTAATGTGCCCCTCTTATGCT 51064 Sequence 23:

 66762 AGGTTGAAGTGATGAGGTCAGGAAAG

Specific sequence of the 3 'downstream region of KAP5.2 B. Cloning of DNA fragment into vector

 The amplified DNA fragment is double-quenched with restriction enzymes M 1 u I and N he I and separated by agarose gel electrophoresis.

NA fragments were recovered. This DNA fragment is extracted with M lu I and N he I of the repo-overnight vector pGL-3 basic (obtained from Promega) with ia gene; fireflyluciferase. D-ning during

8-B). Subcloning [Step 1: Subclamate the SacI / NcoI fragment (15 4 bp, Fig. 9) to pGL-3bbasic. Step 2: Insert a SacI fragment (approximately 4.0 kbp, Fig. 9) into the resulting plasmid, and repo overnight containing the 5 'upstream region of KAP 5.1 (SEQ ID NO: 24). We constructed plasmid pGL-3-KAP 5.1 (Fig. 9). Experiment 2

 A P 5.1 Repo Overnight--Atsusei

 Immortalized outer root sheath cells (IORS) (special.open 2 0 0 0-8 9)

) Inoculate 80,000 cells in a 75 cm ² flask and incubate for 6 days at 37 ° C · 5% co ₂ . The medium is K eratinocyte-S

Use FM medium (G i b c o).

 Day 1: Plasmid DNA introduction (transient) The cultured Io RS cells were constructed according to the manual of Effectene Trnsfection Reagent (QIAGEN) and the reporter plasmid pGL 3 — KA P 5.1 (firef 1 yluciferase) and a commercially available internal standard plus S de p RL

(reni 1 1 aluciferase) and transformed to Dual. Day 2: Reseeded transformed cells in 24 well multiwell plates 0 to 10-16 000 cells per well, 37 ° C

• Sputum culture under 5% CO ₂

 Day 3: Replace the culture medium of each well with the basic medium in which various agents are dissolved, and perform the sputum culture under conditions of 37 ° C · 5% CO 2.

 Day 4: Atsey. Aual-Luciferase · Repo-Evening · Assesse System (Du a 1 — L u c i f e r a r e R, e p o r t e r

Measure the luciferase activity for each well according to the manufacturer's manual using A s s a y S y s s te tem (P rom ega). Lumi Nome overnight is A u t o L u m a t L B 9 5 3 (B E R T

HO L D).

 The drugs used in the test are as follows:

 Test drug:

 〇 -Phosphoserin (Obtain from Nacalati Tesque, L)

 Phosphodaricelic acid (obtained from Nacalai Tesque)

 Selinetyl Esterile (available from Wako Pure Chemicals, L)

 Z-S e r-OH (from S I GMA, hand, L)

 H-Ser-O B z 1-HC 1 (obtained from S I GMA, L) Acetyldaricin (obtained from Nacalai Tesque, L)

 Glycylglycine (obtained from SIGMA, L)

 Glycylserine (obtained from S I GMA, L)

 Hipotaurine (obtained from Wako Pure Chemical)

 Chiotaurine (obtained from Mutual Drug)

 Vitamin U chloride (obtained from Tokyo Kasei)

 2-amino-6- (methylsulfonyl) benzothiazol (obtained from Wako Pure Chemical)

N-(2-acetamido) 1-2_amino sulfonic acid (Al (Purchased from Dritch, purity 9 9%)

 2 i (Amidinothio) ethanesulfonic acid (obtained from Tokyo Kasei Co., Ltd./purity> 9 8%)

 Dimethyl 4-1- (Acetylamino) Chlohexane 1-, 3--dicarboxylate (obtained from MAYB R I D G E)

 Hydrochloric acid _ L-Ornitine (obtained from Wako Pure Chemical)

 L-citrulline (obtained from Wako Pure Chemical),

 L-threonine (obtained from Wako Pure Chemical)

 Thiamine (obtained from Wako Pure Chemical)

 Tyrosine (obtained from Wako Pure Chemical)

 Colline chloride (obtained from Wako Pure Chemical)

 Evening Vrussia Min (obtained from Wako Pure Chemicals, purity> 9 8%)

 Thiazolidine 1 2 Ruponic acid (obtained from Tokyo Chemical Industry, purity> 9 8

%)

 3-(2 -benzothiazolylthio) 1 1 sodium propanesulfonate (obtained from Aldrich, purity 9 5%)

 L I homoserine (obtained from Tokyo Kasei).

 N monobenzyl L-serine (obtained from B A C H EM, purity) 9 9

%)

 H 1 S e r-V a 1-0 H (obtained from domestic production)

 2 Iaminobenzothiazole (obtained from Nacalai Tesque, purity 9

8)

 (21-amino-4-thiazolyl) Acetic acid (obtained from Tokyo Chemical Industry, purity

> 9 7%)

 Serine (available from Wako Pure Chemicals, L, purity 9 9%)

 N-acetylacetylene (obtained from SIGMA, D L)

O-acetylcellulose (obtained from SIGMA, L) Serine methyl ester (obtained from A 1 drich, L, purity 98%, hydrochloride) 'Glycine (obtained from Nacalai Testa, purity 9 9%)

 Sistine (obtained from F LUKA> L, purity 99.5%)

 Cystine (obtained from S I GMA, L, purity 98.5%)

 Acetylcystine (obtained from S I GMA, L, purity 9 9%) Homocysteic acid (obtained from S I GMA, L, purity 9 9%) Methionine (obtained from Wako Pure Chemical, L, purity 9 9%)

 Dalyu thione reduced form (obtained from S I GMA, L, purity 9 9%) Folic acid (obtained from Wako Pure Chemical, purity 98 to 100%)

 Adenosine (obtained from S I GMA, purity 9 9%)

Dibutyl c AMP (obtained from SI GMA, purity 9 7%, N ⁶ , 2, 1 0-dibutyryl adenosine 3 ', 5'-cyclic monophosphate sodium salt) (K—S FM (—)).

The results are shown in Tables 7-9. Various drugs shown in Tables 7 and 8 were found to enhance the gene expression of Κ A Κ 5.1. In contrast, the drugs shown in Table 9 did not show the effect of enhancing the gene expression of KAP 5.1. Table 7

Drug name Increase rate (% ratio of control)

〇 One phosphoserine 109 (lOppm), 117 (lOOppm) Phosphodariseric acid 107 (lOppm)

Serine ethyl ester 123 (300ppm)

 Z-Ser -OH-112 (lOppm)

 H-S r -O B z 1 HC 1 125 (lOOppm), 137 (300ppm) Acetyldaricin 107 (lOppm)

Glycylglycine 113 (lOppm)

Glycylserine 149 (lOppm)

Hipotaurin 126 (10 lessons) ''

Thiotaurine 106 (lOppm)

Methionine methyl ester 119 (lOppm)

Vitamin U chloride 111 (lOppm), 127 (lOOppm)

2-amino-6- (methylsulfonyl) be 132 (10,), 168 (lOOppm)

 N— (2-acetamide) 1 2-116 (lOOppm)

Aminoethanesulfonic acid

 2- (amidinothio) ethanesulfonic acid 117 (Class 1), 149 (lOppm) Dimethyl 4- (acetylamino) Cyclohe 124 (IO M), 127 (IOO M) Xanthone 1, 3-dicarboxylate

Taurocyanine 119¾ (10ppm)

Thiazolidine _ 2-carboxylic acid 103¾ (10ppm), 112¾ (lOOppm)

3-(2-Benzothiazolylthio) — 1 — 107¾ (10ppm), 115¾ (lOOppm) Sodium propanesulfonate

 L-homoserine 115¾ (10ppm), 115% (lOOppm)

N-Benzyl mono L-serine 125¾ (10ppm), 127% (lOOppm)

H-S e r -V a l -OH 109¾ (lOOppm)

 2_aminobenzothiazol 112¾ (lOOppm)

(2-Amino-4 monothiazolyl) Acetic acid 112 (lOOppm)

Table 8

Four

 Five

Table 9

In this example, the results were shown only for KAP 5.1, but as described above, the sequence of the promoter region of KAP 5.1 gene Since the sequences of the promoter regions of the other KA P 5.2-5.5 genes are very close to each other (Fig. 2) and their control mechanisms are likely to be equivalent, KA P 5.1 It is very likely that a drug that enhances the expression of keratin also enhances the expression of other KAP5 genes, thus improving the feeling of stiffness. Experiment 3,

Preparation of hair cosmetics

 Formulation examples of the cosmetic for hair of the present invention are shown below. The blending amount is mass%. The hardness of the wax was measured by I-Techno Engineering Co., Ltd. Powerhouse Dome Ichiya / Max ME-4 15 (Diameter: 5.6 mm; Speed: 7 sec Z inch; Load: 20 0 0 g; Temperature: 37 ° C). The viscosity was measured at a single cylinder type rotational viscometer manufactured by Shibaura System Co., Ltd. at 1 2 8 7 temperature 30 ° C. High viscosity products such as jewel, tritment, etc. are VS-HI type (No. 6/10 rpm), mist, hair liquid, moose,., Hair tonic, hair growth VS-A type 1 (Low Yuichi No. 1/6 Orp. Pm) was used for the low-viscosity agent. Formulation example

Formulation example 1.1 Wax

 A wax containing the drug of the present invention was prepared by a conventional method according to the following formulation. Emulsified wax, hardness 20 This wax had a good feeling of use, and an improvement in the feel of a sticker was observed.

 Drug (Chiotaurine) 0.5

 Current paraffin 1 0

 Micro Crisis Evening Wax 1 0

Dimethylpolysiloxane 4 Stearyl alcohol 4

 Propylene glycol 1 0

 Carnauba Row 3

 Isostearic acid 0.5

 Stearic acid 4.5

 Tetler 2—Ethylhexanoic acid pen

 Polyoxyethylene hydrogenated castor oil 3,

 Polyoxyethylene oleyl ether phosphate 2

 Self-emulsifying monostearate glycerin U 3

 卜 Lietano Lumin 1

 Estel of paraoxybenzoate

 Polyacrylic acid sodium h U

 Purified water residue

 Perfume appropriate amount. Formulation example 1.2

 A wax containing the drug of the present invention was prepared by a conventional method according to the following formulation. Emulsified wax, hardness 20 This wax had a good feeling of use, and an improvement in the feel of a sticker was observed. '·

 Drug (Serine) 0.5

 Current paraffin 1 0

 Micro Crisis Evening Wax 1 0

 Dimethylpolysiloxane 4

 Stearyl alcohol 4

 Propylene glycol 1 0

 Carnaup Palou 3

Isostearic acid 0.5 Stearic acid 4.5

 Tetler 2 — Ethylhexanoic acid pen erythritol 2 Polyoxyethylene hydrogenated castor oil 3

 Polyoxyethylene oleyl ether phosphate 2

 Self-emulsifying glycerin monostearate 3

 Triethanolamine 1

 Paraoxybenzoate appropriate amount,

 Sodium polyacrylate

 Purified water residue

 Perfume appropriate amount. Formulation example 2.1 Miss

 According to the following formulation, a mist containing the drug of the present invention was prepared by a conventional method. Mist (aerosol), viscosity 5. This mist had a good feeling of use, and an improvement in the feel of the beam was observed.

 Drug (Glycylglycine) 0.5

 Acrylic resin alkanolamine solution 1 2

 Diethanolamide laurate 0.5

 Ethanol 5 7

 Polyoxyethylene oleyl ether 0.5

 Purified water residue formulation example 2.2 Misto

 According to the following formulation, a mist containing the drug of the present invention was prepared by a conventional method. Mist (aerosol), viscosity 5. This mist had a good feeling of use, and an improvement in the feel of the beam and stiffness was observed.

Drug (Serine) 0.5 Acrylic resin alkanolamine solution 1 2

 Lauric acid diethanolamide 0.5

 Ethanol 5 7

 Polyoxyethylene oleyl ether 0.δ

 Purified water residue Formulation Example 3.1 Giel,

 According to the following formulation, a jewel containing the drug of the present invention was prepared by a conventional method. Transparent solid (die), viscosity 3 0 0 0 0. This jewel has a good feeling of use, and an improvement in the feel of the beam is seen.

 Drug (Hipotaurine) 0.5

 Behenyl alcohol 1

 Glycerin 5

 1, 3—Butylene Recall 5

 Polyoxyethylene hydrogenated castor oil succinic acid (50 Ε. 〇.) 4 0-Hydroxyl power Lithium 1 —

 Paramethoxycinnamic acid 2_ethylhexyl 0.1

 Purified water residue

 Perfume appropriate amount. · Formulation example 3.2 Gel

 According to the following formulation, a jewel containing the drug of the present invention was prepared by a conventional method. Transparent solid (die), viscosity 3 0 0 0 0. This jewel has a good feeling of use, and has an improved feeling of tension and stiffness.

 Drug (serine) 0.5

Glycerin 5 Behenyl alcohol 1

 Glycerin 5

 1, 3 — Petitrene Grill 5

 Polyoxyethylene hydrogenated castor oil Succinic acid (5 0 E. 〇.) 4

0

 Potassium hydroxide 1

 Paramethoxycinnamic acid 2 — Ethylhexyl 0., 1

 Purified water residue

 Perfume appropriate amount. Formulation example 4.1 Hair liquid

 According to the following prescription, a hair kit containing the drug of the present invention was prepared by a conventional method. Transparent solid, viscosity 8. This hair liquid has a good feeling of use, and an improved feeling of elasticity and stiffness has been observed.

 Drug (Acetylglycine) 0.5

 Ethanol 5 5-Propylene glycol 5

 Polyoxyethylene · Polyoxypropylene · Pen erythritol-ether (5 E O) 2 5

 Paramethoxycinnamic acid 2-Ethylhexyl 0.5

 Pigment.

 Purified water residue

 Perfume appropriate amount. Formulation example 4.2 Hair liquid

According to the following prescription, a hair kit containing the drug of the present invention was prepared by a conventional method. Transparent solid, viscosity 8. This hair liquid feels good There was also an improvement in the feel of the beam.

 Drug (folic acid) 0.1

 Ethanol 5 5

 Propylene glycol 5.

 Polyoxyethylene · Polyoxypropylene · Pen evening erythrite — Luertel (5 E〇) 2 5

 Paramethoxycinnamic acid 2-ethyl hexyl 0,5

 Appropriate amount of dye

 Purified water residue

 Perfume appropriate amount. Prescription Example 5.1 Treatment

 In accordance with the following formulation, a treatment containing the agent of the present invention was prepared by a conventional method. Emulsion cream, viscosity 2 5 0 0 0. This treatment had a good feeling of use, and an improvement in the feel of the beam was observed.

 Drug (Ciotaurine J 0.5

 Current paraffin 1 0

 Vaseline 3

 Dimethylpolysiloxane 2

 Propylene glycol 1 0

 Polyoxypropylene (40) butyl ether

 Terra 2 — Ethylhexanoic acid pen

 Polyoxychethylene hardened castor

 Potassium hydroxide 0.1

 Forced Loxyresin Polymer-0.3

 Purified water residue

Perfume appropriate amount. Formulation example 5.2 Treatment

 According to the following prescription, an ointment containing the agent of the present invention was prepared by a conventional method. Emulsion cream viscosity 2 5 0 0 0. This treatment has a good feeling of use, and an improvement in the feel of the beam is observed.

 Drug (Serine) 0.5

 Current paraffin 1 0,

 Vaseline 3

 Dimethylpolysiloxane 2

 Propylene glycol 1 0

 Polyoxypropylene (40) butyl ether

 Tetra 21-ethyl pentylate erythritol

 Polyoxyethylene hydrogenated castor oil 2

 Potassium hydroxide 0.1

 Carboxyvinyl polymer 0.3

 Purified water residue.

 Perfume appropriate amount. Formulation example 6.1 Moose

 According to the following formulation, a mousse containing the drug of the present invention was prepared by a conventional method. Stock solution / propellant 9 0 Z 1 0. Foam (Ezol), Viscosity 5. This mousse was easy to use, and improved the feel of the beam. Stock solution:

 Drug (Glycylglycine) 0.5

 Volatile isoparaffin 0.5

 Ethanol 1 0

Polyoxyethylene hydrogenated castor oil 0.5 Polyoxyethylene · Polyoxypropylene decyl ether 0

Five

 Bi Bamboo Leaf Extract 0.1

 Yuka Former S M 1 0

 Purified water residue.

 Propellant:

 L P G Formula 6 2 Moose

 According to the following formulation, a mousse containing the drug of the present invention was prepared by a conventional method. Stock solution / propellant 90 0 Foam (aerosol), viscosity 5. This mousse was good to use and improved. Stock solution:

 Drug (serine) 0.5

 Volatile isoparaffin 0.5

Ethanol 1 0 ₌

 Polyoxyethylene hydrogenated castor oil 0 .. 5

 Polyoxyethylene / polyoxypropylene decyl ether 0.5

 Pepper leaf extract 0.1

 Yuka Forma S M 1 0

 Purified water residue.

 Propellant: Formulation example 7.1 Hair tonic

In accordance with the following formulation, a satellite containing the drug of the present invention was prepared by a conventional method. Transparent liquid, viscosity 7. This hair tonic also feels good There was good improvement in the feeling of stiffness and stiffness.

 Drug (Acetylda Uun) 0.5

 Ethanol 6 0

 Dipropylene glycol 2.

 Polyoxychethylene hardened castor oil 0.

 Lactic acid appropriate amount

 Lactic acid sodium solution

 Monomonium glycyrrhizinate 0

 Nicotinic acid amide 0.1

 Acetic acid D L-a-tope □ -l 0.1

 L one menthol 0.2

 Appropriate amount of dye

 Purified water residue

 Perfume appropriate amount. Formulation example 7.2 Hair tonic

 In accordance with the following formulation, a satellite containing the drug of the present invention was prepared by a conventional method. Transparent liquid, viscosity 7. This hair tonic has a good feeling of use.

 Drug (folic acid) 0.1

 Ethanol 6 0

 Dipropylene glycol 2

 Polyoxyethylene hydrogenated castor oil 0.5

 Lactic acid appropriate amount

 Sodium lactate solution

 Monoammonium glycyrrhizinate 0.1

Nicotinic acid amide 0.1 Acetic acid DL— Hiichi Tocopherol 0. 1

 L One Menthol 0.2

 Appropriate amount of dye

 Purified water residue.

 Perfume appropriate amount. Formulation example 8.1 Hair restorer

 According to the following formulation, a hair restorer containing the agent of the present invention was prepared by a conventional method. Transparent liquid, viscosity 7. This hair-restoring agent also had a good feeling of use, and an improvement in the feel of agitation and strain was observed.

 Drug (Acetyldaricin) 0.5

 Ethanol 8 0

 Isostearyl alcohol 2

 1, 3 —Butylene glycol 3

 Polyoxyethylene hydrogenated castor oil 1

 Sodium lauryl sulfate 0.3

 D L-Lingoic acid appropriate amount.

 iS—Glycyrrhetinic acid 0.2

 Pantothenyl ether 0.1

 Benzyl nicotinate 0.1

 Nicotinic acid amide 0.1

 Acetic acid D L— Q! — Tocopherol 0.5

 Decyltetradecyldimethylamine oxide solution (20%) 5 L menthol 1 Formulation example 8.2 Hair restorer

In accordance with the following formulation, a hair restorer containing the drug of the present invention is prepared by a conventional method. Prepared. Transparent liquid, viscosity 7. This hair-restoring agent had a good feeling of use, and an improvement in a feeling of elasticity and stiffness was observed.

 Drug (folic acid) 0.1

 Ethanol 8 0.

 Isostearyl alcohol 2

 1, 3 —Butylene glycol 3

 Polyoxyethylene hydrogenated castor oil 1,

 Sodium lauryl sulfate 0.3

 D L —malic acid appropriate amount

 β-Glycyrrhetinic acid 0.2

 Pantothenyl ether 0.1

 Benzyl nicotinate 0.1

 Nicotinic acid amide 0.1

 Acetic acid D L — α — Tocopherol 0.5

 Decyltetradecyldimethylamine oxide solution (20%) 5 L-menthol Industrial applicability

 The hair paste / scrubbing improver and hair cosmetic of the present invention can improve hair paste / strain by being used for the hair or scalp and penetrating into the hair or absorbed by the hair follicle. Yes, it is useful as a beauty method.

Claims

1. From N — acetyl selenium, 〇-acetyl cereal, —-acetyl suldarine, O — phospho-L-serine,. Phosphodarice υnic acid, glycerine U and their pharmaceutically acceptable salts • (_She improver. Hair hair containing one or more compounds selected from the group consisting of active ingredients as active ingredients.

 Contract

 2. N-Acetyl DL, 0 — Acetyl L rfe υ, N-Acetyl Daricin, ○ — Phospho L-Serine, Phosphodarice U acid, Gu V Silce U and their pharmaceutically acceptable salts Cosmetics for hair comprising one or more compounds selected from the group consisting of

 3. N-Acetyl DL, O-acetyl-L-Se, O-Acetyl-Dalicin, O-Phospho-L-Serine, Phospho-darice-U, G-V-silcerine and their pharmaceutically acceptable salts A method for improving hair tension, comprising: applying one or more compounds selected from the group consisting of: to the hair or scalp.

 4. N-Acetyl D. L-Serine, 0--Acetyl L-Se, N-Acetyl Daricin, Oichi Phospho-L-Serine, Phosphodarice U-acid, Glycylse-U and their pharmaceutically acceptable products A method for producing a hair cosmetic, characterized in that one or more compounds selected from the group consisting of salts are added to a water phase or an oil phase to produce a hair cosmetic.