WO2006046152A2 - Methods for heterologous expression of secondary metabolites - Google Patents
Methods for heterologous expression of secondary metabolites Download PDFInfo
- Publication number
- WO2006046152A2 WO2006046152A2 PCT/IB2005/003650 IB2005003650W WO2006046152A2 WO 2006046152 A2 WO2006046152 A2 WO 2006046152A2 IB 2005003650 W IB2005003650 W IB 2005003650W WO 2006046152 A2 WO2006046152 A2 WO 2006046152A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- host cell
- genes
- gene
- biosynthetic pathway
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/14—Nitrogen or oxygen as hetero atom and at least one other diverse hetero ring atom in the same ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
Definitions
- the invention relates to methods for heterologous expression of secondary metabolites.
- DNA mutagenesis can theoretically alter every bond in a secondary metabolite. Therefore DNA mutagenesis presents exceptional promise for the alteration of existing, and the creation of new, secondary metabolites for drug optimization and discovery.
- DNA mutagenesis technology which is highly developed for E.coli, is poorly developed for the diverse hosts of relevance to secondary metabolite production.
- current in situ host-by-host approaches for mutagenesis of secondary metabolite pathways are limited to individual mutagenesis that is often labour intensive.
- other heterologous hosts have been investigated. E.
- Kealey et al. ('Production of a polyketide natural product in nonpolyketide-producing prokaryotic and eukaryotic hosts', PNAS USA, (1998), 95:505-509), describes the production of the fungal polyketide 6-methylsalicylic acid (6-MSA) in heterologous E. coli, yeast and plant cells.
- 6-MSA 6-methylsalicylic acid
- Pfeifer et al. ('Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli', Science (2001) 291 : 1790-1792) describes the genetic engineering of a derivative of E.
- E. coli in which the resulting cellular catalyst converts exogenous propionate into the polyketide erythromycin (6-deoxyerythronolide B).
- the use of E. coli for engineering coupled with Streptomyces as the expression host has been described by scientists at the John Innes Institute in Norwich in Gust et al., ('PC R- targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin.' PNAS USA (2003) 100:1541- 1546).
- E. coli lacks at least two activities required for most polyketide and non-ribosomal peptide (NRP) pathways. Whereas these activities can be introduced into E. coli, these engineered hosts produce only small amounts of the intended secondary metabolite.
- E. coli has a low GC genomic content, unlike the genomes of Actinomycetes and Myxobacteria, the major secondary metabolite producing hosts, which both have a high GC content. Thus, codon usage is not optimised in E. coli when a gene from these organisms is expressed.
- the invention provides a method for the heterologous production of a secondary metabolite encoded by a biosynthetic pathway, comprising: i) generating in a first host cell, a single vector comprising the component genes of the biosynthetic pathway; ii) transforming a second host cell with the vector; and iii) culturing the second host cell under conditions which are suitable for synthesis of the secondary metabolite; wherein the genes of the biosynthetic pathway are transcribed under the control of promoters that are found naturally in the second host cell.
- the method of the invention allows, for the first time, the expression of complex metabolic pathways within host systems that are compatible with and able to support both the expression and activity of the proteins that form part of such pathways.
- This method combines the simplicity of genetic manipulation in a first host cell, used for cloning purposes, with the properties of a second host cell that is more suitable for the expression and screening of secondary metabolites.
- This methodology allows the experience and technology acquired over many years of working with cloning hosts, such as E. coli and Salmonella, to be exploited, whilst utilising the much greater capacity of other, less well understood species as expression vehicles for generation of complex secondary metabolites.
- the secondary metabolite expressed in the method of the invention may be known or unknown, but in most cases the invention will be utilised in the pursuit of novel, bioactive compounds.
- the secondary metabolite is preferably bioactive, and thus has useful biological properties.
- the secondary metabolite may advantageously have antibiotic or cytotoxic properties.
- Such compounds may be synthesised by a biosynthetic pathway encoded by a single gene or a biosynthetic pathway encoded by more than one gene.
- the biosynthetic pathway is encoded by more than one gene.
- the vector used in the methodology of the invention may comprise two, three, four, five or more of the genes of the biosynthetic pathway. If not all of the genes of the biosynthetic pathway are contained on the vector, the other genes required for activity of the pathway may be provided either on one or more additional vectors or may be integrated onto the chromosome of the second host cell, either naturally, or through directed chromosomal integration. Preferably, all the genes of the biosynthetic pathway that are not already present in the second host cell are encoded on a single vector.
- all of the genes of a particular biosynthetic pathway are encoded on a single vector.
- the establishment of a secondary metabolite pathway on a single DNA molecule is not only relevant for pathways that exist naturally as single contiguous clusters, but also for pathways that exist in more than one part, often in distinct regions of the genome.
- the parts can be cloned together into one molecule to simplify handling.
- the presence of all the enzymes on one single vector enables the second host cell to be transformed so as to contain the pathway in one single step.
- prior art methods for example in which E. coli has been modified to contain the genes for epothilone or erythromycin synthesis, have utilised several plasmids to transform the genes into E.
- the biosynthetic pathway is encoded by more than one gene
- the presence of all the genes on a single vector enables the various enzymes of the biosynthetic pathway to be expressed at an equivalent stoichiometric ratio of 1 :1.
- the expression of the genes is generally equivalent, governed by the principal of co-linearity, and is not influenced by the potentially different copy number of different vectors carrying different parts of the gene cluster.
- suitable vectors will be known to those of skill in the art, and may be selected rationally to suit the requirements of any particular system, taking into account information known about the length of sequence to be cloned, the type of second host system to be used, and so on. Of particular suitability will be episomal and virus-derived systems derived from: bacterial plasmids, bacteriophage, cosmids and phagemids, and bacterial artificial chromosomes (BACs). BACs in particular may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid.
- the component genes of the biosynthetic pathway may be comprised within a transposable element ("transposon") carried by the vector.
- transposable elements The movement of transposable elements was described by Barbara McClintock in the 1940s and 1950s during her discovery of transposition in maize (Comfort NC. 2001. "From controlling elements to transposons: Barbara McClintock and the Nobel Prize", Trends Biochem. ScL 26:454-57). Transposons are ubiquitous and they are present in nearly all organisms from prokaryotes to eukaryotes, including humans (Berg, D.E. and Howe, M.M., 1989, "Mobile DNA ", Washington, DC: ASM Press; Craig N.L.
- transposase randomly integrates the transposon into the chromosome.
- Transposition technology is widely used nowadays. Its applications include in vitro transposition mutagenesis for DNA sequencing, in vivo insertional mutagenesis for functional gene studying and gene transfer.
- Gene transfer by using the Sleeping Beauty Transposon has been used in gene therapy (Ohlfest JR et al., "Combinatorial Antiangiogenic Gene Therapy by Nonviral Gene Transfer Using the Sleeping Beauty Transposon Causes Tumor Regression and Improves Survival in Mice Bearing Intracranial Human Glioblastoma", MoI Ther. 2005 Sep 5; [Epub ahead of print]) and its size limit has been studied in a mouse cell line (Karsi A.
- transposable elements (86kb) were successfully used for in vitro mutagenesis mediated by Tn5 transposase (Joydeep B. et al., 2005, "Rapid creation of BAC-based human artificial chromosome vectors by transposition with synthetic alpha-satellite arrays" Nucleic Acids Research. 33(2):587-596).
- Tn5 transposase Large sized transposable elements (86kb) were successfully used for in vitro mutagenesis mediated by Tn5 transposase (Joydeep B. et al., 2005, "Rapid creation of BAC-based human artificial chromosome vectors by transposition with synthetic alpha-satellite arrays" Nucleic Acids Research. 33(2):587-596).
- transposon to introduce large sized DNA molecules (also described herein as large sized DNA "fragments”) into a heterologous host. Transferring and integration of large sized DNA molecules into the chromosome in many
- the invention also provides the use of a transposable element to introduce one or more large sized DNA molecules into the chromosome of a heterologous host.
- This aspect of the invention thus provides a method for introducing a large sized DNA molecule into the chromosome of a heterologous host using a transposable element.
- the large sized DNA molecule is introduced into the chromosome within a transposable element carried by a vector.
- the large sized DNA molecule is flanked by transposon sequences that are recognized by a transposase enzyme.
- the large sized DNA molecule or molecules provide one or more component genes of a biosynthetic pathway for synthesising a secondary metabolite, as described herein.
- the whole biosynthetic gene cluster is integrated into the transposable element.
- the vector is a BAC.
- a second host cell may be transformed with the vector comprising large sized DNA molecule flanked by the transposon sequences recognised by the transposase using any suitable method, for example, by conjugation or electroporation.
- Particularly preferred transposons for use in the invention belong to the mariner family of transposable elements.
- the mariner family of transposable elements is named for the original element discovered in D. mauritiana (Berg, D.E. and Howe, M.M., 1989, "Mobile DNA ", Washington, DC: ASM Press).
- the most preferred transposon for transferring large sized DNA molecules is the MycoMar transposable element, which is a mariner transposon (Rubin, E. et al., 1999, "In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria", Proc. Natl. Acad. Sci. USA., 96:1645-1650).
- large sized DNA molecule a DNA molecule of more than 20kb in length, for example 30-150 kb in length, 40- 100kb in length, 50-80 kb in length, and so on.
- Large sized DNA molecules are preferably introduced into the transposon (for example, into the MycoMar transposable element) using recombineering (also known as "Red/ET recombination technology”), as described below. Red/ET recombination technology is an ideal tool for large size DNA engineering.
- a suitable transposase is preferably also transformed into the second host cell.
- the MycoMar transposable element is used, the MycoMar transposase gene is also preferably transformed into the second host cell.
- the transposase is under the control of a promoter that is not active in the first host, but is active in the second host. Expression of the transposase after the vector enters the second host cell integrates the transposable element into the chromosome.
- the vector comprising the transposon also comprises the transposase gene.
- the transposase gene is preferably cloned outside of the transposable element flanked by the inverted repeats.
- the transposase gene itself is present in the non-replicatable vector backbone, its expression is lost after the initial phase of expression in the second host.
- the secondary metabolite is generated by a polyketide pathway, a non-ribosomal peptide (NRP) pathway or a fatty acid pathway or is synthesised by a pathway which combines enzymes from two or more of the pathways encoding these secondary metabolites, for example a hybrid polyketide-NRP.
- NTP non-ribosomal peptide
- this pathway is preferably a type I polyketide pathway.
- the polyketide may be any other type of polyketide, for example a type II or a type III polyketide, such as flaviolin.
- An example of a secondary metabolite generated by a hybrid polyketide-NRP pathway is myxochromide.
- the myxochromide gene cluster is a preferred example of a biosynthetic pathway that can be exploited according to the present invention.
- the biosynthetic pathway is not endogenous to the second host cell.
- the pathway itself, in the form contained on the vector is not naturally known in the second host cell, or that one or more of the genes that make up the pathway is not known in the second host cell.
- the secondary metabolite is not naturally produced in the second host cell.
- the method of the invention allows the study of pathways that are completely unknown in either of the host cell systems that are used.
- the genes of the biosynthetic pathway are transcribed under the control of promoters that are found naturally in the second host cell. This is an important element of the methodology of the invention, for it allows the transcription machinery of the second host cell to recognise its own promoters and thus transcribe the genes implicated in the metabolic pathway under study.
- first host cell in which genetic manipulation is simple allows the alteration of the promoters in the second cell, without undue difficulty.
- Standard tools may be used for this manipulation, including PCR.
- recombineering methodologies are used to alter the promoters, as necessary (see International patent applications WO99/29837 and WO02/062988; European patent applications 01117529.6 and 0103276.2; United States patents 6,509,156 and 6,355,412; and also Muyrers, J.P.P. et al., 2000 ( ⁇ T-Cloning: Think Recombination First', Genetic Eng., vol.
- One or more of the genes in the biosynthetic pathway may be cloned under the control of an inducible promoter. This will be particularly advantageous where the secondary metabolite is toxic to the second host cell, since it will mean that the pathway can be established in the host while quantities of the host are grown up unaffected by the potential toxicity of the secondary metabolite.
- an inducible promoter to govern expression of one or more of the genes necessary for production of the secondary metabolite allows the cells to grow to a high cell density before the inducing agent is added, and expression of a high level of the secondary metabolite is only induced at that point. If the metabolite is toxic, the cells will die, but while dying will still produce a sufficient quantity of secondary metabolite for further analysis or purification.
- Preferred inducible promoters will be those which are induced by small molecules.
- suitable systems include the toluic acid inducible Pm promoter in Pseudomonas species described by Abril M.A et al., 1989 (Regulator and enzyme specificities of the TOL plasmid-encoded upper pathway for degradation of aromatic hydrocarbons and expansion of the substrate range of the pathway, J. Bacterid., 171 :6782), which is an example of a preferred inducible promoter.
- cell death may be used as an indication that the secondary metabolite is bioactive.
- the inducible promoter will be one that can be regulated with small ligands so that potential toxic effects of the expressed secondary metabolite can be managed with ease.
- Standard prior art DNA cloning methodologies can in principal produce DNA clones that are large enough to carry known secondary metabolite pathways. However, such cloning methodologies are random processes with no control maintained over the end points of the segment found in any one clone. As a result, large segments of randomly cloned DNA usually omit, at one end or the other, essential parts of the gene clusters in question, and/or include flanking sequences encoding irrelevant genes that could provoke undesired complications.
- the method of the present invention preferably exploits recombineering methodologies, which allow large stretches of DNA encoding the gene or genes encoding the enzymes of the biosynthetic pathway to be cloned effectively into one vector.
- Recombineering enables stretches of DNA of various sizes to be cloned into vectors, ranging from very short genes up to many kilobases, potentially encompassing gene clusters of more than 20 kb, for example 30- 150 kb in length, 40-100kb in length, 50-80 kb in length, and so on, to be engineered and expressed in a system that allows their subsequent manipulation and analysis.
- the method devised by the inventors involves the use of recombineering to clone the genes encoding the enzymes of the biosynthetic pathway, preferably onto a single vector.
- the vector is constructed in the first host cell using recombineering (see above).
- Recombineering is a method of cloning DNA which does not require in vitro treatments with restriction enzymes or DNA ligases and is therefore fundamentally distinct from the standard methodologies of DNA cloning. The method relies on a pathway of homologous recombination in E.
- recE encodedonuclease
- recT phage annealing protein
- the use of the recombineering methodology carries with it the dual advantages of enabling both small and large DNA molecules to be engineered and also enabling other more subtle genetic manipulations, such as insertions, deletions and point mutations, to be performed in a restriction enzyme-independent fashion. This facility is of great significance when manipulating large stretches of nucleic acid, when restriction analysis becomes unfeasible.
- One such advantage of recombineering is the ability to allow promoters to be manipulated at will.
- Another advantage comes from the realisation that in many cases, random starting clones will be engineered to create single clones that are optimized for the specific goal of screening for secondary metabolites of interest.
- conventional cloning methodologies require the sequence of the cloned material to be known, so that strategies can be designed to manipulate the genes of interest, recombineering does not require this and allows large stretches of nucleic acid of unknown sequence to be cloned and manipulated at will.
- a further advantage of recombineering methods is that the recombined vector can be integrated into the genome of the second host cell, giving rise to transformed strains of this host with a stable insertion of the genes of desired biosynthetic pathway.
- the first host cell is preferably a host cell that allows the generation and maintenance of a vector for use in the method of the present invention.
- the first host cell is preferably a host cell for which genetic engineering techniques are well known in the art.
- the first host cell is one in which recombineering methodologies may be effected, so as to allow manipulation of large stretches of nucleic acid of unknown sequence, as well as to perform more subtle, but equally necessary refinements such as promoter replacement.
- the first host cell is also preferably a host cell that is able to conjugate efficiently with the second host cell.
- E. coli is a preferred first host cell.
- other suitable first host cells include other gram negative bacteria, particularly those that are well studied such as Pseudomonads and Salmonella species. Methods for genetic engineering of E. coli and Salmonella are described in full in known laboratory manuals such as that by Sambrook et al, Molecular Cloning; A Laboratory Manual, Third Edition (2001).
- the second host cell is a cell which normally expresses secondary metabolites of the type in which there is an interest, particularly secondary metabolites of the class that is being expressed (i.e. generated by NRP pathways, type I polyketides pathways etc.).
- An appropriate choice of the second host cell will ensure that this host is well adapted for expression of the secondary metabolite.
- the second host cell may be a cell which does not naturally express the precise secondary metabolite of interest. Certain host cells do not naturally express one or more of the substrates that are required for biosynthesis of certain classes of secondary metabolite.
- type I polyketide synthases catalyze the successive condensation of carboxylic acid residues from their substrates such as malonyl-CoA and methylmalonyl-CoA.
- Malonyl-CoA is a substrate for primary metabolism pathway and is present in all bacteria.
- methylmalonyl-CoA (a second common precursor of polyketides) is not naturally produced in a wide range of bacterial strains.
- a heterologous host for all kinds of polyketide gene cluster expression should synthesize methylmalonyl-CoA.
- the second host cell is preferably transformed with genes encoding the enzymes required for making substrates that are required to synthesise the secondary metabolite but which are not naturally expressed in the wild-type second host cell.
- the genes are integrated into the chromosome of the second host cell.
- a substrate which is not normally expressed in the second host cell may be induced to be expressed in the second host cell by replacement of the endogenous promoter governing expression of the appropriate gene with an appropriate constitutive or inducible promoter, and/or by culturing it under specific conditions.
- suitable second host cells are Pseudomonas, Actinomycetes (for example, a Streptomyces), and Myxobacteria.
- the second host is a Pseudomonas or a Myxobacterium.
- the second host cell is a Pseudomonas.
- the inventors have established that the use of Pseudomonas as the host in which to synthesise the secondary metabolite is advantageous for a number of reasons. Principal among these is that, unlike most secondary metabolite producing hosts, Pseudomonas and Myxobacteria grow easily and rapidly in culture and their use is scalable for industrial production. Furthermore, Pseudomonas species are genetically more similar to Actinomycetes and Myxobacteria, the major secondary metabolite producing hosts, than hosts such as E. coli, that have proven ineffective for production of such compounds. For example, Actinomycetes and Myxobacteria both have a high GC genomic content, as does
- Pseudomonas whereas E. coli has a low GC genomic content. This results in codon usage being more efficient in Pseudomonas than in E. coli since Pseudomonas has an endogenous codon usage profile that is very similar to that of both Myxobacteria and Actinomycetes. The codon usage profile of these species is very different to that of E. coli.
- Pseudomonas putida P. stutzeri and P. syringae are particularly preferred host cells for expression of the genes of the biosynthetic pathway. These host cells have been found to grow fast, facilitating culture on both a laboratory and industrial scale. Furthermore, Pseudomonas putida has, in particular, surprisingly been found to generate very high protein levels, when tested by the inventors. This clearly reinforces its suitability for use in the present invention, as the quantities of cell culture that need to be prepared are reduced by to as little as a third of what would be required using alternative systems.
- Pseudomonas can grow on valine as the sole carbon source. Under these conditions Pseudomonas may produce methylmalonyl CoA, one of the substrates required for polyketide synthesis. In the presence of other carbon sources methylmalonyl CoA expression could be induced by the replacement of the endogenous promoter governing expression of the appropriate gene with an appropriate constitutive or inducible promoter. It is preferable, according to the invention, to transform the Pseudomonas with the genes encoding the enzymes required to synthesise methylmalonyl CoA.
- Pseudomonas As a second host cell in the context of the invention is that this bacterium is capable of producing heterologous secondary metabolites from particular complex gene clusters that require the activity of phosphopantetheinyl (Ppant) -dependent carrier proteins. These must be made functionally active by transfer of the 4'-Ppant moiety from coenzyme A in order for polyketide synthases and non- ribosomal peptide synthases to function. This step is catalyzed by an enzyme called P-pant transferase.
- the apo form of polyketide synthase enzymes is synthesized from their gene clusters and is converted to the holo form by adding a phosphopantetheinyl (P-pant) moiety to a serine residue of the acyl or peptidyl carrier protein (ACP or PCP) domains.
- P-pant transferase is not produced in a wide range of bacterial strains and so it may be necessary to transform the second host that is used in a method of the invention with a gene encoding a P-pant transferase.
- dedicated host Ppant transferases have been used to catalyse reactions of this type.
- the inventors have discovered that P. putida, P.
- Pseudomonas species are able to activate heterologous PCPs and ACPs with CoA using endogenous Ppant transferase activity. This quality makes Pseudomonads particularly suitable second hosts for the expression of polyketide biosynthetic pathways.
- Pseudomonas can be readily transformed with DNA using physical methods such as calcium phosphate transformation and electroporation. It also has excellent endogenous properties for homologous recombination, which enables efficient integration into the endogenous genome for stable maintenance of introduced DNA molecules.
- Pseudomonas is known to conjugate efficiently with E. coli, so this facilitates transfer of the vector prepared in E. coli to the second host for production.
- the vector transmitted between the species should preferably include an appropriate origin of conjugation for Pseudmonas, such as oriT (Simon et al., 1983, Bio. Technol., 1, 784).
- the vector should also contain an origin of replication for maintenance in the first host cell.
- the preferred origin of replication is oriS (Birren et al., 1997, in Genome Analysis, a laboratory manual, Cold Spring Habour, VoI 3) in order to give rise to a single copy vector, which increases plasmid stability.
- the second host cell should be cultured under conditions which are suitable for synthesis of the secondary metabolite. Suitable conditions for growth of the host cell will be known to those of skill in the art.
- an inducible promoter is used in one or more of the genes that form part of the biosynthetic pathway under study; in these systems, the inducing agent will preferably be added once the host cells have attained a high cell density. This will minimise cell death during earlier stages of growth as a result of potential toxicity of the secondary metabolite produced.
- the invention thus incorporates a test for determining whether a secondary metabolite that is toxic for a heterologous host cell is bioactive, by gauging the effect of induction of the complete biosynthetic pathway on the growth of the host cells in which this is taking place.
- the methodology of the invention may be performed iteratively, with successive rounds of screening and selection in order to allow the molecular evolution of one or more of the genes that participates in the pathway toward a desired function. Indeed, an entire pathway can be evolved in this fashion.
- the genes encoding the enzymes of the biosynthetic pathway may optionally be further genetically engineered. Mutagenesis of the genes encoding the enzymes is an advantageous way to alter the chemical product because the structure of the secondary metabolite is directed by the specificity of the enzymes of the biosynthetic pathway.
- genetic engineering of the secondary metabolite preferably alters the biological properties of the secondary metabolite itself, for example, by altering the structure of the molecule generated by the biosynthetic pathway.
- genetic engineering may enable an increase in the half-life of the secondary metabolite or may increase its specific activity.
- genetic engineering may for example decrease the IC50 of the antibiotic when compared to the ICsoof the antibiotic synthesised by wild-type enzymes.
- genetic manipulation may confer a new biological property on the secondary metabolite and/or may delete an existing property. Genetic manipulation of this type may be carried out by shuttling a vector selected in the second host cell back into the first host cell, or may be carried out directly in the second host cell or in a further host cell.
- Pseudomonas as the second host cell presents options for in situ engineering of pathways after introduction. It is considered possible that in the event that our knowledge of Pseudomonas species is extended, host cells of this type might also be utilised as the first host cell species in the context of the invention described herein.
- the genetic engineering of one or more genes in the biosynthetic pathway may involve any suitable type of mutagenesis, for example, substitution, deletion or insertion mutagenesis. If the sequence encoding the one or more genes contains redundant, irrelevant and potentially undesirable sequences, genetic engineering can be carried out to remove these sequences from the vector. Mutagenesis may be carried out by any suitable technique known in the art, for example, by site-directed mutagenesis or by transposon-mediated mutagenesis, as the skilled reader will appreciate. Site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and so forth. Recombineering may also be used where appropriate.
- the second host cell may be cultured under any suitable conditions, as will be understood by those of skill in the art. However, it is preferred that the second host cell is cultured between 10°C and 2O 0 C, for example between 13°C and 18°C. In a particularly preferred embodiment, the second host cell is cultured at 16°C. These culture conditions are particularly preferred when Pseudomonas is used as the second host cell. Even more preferably, the second host cell grown at 16°C is P. putida.
- Figure 1 shows a schematic representation of the generation of pZero-oriT-tet and a restriction digest thereof
- Figure 2 shows the PCR product of the trpE gene from Pseudomonas together with a schematic representation of the generation of the pZero-oriT-tet-trpE cassette and a restriction digest thereof;
- Figure 3 shows a schematic representation of the generation of a subclone of the oriT-tet-trpE cassette in pl5A and a restriction digest thereof
- Figure 4 shows a restriction digest of pl5A-oriT-tet-trpE together with a schematic representation of insertion of the oriT-tet-trpE conjugation cassette into cosmids containing the myxochromide gene cluster and a restriction digest thereof;
- Figure 5 shows the PCR product of the zeocin resistance gene together with a schematic representation of the generation of pMch23 and a restriction digest thereof
- Figure 6 shows a restriction digest of pMch23 together with a schematic representation of the generation of CMch36 and a restriction digest thereof;
- Figure 7 shows a schematic representation of the construction of a Pm inducible promoter cassette and a restriction digest thereof
- Figure 8 shows the PCR product of the Pm promoter together with a schematic representation of the insertion of the Pm promoter into the myxochromide S gene cluster and a restriction digest thereof;
- FIG. 9 a Maps of cosmid E 196 and the Red/ET recombinant cosmid CMch34, CMch36 and CMch37 with virtual PvuU restriction, indicated by dotted lines, b, Restriction analysis of cosmid E196 and the RED/ET recombinant cosmid CMch34, CMch36 and CMch37 with the indicated restriction enzymes including PvwII;
- Figure 10 shows a gel analysis of the presence of the Myxochromide S gene cluster in transformants
- Figure 11 shows a TLC showing the detection of Myxochromide S production from the mutant P. putida/CMch37;
- Figure 12 a Structures of myxochromides Si -3 (1-3) produced by the myxobacterium S. aurantiaca DW4/3-1.
- b HPLC profiles from extracts of the P. putida/CMch.37 mutant strain in comparison to P. putida wild type and the natural myxochromide S producer S. aurantiaca DW4/3-1 (diode array detection at 200-400nm).
- Figure 14 shows the UV-spectrum of peak number 23 of Figure 13, lower trace (P. putida + pFG 154 extract);
- Figure 15 shows the positive (+1) and negative (-1) MS spectrum of peak 23, expected mass of flaviolin is 206;
- Figure 16 shows the final pl5A-sacB-neo-mutase-lacZ-zeo construct for methylmalonyl-CoA production in Pseudomonads;
- Figure 17 shows PCR checking results for the integration of methylmalonyl-CoA generation cassette into P, putida.
- the upper panels show the chromosomal region of the P. putida strains harboring the integrated D ⁇ A-fragment after double-cross-over event.
- the letters indicate the primer pairs used for verification in colony-PCR (The schematic diagram in the upper panel is not drawn to scale).
- the lower panels show the pictures of agarose gels with the amplification products of the corresponding primer pairs;
- Figure 18A shows the calibration curve of methylmalonate. The amount ratio is shown on the x axis and the response ratio is shown on the y axis. All calibration samples contained 10 nmol of internal standard methyl-d3-malonate. The methylmalonate quantities were 1, 2, 5, 10, 20 and 50 nmol. Each point was measured in triplicate and the data points represent an average of the results.
- Figure 18B shows the methylmalonate content (a) and OD ⁇ oo (b). The methylmalonate content was calculated from the nmol quantity found in the extract and the OD ⁇ ooat the given time point;
- Figure 19 shows the construction of the myxothiazol gene cluster for expression in P. putida.
- Fig. 19A diagram of strategy for stitching of mta gene cluster.
- Fig. 19B restriction result of gene cluster before and after stitching.
- Fig. 19C final mta construct for P .putida integration;
- Figure 20 shows the detection of the myxothiazol in the P. putida extracts: a) standard reference myxothiazol A; b) extract of f. putida FG2005; peak corresponds to the mass peak of authentic myxothiazol.
- Figure 2011 shows the mass fragmentation in the reference substance (a) and in P. putida FG2005 extract (b);
- Figure 21 shows the sequence of operon from So ce56;
- Figure 22 shows the best 20 Hits from a search of the database with BLASTP with methylmalonyl-CoA mutase of Sorangium cellulosum So ce56 as input and alignment of top 2 scores with the query sequence
- Figure 23 shows the best 20 Hits from a search of the database with BLASTP with methylmalonyl-CoA epimerase of Sorangium cellulosum So ce56 as input and alignment of top 3 scores with the query sequence;
- Figure 24 shows the best 20 Hits from a search of the database with BLASTP with MeaB of Sorangium cellulosum So ce56 as input and the alignment of the top 2 scores with the query sequence;
- Figure 25 shows the MycoMar transposase DNA and protein sequences and its inverted repeat sequences
- Figure 26 is a diagram of myxochromide S gene cluster engineering.
- Fig. 26A shows the insertion of MycoMar transposase gene plus right IR into mchS expression plasmid and
- Fig. 26B shows the integration of the left IR plus Tn5-neo gene in front of the mchS gene cluster;
- Figure 27A shows the detection of myxochromide S compounds in M. xanthus.
- Figure 27B shows the detection of myxochromide compounds in TCL;
- Figure 28A shows HPLC peaks obtained from analysis of a methanol extract from an M. xanthus OK. ⁇ 622:mchS mutant strain for the production of myxochromides S.
- Figure 28B shows the UV spectra from each of peaks 1-7 of the HPLC chart resulting from the characteristic myxochromide chromophores.
- Table 1 shows MALDI /TOF results summary of the Pseudomonads PPant transferase activity evaluation.
- Table 2 shows the number of transformants obtained using transposon-mediated integration compared to the number obtained using homologous integration.
- oriT is the sequence used for conjugation between bacterial species.
- TetR is a tetracyline regulon and consists of the tet regulator and the tet resistant gene.
- the oriT-tetR fragment was inserted into the pZeo2.1 vector (Invitrogen) by recombineering ( Figure 1).
- the trpE gene from Pseudomonas was inserted into the oriT- tetR cassette using recombineering ( Figure 2).
- the trpE gene is in this instance used as homology for homologous recombination in Pseudomonas. Homology arms for recombineering the oriT- tetR-trpE cassette into the pSuperCos (Stratagene) vector backbone were added in one recombineering step by subcloning into a pl5A ori plasmid ( Figure 3). The oriT-tetR-trpE cassette was then inserted into the vector backbone part of pSuperCos-Myxochromide by recombineering (Figure 4). B. Reconstruction of the complete myxochromide pathway.
- the myxochromide S biosynthetic gene cluster has been cloned and sequenced.
- the original cosmid El 96 does not contain the full-length pathway because it is missing the thioesterase (TE) domain of the second NRPS.
- the original cosmid El 96 was modified sequentially by recombineering using Red/ET recombination.
- the backbone of cosmid El 96 was modified by single step insertion of the origin of transfer (oriT) for conjugation purposes, the tetracycline resistance gene for selection in P. pudita and a DNA fragment from the chromosome of P.
- oriT origin of transfer
- zeocin resistance gene (zeoR) was amplified by PCR reaction and inserted into pSWMch2 by recombineering resulting in plasmid pMch23 ( Figure 5). Then, a 3.5 kb Stul/Ndel fragment from pMch23 containing the TE-zeoR cassette was recombined with CMch34 to create CMch36 ( Figure 6).
- zeoR zeocin resistance gene
- CMch37 contains only the three genes from the myxochromides S pathway (one PKS and two NRPSs) with the Pm-promoter placed in front of the PKS ( Figure 8).
- the MS data from extracts indicate the presence of the corresponding compounds lacking the threonine N- methyl group and thus representing new myxochromide S derivatives.
- Myxochromides were only detected in the cells and not in the fermentation medium, indicating that P. pudita is not able to export these secondary metabolites out of the cell.
- a kinetic of myxochromide S production in P. pudita/CMch37 mutants reveals that the production maximum was reached after 2-3 days, which surpasses the 6 days required for S. aurantiaca to reach maximum production.
- Pseudomonas is able to express Type III PKS
- the purified carrier protein was analysed using MALDI/TOF for a mass increase of 340 mass units expected to be the phosphopantetheine moiety. From the carrier proteins tested, six could be purified from Pseudomonas putida, which was chosen as the general host. Out of the six domains five were completely activated, whereas of the sixth domain only 5% of the protein was in the holo-form. Four domains were also expressed in the other alternative hosts. The MALDI/TOF analysis results are shown in Table 1.
- methylmalonyl-CoA epimerase epi, sce_20050509_2546
- methylmalonyl-CoA mutase mem, sce_20050509_2547
- meaB sce_20050509_2548
- the open reading frame of the predicted methylmalonyl-CoA mutase is 2649 nucleotides long.
- the blast results and alignments of Figure 22 show that the deduced protein (882 amino acids) shows highest homologies to the methylmalonyl-CoA mutases of Chloroflexus aurantiacus (ZP 00358667; identities: 460/670 (68%), positives: 537/670 (80%)) and Leptospira interrogans serovar Copenhageni str.
- Fiocruz Ll-130 (YP 003598; identities: 460/677 (67%), positives: 539/677 (79%)).
- the predicted methylmalonyl-CoA epimerase is 519 nucleotides long.
- the blast results and alignments of Figure 23 show that the deduced protein (172 amino acids) shows highest homologies to predicted glyoxylases/bleomycin resistance genes (lactoylglutathione (LGSH) lyases family) from Solibacter usitatus Ellin6076 (ZP 00519667; identities: 98/149 (65%), positives: 125/149 (83%)) and Nocardioides sp.
- LGSH lactoylglutathione
- JS614 (ZP_00656876; identities: 58/151 (38%), positives: 87/151 (57%)) and then to a predicted methylmalonyl-CoA epimerase from Geobacter sulfurreducens PCA (NP_954343; identities 59/139 (42%), positives: 83/139 (59%)).
- the open reading frame of meaB is 993 nucleotides long.
- the blast results and alignments of Figure 24 show that the deduced protein (330 amino acids) shows highest homologies to argK (lysine/arginine/ornithine (LAO) transport protein family) from Solibacter usitatus Ellin6076 (ZP_00519926; identities: 183/298 (61%), positives: 218/298 (73%)).
- the operon-containing BAC clone generated from genomic DNA of So ce56 was used for downstream experiments.
- the final integration cassette in a pl5A origin based plasmid is shown in Figure 16. After subcloning the operon into a pl5A origin based plasmid, sacB-neo, a counter-selection cassette, was placed in front of the epimerase gene to drive the operon expression and lacZ-zeo was placed at the end of operon (end of meaB gene) for reporting the Tn5 promoter which drives 6 genes.
- putida were cloned at both ends of sacB-neo-epi-mut-meaB-lacZ-zeo for homologous integration into Pseudomonas putida.
- the final construct was called pl5A-sacB-neo-mutase-lacZ-zeo.
- a ribosomal binding site was placed in between each of the Tn5-neo and epimerase genes, the meaB and lacZ genes, and the lacZ and zeocin resistant genes. All of the steps were done by using Red/ET recombination.
- the expression plasmid pl5A-sacB-neo-mutase-lacZ-zeo was transformed into P. putida by electroporation and kanamycin resistant clones were selected.
- the electrocompetent cells were prepared as follows: 1.4 ml LB medium in a 1.5 ml reaction tube were inoculated with 30 ⁇ l of a saturated overnight culture of P. putida KT2440 and incubated for 2 hours at 28 0 C with shaking. The cells were washed twice with ice cold water and resuspended after the last washing step after pouring off the water in the remaining liquid.
- primers were used for colony-PCR reaction.
- the primers used for panel A PCR reaction were 5'- GGACC AG ATGAAGATCGGTA-3' and 5'-TGTTCATCGTTCATGTCTCC-S' ;
- Primers used for panel B PCR reaction were 5'-CGACTTCCAGTTCAACATCA-S ' and 5'- GATTCGAGCAGGTACGAGTT-3';
- Primers used for panel C PCR reaction were 5'- GCTTCGCCCACGTCGCCTACC-3' and 5'-CGACGATGCCGCGGAGGAGGTT-S' ;
- Primers used for panel D PCR reaction were 5'-CGAGACGGGCGAGGGGAACC-S' and 5'- CGTCTTGTCGCCGAGGATGCT-3'.
- Samples were measured on an Agilent 6890N gas chromatograph equipped with a 5973N mass selective detector and a 7683B automatic liquid sampler.
- the stationary phase was a HP-5ms capillary column (0.25 mm x 30 m x 0.25 ⁇ m, Dimethylpolysiloxane with 5 % phenyl rests), and the carrier gas was helium at a flow rate of 1.5 ml/min.
- the temperature gradient used was as follows: 70°C 5 min isothermal, heating up to 170°C at 5 °C/min, heating up to 300°C at 30°C/min, 300 0 C 5 min isothermal, then cooling down to 70 0 C at 30°C/min.
- a pulsed splitless injection mode was used injecting 2 ⁇ l of sample.
- the mass detector was configured for single ion monitoring (SlM), scanning ions m/z 101, 104 and 105 at a dwell time of 100 ms per ion, and the quantitation was based on the ratio of the areas of the ions m/z 101 (Methylmalonate) and m/z 104 (Methyl-d3-malonate).
- Calibration was done by injecting triplicate samples of 1, 2, 5, 10, 20 and 50 nmol methylmalonate with 10 nmol methyl-d3-malonate in each sample. Data analysis, calibration and quantitation were carried out with Agilent ChemStation software.
- the calibration curve is shown in Figure 18A. All calibration samples contained 10 nmol of internal standard methyl-d3-malonate. The methylmalonate quantities were 1 , 2, 5, 10, 20 and 50 nmol. Each point was measured in triplicate.
- myxothiazol Production of myxothiazol from its gene cluster must utilize methylmalonyl-CoA.
- Hetero- expression of myxothiazol gene cluster in engineered P. putida FG2005 strain is used to evaluate the methylmalonyl-CoA production.
- myxothiazol gene cluster is presented in 2 cosmids.
- a diagram of strategy for stitching of mta gene cluster is shown in Figure 19A. The mta gene cluster is presented in two cosmids.
- the engineered and stitched myxothiazol gene cluster in pl5A 138+201 oriT-trpE-Pm-cm was introduced into the chromosome of the P. putida KT2440 wild-type as well as into the chromosome of the methylmalonate-generating P. putida FG2005 by tri-parental conjugation using helper plasmid pRK2013 (Figurski, D.H., and Helinski, D.R., 1979, "Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans". Proc. Natl. Acad. Sci. U.S.A., 76:1648-1652).
- the cells were scraped from the plate, resuspeded in 100 ⁇ l sterile water and plated onto the selection PMM agar plates containing either tetracycline (25 ⁇ g/ml) for selection for the cosmid with the myxothiazol biosynthetic genes or tetracycline and kanamycin (50 ⁇ g/ml) to perform selection for the clones containing myxothiazol genes in the methylmalonate producing P. putida FG2005.
- the obtained clones were tested by colony PCR using myxothiazol specific primers designated for different parts of the gene cluster to verify the integration of the whole biosynthetic gene cluster into the chromosome.
- the primers used for checking mtaB gene are 5' -gaacgtggtcgtctcgggag- 3' and 5'- cgaatcaccagcccggagac- 3'; for checking mtaE gene are 5' - tcaagccggatgaggtctac - 3' and 5'- cttggacacggtatcgaggt - 3'; for checking mtaG gene are 5' - ctcttcttcatgcatccgac- 3' and 5'- ccggtacatctgaacctgct- 3'.
- PBS buffer and the cell lysates were prepared using French Press. After addition of 50 ml methanol, the suspension was incubated for 1 h with agitation and then filtered through a folded paper filter. The methanol was removed in vacuo and the residue dissolved in 1 ml methanol.
- the P. putida strain producing methylmalonate and containing the myxothiazol biosynthetic gene cluster integrated into the chromosome was inoculated with overnight culture (1 :100) and incubated in 300 ml flasks containing 50 ml LB medium supplemented with tetracycline (25 ⁇ g/ml) and with 2 % of XAD 16 for 1-2 h at 30 0 C with shaking.
- the myxothiazol production was induced with toluic acid (5 mM) and the culture was transferred to 16°C and incubated for 2 - 3 days.
- the cells were harvested by centrifugation and extracted with acetone and methanol.
- the myxochromide S (mchS) gene cluster is composed of 3 large genes and is 29.6kb in total.
- the starting construct comprising the mchS cluster is described in Wenzel, S. et al., "Heterologous expression of a myxobacterial natural products assembly line in Pseudomonads via Red/ET recombineering", Chemistry & Biology, 2005, 12: 349-356.
- Figure 26A shows the insertion of the MycoMar transposase gene into the mchS expression plasmid.
- the MycoMar transposase gene plus right IR fragment was generated by PCR reaction from an original MycoMar transposon vector (Rubin, E.
- FIG. 26B The integration of the left IR plus Tn5-neo gene (which confers kanamycin resistance) in front of the mchS gene cluster is shown in Figure 26B.
- the previously-used cassette, tetR-trpE-oriT (Zhang Y et al., 2000, "DNA cloning by homologous recombination in Escherichia coli", Nature Biotechnology, 18:1314-1317), is not necessary for transposition and so was removed by the left IR plus Tn5-neo using Red/ET recombination.
- a ribosomal binding site was placed in front of the mchS gene cluster.
- the TnS promoter will drive expression of the neo and mchS gene cluster ( Figure 26B).
- the final construct is formed as IR-Tn5-neo-mchS-IR-Tps (transposase) and named pTps-mchS.
- the fragment inside of the two IRs will be integrated into the host chromosome by transposase.
- Myxococcus xanthus can be transformed using electroporation.
- the construct, bearing homology arm(s) will be integrated into the chromosome via homologous recombination.
- the correct clone i.e., the clone containing the integrated large size DNA fragment, must be selected using a screening method.
- transposition has been used frequently in myxobacteria for insertional mutagenesis and the transposition efficiency is much higher than the efficiency obtained using homologous recombination (Sandmann A et al., 2004, "Identification and analysis of the core biosynthetic machinery of tubulysin, a potent cytotoxin with potential anticancer activity” Chemistry and Biology. 1 1 : 1071-9; Kopp, M. et al., 2004, "Critical variations of conjugational DNA transfer into secondary metabolite multiproducing Sorangium cellulosum strains So cel2 and So ce56: development of a mariner-based transposon mutagenesis system", J Biotechnol, 107(l):29-40).
- pTps-mchS is around 35 kb in total and the integration fragment inside of the two IRs is around 31kb. Although its efficiency of integration is lower than for the small integration fragment (pTps-lacZ), it is more efficient at integrating than the homologous integration plasmid (pOPB18).
- Myxochromide S compounds are characterized by their yellow-orange colour and are easy to observe in culture. Colonies from pTps-mchS and pTps-lacZ were picked and replated on kanamycin plate. The photo in Figure 27A was taken from the plate after incubation for 2 days. Clones 1-7 are from pTps-mchS transformation and lacZ is from pTps-lacZ transformation. Colonies from pTps-mchS transformation were truly redish ( Figure 27A) and the liquid cultures were also redish (data not shown). MchS and lacZ clones were cultured in 100 ml medium and the myxochromide compounds were extracted from medium and cells.
- the compounds were run in a thin layer chromatography (TLC). The results are shown in Figure 27B.
- Lane 1 is lacZ clone as negative control.
- Lanes 2-7 are mchS clones 1-5 and 7, respectively.
- Myxochromide compounds are yellowish in TLC. Myxochromide compounds can be found in the cells and also in the growth medium. The secretion of the myxochromides into the culture medium may be useful for production of the compound as it may be captured using, for example, a resin, which might lead to loss of feedback inhibition.
- HPLC was carried out using a DlONEX solvent system with a diode-array detector (PDA-100); column: MN nucleodur-C18 (RP) 125 x 2 mm /3 ⁇ m (precolumn: 8 x 3 mm / 5 ⁇ m); solvents: water + 0.1 % acetic acid (A) and acetonitril + 0.1 % acetic acid (B); solvent gradient from 50 % B at 2 min to 60 % B at 22 min and from 60 % B at 22 min to 95 % B at 26 min, followed by 3 min with 95 % B; flow rate: 0.4ml/min, detection at 400 nm.
- PDA-100 diode-array detector
- Myxobacteria GT2 was also transformed by the pTps-mchS construct and found to produce the myxochromide compounds (data not shown).
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Steroid Compounds (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2005298341A AU2005298341B2 (en) | 2004-10-26 | 2005-10-26 | Methods for heterologous expression of secondary metabolites |
| EP05810933A EP1809749B1 (en) | 2004-10-26 | 2005-10-26 | Methods for heterologous expression of secondary metabolites |
| US11/577,972 US20090298117A1 (en) | 2004-10-26 | 2005-10-26 | Methods for heterologous expression of secondary metabolites |
| CA002584777A CA2584777A1 (en) | 2004-10-26 | 2005-10-26 | Methods for heterologous expression of secondary metabolites |
| DE602005012718T DE602005012718D1 (de) | 2004-10-26 | 2005-10-26 | Verfahren zur heterologen expression sekundärer metabolite |
| JP2007538549A JP5566577B2 (ja) | 2004-10-26 | 2005-10-26 | 二次代謝産物の異種発現方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0423755.8A GB0423755D0 (en) | 2004-10-26 | 2004-10-26 | Methods for heterologus expression of secondary metabolites |
| GB0423755.8 | 2004-10-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006046152A2 true WO2006046152A2 (en) | 2006-05-04 |
| WO2006046152A3 WO2006046152A3 (en) | 2006-11-16 |
Family
ID=33485231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2005/003650 Ceased WO2006046152A2 (en) | 2004-10-26 | 2005-10-26 | Methods for heterologous expression of secondary metabolites |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20090298117A1 (enExample) |
| EP (1) | EP1809749B1 (enExample) |
| JP (1) | JP5566577B2 (enExample) |
| AT (1) | ATE422547T1 (enExample) |
| AU (1) | AU2005298341B2 (enExample) |
| CA (1) | CA2584777A1 (enExample) |
| DE (1) | DE602005012718D1 (enExample) |
| GB (1) | GB0423755D0 (enExample) |
| WO (1) | WO2006046152A2 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| EP3938518A4 (en) * | 2019-03-12 | 2023-01-11 | Terra Bioworks, Inc. | EXPRESSION VECTOR |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BRPI0605166A (pt) * | 2006-11-03 | 2008-07-01 | Inst Fleury | método de determinação de ácido metilmalÈnico baseado na extração alquilativa associada à cromatografia lìquida acoplada à espectrometria de massas |
| GB0922108D0 (en) | 2009-12-17 | 2010-02-03 | Gene Bridges Gmbh | Heterologous hosts |
| EP3027754B1 (en) | 2013-08-02 | 2022-03-02 | enEvolv, Inc. | Processes and host cells for genome, pathway, and biomolecular engineering |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1291420B1 (en) * | 1997-12-05 | 2009-11-25 | Europäisches Laboratorium Für Molekularbiologie (Embl) | Novel DNA cloning method relying on the E.coli RECE/RECT recombination system |
| US6355412B1 (en) * | 1999-07-09 | 2002-03-12 | The European Molecular Biology Laboratory | Methods and compositions for directed cloning and subcloning using homologous recombination |
| JP2004508810A (ja) * | 2000-04-28 | 2004-03-25 | コーサン バイオサイエンシーズ, インコーポレイテッド | ポリケチドの生成 |
| WO2003044186A2 (en) * | 2001-11-22 | 2003-05-30 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel gene cluster of pederin biosynthesis genes |
| US20040005672A1 (en) * | 2002-02-22 | 2004-01-08 | Santi Daniel V. | Heterologous production of polyketides |
-
2004
- 2004-10-26 GB GBGB0423755.8A patent/GB0423755D0/en not_active Ceased
-
2005
- 2005-10-26 AT AT05810933T patent/ATE422547T1/de not_active IP Right Cessation
- 2005-10-26 US US11/577,972 patent/US20090298117A1/en not_active Abandoned
- 2005-10-26 EP EP05810933A patent/EP1809749B1/en not_active Expired - Lifetime
- 2005-10-26 AU AU2005298341A patent/AU2005298341B2/en not_active Ceased
- 2005-10-26 JP JP2007538549A patent/JP5566577B2/ja not_active Expired - Fee Related
- 2005-10-26 CA CA002584777A patent/CA2584777A1/en not_active Abandoned
- 2005-10-26 WO PCT/IB2005/003650 patent/WO2006046152A2/en not_active Ceased
- 2005-10-26 DE DE602005012718T patent/DE602005012718D1/de not_active Expired - Lifetime
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| EP3938518A4 (en) * | 2019-03-12 | 2023-01-11 | Terra Bioworks, Inc. | EXPRESSION VECTOR |
| US12404524B2 (en) | 2019-03-12 | 2025-09-02 | Terra Bioworks, Inc. | Expression vector |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005298341A1 (en) | 2006-05-04 |
| JP5566577B2 (ja) | 2014-08-06 |
| EP1809749A2 (en) | 2007-07-25 |
| EP1809749B1 (en) | 2009-02-11 |
| CA2584777A1 (en) | 2006-05-04 |
| US20090298117A1 (en) | 2009-12-03 |
| DE602005012718D1 (de) | 2009-03-26 |
| WO2006046152A3 (en) | 2006-11-16 |
| AU2005298341B2 (en) | 2011-06-23 |
| GB0423755D0 (en) | 2004-11-24 |
| JP2008517996A (ja) | 2008-05-29 |
| ATE422547T1 (de) | 2009-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Song et al. | Enhanced heterologous spinosad production from a 79-kb synthetic multioperon assembly | |
| US9181539B2 (en) | Strains for the production of flavonoids from glucose | |
| CN102015756B (zh) | Nrps-pks基因簇及其操纵和应用 | |
| US11746336B2 (en) | Producing 3-hydroxycarboxylic acid and ketone using polyketide synthases | |
| Ongley et al. | Recent advances in the heterologous expression of microbial natural product biosynthetic pathways | |
| JP2674998B2 (ja) | 抗生物質産生微生物の改良 | |
| Gao et al. | Mutations in genes encoding antibiotic substances increase the synthesis of poly‐γ‐glutamic acid in Bacillus amyloliquefaciens LL3 | |
| KR20220023339A (ko) | 조작된 트랜스아미나아제 및 제조 및 사용 방법 | |
| Liu et al. | A seamless and iterative DNA assembly method named PS-Brick and its assisted metabolic engineering for threonine and 1-propanol production | |
| AU2005298341B2 (en) | Methods for heterologous expression of secondary metabolites | |
| Zhang et al. | Simultaneous multiplex genome loci editing of Halomonas bluephagenesis using an engineered CRISPR-guided base editor | |
| EP2135955A1 (en) | Biosynthesis of polyketide synthase substrates | |
| US20020045220A1 (en) | Biosynthesis of polyketide synthase substrates | |
| Perlova et al. | Novel expression hosts for complex secondary metabolite megasynthetases: Production of myxochromide in the thermopilic isolate Corallococcus macrosporus GT-2 | |
| CN119464244B (zh) | 一种合成(2s)-柚皮素的解脂亚洛酵母菌株及应用 | |
| Gillane et al. | Biosynthesis of novel non-proteinogenic amino acids β-hydroxyenduracididine and β-methylphenylalanine in Escherichia coli | |
| CN101962647B (zh) | 诺卡噻唑菌素的生物合成基因簇及其应用 | |
| WO2004015088A2 (en) | Transposon-based transformation system | |
| CN110551739A (zh) | 吡唑霉素生物合成基因簇、重组菌及其应用 | |
| Walker | Mechanisms for the Generation of Structural Diversity in Polyketide Biosynthesis | |
| US20020192767A1 (en) | Biosynthesis of polyketide synthase substrates | |
| Zhang et al. | High-Level Prodigiosin Production in Pseudomonas putida Enabled by Combinatorial Metabolic Engineering | |
| Linna | Expression of atromentin synthetase in yeast Saccharomyces cerevisiae and metabolic model-guided design of production optimization | |
| KR101921678B1 (ko) | 세린 생합성능이 향상된 변이 세포 | |
| Liu et al. | De novo biosynthesis of daptomycin through module construction and assembly in Escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV LY MD MG MK MN MW MX MZ NA NG NO NZ OM PG PH PL PT RO RU SC SD SG SK SL SM SY TJ TM TN TR TT TZ UG US UZ VC VN YU ZA ZM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SZ TZ UG ZM ZW AM AZ BY KG MD RU TJ TM AT BE BG CH CY DE DK EE ES FI FR GB GR HU IE IS IT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2584777 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007538549 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005298341 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3398/DELNP/2007 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2005298341 Country of ref document: AU Date of ref document: 20051026 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005810933 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005810933 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11577972 Country of ref document: US |