WO2006046861A2 - Tomato plants having higher levels of resistance to botrytis - Google Patents

Tomato plants having higher levels of resistance to botrytis Download PDF

Info

Publication number
WO2006046861A2
WO2006046861A2 PCT/NL2005/000762 NL2005000762W WO2006046861A2 WO 2006046861 A2 WO2006046861 A2 WO 2006046861A2 NL 2005000762 W NL2005000762 W NL 2005000762W WO 2006046861 A2 WO2006046861 A2 WO 2006046861A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
botrytis
lycopersicon
qtl
resistance
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/NL2005/000762
Other languages
English (en)
French (fr)
Other versions
WO2006046861A3 (en
Inventor
Johannes Arnoldus Laurentius Van Kan
Arjen Ten Have
Willem Hendrik Lindhout
Hendrikus Johannes Finkers
Remco Van Berloo
Adriaan Willem Van Heusden
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Monsanto Invest BV
Original Assignee
De Ruiter Seeds R&D BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=34928600&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2006046861(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CA2584780A priority Critical patent/CA2584780C/en
Priority to KR1020077011767A priority patent/KR101329485B1/ko
Priority to ES05797992T priority patent/ES2436094T3/es
Priority to MX2013010797A priority patent/MX349007B/es
Priority to JP2007538841A priority patent/JP5464804B2/ja
Priority to CN200580044768.8A priority patent/CN101087884B/zh
Priority to MX2007004779A priority patent/MX2007004779A/es
Priority to KR1020137010619A priority patent/KR101365296B1/ko
Application filed by De Ruiter Seeds R&D BV filed Critical De Ruiter Seeds R&D BV
Priority to AU2005300181A priority patent/AU2005300181B8/en
Priority to BRPI0516970-4A priority patent/BRPI0516970A/pt
Priority to EP05797992.4A priority patent/EP1812575B1/en
Publication of WO2006046861A2 publication Critical patent/WO2006046861A2/en
Publication of WO2006046861A3 publication Critical patent/WO2006046861A3/en
Priority to US11/738,279 priority patent/US7968773B2/en
Priority to IL182722A priority patent/IL182722A/en
Anticipated expiration legal-status Critical
Priority to US13/166,958 priority patent/US8575451B2/en
Priority to IL217617A priority patent/IL217617A/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/825Solanum lycopersicum [tomato]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/08Fruits
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/138Amplified fragment length polymorphism [AFLP]

Definitions

  • the present invention relates to plant breeding and molecular biology. More specifically, the present invention relates to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis cinerea in tomato, to a method of producing a Botrytis-resistant tomato plant therewith and to Botrytis-resistant tomato plants thus obtained and parts thereof.
  • QTL quantitative trait locus
  • Botrytis dnere ⁇ is a necrotrophic pathogenic fungus with an exceptionally wide host range comprising at least 235 possible hosts. Because of its wide host range and because it affects economically important parts of the plant B. cinere ⁇ is a major problem in many commercially grown crops. Amongst growers, the fungus is commonly referred to as Botrytis. The cultivated tomato (predominantly Lycopersicon esculentum) is also susceptible to infection by Botrytis and the fungus generally affects stem, leaves and fruit of the tomato plant. In heated greenhouses the occurrence of infections by Botrytis on stems is particularly common.
  • Botrytis actively kills infected cells, causing soft rot, blights, leaf spot, damping-off and stem cancers. Affected leaves become covered with conidiophores and conidia, and subsequently collapse and wither. The fungus will grow from diseased leaves into the stem and produce dry, light brown lesions a few millimetres to several centimetres in length. Lesions may also form at pruning scars on the stem. The stem lesions may also be covered with a gray mold. In severe cases, the infection girdles the stem and kills the plant. Older, senescent tissue of a tomato plant is usually more susceptible to attack by Botrytis than younger tissue.
  • L. hirsutum comprises a genetic region on chromosome 10 of the genome that is involved in partial resistance to Botrytis.
  • the introgression of this genetic material into cultivated tomato varieties is believed to be capable of providing for cultivated tomato plants that are partially resistant to Botrytis.
  • Botrytis It is a further aim of the present invention to provide for additional and/or improved resistance to Botrytis in commercial tomato varieties. It is yet another aim of the present invention to provide for a method for finding additional wild Lycopersicon accessions as sources of resistance to Botrytis and for finding additional genetic material in the genome of such plants that is involved in resistance of tomato to Botrytis. Such additional sources and additional genetic material may be used to broaden the basis for the production of Botryti s-resistant varieties of cultivated tomato. SUMMARY OF THE INVENTION
  • a particular quantitative bioassay which comprises the measurement of initial and/or progressive parameters of infection with Botrytis in tomato plants in combination with a molecular marker detection technique provides for a very advantageous method of detecting sources of resistance to Botrytis amongst wild Lycopersicon accessions and for detecting genetic material in the genome of such plants that is involved in improved resistance of tomato to Botrytis.
  • the present inventors have successfully identified partial resistance to Botrytis in two lines of wild relatives of tomato, i.e. Lycopersicon hirsutum LYC 4/78 and Lycopersicon par ⁇ iflorum Gl.1601.
  • the inventors were subsequently able to produce Botrytis-resistant tomato plants by crossing plants from these i3o£ryi£is-resistant wild (donor) tomato lines with non-resistant recipient tomato plants. These plants exhibited a higher level of resistance than plants comprising a genomic region on chromosome 10 of L. hirsutum associated with Botrytis resistance as disclosed in WO 02/085105.
  • the present inventors By assessing the resistance level to Botrytis in segregating populations (F2 populations) of these newly produced crosses in relation to the presence of molecular markers of the donor plant, the present inventors were able to identify multiple quantitative trait loci (QTLs) linked to j3o£ry£js-resistance in the resistant wild tomato lines and thereby establish the location of multiple resistance-conferring DNA sequences in the genome.
  • QTLs quantitative trait loci linked to j3o£ry£js-resistance in the resistant wild tomato lines and thereby establish the location of multiple resistance-conferring DNA sequences in the genome.
  • the present inventors have now found that Botrytis resistance in tomato is inherited polygenically, which may partly explain the poor breeding results. This finding now provides for the improvement of methods of producing Botrytis-xesistaxit tomato plants.
  • a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato will be addressed in short as a QTL for Botrytis-resistance or a QTL associated with Botry tis-resistance.
  • QTL quantitative trait locus
  • a total of six new QTLs for Botryt is-resistance were found in the two wild tomato lines.
  • Four of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to reduce the initial establishment of an infection, hereinafter referred to as the parameter for disease incidence.
  • Two of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to slow the progression of infection, hereinafter referred to as the parameter for lesion growth rate.
  • chromosome 1 of L. hirsutum LYC 4/78 harbors a QTL that is linked to a reduced rate of growth of lesions induced by Botrytis infection and that both chromosomes 2 and 4 of that same accession harbor a QTL that is linked to a reduced disease incidence.
  • L. par ⁇ iflorum Gl.1601 a QTL for reduced rate of lesion growth was found to be located on chromosome 9, while two separate QTLs for reduced disease incidence were found to be located on chromosomes 3 and 4.
  • a QTL on chromosome 10 could not be detected by this method.
  • the present invention relates in a first aspect to a .Bo ⁇ ry ⁇ s-resistant tomato plant, wherein said plant has a susceptibility to Botrytis dnerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay wherein the average length of a stem lesion resulting from Botrytis dnerea infection in adult plants is measured during a three week period under standard practice conditions.
  • the stem lesion length over a period of three weeks as used herein as a measure for the level of resistance is to be determined by standard practice conditions as described herein.
  • said Botrytis-resistant tomato plant is characterized in that said plant comprises within its genome at least one QTL or a .Boiryf ⁇ s-resistance-conferring part thereof selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicori hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said .Botfryiis-resistance-conferring part thereof is not in its natural genetic background.
  • the present invention relates in another aspect to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato.
  • the method comprises the steps of crossing a Botrytis-resistant donor tomato plant with a non-resistant or partially resistant (Botry tis-susceptible) recipient tomato plant; contacting one or more offspring plants with an infective amount of Botrytis; quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants; establishing a genetic linkage map that links the observed disease incidence and/or the lesion growth rate to the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants; and assigning to a quantitative trait locus the contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced lesion growth rate.
  • QTL quantitative trait locus
  • the present invention relates to QTLs obtainable by a method for detecting a QTL for Botrytis-resistance according to the invention as outlined above.
  • QTLs are different from the prior art QTLs.
  • prior art QTLs could not be found.
  • the QTLs of the present invention are more informative than those of the prior art as they are indicative of either a characteristic relating to the plant's ability to oppose the onset of the disease, or a characteristic relating to the plant's ability to slow the progress of the disease.
  • Such information is highly valuable in breeding programs, since combinations thereof may suitably provide for improved resistance, and proper inheritance of the resistance trait from one generation to another may be better controlled.
  • the present invention further relates to a QTL for Botiytis-resist&nce in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parviflorum G 1.1601 associated with Botrytis resistance.
  • QTLs are located on positions of the genome not previously associated with resistance to Botrytis. Details of these QTLs are described in more detail herein below.
  • a QTL of the present invention may be in the form of an isolated, preferably double stranded nucleic acid sequence comprising said QTL or a resistance-conferring part thereof.
  • the size of the nucleic acid sequence which may for instance be isolated from the chromosome of a suitable donor plant, may represent a genetic distance of 1-100 cM, preferably 10-50 cM on said chromosome.
  • Said nucleic acid may comprise at least 50, more preferably at least 500, even more preferably at least 1000, still more preferably at least 5000 base pairs.
  • One or more nucleic acid sequences comprising a QTL or a resistance-conferring part thereof according to the invention may in turn be comprised in a nucleic acid construct, said construct may further comprise regions that flank said one or more nucleic acid sequences and which regions are capable of being integrated into a suitable vector for transfer of said one or more nucleic acid sequences into a suitable Bo£r;y£fs-susceptible recipient tomato plant.
  • the vector may further comprise suitable promoter regions or other regulatory sequences.
  • the QTLs may also be in a form present within the genome of a tomato plant.
  • the QTLs of the present invention preferably comprise at least one marker, preferably two, more preferably three, still more preferably four, still more preferably more than four markers associated with jBo£ryiis-resistance selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to said QTL.
  • the present invention relates in another aspect to a method for detecting a QTL for Botrytis-resistance, comprising detecting at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for J3o£ry£js-resistance in a suspected Botrytis- resistant tomato plant.
  • the present invention further relates to a method of producing a Botrytis- resistant tomato plant.
  • the method comprises the steps of detecting a QTL for Botjytis-resistance in a Botryt is-resistant donor tomato plant by performing any one of the methods for detecting a quantitative trait locus (QTL) for Botrytis ⁇ resistwn.ce according to the invention, and transferring nucleic acid comprising at least one QTL thus detected, or a Sofryiis-resistance-conferring part thereof, from said donor plant to a jBo£ry£ ⁇ s-susceptible recipient tomato plant.
  • QTL quantitative trait locus
  • the transfer of nucleic acid comprising at least one QTL or a Botrytis- resistance-conferring part thereof may very suitably be performed by crossing said Botrytis-resistant donor tomato plant with a .Boiryiis-susceptible recipient tomato plant to produce offspring plants; and selecting from among the offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL for Botrytis- resistance according to the invention, or a Bo£ry£is-resistance-conferring part thereof.
  • the presence in said introgressed nucleic acid of at least one QTL for Botrytis- resistance according to the invention, or a .Bo£r.y£is-resistance-conferring part thereof, may suitably be detected by a method according to the present invention wherein at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for Botrytis- resistance is detected.
  • a preferred selection method therefore comprises marker-assisted selection (MAS) (see e.g. Tanksley et al. 1998) of said introgressed DNA wherein one or more markers associated with said QTL are detected in offspring plants.
  • MAS may for instance be performed by isolating genetic material from said offspring plants and determining the presence therein, by molecular techniques, of one or more donor plant markers.
  • molecular marker detection methods may be used without prior isolation of genetic material.
  • a phenotypic test on Botrytis resistance may be performed in order to select suitable plants.
  • a very suitable test therefore is the quantitative bioassay as described herein, whereby such parameters as disease incidence and/or rate of lesion growth are determined.
  • the confirmation of the presence of at least one marker from a QTL for .Bo£r;y£ ⁇ s-resistance in combination with the establishment of the presence of a resistant phenotype provides evidence for the successful transfer of nucleic acid comprising at least one QTL, or a .Bofryt ⁇ -resistanee-conferring part thereof, from the donor plant to the recipient plant.
  • the indicated transfer of nucleic acid may very suitably be performed by transgenic methods (e.g. by transformation), by protoplast fusion, by a doubled haploid technique or by embryo rescue.
  • the donor plants are Lycopersicon hirsutum LYC 4/78 and/or Ly coper sicon par ⁇ iflorum Gl.1601 and the nucleic acid transferred from these donor plants into recipient plants preferably comprises at least one QTL for Botrytis- resistance selected from the group consisting of the QTLs on chromosomes 1 (QTL- Ih), 2 (QTL-2h) and 4 (QTL-4K) of Lycopersicon, hirsutum LYC 4/78 and the QTLs on chromosomes 3 (QTL-3p), 4 (QTL-4p) and 9 (QTL-9p) in Lycopersicon parviflorum Gl.1601 associated with Botrytis resistance, or a So ⁇ -j ⁇ s-resistance-conferring part thereof.
  • the method comprises the crossing of said Bot?ytis-vesistant donor tomato plant with a Bo ⁇ ss-susceptible recipient tomato plant to produce first generation offspring plants; selecting from among the first generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Uoiryiis-resistance according to the invention, or a Bofryiis-resistance-conferring part thereof; crossing said selected offspring plant with a suitable commercial tomato line to produce second generation offspring plants; selecting from among the second generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said first generation offspring tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Botryt
  • the present invention relates to a .Bo ⁇ ryiis-resistant tomato plant, or part thereof, obtainable by a method of the present invention.
  • the present invention relates to a .Boiryi ⁇ s-resistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a £o£ry£is-resistance-conferring part thereof, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said Boirytis- resistance-conferring part thereof is not in its natural genetic background.
  • the present invention relates to a method of producing a
  • the method comprises the steps of producing a JBofryiis-resistant tomato plant according to a method of the invention, selfing said plant, growing seed obtained from said selfed plant into new plants; identifying plants that exhibit Botrytis resistance and possess commercially desirable characteristics from amongst said new plants, and repeating the steps of selfing and selection until an inbred tomato plant is produced which exhibits Botrytis resistance and possesses commercially desirable characteristics.
  • a method of producing a Botrytis-resistax ⁇ , inbred tomato plant may further comprise the additional step of selecting homozygote inbred tomato plants that exhibit Botrytis resistance and possess commercially desirable characteristics.
  • the present invention relates to a Botrytis-ves ⁇ st&nt inbred tomato plant, or parts thereof, obtainable by a method of the invention.
  • the present invention relates to a hybrid tomato plant, or parts thereof, that exhibits resistance to Botrytis, wherein said hybrid tomato plant is obtainable by crossing a jBo.ryiis-resistant inbred tomato plant obtainable by a method of the invention with an inbred tomato plant that exhibits commercially desirable characteristics.
  • the invention further relates to a tissue culture of regenerable cells of the tomato plants of the present invention.
  • a tissue culture the cells or protoplasts of said cells having been isolated from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruits, and stems and seeds.
  • the invention further relates to the use of a marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6, for the detection of QTLs for Bot ryt is-resistance according to the invention, and/or for the detection of .Boiry ⁇ s-resistant tomato plants.
  • the Botryt is-resistant donor tomato plant used in methods of the present invention is preferably selected from the group consisting of Lycopersicon cer ⁇ siforme, Lycopersicon cheesm ⁇ nii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon p ⁇ r ⁇ iflorum, Lycopersicon pennellii, Lycopersicon peru ⁇ i ⁇ num, Lycopersicon pimpinellifolium and Sol ⁇ num lycopersicoides, more preferably, a wild Lycopersicon accession is used as the donor plant.
  • Lycopersicon hirsutum and Lycopersicon p ⁇ r ⁇ iflorum are Lycopersicon hirsutum and Lycopersicon p ⁇ r ⁇ iflorum, in particular Lycopersicon hirsutum LYC 4/78 and Lycopersicon p ⁇ r ⁇ iflorum Gl.1601.
  • the recipient tomato plant used in methods of the present invention is preferably a plant of the species Lycopersicon esculentum, more preferably an L. esculentum cultivar that possess commercially desirable characteristics, or another commercial tomato line.
  • Figure 1 shows the position of quantitative trait loci (QTLs) for resistance to B. cinerea originating from L. hirsutum LYC 4/78 with the linkage maps representing chromosome 1 and 2. Map positions are given in cM. The QTL detected on chromosome 1 is for lesion growth and the QTL detected on chromosome 2 is for disease incidence. Bars indicate the QTL intervals. The box shows the LOD 1 interval and the line shows the LOD 2 interval. The codes for AFLP markers are more extensively described in Table 1. All markers indicated as associated to the QTLs may be used as markers in aspects of the present invention.
  • Figure 2 shows a schematic overview of the development of the L. esculentum x
  • BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain BC5 lines to aid in the development of QTL-NIL lines for the two main effects, which were identified in the F2 population.
  • BC3 and BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain a backcross inbred line (BIL) population (See Example 3).
  • Figure 3 shows the segregation in the two BC2S1 populations (population size 60 resp. 47) segregating for lesion growth (figure 3B and 3D and disease incidence (figure 3A and 3C).
  • Lesion growth is on the x-axis in mm (figure 3B and 3D) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on ) and disease incidence (figure 3A and 3C) is in classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on).
  • On the y-axis is the number of plants in each class. The average parental values are indicated by the arrows for MM resp. Lye 4/78.
  • Figure 4 shows the results of the L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 cross.
  • Disease incidence is on the x-axis as percentage (figure 4A) and classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on.
  • Lesion growth is on the x-axis in mm (figure 4B) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on).
  • Figure 5 shows a linkage map of the L. parviflorum QTLs as described herein.
  • QTL-3p is located in the region indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60-65.
  • Figure 6 shows a linkage map and QTL plots of the L. hirsutum QTLs as described herein. The map is an update to that of Figure 1, showing the genomic regions more clearly.
  • markers indicated as associated to the QTLs may be used as markers in aspects of the present invention.
  • This updated version provides basis for preferred embodiments in aspects of the present invention.
  • Botrytis means Botrytis cinerea, also known as gray mold or gray spot, a disease commonly found on the stem, leaves and fruit of tomatoes. It is generally considered that the plant pathogenic fungus Sclerotinia sclerotiorum has an infection mechanism similar to that of B. cinerea (Prins et al., 2000). Although S. sclerotiorum-in ⁇ ection in tomato is economically far less important than B.
  • Botrytis-vesistance such resistance should be understood as including resistance to any fungus of the family of Sclerotini ⁇ ce ⁇ e, preferably resistance to S. sclerotiorum and B. cinerea, more preferably resistance to B. cinerea.
  • allele(s) means any of one or more alternative forms of a gene, all of which alleles relate to at least one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. Since the present invention relates to QTLs, Le. genomic regions that may comprise one or more genes, but also regulatory sequences, it is in some instances more accurate to refer to "haplotype" (i.e. an allele of a chromosomal segment) in stead of "allele", however, in those instances, the term “allele” should be understood to comprise the term “haplotype”.
  • haplotype i.e. an allele of a chromosomal segment
  • a “gene” is defined herein as a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristics or trait in an organism.
  • locus is defined herein as the position that a given gene occupies on a chromosome of a given species.
  • heterozygous means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
  • homozygous means a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
  • hybrid means any offspring of a cross between two genetically unlike individuals, including but not limited to the cross between two inbred lines.
  • inbred means a substantially homozygous individual or line
  • a "recombination event” is understood to mean a meiotic crossing-over.
  • the terms “introgression”, “introgressed” and “introgressing” refer to both a natural and artificial process whereby genes of one species, variety or cultivar are moved into the genome of another species, variety or cultivar, by crossing those species. The process may optionally be completed by backcrossing to the recurrent parent.
  • “Genetic engineering”, “transformation” and “genetic modification” are all used herein as synonyms for the transfer of isolated and cloned genes into the DNA, usually the chromosomal DNA or genome, of another organism.
  • the term "molecular marker” refers to an indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences.
  • indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), microsatellite markers (e.g. SSRs), sequence-characterized amplified region (SCAR) markers, cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
  • RFLP restriction fragment length polymorphism
  • AFLP amplified fragment length polymorphism
  • SNPs single nucleotide polymorphisms
  • SCAR sequence-characterized amplified region
  • CAS cleaved amplified polymorphic sequence
  • resistant and resistance encompass both partial and full resistance to infection.
  • a Botryt is-susceptible tomato plant may either be non- resistant or have low levels of resistance to infection by Botrytis.
  • plant part indicates a part of the tomato plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which tomato plants can be regenerated.
  • plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
  • population means a genetically heterogeneous collection of plants sharing a common genetic derivation.
  • tomato means any plant, line or population of Lycopersicon including but not limited to Lycopersicon cerasiforme, Lycopersicon cheesmanii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum (or Solanum lycopersicum), Lycopersicon hirsutum, Lycopersicon par ⁇ iflorum, Lycopersicon pennellii, Lycopersicon peruvianum, Lycopersicon pimpinelli folium, or Solanum lycopersicoides.
  • L. cerasiforme, and L. pimpinellifolium Over the past few years, there has been debate among tomato researchers and botanists whether to reclassify the names of these species. The newly proposed scientific name for the modern tomato is Solanum Iy coper sicum. Similarly, the names of the wild species may be altered. L. pennellii may become Solanum pennellii, L. hirsutum may become S. habrochaites, L. peruvianum may be split into S. 'N peru ⁇ ianum' and S. 'Callejon de Huayles', S. peruvianum, and S. corneliomuelleri, L. par ⁇ iflorum may become S.neorickii, L.
  • L. chilense may become S. chilense
  • L. cheesmaniae may become S. cheesinaniae or S. galapagense
  • L. pimpinellifolium may become S. pimpinellifolium (Solanacea Genome Network (2005) Spooner and Knapp; http://www.sgn.cornell.edii/help/about/solanum nomenclature.html)
  • variable means a group of similar plants that by structural or genetic features and/or performance can be distinguished from other varieties within the same species.
  • QTL is used herein in its art-recognised meaning.
  • QTL associated with resistance to B. cinerea in tomato as well as the shorter term “QTL for Bohytis-xesistance” refer to a region located on a particular chromosome of tomato that is associated with at least one gene that encodes for Boiryiis-resistance or at least a regulatory region, i.e. a region of a chromosome that controls the expression of one or more genes involved in Botrytis-xesistaxice. The phenotypic expression of that gene may for instance be observed as a reduced rate of lesion growth and/or as a reduced disease incidence.
  • a QTL may for instance comprise one or more genes of which the products confer the genetic resistance.
  • a QTL may for instance comprise regulatory genes or sequences of which the products influence the expression of genes on other loci in the genome of the plant thereby conferring the Botrytis-resist ⁇ nce.
  • the QTLs of the present invention may be defined by indicating their genetic location in the genome of the respective wild Lycopersicon accession using one or more molecular genomic markers. One or more markers, in turn, indicate a specific locus. Distances between loci are usually measured by frequency of crossing- over between loci on the same chromosome. The farther apart two loci are, the more likely that a crossover will occur between them.
  • Botrytis-susceptible recipient tomato plant is used herein to indicate a tomato plant that is to receive DNA obtained from a donor tomato plant that comprises a QTL for Botiytis-resistsuice. Said " Botry tis-susceptible recipient tomato plant” may or may not already comprise one or more QTLs for Botrytis- resistance, in which case the term indicates a plant that is to receive an additional QTL.
  • Naturally genetic background is used herein to indicate the original genetic background of a QTL.
  • a background may for instance be the genome of a Botiytis-resistance wild accession of tomato.
  • the QTLs of the present invention were found at specific locations on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and chromosomes 3, 4 and 9 of Lycopersicon parviflorum Gl.1601.
  • the Lycopersicon hirsutum LYC 4/78 represents the natural genetic background of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78.
  • Lycopersicon hirsutum LYC 4/78 represent the natural genetic background of said QTLs.
  • a method that involves the transfer of DNA comprising the QTL, or a resistance-conferring part thereof, from chromosomes 1 of Lycopersicon hirsutum LYC 4/78 to the same position on chromosome 1 of another tomato species will result in that QTL, or said resistance-conferring part thereof, not being in its natural genetic background.
  • the term "disease incidence” is defined herein as the parameter that reflects the capability of the plant to reduce the establishment of an infection and may for instance be established by determining the success of achieving infection of the plant upon contact with the infectious agent.
  • rate of lesion growth or “lesion growth rate” is defined herein as the parameter that reflects the capability of the plant to slow or reduce the progression of infection, and may for instance be established by determining the rate of growth of expanding lesions.
  • Quantitatively determining is defined herein as establishing or assessing in a manner involving measurement, in particular the measurement of aspects measurable in terms of amounts and number. Determinations in degrees of severity and indications of greater, more, less, or equal or of increasing or decreasing magnitude, are not comprised in the present term “quantitatively determining”, which term ultimately implies the presence of objective counting mechanism for determining absolute values.
  • “quantitatively determining disease incidence and/or rate of lesion growth” preferably comprises determining the percentage of all potentially infectious contacts between plant and infectious agent that result in measurable lesions (in order to asses the disease incidence), and/or determining the increase in diameter, circumference, surface area or volume of one or more of said lesions over time under favourable conditions for fungal growth (in order to asses the rate of lesion growth).
  • standard practice conditions refer to the conditions of light, humidity, temperature, etc. where under plants are grown or incubated, for instance for the purpose of phenotypic characterization of disease resistance, as being standard. For greenhouses for instance, this refers to 16-h day, 15°C-25°C.
  • the terms refer to standard and reference growth conditions with a photoperiod of 8 to 24 h (photosynthetic photon flux (PPF) 50 to 1000 ⁇ mol nr 2 s" 1 ), preferably a light regime of 16 hours light and 8 hours dark, an air temperature of about 19 0 C during the day and 15°C at night, a water vapour pressure deficit of about 4.4 g m "3 corresponding to a relative humidity (RH) of about 60%-85%, at 600-700 ppm CO 2 and atmospheric O2 concentration and at atmospheric air pressure (generany 1008 hPa). Water and nutrients may be given drop wise near the stem, or in the form of spray or mist.
  • Standard bioassay experimentation conditions such as stem lesion length assay, disease incidence and lesion growth rate measurements, are further specified in the Examples below. In more detail, the average stem lesion length assay is to be performed as described in Examples 3.10 and 3.11.
  • Urbasch Urbason, 1986
  • QTLs quantitative trait loci
  • Botrytis cinerea infection in Lycopersicon esculentum under laboratory conditions is relatively well studied (e.g. Benito et al., 1998).
  • Droplet inoculation of leaves and subsequent incubation at moderate temperatures (15-20 0 C) results in a rapid (16-24 h post-infection (hpi)) development of necrotic spots at the site of the inoculum. Infection is temporarily restricted at this point for approximately 48 h. From that moment onwards a proportion of the lesions (usually 5-10%) starts to expand.
  • Outgrowth of these so called “expanding lesions” is accompanied by an increase in fungal biomass and results in colonisation of the complete leaflet in the following 48 h.
  • the present inventors found that specific QTLs associated with Botrytis- resistance in tomato can be identified when a bioassay for measuring resistance is used wherein the rate of the progression of infection and or the success of achieving infection upon contact with the infectious agent are measured quantitatively on parts of the tomato plant, preferably on detached parts, more preferably on stem segments. It was surprisingly found that multiple QTLs for Boiryiis-resistance were present in the genomes of Botrytis-resistant tomato plants, whereas the prior art methods resulted in the tentative identification of only a single QTL for Bofrytis-xesist&nce. Moreover, the QTLs that were found by using these methods were located on chromosomes not previously associated with J3o£r;y£is-resistance of tomato plants and the QTLs were associated with various phenotypic manifestations of resistance.
  • the methods of the present invention have provided the new insight that the genetic basis of Bot ry iis-resistance in tomato is polygenic.
  • the method of the present invention is capable of uncovering major QTLs for Botrytis resistance that confer a level of resistance to the plant that is higher than previously attained.
  • one advantage of the method of the present invention is that it results in the discovery of QTLs that are associated with higher levels of resistance to Botrytis.
  • This level of resistance may be determined by any method available, such as by using the methods of the present invention or by using conventional methods of the prior art. A detailed description of experimental setup and conditions is provided in the Examples below.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato requires the availability of a (partially) Botrytis-resistant tomato plant.
  • a plant may be provided by any means known in the art, and by using any method for the determination of the presence of said (partial) resistance in said plant.
  • Botrytis-xesistant tomato plant (which will further serve as a donor plant in a method of the present invention) enables the establishment or provision of chromosomal markers, preferably AFLP, CAPS and/or SCAR markers, most preferably CAPS and/or SCAR markers, for at least one, but preferably for all chromosome of said plant.
  • chromosomal markers preferably AFLP, CAPS and/or SCAR markers, most preferably CAPS and/or SCAR markers, for at least one, but preferably for all chromosome of said plant.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato comprises as a first step the crossing of said (partially) Botrytis-xesistant donor tomato plant with a non- resistant, or Botrytis susceptible, recipient tomato plant in order to produce offspring plants. Subsequently one or more offspring plants are contacted with an infective amount of Botrytis. Such an amount may vary between plants and between fungal species tested. Usually an amount of about 1 to 10 to an amount of about 500-5000 conidia of said fungus will be sufficient.
  • a subsequent step comprises quantitatively determining the disease incidence and/or the rate of lesion growth in one or more offspring plants produced from said cross.
  • the offspring plants are preferably plants of the F2 population derived from a cross between a i?o£r;y£is-resistant donor tomato plant and a non-resistant or Botrytis- susceptible recipient tomato plant.
  • a segregating F2 population is used, more preferably, an F2 population derived from a cross between L. esculentum cv. Moneymaker and L. hirsutum LYC 4/78.
  • Fi seed derived from said cross may be grown into Fi plants where after one single Fi plant is then selfed to produce F2 seed of which the subsequently derived F2 plants are used for the determination of the disease incidence and/or the rate of lesion growth in a method of the invention.
  • F3 lines may be used for resistance assays.
  • the step of contacting one or more offspring plants with an infective amount of Botrytis and quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants is preferably performed as part of a resistance bioassay on stem segments or leaves as described herein, preferably a resistance bioassay on stem segments.
  • a resistance bioassay on stem segments preferably a resistance bioassay on stem segments.
  • a resistance bioassay on stem segments may essentially be performed as follows: First, seeds for the offspring plants are planted and grown to seedlings/plants of suitably approximately 50 cm in height. The top 5-10 cm and bottom 5-10 cm of the stem of the plants may be removed and the remaining 30 cm may be cut into equal segments of 5-6 cm.
  • the stem segments are preferably placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments are suitably sprayed with water in order to ensure an equal spread of the inoculum over the wound surface. Each stem segment may then be inoculated by a conidial suspension of B. cinerea.
  • a suitable amount of inoculum for instance one drop of about 5 ⁇ l, comprising approximately 10 ⁇ conidia • ml "1 , may thereto be applied on the top of each stem segment.
  • the stem segments are then incubated at a temperature of suitably about 16 0 C, preferably in the dark, and preferably at high humidity (e.g. 100% RH).
  • Infection progress may be determined quantitatively by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper.
  • the stems may then be inspected for lesion formation (disease incidence) and lesion growth, in a quantitative manner.
  • Very suitable parameters comprise the measurement of the size of the lesion, for instance by using a caliper.
  • the quantitative measurements of the bioassays may be related to the comparable measurements in susceptible control or reference lines.
  • the disease incidence may suitably be determined by dividing the total number of expanding lesions by the total number of inoculation droplets.
  • the proportion of expanding lesions on a particular genotype may then be divided by the proportion of expanding lesions observed in a control or reference genotype and expressed as a percentage.
  • lesion growth rates may be determined by calculating the increase in lesion size (e.g. in mm) over a suitable period, for instance over a 24 h period.
  • Data for the non-expanding lesions may be deleted from the quantitative analysis.
  • the lesion growth rate obtained may then optionally be divided by the lesion growth rate observed in a control or reference genotype and expressed as a percentage or as an absolute figure, for instance in millimetres.
  • plants can be screened by using a leaf infection bioassay as follows: First, tomato seeds are planted and grown to seedlings/plants. For each individual plant one or two compound leaves may be cut from the main stem and transferred to pre-wetted florist foam. The florist foam is then placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. A suitable inoculum comprising B. dnerea conidia may be prepared by methods known in the art, for instance as described by Benito et al., 1998. The compound leaves are then inoculated with the conidial suspension of B.
  • dnerea by placing a number of droplets, suitably for instance 6 to 10 droplets of 2 ⁇ l each, onto the upper surface of the leaves.
  • the container is then closed and the leaves are incubated at a temperature of suitably between 15°C-20°C, preferably in the dark, and preferably at high humidity.
  • the leaves may then be inspected for disease incidence and lesion growth, in a quantitative manner as described above for the stem bioassay.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato further comprises the steps of establishing a genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants and assigning contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced rate of lesion growth to a quantitative trait locus.
  • a genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of the donor tomato plant in said one or more offspring plants may be established by any method known in the art.
  • the skilled person is aware of methods for identifying molecular markers linked to resistance quantitative trait loci (QTLs) and the mapping of these markers on a genetic linkage map (see e.g. Bai et al., 2003; Foolad et al., 2002; van Heusden et al., 1999).
  • the association between the J3o£?;y£is-resistant phenotype and marker genotype may suitably be performed by using such software packages as JoinMap ® and MapQTL ® (see Examples) or any standard statistical package which can perform analysis of variance analysis.
  • the molecular markers can be used to construct genetic linkage maps and to identify quantitative trait loci (QTLs) for Botrytis resistance.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention may further be improved by reducing experimental variation in the bioassay and/or by the construction of a complete backcross inbred population (BIL).
  • BIL backcross inbred population
  • Molecular markers are used for the visualisation of differences in nucleic acid sequences. This visualisation is possible due to DNA-DNA hybridisation techniques (RFLP) and/or due to techniques using the polymerase chain reaction (e.g. STS, microsatellites, AFLP). All differences between two parental genotypes will segregate in a mapping population (e.g., BCi, F2; see Figure 2) based on the cross of these parental genotypes. The segregation of the different markers may be compared and recombination frequencies can be calculated. The recombination frequencies of molecular markers on different chromosomes is generally 50%. Between molecular markers located on the same chromosome the recombination frequency depends on the distance between the markers.
  • RFLP DNA-DNA hybridisation techniques
  • STS polymerase chain reaction
  • a low recombination frequency corresponds to a low distance between markers on a chromosome. Comparing all recombination frequencies will result in the most logical order of the molecular markers on the chromosomes. This most logical order can be depicted in a linkage map (Paterson, 1996). A group of adjacent or contiguous markers on the linkage map that is associated to a reduced disease incidence and/or a reduced lesion growth rate pinpoints the position of a QTL. Upon the identification of the QTL, the QTL effect (the resistance) may for instance be confirmed by assessing .Boiryiis-resistance in BC2S1 progenies segregating for the QTLs under investigation. The assessment of the Botrytis resistance may suitably be performed by using a stem or leaf bioassay as described herein.
  • the QTLs for resistance against Botrytis in tomato are an aspect of the present invention.
  • a characteristic of such QTLs is that, when present in plants, they are indicative of the presence of a reduced disease incidence and/or a reduced lesion growth rate upon contacting said plant with infective amount of Botrytis material, which material may be provided in any form, such as in the form of conidia or mycelium.
  • the present invention also relates to a QTL for resistance against Botrytis in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon par ⁇ iflorum Gl.1601 associated with Botrytis resistance.
  • QTLs may be more clearly defined or indicated by the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6.
  • Table 1 and Figures 1 and 6 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L.hirsutum LYC 4/78.
  • Table 2 and Figure 5 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L. par ⁇ iflorum Gl.1601. In both tables, the genomic region where the QTLs are located is indicated by the AFLP-markers listed.
  • the QTLs of the present invention comprise genetic information in the form of DNA responsible for conferring (partial) Botrytis disease incidence or a reduced rate of Botrytis lesion growth in a tomato plant.
  • the genetic information may for instance comprise a gene or a regulatory element.
  • P-GT M-GAT - 412h wherein P and M are the common Pstl and Msel primer sequences or universal primers (Vos et al., 1995; Bai et al. 2003) followed by 2 or 3 extra selective bases as indicated by a two digit extension code.
  • 412 is the approximated size in basepairs of the resulting polymorphic fragment (given size ⁇ 2 basepairs). The size is normally rounded off but may also be given in decimals. This fragment is amplified in either L. esculentum cv Moneymaker (e) or L. hirsutum LYC 4/78 (h). Primer and adapter sequences are described in detail by Bai et al. 2003.
  • CT128 is a marker located on chromosome 2 position 44 cM on the Tanksley map (Tanksley et al. 1992).
  • TG609 (see Table 20) is an RFLP Marker located on chromosome 4 position 38 cM on the Tomato-EXPEN 1992 composite map based on a S. lycopersicum cv. VF36 x S. pennellii LA716 F2 population (Tanksley et al. 1992).
  • any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as well as any marker known to be located in that region based on publicly available information, such as from consensus maps Tomato-EXPEN 1992 (Tanksley et al, 1992), Tomato-EXHTR 1997 (Bernacchi and Tanksley, 1997), Tomato-EXPEN 2000 (Fulton et al, 2002) or Tomato-EXPIMP 2001 (Grandillo and Tanksley, 1996; Tanksley et al. 1996, Doganlar et al. 2002).
  • the genomic region where QTL-4h is located is positioned between markers TG609 (Table 20) and C2Atlg74970 (Table 24) as shown in Figure 6. Therefore, any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as' well as any marker known to be located in that region based on publicly available information.
  • Table 2 QTLs found in offspring of a cross of L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 and related quantitative resistance information.
  • the genomic region where QTL-3p is located is indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60- 65.
  • a QTL of the present invention comprises at least one marker of Table 1 or 2 or as indicated in Figures 1, 5 or 6 associated with said QTL. Because the nucleic acid sequence of the QTL that is responsible for conferring the Botrytis resistance may only be a fraction of the entire QTL herein identified, the markers merely indicate linked inheritance of genetic regions or the absence of observed recombination within such genetic regions.
  • the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6 indicate the chromosomal region where a QTL of the invention is located in the genome of the specified Lycopersicon lines and that those markers do not necessarily define the boundaries or the structure of that QTL.
  • the part of the QTL that comprises the essential resistance-conferring nucleic acid sequence(s) may be considerably smaller than that indicated by the contiguous markers listed for a particular QTL.
  • Such a part is herein referred to as a "resistance-conferring part" of a QTL.
  • a resistance-conferring part of a QTL need not necessarily comprise any of said listed markers.
  • markers may be used to indicate the various QTLs, provided that such markers are genetically linked to the QTLs and the skilled person may find or use a QTL that is analogous to those of the present invention, but wherein one or more markers listed in table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL are absent.
  • a jBofryf ⁇ s-resistance-conferring part of a QTL for resistance against Botrytis in tomato may be identified by using a molecular marker technique, for instance with one or more of the markers for a QTL shown in Table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL, preferably in combination with a resistance bioassay.
  • Tomato plants that do not comprise a Boiryiis-resistance-conferring part of a QTL of the present invention are relatively susceptible to infection by Botrytis.
  • the markers provided by the present invention may very suitably be used for detecting the presence of one or more QTLs of the invention in a suspected Botrytis- resistant tomato plant, and may therefore be used in methods involving marker- assisted breeding and selection of Botrytis resistant tomato plants.
  • detecting the presence of a QTL of the invention is performed with at least one of the markers for a QTL shown in Table 1 or 2 or as indicated in Figures 1, 5 or 6 as being linked to said QTL.
  • the present invention therefore relates in another aspect to a method for detecting the presence of a QTL for Botiytis-Yesistance, comprising detecting the presence of a nucleic acid sequence of said QTL in a suspected Botrytis- resistant tomato plant, which presence may be detected by the use of the said markers.
  • the nucleic acid sequence of a QTL of the present invention may be determined by methods known to the skilled person. For instance, a nucleic acid sequence comprising said QTL or a resistance-conferring part thereof may be isolated from a Botrytis-resistant donor plant by fragmenting the genome of said plant and selecting those fragments harboring one or more markers indicative of said QTL.
  • the marker sequences (or parts thereof) indicative of said QTL may be used as (PCR) amplification primers, in order to amplify a nucleic acid sequence comprising said QTL from a genomic nucleic acid sample or a genome fragment obtained from said plant.
  • the amplified sequence may then be purified in order to obtain the isolated QTL.
  • the nucleotide sequence of the QTL, and/or of any additional markers comprised therein, may then be obtained by standard sequencing methods.
  • the present invention therefore also relates to an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a Boiryiis-resistance-conferring part thereof.
  • an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a Boiryiis-resistance-conferring part thereof.
  • the markers that pinpoint the various QTLs described herein may be used for the identification, isolation and purification of one or more genes from tomato that encode for Botrytis resistance.
  • the nucleotide sequence of a QTL of the present invention may for instance also be resolved by determining the nucleotide sequence of one or more markers associated with said QTL and designing internal primers for said marker sequences that may then be used to further determine the sequence the QTL outside of said marker sequences.
  • the nucleotide sequence of the AFLP markers from Tables 1 and 2 may be obtained by isolating said markers from the electrophoresis gel used in the determination of the presence of said markers in the genome of a subject plant, and determining the nucleotide sequence of said markers by for instance dideoxy chain terminating methods, well known in the art.
  • the method may also comprise the steps of providing a oligonucleotide or polynucleotide capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence of a marker linked to said QTL, preferably selected from the markers of Tables 1 and 2 and as indicated in Figures 1, 5 or 6 as being linked to said QTL, contacting said oligonucleotide or polynucleotide with a genomic nucleic acid of a suspected Botryt is-resistant tomato plant, and determining the presence of specific hybridization of said oligonucleotide or polynucleotide to said genomic nucleic acid.
  • said method is performed on a nucleic acid sample obtained from said suspected Botrytis-resistant tomato plant, although in situ hybridization methods may also be employed.
  • the skilled person may, once the nucleotide sequence of the QTL has been determined, design specific hybridization probes or oligonucleotides capable of hybridizing under stringent hybridization conditions to the nucleic acid sequence of said QTL and may use such hybridization probes in methods for detecting the presence of a QTL of the invention in a suspected .Boirytis-resistant tomato plant.
  • stringent hybridization conditions refers to conditions under which a probe or polynucleotide will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Thijssen, 1993). Generally, stringent conditions are selected to be about 5-10 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O 0 C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions are often: 50% formamide, ⁇ xSSC, and 1% SDS, incubating at 42°C, or, 5xSSC, 1% SDS, incubating at 65 0 C, with wash in 0.2xSSC, and 0.1% SDS at 65 0 C.
  • a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures may vary between about 32°C and 48 0 C depending on primer length. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g. Current Protocols in Molecular Biology, eds. Ausubel, et al. 1995).
  • Nucleic acid or “oligonucleotide” or “polynucleotide” or grammatical equivalents used herein means at least two nucleotides covalently linked together. Oligonucleotides are typically from about 7, 8, 9, 10, 12, 15, 1820 25, 30, 40, 50 or up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10.000, etc.
  • a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, 1991), and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring nucleic acids and analogs can be used. Particularly preferred analogs for oligonucleotides are peptide nucleic acids (PNA).
  • PNA peptide nucleic acids
  • a nucleic acid (preferably DNA) sequence comprising at least one QTL of the present invention or a Botrytis- resistance-co ⁇ ferring part thereof, may be used for the production of a Botrytis- resistant tomato plant.
  • the invention provides for the use of a QTL of to the present invention or Botryt is-resistanee-conferring parts thereof, for producing a Botrytis-vesist&nt tomato plant, which use involves the introduction of a nucleic acid sequence comprising said QTL in a Boiryiis-susceptible recipient tomato plant.
  • said nucleic acid sequence may be derived from a suitable Botrytis-resist&nt donor tomato plant.
  • Two suitable J3o£ry£is-resistant donor tomato plants capable of providing a nucleic acid sequence comprising at least one of the hereinbefore described QTLs, or Bofryiis-resistance-conferring parts thereof, are L. hirsutum LYC 4/78 and L. parviflorum Gl.1601.
  • Other related tomato plants that exhibit resistance to Botrytis and comprise one or more genes that encode for Botrytis resistance may also be utilized as JSoiryiis-resistance donor plants as the present invention describes how this material may be identified.
  • the nucleic acid sequence that comprises a QTL for Botrytis-resistance according to the present invention, or a ⁇ o£r,y£is-resistance-coriferring part thereof may be transferred to a suitable recipient plant by any method available.
  • the said nucleic acid sequence may be transferred by crossing a .Bofryiis-resistance donor tomato plant with a susceptible recipient tomato plant (i.e. by introgression), by transformation, by protoplast fusion, by a doubled haploid technique or by embryo rescue or by any other nucleic acid transfer system, optionally followed by selection of offspring plants comprising the QTL and exhibiting jBo£ry£ ⁇ s-resistance.
  • a nucleic acid sequence comprising a QTL for jBoiryfis-resistance according to the present invention, or a jBoiry&s-resistance-conferring part thereof, may be isolated from said donor plant by using methods known in the art and the thus isolated nucleic acid sequence may be transferred to the recipient plant by transgenic methods, for instance by means of a vector, in a gamete, or in any other suitable transfer element, such as a ballistic particle coated with said nucleic acid sequence.
  • Plant transformation generally involves the construction of an expression vector that will function in plant cells.
  • a vector comprises a nucleic acid sequence that comprises a QTL for Botrytis-resistance of the present invention, or a .Bofryiis-resistance-conferring part thereof, which vector may comprise a .Bofryiis-resistance-conferring gene that is under control of or operatively linked to a regulatory element, such as a promoter.
  • the expression vector may contain one or more such operably linked gene/regulatory element combinations, provided that at least one of the genes contained in the combinations encodes for Botrytis- resistance.
  • the vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, to provide transgenic plants that are resistant to Botrytis, using transformation methods known in the art, such as the Agrobacterium transformation system.
  • Expression vectors can include at least one marker gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the marker gene).
  • selectable marker genes for plant transformation include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor.
  • positive selection methods are known in the art, such as mannose selection.
  • marker-less transformation can be used to obtain plants without mentioned marker genes, the techniques for which are known in the art.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria that genetically transform plant cells.
  • the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant (see e.g. Kado, 1991).
  • Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant cells with Agrobacterium tumefaciens (Horsch et al., 1985).
  • Another method for introducing an expression vector into a plant is based on microprojectile-mediated transformation wherein DNA is carried on the surface of microprojectiles.
  • the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes (See, Sanford et al., 1987, 1993; Sanford, 1988, 1990; Klein et al.,1988, 1992).
  • Another method for introducing DNA to plants is via the sonication of target cells (see Zhang et al., 1991).
  • liposome or spheroplast fusion has been used to introduce expression vectors into plants (see e.g.
  • protoplast fusion can be used for the transfer of nucleic acids from a donor plant to a recipient plant.
  • Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells of which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell.
  • the fused cell that may even be obtained with plant species that cannot be interbreeded in nature, is tissue cultured into a hybrid plant exhibiting the desirable combination of traits.
  • a first protoplast can be obtained from a tomato plant or other plant line that exhibits resistance to infection by Botrytis. For example, a protoplast from L.
  • a second protoplast can be obtained from a second tomato or other plant variety, preferably a tomato line that comprises commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art.
  • embryo rescue may be employed in the transfer of a nucleic acid comprising one or more QTLs of the present invention from a donor plant to a recipient plant.
  • Embryo rescue can be used as a procedure to isolate embryo's from crosses wherein plants fail to produce viable seed. In this process, the fertilized ovary or immature seed of a plant is tissue cultured to create new plants (Pierik, 1999).
  • the present invention also relates to a method of producing a J3o£ry£is-resistant tomato plant comprising the steps of performing a method for detecting the presence of a quantitative trait locus (QTL) associated with resistance to B. cinerea in a donor tomato plant according to invention as described above, and transferring a nucleic acid sequence comprising at least one QTL thus detected, or a Bot ryt is-resistance- conferring part thereof, from said donor plant to a .Boiry ⁇ s-susceptible recipient tomato plant.
  • QTL quantitative trait locus
  • a preferred embodiment of such a method comprises the transfer by introgression of said nucleic acid sequence from a Botrytis-resistant donor tomato plant into a .Boiryiis-susceptible recipient tomato plant by crossing said plants. This transfer may thus suitably be accomplished by using traditional breeding techniques.
  • QTLs are preferably introgressed into commercial tomato varieties by using marker- assisted breeding (MAS).
  • Marker- assisted breeding or marker-assisted selection involves the use of one or more of the molecular markers for the identification and selection of those offspring plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on selection of QTLs of the present invention or markers associated therewith.
  • MAS can also be used to develop near-isogenic lines (NIL) harboring the QTL of interest, allowing a more detailed study of each QTL effect and is also an effective method for development of backcross inbred line (BIL) populations (see e.g. Nesbitt et ⁇ l., 2001; van Berloo et ⁇ l., 2001).
  • NIL near-isogenic lines
  • BIL backcross inbred line
  • At least two, preferably three QTLs or .Bofryi ⁇ s-resistance-conferring parts thereof, are inserted by a suitable transfer method into a single recipient plant, i.e. that multiple QTLs are stacked in the recipient plant's genome. It is believed that stacking of two or more QTLs of the invention may lead to increased resistance to Botrytis. As the skilled person will readily understand, stacking may be achieved by any method, for instance by transforming a plant with a nucleic acid construct comprising multiple QTLs of the invention.
  • At least one QTL may be present in each parent plant of a cross, so that at least two QTLs are comprised in the resulting hybrid.
  • highly resistant plants may be obtained.
  • Such plants are highly preferred embodiments of the present invention.
  • traditional breeding techniques can be used to introgress a nucleic acid sequence encoding for Botrytis resistance into a Botrytis- susceptible recipient tomato plant.
  • a donor tomato plant that exhibits resistance to Botrytis and comprising a nucleic acid sequence encoding for Botrytis resistance is crossed with a Botrytis- susceptible recipient tomato plant that preferably exhibits commercially desirable characteristics, such as, but not limited to, disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the resulting plant population (representing the Fi hybrids) is then self-pollinated and set seeds (F2 seeds).
  • the Fs plants grown from the F2 seeds are then screened for resistance to Botrytis.
  • the population can be screened in a number of different ways.
  • the population can be screened using a traditional disease screen.
  • a quantitative stem or leaf infection bioassay is used, preferably the stem bioassay used in methods of the present invention as outlined in more detail hereinabove and the Examples is used.
  • marker-assisted selection can be performed using one or more of the hereinbefore- described molecular markers to identify those progeny that comprise a nucleic acid sequence encoding for Botrytis-vesistance. Other methods, referred to hereinabove by methods for detecting the presence of a QTL may be used.
  • marker-assisted selection can be used to confirm the results obtained from the quantitative bioassays, and therefore, several methods may also be used in combination.
  • a Botrytis-resistaxit tomato plant of the present invention is characterized by having a high level of resistance. This is defined as being a resistance level that is higher than that observed for susceptible control plants. In fact, the plants of the invention have a level of resistance that is higher than that of any commercial tomato variety, i.e. a variety having commercially desirable characteristics, known to date.
  • a plant of the invention has a susceptibility to Botrytis cinerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay.
  • a plant of the invention has a level of resistance that results in an average stem lesion length of Botrytis cinerea lesions in adult plants of less than 3.2 cm three weeks after inoculation using standard practice conditions in a resistance bioassay designed to determine resistance based on such characteristics. More typically, a plant of the invention shows an average stem lesion length of less than 2.9 cm. Some plants of the invention even show an average stem lesion length of 2.0 cm.
  • the plants of the invention show net stem lesions in the above referred resistance bioassay that are generally less than about 30% (0.9/2.85 xlOO%) of the net length of susceptible control plants, and generally less than about 40% (0.9/2.3 x 100%) of the net length of partially resistant L. hirsutum LA 1777.
  • a plant of the present invention has a susceptibility to Botrytis cinerea when measured by a bioassay which is 3 times lower than, or which is less than 1/3 the level of, a susceptible control plant.
  • a plant of the invention is more than 3 times more resistant than a susceptible control plant, as defined herein and determined with the bioassay as described.
  • QTLs or combinations of QTLs e.g. QTL-Ih and the combinations of QTL-3p+QTL-4p or QTL-9p+QTL-4p
  • full resistance is observed (See Table 10).
  • a susceptible control plant is defined as a plant showing normal susceptibility, or no resistance, to Botrytis cinerea infection.
  • Examples of susceptible control plants are the hybrid Lycopersicon esculentum cv. "Tradiro”, and Lycopersicon esculentum cv. “Moneyberg” (De Ruiter Seeds CV, Bergschenhoek, The Netherlands).
  • a Bot ryiis-resistant tomato plant, or a part thereof, obtainable by a method of the invention is also an aspect of the present invention.
  • Another aspect of the present invention relates to a Botrytis-vesistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a Botrytis- resistance-conferring part thereof, selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, wherein said QTL or said Boiryiis-resistance-conferring part thereof is not in its natural genetic background.
  • the Botrytis-resistant tomato plants of the present invention can be of any genetic type such as inbred, hybrid, haploid, dihaploid, parthenocarp or transgenic. Further, the plants of the present invention may be heterozygous or homozygous for the resistance trait, preferably homozygous.
  • the QTLs of the present invention, as well as those QTLs obtainable by a method of the invention, as well as jBo£ry£ts-resistance-conferring parts thereof may be transferred to any plant in order to provide for a .Boiryi ⁇ s-resistant plant
  • the methods and plants of the invention are preferably related to plants of the Sol ⁇ n ⁇ ce ⁇ e family, more preferably tomato.
  • Botrytis-resistant tomato plant lines can be developed using the techniques of recurrent selection and backcrossing, selling and/or dihaploids or any other technique used to make parental lines.
  • Botrytis-xesistance can be introgressed into a target recipient plant (which is called the recurrent parent) by crossing the recurrent parent with a first donor plant (which is different from the recurrent parent and referred to herein as the "non-recurrent parent").
  • the recurrent parent is a plant that is non-resistant or has a low level of resistance to Botrytis and possesses commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the non-recurrent parent exhibits Botrytis resistance and comprises a nucleic acid sequence that encodes for Botrytis resistance.
  • the non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent.
  • the progeny resulting from a cross between the recurrent parent and non-recurrent parent are backcrossed to the recurrent parent.
  • the resulting plant population is then screened.
  • the population can be screened in a number of different ways. For instance, the population can be screened using a stem quantitative bioassays as described previously herein.
  • Fi hybrid plants that exhibit a .Bo£ry£is-resistant phenotype comprise the requisite nucleic acid sequence encoding for Botrytis resistance, and possess commercially desirable characteristics, are then selected and selfed and selected for a number of generations in order to allow for the tomato plant to become increasingly inbred. This process of continued selfing and selection can be performed for two to five or more generations.
  • the result of such breeding and selection is the production of lines that are genetically homogenous for the genes associated with Botrytis resistance as well as other genes associated with traits of commercial interest.
  • MAS can be performed using one or more of the hereinbefore described molecular markers, hybridization probes or polynucleotides to identify those progeny that comprise a nucleic acid sequence encoding for .Bo ⁇ ry ⁇ s-resistance.
  • MAS can be used to confirm the results obtained from the quantitative bioassays. Once the appropriate selections are made, the process is repeated. The process of backcrossing to the recurrent parent and selecting for jBo£ry£ ⁇ s-resistance is repeated for approximately five or more generations.
  • progeny resulting from this process are heterozygous for one or more genes that encode for J3o£ry£is-resistance.
  • the last backcross generation is then selfed in order to provide for homozygous pure breeding progeny for -Bo£ry£ ⁇ s-resistance.
  • Bot ryiis-resistant inbred tomato lines described herein can be used in additional crossings to create Botrytis-resistant hybrid plants.
  • a first Botryt is-resistant inbred tomato plant of the invention can be crossed with a second inbred tomato plant possessing commercially desirable traits such as, but not limited to, disease resistance, insect resistance, desirable fruit characteristics, etc.
  • This second inbred tomato line may or may not be JBo.r ⁇ tis-resistant.
  • Another aspect of the present invention relates to a method of producing seeds that can be grown into Botrytis-xesi&tant tomato plants.
  • the method comprises the steps of providing a Botrytis-resistant tomato plant of the invention, crossing said Botrytis-resistant plant with a Lycopersicon esculentum plant, and collecting seeds resulting from said cross, which when planted, produce Botrytis- resistant tomato plants.
  • the method comprises the steps of providing a Botiytis-vesistant tomato plant of the invention, crossing said .BoJryiis-resistant plant with a Lycopersicon esculentum plant, collecting seeds resulting from said cross, regenerating said seeds into plants, selecting jBoiryiis-resistant plants by any of the methods described herein, self-crossing the selected plants for a sufficient number of generations to obtain plants that are fixed for an allele that confers Botrytis- resistance in the plants, backcrossing the plants thus produced with L. esculentum plants having desirable phenotypic traits for a sufficient number of generations to obtain L. esculentum plants that are Botrytis-resistant and have desirable phenotypic traits, and collecting the seeds produced from the plants resulting from the last backcross, which when planted, produce tomato plants which are Soir ⁇ iis-resistant.
  • Example 1 Method of identifying plants resistant to Botrytis cinere ⁇ . 1.1. Introduction.
  • This Example presents the development of a quantitative bioassay for evaluating the resistance to Botrytis cinere ⁇ of a collection of wild tomato genotypes.
  • Partial resistance against Botrytis cinere ⁇ has been reported in wild Lycopersicon species, but these reports have largely been descriptive and qualitative.
  • the identification of partially resistant genotypes would provide perspectives to introgress resistance into commercial breeding lines to obtain lines with manageable resistance levels.
  • the availability of a reproducible, objective and quantitative assay, as well as the identification of genotypes with a genetically determined (partial) grey mould resistance opens the way for resistance breeding in cultured tomato varieties.
  • the present Example describes a quantitative disease assay.
  • the assay is applied on leaves (leaf inoculation assay) and stem segments (stem inoculation assay).
  • Two parameters for disease susceptibility were examined.
  • the first parameter was the disease incidence (DI), i.e. the proportion of inoculation droplets that resulted in an expanding lesion. If the (partial) failure of a primary S. cinere ⁇ lesion to expand on a particular host genotype is a genetic trait of the plant, such a trait is important as it directly limits the number of disease foci in the crop.
  • DI disease incidence
  • the second parameter tested was the lesion growth rate over a period of 24 h (lesion growth, LG).
  • the present assays enable the quantification of both the occurrence (disease incidence) and development (lesion growth) of B. cinerea infection, resulting in two sets of quantitative trait data.
  • the assay was used to screen a collection of Lycopersicon species (hereinafter also termed "accessions") for the presence of resistance therein.
  • Table 3 List of Lycopersicon genotypes tested.
  • DRS De Ruiter Seeds, Bergschenhoek, The Netherlands
  • WU PPW Plantgrass Proefcentrum Wageningen, Wageningen University, Wageningen, The Netherlands
  • LoPB Laboratory of Plant Breeding, Wageningen University, Wageningen, The Netherlands
  • MPIZK Max Planck Institut fur Z ⁇ chtungsutze, K ⁇ ln, Germany
  • TGRC Tomato Genetics Resource Center, University of California at Davis, Davis CA, USA
  • IPK Institut fur Degenetik undbooesseforschung, Gatersleben, Germany.
  • An inoculum from B. cinerea strain B05.10 was prepared according to Benito (1998). For each individual plant one or two compound leaves that were fully stretched were detached from the main stem with a sharp razor blade and transferred to pre-wetted florist foam. The florist foam was placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. The compound leaves were then inoculated with a conidial suspension of B. cinerea by carefully pipetting a total of 6 to 10 droplets of inoculum (2 ⁇ l) onto the upper surface of the leaves.
  • the containers were closed with a spray-wetted lid and incubated at 15°C in the dark at 100% RH, essentially as described by Benito et al., 1998.
  • the data in Table 4 were derived from a test wherein one composite leaf was divided into four leaflets, and wherein every leaflet was inoculated with 10 drops of 2 ⁇ l each, containing 2000 conidia. Both the proportion of aggressive expanding lesions (disease incidence) and the lesion growth rate were monitored over several days.
  • the disease incidence of a particular genotype in each experiment was related to the disease incidence of Moneymaker tested in that same experiment.
  • Lesion sizes were measured at 96, 120 and 144 hpi using a caliper. The disease incidence was determined by dividing the total number of expanding lesions by the total number of inoculation droplets. Lesion growth rates were determined by calculating the increase in lesion size (in mm) over a 24 h period. Data for the non- expanding lesions were deleted from the quantitative analysis. The results of the leaf assay are presented in Table 4.
  • Table 4 Disease incidence (DI, in %) and lesion growth rates (LG, in mm/day ⁇ standard deviation) in leaves of Lycopersicon accessions inoculated with B. cinerea. Experiments were conducted in 1999 and 2000 in different weeks as indicated.
  • the stem assay was performed as follows: The top 5-10 cm and bottom 5-10 cm of the stem of approximately 50 cm high plants were removed and the remaining 30 cm was cut into equal segments of 5-6 cm. Each stem segment was placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments were sprayed with tap water in order to ensure an equal spread of the inoculum over the wound surface. Inoculum was prepared as described for the leaf assay. One drop of a 5 ⁇ l inoculum, containing approximately 10 6 conidia • ml" 1 , was applied on the top of each stem segment. Incubations were performed at 15 ⁇ 2 0 C in the dark with 100% relative humidity. Infection progress was determined by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper.
  • the percentage of infected stem pieces was calculated.
  • the disease incidence was determined by dividing the total number of stem segments with expanding lesions by the total number of inoculated segments.
  • Lesion growth rates were determined by calculating the increase in lesion size over a 24 h period, whereby the data for the non-expanding lesions were omitted from the analysis.
  • the results of the stem assay are presented in Table 5.
  • the disease incidence and lesion growth in detached leaf infection experiments were determined over several days for each genotype, usually from 2-4 days post ⁇ infection.
  • Table 4 shows the results of 14 genotypes for which detached compound leaves originating from at least 5 individual plants were inoculated, with 40 inoculation spots per leaf (10 per leaflet).
  • the disease incidence in these 14 genotypes should be compared to that in the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Except for genotypes 82/2577 and 83/2896 (both of the species L.
  • Genotypes Gl.1556, Gl.1560 and Gl.1601 showed a low disease incidence in three independent experiments, ranging from 0 to 21%.
  • the disease incidence in 17 genotypes should be compared to the disease incidence of the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Most genotypes showed a disease incidence in a similar range as the control line Moneymaker. Genotypes Gl.1556 (29% and 41%) and Gl.1560 (28% and 7%) showed a reduced disease incidence. Only Gl.1560 differed statistically significant (p ⁇ 0.05) from the control.
  • the lesion growth rates in the stem assay (Table 5) for the control genotype L. esculentum cv. Moneymaker ranged from 5.4 to 9.2 mm/day. The lesion growth rates of many genotypes were in a similar range as the control.
  • the glasshouse compartment was kept at high humidity by spraying the floor twice a day with tap water and leaving doors and windows closed. At regular intervals pruning wounds were made on all plants and the occurrence of grey mould was monitored over time. A number of wild Lycopersicon accessions were identified that displayed a severe reduction of both parameters, thus providing potential sources for introgressing two, potentially independent mechanisms of partial resistance into L. esculentum.
  • a set of Lycopersicon accessions from diverse origins was screened for resistance to the fungal pathogen Botrytis cinerea as described in Example 1.
  • the accession Lycopersicon par ⁇ iflorum Gl.1601 showed in a leaf assay a lower disease incidence and also a slower lesion growth (see Tables 4 and 5 above).
  • Amplified Fragment Length Polymorphism markers were used to construct a linkage map and to perform Quantitative Trait Locus-analysis. QTLs were detected for both disease incidence and lesion growth.
  • Lycopersicon par ⁇ iflorum Gl.1601 a segregating population with this accession as founding parent (Huang, 2001), was used for further analysis.
  • the segregating population consisted of 130 Fa- derived F3 populations.
  • Example 2 2.3. Disease evaluations From each of the 130 F3 populations 5 seedlings were grown and subjected to the stem assay described in Example 1 (see 1.4). For practical reasons the complete set of measurements was divided (at random) into 13 portions of equal size. Every week one portion consisting of 50 plants was measured. A large set of susceptible Moneymaker control plants was used to correct for environmental differences between weeks. For practical reasons L. par ⁇ iflorum Gl.1601 was not included in the experiment. Measurements were performed as described in Example 1.
  • aa is homozygous L. esculentum for the complete chromosomal region
  • b- is heterozygous or homozygous L. par ⁇ iflorum for the QTL-region.
  • This Example shows that genetic sources like L. par ⁇ iflorum Gl.1601 can be used to increase the resistance to B. cinerea in tomato.
  • Several QTLs both for disease incidence as for lesion growth could be identified (table 6). These QTLs may be confirmed in more advanced breeding material such as backcross lines.
  • Table 7 shows the experimental results of disease resistance tests of various F3 lines resulting from a cross between L. esculentum cv Moneymaker and L. par ⁇ iflorum G.1601. It is clearly shown that the BChirs ⁇ reference line used in this experiment exhibits a higher level of resistance than that of the L. par ⁇ iflorum (L parv) lines listed. However, the presence of QTL effects can also be established for the par ⁇ iflorum QTLs.
  • Table 7 Average stem lesion length o£ Botrytis cinerea lesions in adult plants of L. parviflorum accession G.1601 three weeks after inoculation.
  • Tradiro is a hybrid, suscpetible to Botrytis according to growers
  • Durintha is a hybrid with partial resistance according to growers
  • Moneyberg and Moneymaker are similar types of susceptible lines
  • GT is Moneyberg with TMV resistance
  • BChirs ⁇ is a backcross line resulting from L. hirsutum LYC 4/78 introgression and comprises the hirsutum QTL-Ih for lesion growth. (+): heterozygous or homozygous presence; (— ): not present; n.d.: not determined.
  • Example 3 Mapping partial resistance to Botrytis cinerea in an interspecific tomato population (L. esculentum cv Moneymaker x L. hirsutum accession LYC 4/78)
  • LYC 4/78 Seeds of Lycopersicon hirsutum LYC 4/78 (hereafter referred as LYC 4/78) were obtained from the gene bank located at the Institute for Plant Genetics and Crop Plant Research, Gatersleben, Germany. Seeds of Lycopersicon esculentum cv. Moneymaker (hereafter referred as Moneymaker) were obtained from the seed bank of De Ruiter Seeds cv, Bergschenhoek, The Netherlands.
  • Genomic DNA was isolated from two young (rolled up) leaves using a cetyltrimethylammonium bromide (CTAB) based protocol according to Steward and Via (1993), adjusted for high throughput DNA isolation using one ml micronic tubes (Micronic BV, Lelystad, The Netherlands) and grounded using a Retsch 300 mm shaker at maximum speed (Retsch BV, Ochten, The Netherlands).
  • CTAB cetyltrimethylammonium bromide
  • the AFLP analysis (Vos et al, 1995) of F2, BC2, BC3, BC4 and BC2S1 populations was done and the AFLP fragments were resolved on a LI-COR 4200 DNA sequencer, essentially following the method published by Myburg (Myburg et al. 2001).
  • the selective Pst primer was labeled with an IRD 700 or IRD 800 fluorescent label.
  • AFLP gel images were scored using the AFLP-Quantar Pro software package (Keygene BV, Wageningen, The Netherlands). The following ten primer combinations and adapter sequences were used for genotyping: P14M48, P14M49, P14M50, P14M60, P14M61, P15M48, P18M50, P18M51, P22M50 and P22M51, as described by Bai et al. (2003). 3.4. Phenotypic analysis of the F2 population
  • Average disease incidence of each individual experiment ranged from 31% to 73%, while the average lesion growth ranged from 6.2 to 7.9 mm/day (Table 8). Lesion growth can only be calculated if there is at least infection in one of the six stem pieces. Consequently an increase in the number of informative genotypes for lesion growth could be observed with higher disease incidences. For instance, with the low average disease incidence (31%) only 52% of the genotypes were informative for lesion growth.
  • Table 8 Average disease incidence and average lesion growth of seven experiments according to Example 3.4. The average values of the weeks are ordered according to disease incidence percentage.
  • AFLP amplified fragment length polymorphism
  • IM interval mapping
  • Interval mapping for disease incidence in the F2 population was done for those individual disease tests with an average disease incidence lower than 50% and for average data obtained from all disease tests (table 8).
  • the average data of all tests gave in the interval mapping procedure a single significant QTL for disease incidence (likelihood of odds (LOD) score must be higher than 3.4 for a genome-wide confidence level o ⁇ P ⁇ 0.05).
  • This QTL had a LOD score of 4.5 and explained 13 % of the total phenotypic variation (Table 9).
  • the allele contributing to resistance originated from the resistant parent LYC 4/78.
  • QTL mapping on each individual experiment gave in all four cases the same QTL region. In each independent experiment occasionally other "minor QTLs" were observed.
  • Lesion growth can best be measured in those disease tests with a high disease incidence.
  • QTL mapping the average of all 7 disease tests was used and one QTL for lesion growth of B. dnerea was identified above the threshold (LOD 3.4 for a genome-wide confidence level of P ⁇ 0.05).
  • This QTL had a LOD score of 4.2 and explained 12 % of the total phenotypic variation (Table 9).
  • the positive effect originated from the resistant parent LYC 4/78. The necessity of performing multiple disease tests is illustrated because in only one single repetition a LOD profile above the threshold was found.
  • Table 9 Estimation of the calculated effects for plants homozygous Moneymaker (A), heterozygous (H) or homozygous LYC 4/78 (B). Scores for the F2 population were calculated with the interval mapping procedure, while scores for the BC2S1 population were calculated with a Kruskal- Walk ' s analysis.
  • the Fi plant of the cross Moneymaker x LYC 4/78 was twice backcrossed with Moneymaker and the 59 progeny plants were screened for the presence of the two identified QTL-regions (one for disease incidence and one for lesion growth) using AFLP markers. Plants, heterozygous for one of the two identified QTLs, were selected and selfed to obtain two BC2S1 populations. A total of four disease bioassays were performed with each BC2S1 genotype. The data of both BC2S1 subpopulations, analyzed with SPSS, showed normal distributions for lesion growth, but not for disease incidence as some subclasses were observed (Figure 2).
  • BC2S1 plants were AFLP genotyped with the same 10 primer combinations as described for the F2 population in section 3.3 above.
  • the average lesion growth in the population segregating for the lesion growth locus was 5.3 mm/day while in the other population an average lesion growth of 6.3 mm/day was observed.
  • Not a single plant had a lesion growth as low as the resistant parent LYC 4/78.
  • plants with a lower disease incidence then the resistant parent LYC 4/78 were observed.
  • the average disease incidence for both BC2S1 populations was equal (57-59%).
  • QTL- 2h a major QTL for disease incidence was identified.
  • QTL-4h a restricted 'multiple QTL mapping 1 (MQM) procedure on the F2 dataset.
  • MQM restricted 'multiple QTL mapping 1
  • QTL-4h A QTL is denoted as "minor” when its score is below the significance threshold of LOD 3.4. The effects however are believed to be real QTL effects.
  • QTL-4h is located on chromosome 4 and reduces disease incidence (see table 1).
  • the QTL has a LOD score of 2.9 and is coupled to the following AFLP markers: P18M51-169.5e, P18M51-305.4h, Pl4M60-262.9e, and P14M61-292.7h.
  • the positive effect of this locus is derived from the resistant parent L. hirsutum.
  • the positive effect was identified both in the F2 and in the BC2S1 population.
  • This QTL was initially identified in the BC2S1 population lacking segregation of QTL-2h and is also coupled to the AFLP markers P14M48-345e, P14M48-177e, and Pl8M50-147e.
  • NIL near isogenic lines
  • BIL backcross inbred line
  • the bioassay for measuring resistance to B. cinerea has proven to be a valuable tool. However, a still large and unknown variation appears to influence the development of the infection process. This large non-genetic variation can be minimized by using standardized procedures and by performing many independent replications. The variation can be caused by the greenhouse conditions changing from week to week (day length, hours of sunlight and temperature) causing differences in physiological conditions of the stem. Also, small variations in the preparation of the fungal inoculum may play a role in the variation of the infection process. Another observation is that the development of the disease can also be affected by the microclimate in the trays in which the stem pieces were placed. Ten different experimental trays were used for the BC2S1 bioassays. Statistical analysis was used to compensate for variation between and within experiments.
  • Table 10 Average stem lesion length oiBotrytis cinerea lesions in adult plants of L. hirsutum accession LYC 4/78 and L. hirsutum LA 1777, three weeks after inoculation.
  • a, b, c and d are repeats whereby each repeat represents 5 plants; e and f are repeats whereby each repeat represents 3 plants; GT is Moneyberg with TMV resistance; Durintha is a hybrid with partial resistance according to growers; Tradiro is a hybrid, susceptible to Botrytis according to growers; BChirs indicates backcross lines resulting from L. hirsutum LYC 4/78 introgressions; LA 1777 is wild species accession L. hirsutum LA 1777; BC chrs 10 indicates backcross lines with introgression at chromosome 10 from L. hirsutum LA 1777; parv indicates lines resulting from L. par ⁇ iflorum introgressions.
  • the level of resistance to Botrytis conferred by L. hirsutum LYC 4/78 QTLs is higher than the level of resistance conferred by L. peruvianum LA 1777 QTLs at chromosome 10.
  • the level of resistance in plants containing the L. hirsutum LYC 4/78 QTLs described herein was compared to that of L. hirsutum LA1777, the source of WO02/085105 that contains a QTL for partial Biotrytis resistance on chromosome 10, and to introgression lines derived therefrom with introgressions at chromosome 10. Lines were placed in the greenhouse in soil and grown under standard practice conditions in the Netherlands.
  • results are listed in Table 10. It was observed that lines containing the QTLs from L. hirsutum LYC 4/78 showed a higher level of resistance to Botrytis than the LA 1777 source and IL-lines. Additionally, L. parviflorum lines containing the combination of either the QTL for disease incidence on chromosome 4 and that of lesion growth on chromosome 9 (line 68), or the combination of both QTLs for disease incidence on chromosome 3 and chromosome 4 (line 78) were compared to the LA 1777 source and IL-lines. Former lines showed less lesion growth on the stem and therefore exhibit a higher level of resistance to Botrytis then the lines derived from LA 1777 (See Table 10). Where a lesion length of 2.0 cm is recorded, only the original wound could be measured and no fungal growth was observed, which indicates a high level of resistance. Thus, a stem lesion length of 2 cm indicates absence of net growth.
  • Tables provide detailed information on the various RFLP and COS-II markers as indicated in the various linkage maps and as indicated for association with the QTLs of the present invention.
  • the information was directly copied in from the SOL Genomic Network (SGN) database hosted at Cornell University, version of 7 October 2005.
  • SGN SOL Genomic Network
  • TGTCTACTTTC CTTTTTAA ⁇ AGAAAGAACTTAAGGAGAGGACATACTTATTATTTTTGCA
  • LA716 380+220
  • LA925 340+220
  • LA716 1300 LA925: 1200
  • TGATAAATGCTGGGAAGATTGACTC Reverse primer ATCAACCTGGCTCCATCTTCTATTTG
  • LA716 200 LA925: 220
  • GAAATTTACGAAGGAATATTATAGACTGA ATTCCTTGGTGACAAGTATCAAGACATCTTGACCAAGTTTAAAGTTTTGTAGTGGCAGTTC
  • Reverse primer (5'-3'): ACGCTTGCGAGCCTTCTTGAGAC Temperature: 55°C Mg +2 concentration: 1.5 mM
  • LA716 1000 LA925: 1000 Digested band sizes (using AIuI)
  • LA716 550 LA925: 850
  • Lycopersicon parviflorum Gl.1601 co-localize with two qualitative powdery mildew resistance genes. MoI. plant microbe interactions 16:169-176.
  • Brassica napus using Agrobacterium vectors Plant Cell Reports 8:238-242. Myburg AA, Remington DL, O' Malley DM, Sederoff RR, Whetten RW (2001)
  • Nesbitt TC, Tanksley SD (2001) fw2.2 directly affects the size of developing tomato fruit, with secondary effects on fruit number and photosynthate distribution. Plant Physiol. 127: 575-583.
  • Nicot PC Moretti A, Romiti C, Bardin M, Caranta C, Ferriere H (2002)
  • Paterson AH ed. (1996) Genome Mapping in Plants, Academic Press Inc San Diego, CA, USA.
  • GGT Software for the display of graphical genotypes. J.
  • Van Heusden AW Van Heusden AW, Koornneef M, Voorrips RE, Bruggemann W, Pet G,

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Physiology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Cultivation Of Plants (AREA)
PCT/NL2005/000762 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis Ceased WO2006046861A2 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
BRPI0516970-4A BRPI0516970A (pt) 2004-10-25 2005-10-24 planta de tomate resistente a botrytis, método para detectar um local de traço quantitativo, local de traço quantitativo associado com resistência a botrytis em tomate, método para produzir uma planta de tomate resistente a botrytis, planta de tomate, semente de tomate, e usos de um local de traço quantitativo, e, de um marcador
KR1020077011767A KR101329485B1 (ko) 2004-10-25 2005-10-24 보트리티스에 대해 더 높은 수준의 내성을 갖는 토마토식물
ES05797992T ES2436094T3 (es) 2004-10-25 2005-10-24 Plantas de tomate que tienen niveles más elevados de resistencia a Botrytis
MX2013010797A MX349007B (es) 2004-10-25 2005-10-24 Plantas de tomate que tienen niveles mas altos de resistencia a botrytis.
JP2007538841A JP5464804B2 (ja) 2004-10-25 2005-10-24 ボトリチスに対して高レベルの耐性を有するトマト植物
CN200580044768.8A CN101087884B (zh) 2004-10-25 2005-10-24 具有更高水平的葡萄孢抗性的番茄植株
MX2007004779A MX2007004779A (es) 2004-10-25 2005-10-24 Plantas de tomate que tienen niveles mas altos de resistencia a botrytis.
KR1020137010619A KR101365296B1 (ko) 2004-10-25 2005-10-24 보트리티스에 대해 더 높은 수준의 내성을 갖는 토마토 식물
AU2005300181A AU2005300181B8 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to Botrytis
CA2584780A CA2584780C (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis
EP05797992.4A EP1812575B1 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to Botrytis
US11/738,279 US7968773B2 (en) 2004-10-25 2007-04-20 Tomato plants having higher levels of resistance to botrytis
IL182722A IL182722A (en) 2004-10-25 2007-04-22 Tomato seedlings with high levels of resistance to botrytis
US13/166,958 US8575451B2 (en) 2004-10-25 2011-06-23 Tomato plants having higher levels of resistance to Botrytis
IL217617A IL217617A (en) 2004-10-25 2012-01-18 Tomato seedlings with high levels of resistance to botrytis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04077931A EP1652930A1 (en) 2004-10-25 2004-10-25 Botrytis-resistant tomato plants
EP04077931.6 2004-10-25

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/738,279 Continuation US7968773B2 (en) 2004-10-25 2007-04-20 Tomato plants having higher levels of resistance to botrytis

Publications (2)

Publication Number Publication Date
WO2006046861A2 true WO2006046861A2 (en) 2006-05-04
WO2006046861A3 WO2006046861A3 (en) 2006-09-08

Family

ID=34928600

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2005/000762 Ceased WO2006046861A2 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis

Country Status (14)

Country Link
US (2) US7968773B2 (https=)
EP (3) EP1652930A1 (https=)
JP (1) JP5464804B2 (https=)
KR (2) KR101329485B1 (https=)
CN (1) CN101087884B (https=)
AU (1) AU2005300181B8 (https=)
BR (1) BRPI0516970A (https=)
CA (1) CA2584780C (https=)
ES (1) ES2436094T3 (https=)
IL (2) IL182722A (https=)
MA (1) MA29041B1 (https=)
MX (2) MX2007004779A (https=)
RU (1) RU2403709C2 (https=)
WO (1) WO2006046861A2 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007139386A1 (en) * 2006-06-01 2007-12-06 De Ruiter Seeds R & D B.V. Totv-resistant plants
EP1992218A1 (en) * 2007-05-18 2008-11-19 De Ruiter Seeds R&D B.V. Parthenocarpic genetic elements derived from S. habrochaites
US8093455B2 (en) 2006-04-25 2012-01-10 Monsanto Invest N.V. Tomato plants having higher levels of resistance to Botrytis
WO2012059497A1 (en) 2010-11-02 2012-05-10 Bayer Cropscience Ag N-hetarylmethyl pyrazolylcarboxamides
WO2012089757A1 (en) 2010-12-29 2012-07-05 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
US8420890B2 (en) 2006-03-28 2013-04-16 Cornell Research Foundation, Inc. Use of NAP gene to manipulate leaf senescence in plants
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
US9474222B2 (en) 2007-07-05 2016-10-25 Monsanto Invest B.V. Parthenocarpy genes in tomato
EP3257944A1 (en) 2016-06-14 2017-12-20 Nunhems B.V. Tomato plants having alterations in the dmr6 gene

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1652930A1 (en) * 2004-10-25 2006-05-03 De Ruiter Seeds R&D B.V. Botrytis-resistant tomato plants
RU2321244C1 (ru) * 2006-09-07 2008-04-10 Олег Иванович Квасенков Способ подготовки к хранению томатов свежих специального назначения
US9414553B2 (en) * 2009-06-17 2016-08-16 Monsanto Invest B.V. Tomato plants resulting from the introgression of a trait from Solanum pennellii into S. lycopersicum and having an increased yield
WO2012050962A1 (en) 2010-09-29 2012-04-19 University Of Georgia Research Foundation, Inc. Hybrid cotton plants with improved fiber quality and yield traits
US9689045B2 (en) 2011-08-30 2017-06-27 Seminis Vegetable Seeds, Inc. Methods and compositions for producing capsicum plants with powdery mildew resistance
CN102759513A (zh) * 2012-07-25 2012-10-31 山东农业大学 一种快速检测灰霉病菌对杀菌剂敏感性的方法
EP4424839A3 (en) * 2015-10-30 2025-01-08 Rijk Zwaan Zaadteelt en Zaadhandel B.V. Tomato plant producing fruits with beneficial compounds
JP2019129705A (ja) 2016-03-31 2019-08-08 日本たばこ産業株式会社 植物に物質を導入する方法
GB2637895A (en) * 2022-08-11 2025-08-13 Puregene Ag Quantitative trait locus associated with a pathogen resistance trait in Cannabis

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE398679T1 (de) 1992-07-07 2008-07-15 Japan Tobacco Inc Verfahren zur transformation einer monokotyledon pflanze
AU2002256321A1 (en) * 2001-04-25 2002-11-05 Cornell Research Foundation, Inc. Tomato plants that exhibit resistance to $i(botrytis cinerea)
US7799976B2 (en) * 2001-04-25 2010-09-21 Seminis Vegetable Seeds, Inc. Tomato plants that exhibit resistance to botrytis cinerea
EP1652930A1 (en) * 2004-10-25 2006-05-03 De Ruiter Seeds R&D B.V. Botrytis-resistant tomato plants
EP1849871A1 (en) * 2006-04-25 2007-10-31 De Ruiter Seeds R&D B.V. Tomato plants having higher levels of resistance to Botrytis

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8420890B2 (en) 2006-03-28 2013-04-16 Cornell Research Foundation, Inc. Use of NAP gene to manipulate leaf senescence in plants
US8093455B2 (en) 2006-04-25 2012-01-10 Monsanto Invest N.V. Tomato plants having higher levels of resistance to Botrytis
AU2007241626B2 (en) * 2006-04-25 2013-12-05 Monsanto Invest N.V. Tomato plants having higher levels of resistance to botrytis
AU2007241626C1 (en) * 2006-04-25 2014-06-19 Monsanto Invest N.V. Tomato plants having higher levels of resistance to botrytis
US8946506B2 (en) 2006-06-01 2015-02-03 Monsanto Invest B.V. Plants having tomato torrado virus resistance
WO2007139386A1 (en) * 2006-06-01 2007-12-06 De Ruiter Seeds R & D B.V. Totv-resistant plants
EP1992218A1 (en) * 2007-05-18 2008-11-19 De Ruiter Seeds R&D B.V. Parthenocarpic genetic elements derived from S. habrochaites
WO2008143504A3 (en) * 2007-05-18 2010-02-11 Monsanto Invest N.V. Parthenocarpic genetic elements derived from s. habrochaites
US9125353B2 (en) 2007-05-18 2015-09-08 Monsanto Invest B.V. Parthenocarpic genetic elements derived from S. habrochaites
AU2008253807B2 (en) * 2007-05-18 2014-09-18 Monsanto Invest N.V. Parthenocarpic genetic elements derived from S. habrochaites
US9474222B2 (en) 2007-07-05 2016-10-25 Monsanto Invest B.V. Parthenocarpy genes in tomato
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
WO2012059497A1 (en) 2010-11-02 2012-05-10 Bayer Cropscience Ag N-hetarylmethyl pyrazolylcarboxamides
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
WO2012089757A1 (en) 2010-12-29 2012-07-05 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
EP3257944A1 (en) 2016-06-14 2017-12-20 Nunhems B.V. Tomato plants having alterations in the dmr6 gene

Also Published As

Publication number Publication date
US20110321192A1 (en) 2011-12-29
CA2584780C (en) 2021-07-06
CN101087884B (zh) 2014-05-14
EP1812575A2 (en) 2007-08-01
JP5464804B2 (ja) 2014-04-09
BRPI0516970A (pt) 2008-09-30
WO2006046861A3 (en) 2006-09-08
IL182722A0 (en) 2007-07-24
EP1812575B1 (en) 2013-08-28
IL182722A (en) 2014-01-30
KR101329485B1 (ko) 2013-11-22
AU2005300181A1 (en) 2006-05-04
IL217617A (en) 2014-01-30
KR20130055024A (ko) 2013-05-27
EP2298068A2 (en) 2011-03-23
MX2007004779A (es) 2007-07-11
ES2436094T3 (es) 2013-12-27
RU2403709C2 (ru) 2010-11-20
AU2005300181B8 (en) 2011-08-11
US7968773B2 (en) 2011-06-28
RU2007119388A (ru) 2008-11-27
MA29041B1 (fr) 2007-11-01
MX349007B (es) 2017-07-06
EP1652930A1 (en) 2006-05-03
US8575451B2 (en) 2013-11-05
CN101087884A (zh) 2007-12-12
AU2005300181A8 (en) 2011-08-11
KR20070084532A (ko) 2007-08-24
EP2298068A3 (en) 2011-06-15
AU2005300181B2 (en) 2011-07-28
US20070300314A1 (en) 2007-12-27
CA2584780A1 (en) 2006-05-04
KR101365296B1 (ko) 2014-02-19
JP2008517621A (ja) 2008-05-29

Similar Documents

Publication Publication Date Title
US7968773B2 (en) Tomato plants having higher levels of resistance to botrytis
AU2008253807B2 (en) Parthenocarpic genetic elements derived from S. habrochaites
US8093455B2 (en) Tomato plants having higher levels of resistance to Botrytis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV LY MD MG MK MN MW MX MZ NA NG NO NZ OM PG PH PL PT RO RU SC SD SG SK SL SM SY TJ TM TN TR TT TZ UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SZ TZ UG ZM ZW AM AZ BY KG MD RU TJ TM AT BE BG CH CY DE DK EE ES FI FR GB GR HU IE IS IT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2005300181

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 554558

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2584780

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/a/2007/004779

Country of ref document: MX

Ref document number: 11738279

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 182722

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 200750029

Country of ref document: ES

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2007538841

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2005300181

Country of ref document: AU

Date of ref document: 20051024

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020077011767

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2007119388

Country of ref document: RU

Ref document number: 2005797992

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200580044768.8

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005797992

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 11738279

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0516970

Country of ref document: BR

WWR Wipo information: refused in national office

Ref document number: 200750029

Country of ref document: ES

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 217617

Country of ref document: IL

Ref document number: 217615

Country of ref document: IL

Ref document number: 217616

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020137010619

Country of ref document: KR