WO2006047510A2 - METHODS AND COMPOSITIONS FOR FeLV DIAGNOSIS - Google Patents

Abstract

The present disclosure provides an improved assay for the presence of certain exogenous feline leukemia virus sequences in a biological sample obtained from a cat or material derived from a cat. The improved assay allows the determination of the status (abortive, regressive, latent or progressive) of a FeLV infection in the felid from which the sample was derived.

Description

METHODS AND COMPOSITIONS FOR FeLV DIAGNOSIS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of United States Provisional Application 60/622,407, filed October 25, 2004.

ACKNOWLEDGEMENT OF FEDERAL RESEARCH FUNDING

This invention was made, at least in part, with funding from the NCRR and the National Institutes of Health (Grant No. T32-RR-07072, Grant No. K08-AI-054194- 01 A1 and Grant No. AI-133773). Accordingly, the United States government has certain rights in the invention.

REFERENCE TO SEQUENCE LISTING, A TABLE, OR A COMPUTER,

PROGRAM LISTING COMPACT DISK APPENDIX

SEQ ID NO:1 , oligonucleotide useful as a primer. SEQ ID NO:2, oligonucleotide useful as a primer. SEQ ID NO:3, oligonucleotide useful as a primer.

BACKGROUND OF THE INVENTION

The field of the present invention is the area of veterinary diagnostic methods, in particular using molecular biological methods to detect feline leukemia virus in a felid and to assess the status of infection (or lack of infection) in the felid containing diagnostic FeLV sequences.

BRIEF SUMMARY OF THE INVENTION

The present invention provides primers and probe oligonucleotide sequences specific for the U3 region of the feline leukemia virus (FeLV) genome. Real time polymerase chain reaction (PCR) using these primers, with detection of the amplification product using a probe specific to the amplification product of about 68 bp, allows an assessment of the provirus load in a biological sample obtained from or derived from a felid for which assessment of FeLV state is desired. Appropriate modification of the polymerase chain reaction conditions allows measurement of viral RNA rather than DNA. As specifically exemplified, the primers are derived in sequence from the U3 region of the FeLV-61 E-A long terminal repeat (LTR) (GenBank accession number M18247) (Donahue et al., 1988), thereby amplifying the exogenous but not endogenous FeLV sequences (Berry et al., 1988; Casey et al., 1981). The forward, 5' AGTTCGACCTTCCGCCTCAT 3' (20 bases; nt 241-260, SEQ ID NO:1), and reverse, 5' AGAAAGCGCGCGTACAGAAG 3^! (20 bases; nt 308- 289, SEQ ID NO:2), primer sequences amplifies a 68bp product. The specifically exemplified probe sequence, 5' TAAACTAACCAATCCCCATGCCTCTCGC 3' (28 bases; nt 262-289, SEQ ID NO:3), is advantageously labeled with the reporter dye, FAM (6-carboxyfluorescein), at the 5' end and the quencher dye, TAMRA (6- carboxytetramethyl-rhodamine; Applied Biosystems) or BHQ-1 (Black Hole

Quencher-1 ; Biosource International, Inc., Camarillo, CA), at the 3' end. Both probes are desirably blocked at the 3' end to prevent extension.

In analyzing biological samples from the felid of interest, desirably blood, buffy coat cells, peripheral blood mononuclear cells (PBMCs), serum, plasma, bone marrow (BM), salivary tissue, bladder tissue, gastrointestinal tissue, lymphoid tissue including spleen (SP), tonsil, thymus and lymph nodes (LN), or other tissue samples. The real time PCR analysis using the primers and probes described herein is used together with an immunological assay, such as an antigen capture ELISA, for the p27 antigen of FeLV. Other immunoassay formats of equivalent sensitivity and specificity can be substituted for the ELISA.

The assay described herein is especially useful in assessing vaccine efficacy, where vaccinated and control felids are subjected to sequential analysis for p27 antigen expression and virus load after challenge with infectious FeLV. The assay of the present invention is also useful for assessing infection status in felids, including pets, felids in shelters or laboratory felids, in which information concerning (potential) FeLV exposure is not available.

When there is no detectable viral antigen and no FeLV-specific amplification product in the biological sample, the felid has an abortive infection or the felid has not been exposed to FeLV. It would not be possible to differentiate these possibilities based only on the real time PCR and antigen-capture ELISA.

Where there is regressive infection in the felid, there is no detectable FeLV antigen in the biological sample at any timepoint, and there is a transient but low level or a persistent low level of virus sequence detected. With regressive infection, the virus copies per million PBMCs is on the order of hundreds, i.e., from about 10² to about 10³ copies per 10⁶ PBMCs.

A latent FeLV infection in a felid is detected when there is transient detectable viral antigen (especially p27) and a persistent, moderate provirus load over the course of time. A moderate virus load characterizing a latent infection corresponds to tens of thousands of viral nucleic acid copies per million PBMCs, i.e., from about 10⁴to about 10⁵ copies per 10⁶ PBMCs.

A progressive FeLV infection is characterized by persistently detectable p27 antigen and relatively high viral DNA load. The virus load is high (and persistently high), in a progressive FeLV infection, with more than a hundred thousand copies of viral nucleic acid detected per million PBMCs, i.e., greater than 10⁵ copies per 10⁶ PBMCs. This pattern is maintained over the passage of time.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1. Linearity and sensitivity of quantitative real-time FeLV DNA PCR. The standard curve of the p61 E-FeLV plasmid is linear. Five copies of the plasmid are consistently detected. Amplification of ten-fold serial dilutions between 5 X 10⁸ copies to 5 X10° copies of the plasmid demonstrated linearity over eight orders of magnitude, generated a standard curve correlation coefficient of 0.999, and produced an amplification efficiency of 96.6%. Mean ± SD for 18 independent experiments are plotted. The equation describing this line is y = -3.4053x + 36.669; R² = 0.9991.

Fig. 2. Amplification efficiency comparison to validate real-time PCR quantification. Serial dilutions (1 :10, 1 :100, 1 :1000, and 1 :10000) of PBMC DNA from an FeLV- 61 E-A-infected cat and of the p61 E-FeLV plasmid standard were amplified. Amplification efficiencies of the FeLV-positive DNA and the FeLV plasmid standard were approximately equal (Δs=0.02) demonstrating that quantification using the plasmid standard is deemed valid. Mean ± SD is plotted. The equation describing the standard curve is y = 3.3033x + 8.8; R² = 0.9998; and the equation describing the FeLV-positive DNA graph is y = 3.2322x + 21.55; R² = 0.9968.

Figs. 3A and 3B. Vaccine A (Fort Dodge Fel-O-Vax Lv-K®) protected cats against FeLV challenge: nine of 10 vaccinated cats did not develop detectable antigenemia and had low to undetectable proviral burden. Sera and PBMC collected at challenge and every 2 weeks thereafter through 8 weeks PC were analyzed for FeLV p27 capsid antigen via capture ELISA (Fig. 3A) and for FeLV DNA via quantitative real- time PCR (Fig. 3B). Only 1 of 10 Vaccine A cats developed persistent antigenemia with persistent high proviral burden. By contrast, 13 of 15 Vaccine B cats and 7 of 10 unvaccinated control cats developed persistent antigenemia and high proviral burdens. Statistically significant differences (p<0.01) for both p27 and viral DNA levels were detected between Vaccine A vs. Vaccine B and Vaccine A vs. unvaccinated Controls. Results for Vaccine B were not statistically different from the unvaccinated Controls. Graphed boxplots show the 10^th, 25^th, 50^th (median), 75^th, and 90^th percentiles of a variable. Values above the 90^th and below the 10^th percentile are not shown. (Fig. 3A) The dotted line represents the threshold for positive results (>10% of the positive control).

Figs. 4A and 4B. Hostvirus relationships were defined using circulating p27 and viral DNA levels. FeLV-61 E-A-infected cats classified as having experienced abortive infection never had detectable p27 (Fig. 4A) or viral DNA (Fig. 4B) in blood. In cats with regressive infection, circulating p27 was not detected, but transient or persistent low viral DNA levels were detectable in blood (median 225 copies/10⁶ PBMC; range 0 to 30,854 copies/10⁶ PBMC). Cats considered to have latent infection developed transient antigenemia and retained moderate viral DNA levels in blood (median 40,969 copies/10⁶ PBMC; range 860 to 328,249 copies/10⁶ PBMC). Cats with progressive infection were persistently antigenemic and had persistent high circulating proviral burdens (median 269,328 copies/10⁶ PBMC; range 7,330 to 2,224,869 copies/10⁶ PBMC). Statistically significant differences (p^«=0.01) in p27 values were identified between progressive vs. abortive, progressive vs. regressive, and progressive vs. latent infection. Statistically significant differences (p<0.01) in proviral burdens were identified between abortive vs. regressive, abortive vs. latent, abortive vs. progressive, regressive vs. latent, and regressive vs. progressive infection. Mean ± SD is plotted. (Fig. 4A) The dotted line represents the threshold for positive results (>10% of the positive control).

Fig. 5. Early FeLV:host relationships were maintained for 2 - 3.5 years and proviral burdens in blood and tissues correlated. Thirteen of 35 cats were available for necropsy after long-term survival periods. Sera were analyzed for antigenemia via p27 capture ELISA. PBMC, BM, SP, and MLN were analyzed for viral DNA burden via quantitative real-time PCR. Three Vaccine A cats with abortive i nfection and 2 Vaccine A cats with regressive infection (transiently detectable viral DNA) remained p27 negative with undetectable viral DNA in PBMC, BM, SP, and MLN. Additional available tissues (thymus, tonsil, and retropharyngeal lymph node) also were negative for viral DNA. One Vaccine B cat with regressive infection remained p27 negative despite retaining low viral DNA levels in PBMC, BM, SP, and MLN. The 1 unvaccinated control cat classified as latent infection became p27-positive with detectable viral DNA in PBMC, BM, SP, and MLN. The 3 Vaccine B cats and 3 unvaccinated control cats with progressive infection remained p27 positive with readily detectable viral DNA in PBMC, BM, SP, and MLN. Pearson correlation coefficients and p values between PBMC and tissues were PBMC vs. BM: r = 0.559, p>0.05; PBMC vs. SP: r = 0.975, p<0.01 ; and PBMC vs. MLN: r = 0.823, p<0.01. Mean ± SD is plotted. Categories of FeLV infection were classified by the p27 and viral DNA assa7s during the first 8 weeks after challenge (A, abortive; R, regressive; L, latent; P, progressive. Experimental groups include VA, Vaccine A; VB, Vaccine B; C, unvaccinated control. A-VA represents results from 3 cats and R-VA represents results from 2 cats, wherein neither circulating n or tissue viral DNA was detected at euthanasia.

Fig. 6. Linearity and sensitivity of quantitative real-time FeLV RNA PCR. Standard curve of the RNA standard is linear. Ten copies of the standard are consistently detected. Amplification of ten-fold serial dilutions between 5 X 10⁷ copies to 5 X10¹ copies of the standard demonstrated linearity over six orders of magnitude, generated a standard curve correlation coefficient of 0.9989, and produced an amplification efficiency of 105.8%. Mean values ± SD for 1S independent experiments are plotted. The equation describing the line is y = -3.1897x + 36.824; R² = 0.9989.

Fig. 7. Amplification efficiency comparison to validate real-time RNA PCR quantification. Serial dilutions (1 :10, 1 :100, and 1 :1000) of plasma RNA from an FeLV61 E-A-infected cat and of the RNA standard were amplified. Amplification efficiencies of the FeLV-positive RNA and the RNA standard were approximately equal (Δs=0.07) demonstrating that quantification using the RNA standard is deemed valid. Mean values ± SD are plotted. The equation describing the standard curve is y = 3.2383x + 12.38; R² = 0.9967; and the equation describing the FeLV RNA- positive sample is y = 3.1733x + 28.039; R² = .9934.

DETAILED DESCRIPTION OF THE INVENTION

Feline leukemia virus (FeLV) is a naturally occurring, contagiously transmitted, gammaretrovirus of cats (Hardy et al., 1973; Hoover et al., 1972; Jarrett et al., 1964; Kawakami et al., 1967; Rickard et al., 1969). Its pathogenic effects are paradoxical, causing both cytoproliferative (e.g. lymphoma or myeloproliferative disorder) and cytosuppressive (e.g. immunodeficiency or myelosuppression) disease (Anderson et al., 1971 ; Cockerell and Hoover, 1977; Cockerell et al., 1976; Hoover et al., 1974; Jarrett et al., 1964; Kawakami et al., 1967; Mackey et al., 1975; Perryman et al., 1972; Rickard et al., 1969). While many FeLV-exposed cats (estimated at ~30%) develop progressive infection and FeLV-related disease, at least twice as many (estimated at ~60%) develop regressive infection marked by an effective and durable immune response which contains and possibly extinguishes viral replication, thereby abrogating development of disease (Hardy et al., 1976; Hoover and Mullins, 1991 ; Hoover et al., 1981 ; Rojko et al., 1979). That effective host containment of FeLV infection can occur prompted research leading to development of the first vaccine for a naturally occurring retroviral infection (Hoover et al., 1991 ; Lewis et al., 1981 ; Sparkes, 1997).

Available evidence suggests that the interplay between the host and virus within the first 4 weeks after FeLV exposure results in either: (a) failure of host immune response to contain viral replication in lymph nodes, epithelia, and bone marrow precursor cells or (b) successful host immune response resulting in curtailment of viral replication (Hoover and Mullins, 1991 ; Hoover et al., 1981 ; Rojko et al., 1979). Cats with progressive infection develop persistent antigenemia as detected by p27 capsid antigen capture in blood and have neither virus neutralizing antibodies (VN Ab) nor high levels of FeLV-specific cytotoxic lymphocytes (CTLs) (Flynn et al., 2002; Flynn et al., 2000; Hoover and Mullins, 1991). By contrast, cats with regressive infection do not develop persistent antigenemia but do produce VN Ab and a detectable CTL response (Flynn et al., 2002; Flynn et al., 2000; Hoover and Mullins, 1991). Because identification of FeLV infection has necessarily been based on assays that rely on viral replication and substantial viremia/antigenemia, it is unclear whether regressors retain latent (non-productive) infection or instead may eliminate all cells bearing integrated FeLV provirus. Several laboratories have shown that it is possible to reactivate FeLV from some cats with regressive infection (Madewell and Jarrett, 1983; Post and Warren, 1980; Rojko et al., 1982). Despite this, attempts by other laboratories to amplify viral DNA sequences in circulating and/or bone marrow cells from cats with suspected latent infections have been unsuccessful using conventional PCR (Herring et al., 2001 ; Jackson et al., 1996; Miyazawa and Jarrett, 1997). Similar to FeLV regressors, protected vaccinates do not develop persistent antigenemia. To the authors' knowledge, however, studies assessing vaccinates for potential latent infections using PCR have not been performed (Sparkes, 1997). _π , . ^ _χ. , ₄. _n^_π . .

Recent studies employing quantitative real-time PCR in experimental FeLV infections have shown that the early circulating proviral burden influences the course of infection and that real-time PCR detected provirus in circulating cells from cats with undetectable or transient antigenemia (Flynn et al., 2002; Hofmann-Lehmann et al., 2001). To explore further the FeLV:host relationship and assess the presence of latent viral DNA in circulation and tissue, we developed a quantitative real-time PCR assay and examined the early (weeks post-challenge) and late (years post- challenge) phases of experimental FeLV infection in both unvaccinated animals and those primed by vaccination. Herein we report proviral and p27 levels in FeLV-61 E- A-challenged cats given effective, ineffective, or no FeLV vaccine. Based on the results of these studies we identified four categories within the spectrum of FeLV infection, which we have designated as abortive, regressive, latent, and progressive.

The analytical specificity of the FeLV quantitative real-time PCR assay was confirmed by sequencing two amplicons after agarose gel confirmation. Using

BLAST® (Altschul et al., 1990; Wheeler et al., 2003), the amplicon sequences were shown to be identical to that of FeLV-61 E-A. Peripheral blood mononuclear cells (PBMC) and lymphoid tissues from FeLV-naϊve, specific-pathogen-free (SPF) cats were consistently negative for FeLV DNA (49/49 samples from 18 cats; thus, endogenous FeLV sequences were not amplified. Consequently, diagnostic specificity was 100% in FeLV-61 E-A-infected animals.

The analytical sensitivity of the FeLV real-time PCR assay was assessed in end-point dilution experiments. These studies consistently detected 5 copies of the p61 E-FeLV plasmid standard (Fig. 1). The template control (no DNA, PCR-grade H₂O only), negative control (FeLV-naϊve, SPF cat DNA), and samples containing 0.5 copy of the plasmid standard never crossed threshold. All FeLV-61 E-A-infected cats that tested positive for p27 capsid antigen also were positive by real-time PCR (76/76 samples from 23 cats) (Table 2). Thus, diagnostic sensitivity in the animals studied was 100%.

The linear range of the plasmid standard curve was evaluated. Amplification of ten-fold serial dilutions starting at 5 X 10⁸ copies and ending at 5 X10° copies of the p61 E-FeLV plasmid standard from 18 independent experiments demonstrated linearity over 8 orders of magnitude, generated a standard curve correlation coefficient of 0.999, and produced an amplification efficiency of 96.6% (Fig. 1).

The amplification efficiencies of FeLV-61 E-A-infected cat DNA and the p61 E-

FeLV plasmid standard were compared to validate quantification using the plasmid standard. Equivalent amplification efficiencies are indicated by regression line slopes (s) with less than 0.1 difference (Δs) (Gut et al., 1999). The observed amplification efficiencies of the target DNA (s=3.32, R²=0.997) vs. the plasmid standard (s=3.30, R²=0.999) had a Δs=0.02. Thus, quantification using the plasmid standard was deemed valid (Fig. 2).

The within-run and between-run precision of the FeLV real-time PCR assay was evaluated. Several dilutions of the p61 E-FeLV plasmid standard and of FeLV- 61 E-A-infected cat DNA were amplified 10 times within the same reaction plate and between 10 different reaction plates. The threshold cycle coefficients of variation, CV(CT), for the within-run precision were 0.31 to 1.11 % (Table 3). The CV(C_τ) for the between-run precision was 0.56 to 1.16%. Thus, the assay was considered highly reproducible.

Early circulating p27 and viral DNA levels in FeLV-challenged animals were evaluated. Sera and PBMC collected pre-challenge and every 2 weeks thereafter through 8 weeks post-challenge (PC) were analyzed for FeLV p27 capsid antigen via capture ELISA and for FeLV U3 LTR DNA via quantitative real-time PCR. None of the cats had detectable antigen or viral DNA pre-challenge.

FeLV p27 was never detected in 9 of the 10 cats (90%) which received Vaccine A (Fig. 3 A). Of these 9 protected vaccinates, 4 never had detectable viral DNA, 2 developed transient low provirus loads (median: 130 copies/10⁶ PBMC; range: 0 to 1 ,723 copies/10⁶ PBMC) which gave way to undetectable levels (1 cat by 6 weeks and 1 cat by 8 weeks), and 3 had persistent low viral DNA levels (median: 225 copies/10⁶ PBMC; range: 0 to 7,744 copies/10⁶ PBMC) (Fig. 3 B). In the one persistently antigenemic failed vaccinate, a persistent high proviral burden was present PC (median: 477,999 copies/10 PBMC; range: 17,140 to 578,572 copies/10⁶ PBMC).

Thirteen of the 15 cats (86%) given Vaccine B developed persistent antigenemia and persistent high proviral burdens PC (median: 259,013 copies/10⁶ PBMC; range: 7,330 to 2,224,869 copies/10⁶ PBMC). p27 was never detected in the remaining 2 vaccinates. In one of these latter animals, viral DNA also was never detected whereas in the second animal, persistent low proviral load (median: 18,790 copies/10⁶ PBMC; range: 6,079 to 30,854 copies/10⁶ PBMC) was present. Seven of the 10 unvaccinated control cats (70%) developed persistent antigenemia and high proviral burdens PC (median: 265,572 copies/10⁶ PBMC; range: 11 ,942 to 1 ,508,006 copies/10⁶ PBMC). The remainin g 3 animals experienced transient antigenemia between 2 and 6 weeks P C, after which p27 was no longer detectable (1 cat by 4 weeks and 2 cats by 6 weeks). These latter cats retained persistent moderate proviral burdens (median: 40,959 copies/10⁶ PBMC; range: 860 to 328,249 copies/10⁶ PBMC).

Using repeated measures-ANOVA and the Tukey-Krarner post-hoc test, statistically significant differences (p<0.01) in p27 and viral DINA levels were present between Vaccine A vs. Vaccine B and between Vaccine A vs. unvaccinated

Controls. Results for Vaccine B were not statistically different from the unvaccinated Controls.

The preventable fraction (PF) is used to express vaccine efficacy due to the inherent resistance of approximately 60% of unvaccinated cats to development of persistent antigenemia after FeLV challenge (Pollack and Scarlett, 1990).

PF = (Incidence of Persistent Antigenemia in Controls — Incidence of Persistent Antigenemia in Vaccinates) divided by Incidence of Persistent Antigenemia in Control

The PF for Vaccine A was 85.7%. The PF for Vaccine B was -23.8%. Hostvirus relationships were defined using circulating p27 and viral DNA levels. In the original Fel_V:host relationship classification scheme, FeLV-exposed animals that did not develop persistent antigenemia were identified as having experienced regressive infections. The results of the present study suggest that FeLV-exposed antigen-negative cats represent a spectrum of host:virus relationships.

The 5 Fel_V-61 E-A-inoculated cats in which neither p27 nor viral DNA were detected at any time were classified as having experienced abortive infection (Table 4 and Fig. 4). Four of these cats were vaccinated with Vaccine A and 1 with Vaccine B.

The 6 cats that never developed detectable antigenemia but in which transient or low persistent circulating viral DNA levels were detectable (median: 225 copies/10⁶ PBMC; range: 0 to 30,854 copies/10⁶ PBMC) were classified as having experienced regressive infection. Five of these cats were vaccinated with Vaccine A and 1 with Vaccine B. Surprisingly, an initial low proviral burden detected at 4 weeks PC was no longer demonstrable by 8 weeks PC in two cats vaccinated with Vaccine A.

Transient antigenemia was demonstrated in 3 unvaccinated control cats that retained persistent moderate proviral loads in blood (median: 40,969 copies/10⁶ PBMC; range: 860 to 328,249 copies/10⁶ PBMC). These animals were classified as retaining latent infection.

Finally, twenty-one cats developed persistent antigenemia with concurrent persistent high circulating proviral burdens (median: 269,328 copies/10⁶ PBMC; range: 7,330 to 2,224,869 copies/10⁶ PBMC). These animals, as in previous classification schemes, were designated as progressive infection.

Using repeated measures-ANOVA and the Tukey-Kramer post-hoc test, statistically significant differences (p<0.01) in p27 values were identified between progressive vs. abortive, progressive vs. regressive, and progressive vs. latent infection. Statistically significant differences (p<0.01) in viral DNA burdens were present among all FeLV categories (with the exception of latent vs. progressive infection): abortive vs. regressive, abortive vs. latent, abortive vs. progressive, regressive vs. latent, and regressive vs. progressive infection.

The kappa statistic was calculated to assess the level of agreement and correlation between p27 and viral DNA detection, beyond that which might be expected due to chance, between the p27 capture ELISA and the real-time PCR assay (Table 2). All samples that tested positive for p27 capsid antigen were positive by real-time PCR (76 samples from 23 cats). All samples with undetectable viral DNA (real-time PCR negative) had undetectable antigen (ELISA negative) (23 samples from 8 cats). No sample was positive by ELISA and negative by real-time PCR. However, 24 samples from 13 cats were positive by real-time PCR and negative by p27 capture. Thus, real-time PCR had greater sensitivity than p27 capture ELISA. The kappa statistic was 0.53 indicating a fair agreement between the two tests.

Pearson correlation coefficients were determined to assess the linear relationship between circulating p27 levels and PBMC viral DNA levels. After a Fisher's r to z transformation, p values were obtained. The correlation between ELISA and real-time PCR became progressively more concordant as infections became fully established as indicated by the following trend in time periods: 2 weeks PC r = 0.761 , p<0.01 ; 4 weeks PC r = 0.461 , p<0.05; 6 weeks PC r = 0.555, p<0.01 ; and 8 weeks PC r = 0.640, p<0.01. After splitting the data by category of FeLV infection, a more linear relationship between the assays appeared: abortive infection r = not applicable (no variability in the data); regressive infection r = 0.831 , p<0.01 ; latent infection r = 0.896, p<0.01 ; and progressive infection r = 0.409, p<0.01.

The long-term outcome and host:virus relationships in 13 of the FeLV- challenged cats were studied. Thirteen of the 35 cats studied above were available for necropsy after survival periods of 2 to 3.5 years. This cohort was comprised of: 5 cats from the Vaccine A group, 4 cats from the Vaccine B group, and 4 from the unvaccinated Control group (Table 1 ). Sera were analyzed for p27 capsid antigen via capture ELISA. PBMC, bone marrow (BM), spleen (SP), and mesenteric lymph node (MLN) from all 13 animals were analyzed for viral DNA via quantitative real- time PCR. In addition, thymus, tonsil, and retropharyngeal lymph node were available for the 5 cats vaccinated with Vaccine A.

Three cats that received Vaccine A and were categorized as having abortive infection (antigen negative/provirus negative) remained antigen negative and provirus negative in blood after a 2-year observation period (Fig. 5). Perhaps surprisingly, viral DNA was not detectable in the BM, SP, or MLN of these same animals. In addition, no viral DNA could be detected in thymus, tonsil, or retropharyngeal lymph node. It would not be possible, therefore, to distinguish these animals from those never exposed to FeLV on the basis of antigen-capture ELISA and real time -PCR assay results alone.

Two cats that received Vaccine A and were classified as having regressive infection (antigen negative/low transient provirus) (Table 4) also remained antigen negative and provirus negative in blood nearly 2 years later. Similar to cats with abortive infections, viral DNA was not detected in BM, SP, or MLN, nor was it detected in thymus, tonsil, and retropharyngeal lymph node. The 1 cat that received Vaccine B and was classified as regressive infection (antigen negative/persistent low proviral load) remained antigen negative. The relatively low PBMC viral DNA levels detected at 8 weeks PC (6866 + 668 copies/10⁶ PBMC) were retained 3 years later (44 ± 76 copies/10⁶ PBMC) and these levels were similar to those detected in BM, SP and MLN.

The one unvaccinated control cat classified as having latent infection (transient antigenemia/persistent moderate proviral load) had become p27-positive after 3 years. Viral DNA levels detected in PBMC of this animal were similar to BM, SP, and MLN although PBMC levels (919 + 330 copies/10⁶ PBMC) after 3 years were appreciably lower than those detected at 8 weeks PC (94,184 ± 4962 copies/10⁶ PBMC).

One cat that received Vaccine B and was considered to have progressive infection also remained unchanged after 3 years. The PBMC proviral load in this animal peaked at 4 weeks PC (518,096 ± 17,778 copies/10⁶ PBMC), decreased by 8 weeks PC (7,330 + 133 copies/10⁶ PBMC), and remained relatively similar to the 8 week level 3 years later (196 ± 63 copies/10⁶ PBMC). Proviral burdens in BM, SP, and MLN were similar to blood levels. Two cats that received Vaccine B and 3 unvaccinated control cats that were classified as progressive infections (antigen positive/persistent high proviral load) remained antigen-positive. The relatively high PBMC viral DNA levels detected at 8 weeks PC (639,174 ± 593,815 copies/10⁶ PBMC) were retained 3 to 3.5 years later (2,143,280 ± 1 ,387,100 copies/10⁶ PBMC) and these levels were similar to those detected in BM, SP and MLN.

Viral DNA levels in circulating cells correlated with levels in tissues. Pearson correlation coefficients between circulating and tissue viral DNA levels and the p values after a Fisher's r to z transformation were PBMC vs. BM: r = 0.559, p>0.05; PBMC vs. SP: r = 0.975, p<O.01 ; and PBMC vs. MLN: r = 0.823, p<0.01.

In summary, it appeared in most instances the hostvirus relationship became established by 8 weeks and was maintained for 2 to 3.5 years in blood and lymphoid tissues.

Similar studies were carried out with quantitative real time polymerase chain reaction analysis of viral RNA sequences in cats having varying states of FeLV infection.

The analytical specificity of the FeLV quantitative real-time RNA PCR assay was confirmed by sequencing two amplicons after agarose gel confirmation (data not shown). The amplicon seq uence from the RNA standard was identical to that of FeLV-61 E-A, and the amplicon sequence from an FeLV-61 E-A-infected cat contained one base mismatch (data not shown). Plasma RNA from FeLV-naive, specific-pathogen-free (SPF) cats were consistently negative for the presence of FeLV RNA using this assay (43/43 samples from 9 cats; data not shown). Consequently, diagnostic specificity was 100% in FeLV-61 E-A-infected animals.

The analytical sensitivity of the FeLV quantitative real-time RNA PCR assay was assessed in end-point dilution experiments. These studies consistently detected 10 copies and inconsistently detected 5 copies of the RNA standard (Fig. 6). Negative samples never crossed threshold: negative control (FeLV-naive SPF cat RNA), template control (no RNA, PCR-grade H₂O), extraction contro l (extracted PCR-grade H₂O), DNA control (no RT added to RNA standard), and samples containing 1 copy of the RNA standard.

The linear range of the RNA standard curve was evaluated. Amplification of ten-fold serial dilutions starting at 5 X 10⁷ copies and ending at 5 X 10¹ copies of the RNA standard from 16 independent experiments demonstrated linea rity over 6 orders of magnitude, generated a standard curve correlation coefficient of 0.999, and produced an amplification efficiency (Klein et al., 2001) of 105.8% (Fig. 6).

The amplification efficiencies of Fel_V-61 E-A-infected cat RNA and the RNA standard were compared to validate quantification using the RNA. standard. Equivalent amplification efficiencies are indicated by regression line slopes (s) with less than 0.1 difference (Δs) (Gut et al., 1999). The observed a mplification efficiencies of the target RNA (s=3.17, R²=0.993) vs. the RNA standa rd (s=3.24, R²=0.997) had a Δs=0.07 (Fig. 2). Thus, quantification using the plasm id standard was deemed valid.

The within-run and between-run precision (reproducibility) of the FeLV real- time RNA PCR assay was evaluated. Several dilutions of the RNA standard and of Fel_V-61 E-A-infected cat RNA were amplified 10 times within the same reaction plate and between 10 different reaction plates. The threshold cycle coefficients of variation, CV(CT), for the within-run precision were 0.93 to 1.81 % and the CV(Cj) for the between-run precision was 0.9 to 2.18% (Table 5).

DISCUSSION

The primary purpose of this study was to develop and validate a quantitative real-time DNA PCR assay to examine FeLV-vaccinated and unvaccinated cats for viral DNA sequences in circulating cells in the early phase of FeLV infection and in both circulating cells and tissue during the late phase of FeLV infection. ^"This assay was based on an FeLV U3 LTR sequence and proved to be reproducible, quantitative, sensitive, and specific for exogenous FeLV. The greater sensitivity of real-time PCR allowed detection of viral DNA in cats with undetectable antigenemia. This finding is consistent with recent studies of Hofmann-Lehmann et al. and Flynn et al. (Flynn et al., 2002; Hofmann-Lehmann et al., 2001). The current real-time PCR assay, while similar to that developed by Hofmann-Lehmann et al. (Hofmann- Lehmann et al., 2001), is based on FeLV-61E-A, the highly replication competent, non-acutely pathogenic component of the FeLV-FAIDS complex (Donahue et al., 1988; Hoover et al., 1987; Mullins et al., 1986; Overbaugh et al., 1988). Because the U3 LTR region is conserved among FeLV subgroup A viruses, the detection of cross-isolates is enabled using the present primer/probe set. While unintegrated viral DNA (UVD) is a characteristic of the FeLV-FAIDS strain, this method cannot distinguish between integrated provirus and UVD.

This is believed to be the first study assessing the efficacy of an FeLV vaccine using real-time PCR. Nine of the 10 cats which received Vaccine A (Fort Dodge FeI- O-Vax Lv-Kd)) were protected as indicated by the absence of circulating FeLV p27. Moreover, in 4 of the 9 protected vaccinates viral DNA was never detected in PBMC. The remaining 5 protected cats had either transient low (2 cats) or persistent low (3 cats) circulating viral DNA levels within the first 8 weeks PC. Importantly, viral DNA was not detectable in PBMC or lymphoid tissues from the 5 available animals, nearly 2 years after viral challenge. Previous studies examining the efficacy of Fel-O-Vax Lv-K® reported preventable fractions of 86% and 100% (Hoover et al. , 1995, 1996; Legendre et al., 1991). Virus was not isolated from bone marrow cultures at 7 or 31 weeks post-challenge/exposure in these experiments (Hoover et al., 1 995, 1996; Legendre et al., 1991). Results of the present study bolster these previous findings, as do those of Haffer et al., (Haffer et al., 1987) lending support to the tenet that successful immunity to retroviral infection can be obtained with immunoprophylaxis.

The greater sensitivity of real-time PCR allowed us to identify more detailed FeLV:host relationship categories, which we designated as abortive, regressive, latent, and progressive. Although it is certainly plausible that these categories of FeLV infection may be dynamic, especially the intermediate categories, we found these host:virus relationships became established by 8 weeks PC and were maintained for years in the limited sample of FeLV-challenged cats in the present study. In the original FeLV:host relationship classification scheme, animals with abortive, regressive, and latent infection all would have been identified as regressive infection due to the lack of persistent antigenemia. In 1980-1982, it was discovered that at least some antigen-negative cats which experienced regressive infection retain latent FeLV infection in bone marrow (Madewell and Jarrett, 1983; Post and Warren, 1980; Rojko et al., 1982). With the advent of PCR, this hypothesis was tested using antigen-negative cats with suspected latent infections, however, no viral DNA sequences were amplified from blood or bone marrow cells (Herring et al., 2001 ; Jackson et al., 1996; Miyazawa and Jarrett, 1997). Thus, it was proposed that these antigen-negative cats did not harbor latent virus in the sites examined. The results of the present study suggest that neither scenario is absolute. Rather, FeLV- exposed antigen-negative cats represent a spectrum of hostvirus relationships wherein some animals appear to eliminate infected cells in circulation and tissues while some maintain a low to moderate level of infected cells. Reactivation is possible in the latter animals.

Without wishing to be bound by any particular theory, we believe that cats with abortive infection produced effective early host immune responses which abrogate viral replication and eliminate FeLV-infected cells. This is inconsistent with the hypothesis that all FeLV-exposed antigen-negative cats harbor a reservoir of infected cells in some hemolymphatic tissue. It remains possible, though not probable in our view, that such animals harbor sequestered FeLV in tissues not examined. It is also possible that the real-time PCR assay is not sufficiently sensitive to detect extraordinarily low proviral levels, as has been proposed to occur in people who are repeatedly exposed to human immunodeficiency virus yet remain seronegative (Zhu et al., 2003). Our present observations bolster the contention that some individuals can resist retroviral infection without conventional evidence of infection.

Without wishing to be bound by theory, we believe that cats with regressive infection successfully contain viral replication, despite retaining a low level of FeLV- infected cells in circulation and tissues. Some of these animals even eliminate these infected cells and go on to resemble cats with abortive infections. This supports the hypothesis that some FeLV-exposed antigen-negative cats can maintain populations of non-productive, infected cells. Our results also demonstrate that these cats harbor viral DNA in circulation and lymphoid tissues in addition to bone marrow. While reactivation of regressive infection may be possible, this was not detected in the present study. Overall, the present study suggests a more likely outcome of eventual elimination or extinction of infected cells.

In cats classified as having latent infection, delayed containment of viral replication occurs resulting in a moderate proviral residuum. As a corollary, if host immune containment wanes, viral reactivation becomes more likely. This is consistent with the tenet that some FeLV-exposed antigen-negative cats can maintain cell populations harboring replication-competent latent FeLV capable of reactivation.

We have concluded that residual viral DNA detected by real-time PCR could represent intact provirus or replication-defective sequences. Previous studies have reported that non-viremic cats from which FeLV was isolated from cultured BM cells did not horizontally transmit FeLV (Madewell and Jarrett, 1983; Pacitti and Jarrett, 1985; Pedersen et al., 1984). However, vertical transmission to offspring from similar animals also has been reported (Pacitti et al., 1986; Pedersen et al., 1984). Additional studies are needed to assess the state and fate of viral DNA in latently infected cats. Such issues are pertinent to use of FeLV antigen-negative cats for blood donation, tissue transplants, and adoptions, as well as to the use of therapeutic immunosuppressive drugs in antigen-negative cats (Coronado et al., 2000; Gregory et al., 1991 ; Nemzek et al., 1994, 1996).

That effective containment of human immunodeficiency virus may be possible is inferred by long-term nonprogression in HIV-infected individuals and apparent resistance to infection in highly HIV-exposed seronegative individuals. Genetic, virological, and immunological factors all likely play a role in HIV containment (Cohen et al., 1997; Haynes et al., 1996; Levy, 1993; Rowland-Jones and McMichael, 1995). Animal models present unique opportunities to prospectively examine the initial events in immunopathogenesis. Further examination of the early immune responses which determine effective vs. ineffective containment of FeLV infection and better characterization of the latent viral state would provide valuable insights into retroviral pathogenesis and resistance overall.

As used herein, endogenous feline leukemia virus sequences are those in the feline genome which are transmitted vertically. These endogenous sequences do not lead to a productive FeLV infection.

Exogenous feline leukemia virus nucleic acid sequences, in the context of the present invention, are transmitted horizontally as well as vertically. In general, the exogenous FeLV are capable of causing infection in a felid, especially one which has not been vaccinated against FeLV. Unless otherwise indicated, FeLV and exogenous FeLV are meant to be synonymous.

A protein is considered an isolated protein if it is a protein isolated from a host cell in which it is recombinantly produced. It can be purified or it can simply be free of other proteins and biological materials with which it is associated in nature.

An isolated nucleic acid has a nucleotide sequence which is not identical to that of any naturally occurring nucleic acid or one which has been purified away from sequences or from cellular components with which it is associated in nature. The term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of (i) DNA and/or RNA molecules, (ii) transformed or transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library. In the present context, a promoter is a DNA region which includes sequences sufficient to cause transcription of an associated (downstream) sequence. The promoter may be regulated, i.e., not constitutively acting to cause transcription of the associated sequence. If inducible, there are sequences present which mediate regulation of expression so that the associated sequence is transcribed only when an inducer molecule is present in the medium in or on

the organism is cultivated. In the present context, a transcription regulatory sequence includes a promoter sequence and can further include cis-active sequences for regulated expression of an associated sequence in response to environmental signals.

One DNA or RNA portion or sequence is downstream of second DNA or RNA portion or sequence when it is located 3' of the second sequence. One DNA portion or sequence is upstream of a second DNA or RNA portion or sequence when it is located 5' of that sequence.

One DNA or RNA molecule or sequence and another are heterologous to another if the two are not derived from the same ultimate natural source. The sequences may be natural sequences, or at least one sequence can be designed by man, as in the case of a multiple cloning site region. The two sequences can be derived from two different species or one sequence can be produced by chemical synthesis provided that the nucleotide sequence of the synthesized portion was not derived from the same organism as the other sequence .

An isolated or substantially pure nucleic acid molecule or polynucleotide is a polynucleotide which is substantially separated from other polynucleotide sequences which naturally accompany a native transcription regulatory sequence. The term embraces a polynucleotide sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA or cDNA isolates, chemically synthesized analogues and analogues biologically synthesized by heterologous systems.

A polynucleotide is said to encode a polypeptide if, in its native state or when manipulated by methods known to those skilled in the art, it can be transcribed and/or translated to produce the polypeptide or a fragment thereof. The anti-sense strand of such a polynucleotide is also said to encode the sequence.

A nucleotide sequence is operably linked when it is placed into a functional relationship with another nucleotide sequence. For instance, a promoter is operably linked to a coding sequence if the promoter effects its transcription or expression. Generally, operably linked means that the sequences being lin ked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, it is well known that certain genetic elements , such as enhancers, may be operably linked even at a distance, i.e., even if not contiguous.

The term recombinant polynucleotide refers to a polynucleotide which is made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.

A polynucleotide or oligonucleotide probe can be a radiolabeled nucleic acid or other detectable nucleic acid. It can include an isolated polynucleotide or oligonucleotide attached to a label or reporter molecule. Such probes can be used to identify and/or isolate other related sequences, for example, an amplification product (amplimer) of a polymerase chain reaction, where the amplimer contains sequences complementary to the probe. A specifically exemplified detectable label is the fluorescent label is 6-carboxyfluorescein. Advantageously, the oligonucleotide can further contain a quencher which improves the sensitivity, including but not limited to a quencher as disclosed in WO 01/86001 , incorporated by reference herein. Probes comprising synthetic oligonucleotides or other polynucleotides may be derived from naturally occurring or recombinant single or double stranded nucleic acids or be chemically synthesized. Polynucleotide probes may be labeled by any of the methods known in the art, e.g., random hexamer labeling, nick translation, or the Klenow fill-in reaction, or by the incorporation of a chromophore, a fluorophore, a chemiluminescent moiety or any other moiety which mediates or enables detection of that probe. See also WO 99/25874, incorporated by reference herein, for a discussion of appropriate detection strategies.

Large amounts of the polynucleotides may be produced by replication in a suitable host cell. Natural or synthetic DNA fragments coding for a protein of interest are incorporated into recombinant polynucleotide constructs, typically DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell. Commonly used prokaryotic hosts include strains of Escherichia coli, although other prokaryotes, such as Bacillus subtilis or a pseudomonad, may also be used. Eukaryotic host cells include yeast, filamentous fungi, plant, insect, amphibian and avian species. Such factors as ease of manipulation and ease of purification of expressed proteins away from cellular contaminants or other factors influence the choice of the host cell.

The polynucleotides or oligonucleotides may also be produced by chemical synthesis, e.g., by the phosphoramidite method described by Beaucage and Caruthers (1981) Tetra. Letts. 22: 1859-1862 or the triester method according to Matteuci et al. (1981) J. Am. Chem. Soc. 103: 3185, and may be performed on commercial automated oligonucleotide synthesizers. A double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

It is recognized by those skilled in the art that the DNA or RNA sequences may vary due to the degeneracy of the genetic code and codon usage. All DNA sequences which code for a particular polypeptide or protein of interest (or portion thereof) are included in this invention.

Additionally, it will be recognized by those skilled in the art that allelic variations may occur in the DNA sequences which will not sign ificantly change activity of the amino acid sequences of the peptides which the DNA or RNA sequences encode. All such equivalent DNA sequences are included within the scope of this invention and the definition of the regulated promoter region. The skilled artisan will understand that the sequence of the exemplified sequence can be used to identify and isolate additional, nonexemplified nucleotide sequences which are functionally equivalent to the sequences given.

Hybridization procedures are useful for identifying polynucleotides with sufficient homology to the subject regulatory sequences to be useful as taught herein. The particular hybridization technique is not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied by one of ordinary skill in the art. A probe and sample are combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting. As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong non-covalent bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical, or completely complementary if the annealing and washing steps are carried out under conditions of high stringency. The probe's detectable label provides a means for determining whether hybridization has occurred.

In the use of the oligonucleotides or polynucleotides as probes, the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and non-radioactive labels. Typical radioactive labels include ³²P, ³⁵S, or the like. Non-radioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases or peroxidases, or a chemiluminescer such as luciferin, or fluorescent compounds like fluorescein and its derivatives. Alternatively, the probes can be made inherently fluorescent as described in International Application No. WO 93/16094. Other detectable labels known to the art can also be used. See, e.g., WO 99/25874.

Various degrees of stringency of hybridization can be employed. The more stringent the conditions, the greater the complementarity that is required for duplex formation. Stringency can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example in Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton Press, New York, NY., pp. 169-170, hereby incorporated by reference.

As used herein, moderate to high stringency conditions for hybridization are conditions which achieve the same, or about the same, degree of specificity of hybridization as the conditions employed by the present inventors. An example of high stringency conditions are hybridizing at 68⁰ C in 5X SSC/5X Denhardt's solution/0.1 % SDS, and washing in 0.2X SSC/0.1% SDS at room temperature. An example of conditions of moderate stringency are hybridizing at 68° C in 5X SSC/5X Denhardt's solution/0.1% SDS and washing at 42° C in 3X SSC. The parameters of temperature and salt concentration can be varied to achieve the desired level of sequence identity between probes and target nucleic acid. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et at. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY, for further guidance on hybridization conditions.

Specifically, hybridization of immobilized DNA in Southern blots with ³²P- labeled gene specific probes can performed as described herein or by standard methods (Maniatis et al.) In general, hybridization and subsequent washes are carried out under moderate to high stringency conditions that allow for detection of target sequences with homology to the exemplified sequences. For double-stranded DNA gene probes, hybridization can be carried out overnight at 20-25° C below the melting temperature (Tm) of the DNA hybrid in 6X SSPE 5X Denhardt's solution, 0.1 % SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G.A., Jacobe, T.H., Rickbush, P.T., Chorbas, and F. C. Kafatos (1983) Methods of Enzymology, R. Wu, L, Grossman and K Moldave (eds) Academic Press, New York 100:266-285). Appropriate modifications are known to the art for RNA molecules.

Tm=81.5° C + 16.6 Log[Na+]+0.41(+G+C)-0.61 (% formamide)-600/length of duplex in base pairs. Washes are typically carried out as follows: twice at room temperature for 15 minutes in 1X SSPE, 0.1 % SDS (low stringency wash), and once at TM-2O⁰ C for 15 minutes in 0.2X SSPE, 0.1 % SDS (moderate stringency wash).

For oligonucleotide probes, hybridization is carried out overnight at 10-20° C below the melting temperature (Tm) of the hybrid 6X SSPE, 5X Denhardt's solution, 0.1 % SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes is determined by the following formula: TM(°C)=2(number T/A base pairs +4(number G/C base pairs) (Suggs, S.V., T. Miyake, E. H., Kawashime, M.J. Johnson, K. Itakura, and R.B. Wallace (1981) ICB-UCLA Symp. Dev. Biol. Using Purified Genes, D.D. Brown (ed.), Academic Press, New York, 23:683-693).

Washes are typically carried out as follows: twice at room temperature for 15 minutes 1X SSPE, 0.1 % SDS (low stringency wash), and once at the hybridization temperature for 15 minutes in 1X SSPE, 0.1 % SDS (moderate stringency wash). In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment >70 or so bases in length, the following conditions can be used: Low, 1 or 2X SSPE, room temperature; Low, 1 or 2X SSPE, 42° C; Moderate, 0.2X or 1X SSPE, 65° C; and High, 0.1X SSPE, 65° C.

Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probe sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence in many ways, and those methods are known to an ordinarily skilled artisan. Other methods may become known in the future.

Thus, mutational, insertional, and deletional variants of the disclosed nucleotide sequences can be readily prepared by methods which are well known to those skilled in the art. These variants can be used in the same manner as the exemplified primer sequences so long as the variants have substantial sequence homology with the original sequence. As used herein, substantial sequence homology refers to homology which is sufficient to enable the variant polynucleotide to function in the same capacity as the polynucleotide from which the probe was derived. Preferably, this homology is greater than 80%, more preferably, this homology is greater than 85%, even more preferably this homology is greater than 90%, and most preferably, this homology is greater than 95%. The degree of homology or identity needed for the variant to function in its intended capacity depends upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are equivalent in function or are designed to improve the function of the sequence or otherwise provide a methodological advantage.

Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Patent Nos. 4,683,195, 4,683,202; 4,800,159; Saiki et al. (1985) Science 230:1350-1354). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes and reaction conditions which can be used are known to those skilled in the art.

DNA (or RNA) sequences having at least 90, or at least 95%, or at least 99% identity to the recited DNA sequences of the probes and primers disclosed herein and functioning to specifically bind to the U3-diagnostic sequences as d isclosed herein and have specificity and sensitivity equal to those disclosed herein are considered the most preferred equivalents. Such functional equivalents are included in the definition of a FeLV diagnostic probe or primer sequence. Following the teachings herein and using knowledge and tech niques well known in the art, the skilled worker will be able to make a large number of operative embodiments having equivalent DNA sequences to those listed herei n without the expense of undue experimentation. It is understood that the probe and primers used can not have sufficient nucleotide sequence identity to the endogenous FeLV-related sequences in the normal cat genome so that those endogenous sequences are amplified and/or detected.

As used herein percent sequence identity of two nucleic acids is determined using the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264- 2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873- 5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. MoI. Biol. 215:402-410. BLAST nucleotide searches are performed with the NBLAST program, score = 100, wordlength = 12, to obtain nucleotide sequences with the desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST is used as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See, for example, the National Center for Biotechnology Information website on the internet.

As used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of excludes any element, step, or ingredient not specified in the claim element. As used herein, "consisting essentially of does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term "comprising", particularly in a description of components of a composition or in a description of elements of a device, is understood to encompass those compositions and methods consisting of essentially of and consisting of the recited components, elements or steps. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.

Monoclonal or polyclonal antibodies, preferably monoclonal, specifically reacting with a polypeptide or protein of interest may be made by methods known in the art. See, e.g., Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratories; Goding (1986) Monoclonal Antibodies: Principles and Practice, 2d ed., Academic Press, New York; and Ausubel et al. (1993) Current Protocols in Molecular Biology, Wiley Interscience, New York, MY.

Standard techniques for cloning, DNA and RNA isolation , amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art. A number of standard techniques are described in Sambrook et al. (1989) Molecular Cloning, Second

Edition, Cold Spring Harbor Laboratory, Plainview, New York; Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, New York; Wu (ed.) (1993) Meth. Enzymol. 218, Part I; Wu (ed.) (1979) Meth. Enzymol. 68; Wu et al. (eds.) (1983) Meth. Enzymol. 100 and 101 ; Grossman and Moldave (eds.) Meth. Enzymol. 65; Miller (ed.) (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Old and Primrose (1981) Principles of Gene Manipulation, University of California Press, Berkeley; Schleif and Wensink (1982) Practical Methods in Molecular Biology; Glover (ed.) (1985) DNA Cloning Vol. I and II, IRL Press, Oxford, UK; Hames and Higgins (eds.) (1985) Nucleic Acid Hybridization, IRL Press, Oxford, UK; Setlow and Hollaender (1979) Genetic Engineering: Principles and Methods, VoIs. 1-4, Plenum Press, New York; and Ausubel et al. (1992) Current Protocols in Molecular Biology, Greene/Wiley, New York, NY. Abbreviations and nomenclature, where employed, are deemed standard in the field and commonly used in professional journals such as those cited herein.

All references cited herein are hereby incorporated by reference to the extent there is no inconsistency with the present disclosure. Although the description herein contains certain specific information and examples, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of the invention. For example, thus the scope of the invention should be determined by the appended claims and their equivalents, rather than by the examples given.

EXAMPLES

Example 1. DNA Quantification. Study Design

The experiments described herein constitute a retrospective analysis. Samples were utilized from two previous vaccine experiments. Experiment 1 consisted of 5 groups: group 1 received Vaccine A, groups 2, 3, and 4 all received Vaccine B but each by different routes of administration, and group 5 served as the Control as these cats did not receive any vaccination. Using repeated-measures ANOVA, no statistically significant differences were detected between the 3 groups which received Vaccine B by different routes of administration (p = 0.47, power = 0.15). Consequently, results from the 3 groups which received Vaccine B were combined. Experiment 2 consisted of 2 groups: group 1 received Vaccine A and group 2 served as the Control as these cats did not receive any vaccination. Again, no statistically significant differences were detected between the Vaccine A groups from Experiment 1 and 2 (p = 0.16 power = 0.27) or between the Control groups from Experiment 1 and 2 (p = 0.53, power = 0.09). Thus, results from the Vaccine A groups from Experiment 1 and Experiment 2 were combined and results from the Control groups from Experiment 1 and Experiment 2 were combined. In summary, this study presents the results from a combined total of 3 groups: Vaccine A, Vaccine B, and Control (Table 1).

Thirty-five specific-pathogen-free (SPF) cats were obtained from Cedar River Laboratories (Mason City, IA) and randomly divided into 7 groups, each group consisting of 5 cats (Table 1). Each group was individually housed at Laboratory Animal Resources at Colorado State University (Fort Collins, CO) in accordance with the University Animal Care and Use Committee regulations. Vaccination, virus challenge, and all sample collections were performed on cats anesthetized with a subcutaneous administration of ketamine hydrochloride (22mg/kg) and acepromazine maleate (0.1mg/kg). Vaccination

Ten cats were administered Vaccine A, the commercial FeLV vaccine FeI-O- Vax Lv-K® (Fort Dodge Animal Health, Overland Park, KS) (Hoover et al., 1995, 1996), according to the manufacturer's specifications (Table 1). Five cats received the subcutaneous priming vaccination at 15-16 weeks of age and a subcutaneous boosting vaccination at 19-20 weeks of age. The other five cats received the prime at 25-27 weeks of age and the boost at 31 -33 weeks of age. Fifteen cats were administered Vaccine B, an experimental whole inactivated FeLV-Sarma-A with monophosphoryl lipid A adjuvant (MPL®) (Corixa Corporation, Seattle, WA), by different routes of administration. All 15 cats received the priming vaccination at 15- 16 weeks of age and a boosting vaccination at 19-20 week of age. Five cats received an intranasal prime and boost, 5 cats received a subcutaneous prime and an intranasal boost, and 5 cats received a subcutaneous prime and no boost. Ten cats which did not receive any vaccinations served as controls.

Virus challenge

All cats were challenged oronasally with 1 ml_ of 10⁴ TCID/mL FeLV-61 E-A via dropwise instillation of 0.25 ml_ in each nostril and 0.5 ml_ in the mouth. This subgroup A virus strain is the highly replication competent, non-acutely pathogenic component of the FeLV-FAIDS complex (Donahue et al., 1988; Hoover et al., 1987; Mullins et al., 1986; Overbaugh et al., 1988). The cell-free infectious virus inoculum was prepared as supernatant from Crandell feline kidney (CrFK) cell cultures and determined to be equivalent to 1 CID₁₀₀ (100% cat infective dose). The vaccinates were challenged three weeks after receiving their boosting immunization; either 22- 23 or 34-36 weeks of age (Table 1). Five control cats were challenged at 22-23 weeks of age and the other five at 34-36 weeks of age. All cats were observed daily for signs of illness after virus inoculation. Sample collection and processing

Blood samples were collected at challenge and every 2 weeks thereafter through 8 weeks post-challenge (PC). Sera were stored at -2O⁰C until analysis for FeLV p27 capsid antigen by capture ELISA. Peripheral blood mononuclear cells (PBMC) were isolated from blood by ficoll-hypaque (Histopaque®-1077; Sigma Diagnostics, St. Louis, MO) density gradient centrifugation, separated into 1 X 10⁶ PBMC/mL aliquots, and stored at -80°C until analysis by FeLV quantitative real-time PCR. DNA was extracted from PBMC using a QIAamp® DNA blood mini kit (Qiagen, Inc., Valencia, CA), eluted in 100 μL of elution buffer, and DNA concentrations determined spectrophotometrically.

Thirteen of the 35 cats were available for necropsy after long-term survival periods. Five cats from the Vaccine A group were necropsied at 90 weeks PC, 4 cats from the Vaccine B group and 2 from the unvaccinated Control group were necropsied at 153 weeks PC, and 2 cats from the unvaccinated Control group were necropsied at 177 weeks PC (Table 1). Blood was collected and processed as above. The thymus, tonsil, retropharyngeal lymph nodes, bone marrow (BM), spleen (SP), and mesenteric lymph nodes (MLN) were collected from the 5 Vaccine A cats. BM, SP, and MLN were collected from the 4 Vaccine B and 4 unvaccinated control cats. Tissues were stored at -80°C until analysis by FeLV quantitative real-time PCR. DNA was extracted and RNA digested from tissues using a QIAamp® DNA mini kit and RNase A (Qiagen, Inc.), respectively, eluted in 100 μL of elution buffer, and DNA concentrations determined spectrophotometrically.

Detection of circulating p27 capsid antigen by capture ELISA

Circulating FeLV p27 capsid antigen was detected in serum by capture ELISA using the monoclonal antibodies (mAbs) anti-p27 A2 and G3 (Lutz et al., 1983) (kindly provided by Niels C. Pedersen; University of California, Davis, CA) as previously described (Zeidner et al., 1990) with minor adaptations. Briefly, 0.5 μg/well of the primary mAb, G3, was used to coat a 96-well plate, 50 μL of control or sample sera was added in duplicate to plate wells, and 50 μL of the secondary horseradish peroxidase-conjugated mAb, A2 at 1 :250, was added and incubated for 45 minutes. The plates were then rinsed and 100 μL/well TMB peroxidase substrate:peroxidase solution B (H2O2) (Kirkegaard and Perry Laboratories, Gaithersburg, MD) was added for color development. After a 15 minute incubation, reactions were stopped with 50 μL/well 2N H₂SO₄ and optical density measurements were taken at 450 nm. Background readings, using FeLV-naive SPF cat serum, were subtracted from each well. Sample well reactions were considered positive if an absorbance value of 10% or more of the positive control (persistent antigenemic FeLV-infected cat serum) was obtained.

Detection and quantification of circulating and tissue FeLV viral DNA by quantitative real-time PCR

Using Primer Express® software (Applied Biosystems, Foster City, CA), we designed a primer/probe set within the U3 region of the FeLV-61 E-A long terminal repeat (LTR) (GenBank accession number M18247) (Donahue et al., 1988), thereby amplifying the exogenous but not endogenous FeLV sequences (Berry et al., 1988; Casey et al., 1981). The forward, 5' AGTTCGACCTTCCGCCTCAT 3' (20 bases; nt 241-260, SEQ ID NO:1), and reverse, 5' AGAAAGCGCGCGTACAGAAG 3' (20 bases; nt 308-289, SEQ ID NO:2), primer sequences amplified a 68bp fragment. The corresponding probe sequence, 5¹ TAAACTAACCAATCCCCATGCCTCTCGC 3' (28 bases; nt 262-289, SEQ ID NO:3), was labeled with the reporter dye, FAM (6- carboxyfluorescein), at the 5' end and the quencher dye, TAMRA (6- carboxytetramethyl-rhodamine; Applied Biosystems) or BHQ-1 (Black Hole Quencher-1 ; Biosource International, Inc., Camarillo, CA), at the 3' end. Both probes were blocked at the 3' end to prevent extension. The two probes produced similar results.

The 25 μL reaction consisted of 40OnM of each primer, 80 nM of fluorogenic probe, 12.5 μL of TaqMan® Universal PCR Master Mix (Applied Biosystems), 3.5 μL of PCR-grade H₂O, and 5 μL of sample or plasmid standard DNA. The master mix was supplied at a 2X concentration and contained AmpliTaq® Gold DNA Polymerase, AmpErase® uracil N-glycosylase (UNG), dNTPs with dUTP, and optimized buffer components. Reactions were performed in triplicate using an iCycler iQ™ real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA). Every reaction plate contained a template control (no DNA, PCR-grade H₂O only) and a negative control (FeLV-naϊve, SPF cat DNA). Thermal cycling conditions were 2 minutes at 5O⁰C to allow enzymatic activity of UNG, 10 minutes at 95⁰C to reduce UNG activity, to activate AmpliTaq® Gold DNA Polymerase, and to denature the template DNA, followed by 40 cycles of 15 seconds at 95⁰C for denaturation and 60 seconds at 60⁰C for annealing/extension.

The plasmid p61 E-FeLV, an EcoRI fragment containing the full-length FeLV- 61 E-A provirus subcloned into pUC18 (Donahue et al., 1988; Overbaugh et al., 1988), was used as the standard for PCR quantification. The plasmid was provided as ampicillin-resistant transformed E. coli JM109 cells through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH from Dr. James Mullins. The transformed E. coli cells were grown on LB media containing 50 μg/mL ampicillin. Plasmid DNA was isolated from the bacterial cells using the QIAfilter™ plasmid isolation midi kit (Qiagen, Inc.), linearized with EcoRI, and the full-length FeLV-61 E fragment was confirmed by agarose gel electrophoresis with ethidium bromide staining. The linearized plasmid standard copy number was calculated from optical density measurements at 260 nm. A 10-fold dilution series of the plasmid standard template DNA was made in 1 X TE buffer with 40 ng/μL salmon testes DNA (Sigma Chemical Co., St. Louis, MO) as a carrier. Quantification of the sample amplicon was achieved by comparing the threshold cycle (C₁-) value of the sample DNA with the standard curve of the co-amplified standard template DNA. Cell numbers were calculated by assuming 6pg DNA/cell.

Analytical specificity and sensitivity of FeLV quantitative real-time PCR Following agarose gel electrophoresis confirmation with GelStar®

(BioWhittaker Molecular Applications, Rockland, ME) staining, the 68 bp PCR products from two separate reactions were sequenced to verify analytical specificity. The TOPO TA Cloning® Kit (with pCR®2.1-TOPO® vector) (lnvitrogen Corp., Carlsbad, CA) was used for cloning the amplicons prior to sequencing. Briefly, the PCR products were directly Iigated into the linearized pCR®2.1-TOPO® vector (lnvitrogen Corp.), the constructs were transformed into One Shot® TOP 10 chemically competent E. coli cells (lnvitrogen Corp.), and the cells were grown on LB media with 50μg/mL ampicillin using blue/white screening. Plasmid DNA was isolated from the bacterial cells using the QIAfilter™ plasmid midi kit (Qiagen, I nα), linearized with EcoRI, and the plasmid insert confirmed by agarose gel electrophoresis with GelStar® (BioWhittaker Molecular Applications) staining. Two cloned inserts were sequenced by Davis Sequencing LLC, Davis, CA. The sequences of the PCR products were then aligned with FeLV-61 E-A using BLAST® (Altschul et al., 1990; Wheeler et al., 2003) on the National Center for Biotechnology Information website.

End-point dilution experiments with the p61 E-FeLV plasmid standard were performed to assess analytical sensitivity. A dilution series of 500, 100, 50, 1O, 5, 1 , 0.5, and 0.1 copies of the plasmid standard, each in triplicate, was tested.

Amplification efficiency and reproducibility of FeLV quantitative real-time PCR

To assess amplification efficiencies, serial dilutions (1 :10, 1 :100, 1 :1000, and 1 :10000) of PBMC DNA from an experimentally FeLV-61 E-A-infected cat and of the p61 E-FeLV plasmid standard were amplified in triplicate and the difference in the slopes (Δs) of the regression lines (CT VS. dilution) was evaluated.

To assess assay reproducibility, dilutions of the p61 E-FeLV plasmid standard (50000, 5000, and 500 copies) and of DNA from an experimentally FeLV-61 E-A- infected cat (100%, 1 :100, and 1 :1000) were evaluated for within-run and between- run precision. Each dilution was run 10 times within the same reaction plate and between 10 different reaction plates to test the within-run and between-run precision, respectively. The coefficients of variations (CV) of the threshold cycles (CT) were calculated: CV (C_τ).

Statistically significant differences in p27 and viral DNA levels (log transformed) between the experimental groups and between the FeLV:host categories were determined using repeated-measure analysis of variance (ANOVA) with the Tukey-Kramer post-hoc test. A statistically significant difference between groups was considered to have occurred when a p value was <0.05. The kappa statistic was calculated to assess the level of agreement, beyond that which might be expected due to chance, between the p27 capture ELISA and the real-time PCR assay. Pearson correlation coefficients were determined to assess the linear relationship between circulating p27 levels vs. PBMC viral DNA levels and between circulating vs. tissue viral DNA levels. After a Fisher's rto z transformation, p values were obtained. Again, a statistically significant difference between groups was considered to have occurred when a p value was <0.05. Repeated-measures ANOVA, the Tukey-Kramer post-hoc test, and the Pearson correlation coefficient were performed using StatView® version 5.0.1 for Macintosh, 1999 (Abacus Concepts, Inc., Berkeley, CA).

Example 2. RNA Quantification Primers and Probe

Using Primer Express software (Applied Biosystems, Foster City, CA), we designed a primer/probe set within the U3 region of the Fel_V-61 E-A long terminal repeat (LTR) (GenBank accession number M18247) (Donahue et al., 1988), thereby amplifying the exogenous but not endogenous FeLV sequences (Berry et al., 1988; Casey et al., 1981). The forward, 5' AGTTCGACCTTCCGCCTCAT 3' (20 bases; nt 241-260, SEQ ID NO:1), and reverse, 5' AGAAAGCGCGCGTACAGAAG 3' (20 bases; nt 308-289, SEQ ID NO:2), primer sequences amplified a 68 bp fragment. The corresponding probe sequence, 5' TAAACTAACCAATCCCCATGCCTCTCGC 3' (28 bases; nt 262-289, SEQ ID NO:3), was labeled with the reporter dye, FAM (6- carboxyfluorescein), at the 5' end and the quencher dye, BHQ-1 (Black Hole Quencher-1 ; Biosource International, Inc., Camarillo, CA), at the 3' end. The probe was blocked at the 3' end to prevent extension.

RNA standard preparation for absolute quantification

The plasmid p61 E-FeLV, an EcoRI fragment containing the full-length FeLV- 61 E-A provirus subcloned into pUC18 (Donahue et al., 1988; Overbaugh et al., 1988), was used to construct an RNA standard. This plasmid was provided as ampicillin-resistant transformed E. coli JM109 cells through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, from Dr. James Mullins. The transformed E. coli cells were grown on LB media containing 50 μg/mL ampicillin. Plasmid DNA was isolated from the bacterial cells using the QIAfilter plasmid midi kit (QIAGEN, Inc., Valencia, CA). The plasmid was then double digested with EcoR\ and BgIW. The 1909 bp fragment was confirmed by agarose gel electrophoresis with GelStar (Cambrex, Corp., East Rutherford, NJ) staining and gel purified using the QIAquick gel extraction kit (QIAGEN). The pGEM-3Z vector (Promega, Corp., Madison, Wl) was double digested with EcoRI and SamHI and the linearized vector, minus 21 bp, was confirmed by agarose gel electrophoresis. The purified 1909 bp fragment from p61 E-FeLV was directly ligated into the linearized pGEM-3Z using a Quick Ligation kit (New England BioLabs, Inc., Ipswich, MA). The constructs were transformed into chemically competent E. coli JM 109 cells (Promega) and the cells were grown on LB media with 50 μg/mL ampicillin using blue/white screening. Plasmid DNA was isolated from the bacterial cells, double digested with EcoRI and HindWl, and the insert confirmed by agarose gel electrophoresis. The recombinant plasmid (named pGEM-3Z-61 E) was sequenced by Davis Sequencing, Inc. (Davis, CA) to verify the insert orientation and length, and the primer/probe target site within the U3 region.

The pGEM-3Z-61 E plasmid was linearized with Hind\\\ and purified by the QIAquick gel extraction kit. RNA transcripts (1943 nt) were produced via in vitro transcription using the T7 RiboMAX express large scale RNA production system (Promega). Residual plasmid DNA was removed using one RQ1 RNase-free DNase (Promega) and two TURBO DNase (Ambion, Inc., Austin, TX) treatments. After each DNase treatment, the resulting RNA transcripts were purified using the MEGAclear kit (Ambion). The absence of contaminating DNA template was confirmed by real-time RNA PCR of the RNA standard with and without the addition of reverse transcriptase (RT) to the reaction. The RNA standard copy number was calculated from optical density measurements at 260 nm. The RNA standard was diluted to 10⁹ copies/μL in THE RNA storage solution (Ambion) with 30 ng/μL transfer RNA (Sigma-Aldrich, Corp., St. Louis, MO) as a carrier. This RNA stock was aliquoted and frozen immediately at -7O⁰C. Each aliquot was used for making a single-use 10-fold dilution series. The starting quantities of the samples were determined by comparing the threshold cycle (C_τ) value of the samples' RNA with the standard curve of the co-amplified standard template RNA. Real-time RNA PCR assay

The 25 μl_ one-tube reaction consisted of 400 nM of each primer, 80 nM of fluorogenic probe, 12.5 μl_ of TaqMan One-Step Real Time-PCR Master Mix (Applied Biosystems), 0.625 μl_ of MultiScribe Reverse Transcriptase and RNase Inhibitor Mix (Applied Biosystems), 2.875 μl_ of PCR-grade H₂O, and 5 μl_ of sample or RNA standard. The master mix was supplied at a 2X concentration and contained AmpliTaq Gold DNA Polymerase, dNTPs with dUTP, and optimized buffer components. Reactions were performed in triplicate using an iCycler iQ™ real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA). Every reaction plate contained a negative control (FeLV-naive SPF cat RNA), a template control (no RNA, PCR-grade H₂O), and an extraction control (extracted PCR-grade H₂O). Thermal cycling conditions were 30 minutes at 48⁰C for the RT reaction, 10 minutes at 95⁰C to activate AmpliTaq Gold DNA Polymerase and to denature the template cDNA, followed by 40 cycles of 15 seconds at 95⁰C for denaturation and 60 seconds at 6O⁰C for annealing/extension.

Analytical specificity and sensitivity of FeLV quantitative Real Time-RNA PCR

Following agarose gel electrophoresis confirmation, the 68 bp PCR products from two real-time RNA PCR separate reactions were sequenced to verify analytical specificity. The TOPO TA Cloning kit (with pCR2.1 -TOPO vector) (Invitrogen, Corp., Carlsbad, CA) was used for cloning the amplicons prior to sequencing. Briefly, the PCR products were directly ligated into the linearized pCR2.1-TOPO vector, the constructs were transformed into One Shot TOP 10 chemically competent E. co// cells (Invitrogen), and the cells grown on LB media with 50 μg/mL ampicillin using blue/white screening. Plasmid DNA was isolated from the bacterial cells, linearized with EcoRI, and the insert confirmed by agarose gel electrophoresis. The cloned inserts were sequenced by Davis Sequencing. The sequences of the PCR products were then aligned with FeLV-61E-A using MacVector software version 7.0 for Macintosh, 2000 (Oxford Molecular, Ltd., Madison, Wl).

End-point dilution experiments of the RNA standard were performed to assess analytical sensitivity. A dilution series of 500, 100, 50, 10, 5, 1 , 0.5, and 0.1 copies of the RNA standard, each in triplicate, was tested. Amplification efficiency and reproducibility of FeLV quantitative RT-RNA PCR

To assess amplification efficiencies, serial dilutions (1:10, 1 :100, and 1 :1000) of plasma RNA from an experimentally FeLV-61 E-A-infected cat and of the RNA standard were amplified in triplicate and the difference in the slopes (Δs) of the regression lines (CT VS. dilution) was evaluated.

To assess assay reproducibility, dilutions of the RNA standard (5 X 10⁷, 5 X 10⁶, and 5 X 10⁵ copies) and of RNA from an experimentally FeLV-61 E-A-infected cat (neat, 1 :10, and 1 :100) were evaluated for within-run and between-run precision. Each dilution was run 10 times within the same reaction plate and between 10 different reaction plates to test the within-run and between-run precision, respectively. The coefficients of variations (CV) of the threshold cycles (C_τ) were calculated: CV(C_T).

Sample Preparation

RNA was extracted from 140 μL of plasma using a QIAamp viral RNA mini kit (QIAGEN). On-column digestion of DNA during RNA purification was performed using the RNase-free DNase set (QIAGEN). The RNA was eluted in 80 μL of elution buffer.

Table 1. Summary of study design.

= Fel-O-Vax Lv-K® (Fort Dodge Animal Health) = Experimental whole inactivated FeLV-Sarma-A with MPL adjuvant ^*** = No vaccine

¹ Experiment 1

² Experiment 2

³ Subcutaneous administration of vaccine

⁴ Intranasal administration of vaccine

Table 2. Real-time DNA PCR vs. p27 capsid capture ELISA for FeLV detection.

Real-time

Total PCR

(+) (-)

P27 <+) 76 0 76 ELISA (-) 24 23 47

Total 100 23 123

Kappa value = 0.53 (fair agreement)

Table 3. Real-time DNA PCR coefficients of variations (%) of -within-run and between-run precision.

Standard DNA (copies) FeLV-positive DNA (dilution)

50 5000 50000 neat 1 :100 1 :1000

CV (Cτ) within-run 0.45 1.11 0.31 0.83 0.33 0.83

CV(CT) between-run 0.59 0.66 0.70 0.56 0.68 1.16

Table 4. Putative categories for FeLV:host relationships in vaccinated and unvaccinated cats challenged with Fel_V-61 E-A.

* After detecting an initial low proviral load, two of the six cats with regressive infection did not have detectable provirus at 8 weeks post-challenge. Both cats received Vaccine A.

Table 5. Real-time RNA PCR coefficients of variations (%) of within-run and between-run precision.

RNA Standard (copies) FeLV-positive RIMA (dilution)

5 > MO⁷ 5 X 10⁶ 5 X 10⁵ neat 1 :10 1 :100

CV (CT) within-run 1 .81 1. 21 1. 44 1.08 1.03 .93

CV (CJ) between-run 1 .94 2. 13 2. 06 2.18 1.19 .90

Bibliography

Altschul, S. F. et al. 1990. Basic local alignment search tool. J. MoI. Biol. 215, 403-

410.

Anderson, L.J. et al. H. M., 1971. Feline leukemia-virus infection of kittens: mortality associated with atrophy of the thymus and lymphoid depletion. J. Nat. Cancer Inst.

47, 807-817.

Berry, B. T. et al. 1988. Structure and function of endogenous feline leukemia virus long terminal repeats and adjoining regions. J. Virol. 62, 3631-3641.

Casey, J.W. et al. 1981. The U3 portion of feline leukemia virus DNA identifies horizontally acquired proviruses in leukemic cats. Proc. Natl. Acad. Sci. USA 78,

7778-7782.

Cockerell, G. L., Hoover, E.A., 1977. Inhibition of normal lymphocyte mitogenic reactivity by serum from feline leukemia virus-infected cats. Cancer Res. 37, 3985-

3989. Cockerell, G. L. et al. 1976. Lymphocyte mitogen reactivity and enumeration of circulating B- and T-cells during feline leukemia virus infection in the cat. J. Nat.

Cancer Inst. 57, 1095-1099.

Cohen, OJ. et al. 1997. Host factors in the pathogenesis of HIV disease. Immunol.

Rev. 159, 31-48. Coronado, G. S. et al. 2000. Effects of a 98% solution of glycerol or sterilization with ethylene oxide on FeLV in bone allografts and effects on bone incorporation of allografts in cats. Am. J. Vet Res. 61, 665-671.

Donahue, P. R. et al. 1988. Strong sequence conservation among horizontally transmissible, minimally pathogenic feline leukemia viruses. J. Virol. 62, 722-731. Flynn, J.N.et al. 2002. Longitudinal analysis of feline leukemia virus-specific cytotoxic

T lymphocytes: correlation with recovery from infection. J. Virol. 76, 2306-2315.

Flynn, J.N. et al. 2000. Feline leukemia virus: protective immunity is mediated by virus-specific cytotoxic T lymphocytes. Immunology 101 , 120-125.

Gregory, CR. et al. 1991. Feline leukemia virus-associated lymphosarcoma following renal transplantation in a cat. Transplantation 52, 1097-1099.

Gut, M. et al. 1999. One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses. J. Virol. Methods 77, 37-46. Haffer, K.N . et al. 1987. Feline leukaemia vaccine protection against viral latency.

Vaccine 5, 133-135.

Hardy, W.D., Jr. et al. 1976. Biology of feline leukemia virus in the natural environment. Cancer Res. 36, 582-588. Hardy, W.D. et al. 1973. Horizontal transmission of feline leukaemia virus. Nature

244, 266-269.

Haynes, B. F. et al. 1996. Toward an understanding of the correlates of protective immunity to HIV infection. Science 271 , 324-328.

Herring, E. S. et al. 2001. Detection of feline leukaemia virus in blood and bone marrow of cats with varying suspicion of latent infection. J. Feline Med. Surg. 3, 133-

141.

Hofmann-Lehmann, R. et al. 2001. Feline leukaemia provirus load during the course of experimental infection and in naturally infected cats. J. Gen. Virol. 82, 1589-1596.

Hoover, E. A. et al. 1974. Erythroid hypoplasia in cats inoculated with feline leukemia virus. J. Nat. Cancer Inst. 53, 1271-1276.

Hoover, E.A. et al. 1972. Intranasal transmission of feline leukemia. J. Nat. Cancer

Inst. 48, 973-983.

Hoover, E.A., Mullins, J. I., 1991. Feline leukemia virus infection and diseases. J. Am.

Vet. Med. Assoc. 199, 1287-1297. Hoover, E.A. et al. 1995. Development and testing of an inactivated feline leukemia virus vaccine. Semin. Vet. Med. Surg. (Small Animal) 10, 238-243.

Hoover, E.A. et al. 1996. Efficacy of an inactivated feline leukemia virus vaccine.

AIDS Res. Hum. Retroviruses 12, 379-383.

Hoover, E.A. et al. 1987. Experimental transmission and pathogenesis of immunodeficiency syndrome in cats. Blood 70, 1880-1892.

Hoover, E.A. et al. 1991. Protection against feline leukemia virus infection by use of an inactivated virus vaccine. J. Am. Vet. Med. Assoc. 199, 1392-1401.

Hoover, E.A. et al. 1981. Pathogenesis of feline leukemia virus infection. In: Olsen,

R.G. (Ed.), Feline Leukemia. CRC Press, Boca Raton, FL, pp. 31-51. Jackson, M. L. et al. 1996. Feline leukemia virus detection by ELISA and PCR in peripheral blood from 68 cats with high, moderate, or low suspicion of having FeLV- related disease. J. Vet. Diagn. Invest. 8, 25-30.

Jarrett, W. F. H. et al. 1964. Leukemia in the cat. Transmission experiments with leukemia (lymphosarcoma). Nature 202, 566-567. Kawakami, T.G. et al. 1967. C-type viral particles in plasma of cats with feline leukemia. Science 158, 1049-1050.

Klein, D. et al. 2001. Influence of preassay and sequence variations on viral load determination by a multiplex real-time reverse transcriptase-polymerase chain reaction for feline immunodeficiency virus. J. Acquired Immune Defic. Syndr. 26, 8-

20.

Legendre, A.M. et al. 1991. Comparison of the efficacy of three commercial feline leukemia virus vaccines in a natural challenge exposure. J. Am. Vet. Med. Assoc.

199, 1456-1462. Levy, J.A., 1993. HIV pathogenesis and long-term survival. AIDS 7, 1401-1410.

Lewis, M. G. et al. 1981. Protection against feline leukemia by vaccination with a subunit vaccine. Infect. Immun. 34, 888-894.

Lutz, H. et al. 1983. Monoclonal antibodies to three epitopic regions of feline leukemia virus p27 and their use in enzyme-linked immunosorbent assay of p27. J. Immunol. Methods 56, 209-220.

Mackey, L.J. et al. 1975. Anemia associated with feline leukemia virus infection in cats. J. Nat. Cancer Inst. 54, 209-217.

Madewell, B. R., Jarrett, O., 1983. Recovery of feline leukemia virus from non- viraemic cats. Vet. Rec. 112, 339-342. Miyazawa, T., Jarrett, O., 1997. Feline leukemia virus proviral DNA detected by polymerase chain reaction in antigenaemic but non-viraemic ('discordant') cats. Arch.

Virol. 142, 323-332.

Mullins, J.I. et al. 1986. Disease-specific and tissue-specific production of unintegrated feline leukaemia virus variant DNA in feline AIDS. Nature 319, 333-336. Nemzek, J.A. et al. 1994. Retroviral transmission in connective tissue allotransplantation: an experimental study. J. Bone Jt. Surg. 76A, 1036-1041.

Nemzek, J.A. et al. 1996. Retroviral transmission in bone allotransplantation. Clin.

Orthop. Relat. Res. 324, 275-282.

Overbaugh, J. et al. 1988. Molecular cloning of a feline leukemia virus that induces fatal immunodeficiency disease in cats. Science 239, 906-910.

Pacitti, A.M., Jarrett, O., 1985. Duration of the latent state in feline leukemia virus infections. Vet. Rec. 117.

Pacitti, A.M. et al. 1986. Transmission of feline leukemia virus in the milk of a non- viraemic cat. Vet. Rec. 118, 381-384. Pedersen, N. C. et al. 1984. The clinical significance of latent feline leukemia virus infection in cats. Feline Pract. 14, 32-48.

Perryman, L.E. et al. 1972. Immunologic reactivity of the cat: immunosuppression in experimental feline leukemia. J. Nat. Cancer Inst. 49, 1357-1365. Pollack, R.V.H., Scarlett, J. M., 1990. Randomized blind trial of a commercial FeLV vaccine. J. Am. Vet. Med. Assoc. 196, 611-616.

Post, J. E., Warren, L., 1980. Reactivation of latent feline leukemia virus. In: Hardy,

W.D., Jr., Essex, M., McClelland, A.J. (Eds.), Feline Leukemia Virus. Elsevier North

Holland, Inc., New York, pp. 151-155. Rickard, CG. et al. 1969. A transmissible virus-induced lymphocytic leukemia of the cat. J. Nat. Cancer Inst. 42, 987-1014.

Rojko, J. L. et al. 1979. Pathogenesis of experimental feline leukemia virus infection.

J. Nat. Cancer Inst. 63, 759-768.

Rojko, J. L. et al. 1982. Reactivation of latent feline leukaemia virus infection. Nature 298, 385-388.

Rowland-Jones, S. L., McMichael, A., 1995. Immune responses in HIV-exposed seronegatives: have they repelled the virus? Curr. Opin. Immunol. 7, 448-455.

Sparkes, A.H., 1997. Feline leukemia virus: a review of immunity and vaccination. J.

Small Anim. Pract. 38, 187-194. Wheeler, D. L. et al. 2003. Database Resources of the National Center for

Biotechnology. Nucleic Acids Res. 31 , 28-33.

Zeidner, N. S. et al. 1990. Alpha interferon (2b) in combination with zidovudine for the treatment of presymptomatic feline leukemia virus-induced immunodeficiency syndrome. Antimicrob. Agents Chemother. 34, 1749-1756. Zhu, T. et al. 2003. Persistence of extraordinarily low levels of genetically homogenous human immunodeficiency virus type 1 in exposed seronegative individuals. J. Virol. 77, 6108-6116.

Claims

We claim:

1. A method for determining Feline Leukemia Virus (FeLV) infection status in a felid said method comprising the steps of:

performing an immunological assay on a biological sample taken from a felid of interest for the detection of at least one protein antigen of FeLV,

performing a quantitative real time polymerase chain reaction assay for FeLV nucleic acid on a biological sample of said felid, using a forward primer having the sequence, δ'-AGTTCGACCTTCCGCCTCAT-S' (SEQ ID NO:1) and a reverse primer having the sequence 5'- AGAAAGCGCGCGTACAGAAG-S' (SEQ ID NO:2) and a detectable oligonucleotide probe specific to an amplification product of said reaction;

whereby a state of abortive or no exposure to FeLV is characterized by no antigen and no PCR reaction product detected, a state of regressive infection is characterized by no antigen detected and a low or transient low amount of virus nucleic acid detected (hundreds of copies of virus nucleic acid per million peripheral blood mononuclear cells); a latent infection is characterized by a moderate number of copies of virus nucleic acid detected (tens of thousands of copies of virus nucleic acid detected per million peripheral blood mononuclear cells) and either no or transient antigen detected; and a progressive infection is characterized by antigen detected and high number of copies of virus nucleic acid detected (more than one hundred thousand copies per million peripheral blood mononuclear cells).

2. The method of claim 1 , wherein the probe sequence is 5' AAACTAACCAATCCCCATGCCTCTCGC-S' (SEQ ID NO:3).

3. The method of claim 1 , wherein the probe is labeled with a reporter.

4. The method of claim 3, wherein the reporter is 6-carboxyfluorescein covalently bound at the 5' end of the probe.

5. The method of claim 4, wherein 6-carboxytetramethyl-rhodamiπe or BHQ-1 (Black Hole Quencher-1) is covalently bound, at the 3' end of the probe.

6. The method of claim 5, wherein abortive or no exposure to FeLV is diagnosed when neither antigen nor virus nucleic acid is detected.

7. The method of claim 5, wherein regressive infection is diagnosed when antigen is not detected in an early biological sample from the felid, antigen is not detected in a n early or a later biological sample, and when the polymerase chain reaction carried out in an earlier sample has a low amount of reaction product and when the later sample has a low amount of or no reaction product.

8. The method of claim 5, wherein latent infection is characterized by transient antigen detection and there is reaction product in both the earlier and later samples.

9. The method of claim 5, wherein progressive infection is characterized by antigen detection in both an earlier and a later samples and there is a high amount of reaction product in both the earlier and later samples.

10. The method of any of claims 1 to 9, wherein the FeLV nucleic acid is DNA.

11. The method of any of claims 1 to 5, wherein the FeLV nucleic acid is RNA.

12. A method for determining presence of exogenous Feline Leukemia virus (FeLV) nucleic acid in a biological sample from a felid, said method comprising the steps of :

a) using as primers in a polymerase chain reaction comprising nucleic acid in a biological sample from a felid 5¹- AGTTCGACCTTCCGCCTCAT-S¹ (SEQ ID NO:1)and 5'- AGAAAGCGCGCGTACAGAAG-S' (SEQ ID NOI2); and

b) contacting a product of the polymerase chain reaction of step (a)with a probe to detect an amplification product of a polymerase chain reaction, wherein the probe is a detectable oligonucleotide which comprises the sequence δ'-TAAACTAACCAATCCCCATGCCTCTCGC-S' (SEQ ID NO:3), under conditions allowing hybridization of the probe with the product,

whereby the presence of feline leukemia virus nucleic acid is detected in the biological sample of the felid when there is hybridization of the probe to the product is detected.

13. The method of claim 12, wherein the detectable oligonucleotide is labeled with FAM (6-carboxyfluorescein), at the 5' end and TAMRA (6-carboxytetramethyl- rhodamine) or BHQ-1 , at the 3' end.