WO2006038289A1

WO2006038289A1 - Pim-1 ACTIVITY/PROTEIN INHIBITING PHARMACEUTICAL

Info

Publication number: WO2006038289A1
Application number: PCT/JP2004/014746
Authority: WO
Inventors: Masanobu Kobayashi; Jian Chen
Original assignee: Oncorex, Inc.
Priority date: 2004-10-01
Filing date: 2004-10-06
Publication date: 2006-04-13
Also published as: JP2008000003A

Abstract

Protein (serine/threonine kinase Pim-1) developed and increased in substantially all solid cancer cells in low oxygen has been found. Further, it has been found that the protein is decomposed by ubiquitin-proteasome system, and that any tumor angiogenesis is inhibited by dominant negative Pim-1.

Description

Specification

Pim-1 activity / protein inhibitor

Technical field

TECHNICAL FIELD [0001] The present invention relates to a molecule useful for cancer treatment 'prevention and a screening method thereof.

Background art

[0002] Currently, deaths from cancer are the second leading cause of heart disease.

Cancer is usually treated with surgical treatment, radiation therapy, chemotherapy, immunotherapy, and hyperthermia. These cancer therapies are thought to be achieved through the removal of all cancer cells or death. When it is judged that surgical treatment is impossible, radiotherapy or chemotherapy is selected. Many types of anticancer agents currently used in chemotherapy are known. However, many of the anticancer agents used clinically have many problems for solid cancer. It has been pointed out that anti-cancer drug-resistant cancer cells appear that once effective anti-cancer drugs are no longer effective, or that they are not effective for solid cancer at first. It has been reported that anti-cancer drugs are less effective for cancers with lower oxygen partial pressure than before, but the state of hypoxia inside the cancer is thought to be the cause of solid tumors being less effective for anti-cancer drugs. .

[0003] In advanced cancer, since the growth rate inside cancer cells is faster than that of surrounding normal cells, supply of newly generated blood vessels is insufficient, blood supply becomes insufficient, and hypoxia occurs. Conceivable. For example, in Non-patent Documents 1 to 6, cancer cells in hypoxia are more resistant to chemotherapy and radiation therapy than cancer cells in high oxygen, and hypoxia Inducing drug resistance in solid cancer cells is disclosed.

[0004] On the other hand, Pim-1 (amino acid sequence Z SEQ ID NO: 1, base sequence Z SEQ ID NO: 2), a serine Z threonine kinase, was originally found in T cell lymphomas caused by murine leukemia virus (MuLV). It is a serine Z threonine kinase identified as a gene that is often activated by the insertion of leukemia virus (Non-patent Document 7). In addition, Pim-1 in the cytoplasm has been reported to function as a factor for inhibiting apoptosis in various hematopoietic cells (Non-patent Document 8). In solid cancer The Pim-1's functions are known! /!

[0005] Information on prior art documents related to the invention of the present application is shown below.

Non-patent document 1: Teicner, B.A.Hypoxia and drug resistance.Cancer Metastasis Rev., 13: 139-168, 1994

Non-Patent Document 2: Brown, JM & Giaccia, AJ The unique physiology of solid tumors: opportunities (and problems) for cancer therapy.Cancer Res., 58: 1408-1416, 1998 Patent Document 3: Brown, JM Exploiting the hypoxic cancer cell: mechanisms and therapeutic strategies. Mol. Med. Today, 6: 157-162, 2000

Non-Patent Document 4: Luk, CK, Veinot— Drebot, L., Tjan, E. & Tannock, IF Effect of transient hypoxia on sensitivity to doxorubicin in human and murine cell lines. J Natl. Cancer Inst., 82: 684- 692, 1990

Non-Patent Document 5: Sakata, K., Kwok, Τ.Τ., Murphy, B.J., Laderoute, K.R., Gordon,

G.R., Sutherland, R.M.Hypoxia— induced drug resistance: comparison to

P—glycoprotein—associated drug resistance. Br. J Cancer, 64: 809—814, 1991 Patent 6: Sanna, K. & Rofstad, EK Hypoxia— induced resistance to doxorubicin and methotrexate in human melanoma cell lines in vitro. J Cancer, 58: 258-262,

1994

Non-Patent Document 7: Cuypers, H.T., Selten, G., Quint, W., Zijlstra, M., Maandag, E.R., Boelens, W., van Wezenbeek, P., Melief, C, Berns, A. Murine leukemia

virus-induced T— cell lymphomagenesis: integration of proviruses in a distinct chromosomal region. Cell, 37: 141-150, 1984

Patent Document 8: Selten, G., Cuypers, H.T. & Berns, A. Proviral activation of the putative oncogene Pim— 1 in MuLV induced T— cell lymphomas. EMBO J,

4: 1793-1798, 1985

Disclosure of the invention

Problems to be solved by the invention

[0006] The present invention aims to provide a novel molecule that inhibits the function of Pim-1 protein, and further provides a drug for preventing or treating cancer comprising the molecule. That eyes Target. In a preferred embodiment of the present invention, dominant negative Pim-1 and naked DNA expressing the same are provided as novel molecules that inhibit the function of Pim-1 protein. Another object of the present invention is to provide a screening method for drug candidates for the prevention or treatment of cancer using the Pim-1 promoter.

Means for solving the problem

[0007] As a result of intensive studies to achieve the above object, the present inventor has found a protein (serine Z threonine kinase Pim-1) that is upregulated in almost all solid cancer cells under hypoxia. Furthermore, it was found that the protein was degraded by the ubiquitin 'proteasome system, and further, it was found that dominant angiogenesis was suppressed by dominant negative Pim-1, and the present invention was completed based on this finding. I let you.

[0008] The present invention has been made based on the above findings, and more specifically, provides the following [1] one [18].

[1] The molecule according to any one of (a) to (d) below:

, A) Dominant negative Pim-1

(b) the anti-sense DNA according to SEQ ID NO: 11-13

(c) the short interference RNA according to any one of SEQ ID NOs: 5-10

(d) naked DNA obtained by incorporating the DNA encoding Dominant negative Pim-1 set forth in SEQ ID NO: 3 into a plasmid-type expression vector

[2] The molecule according to [1], which is used for the prevention or treatment of cancer by inhibiting the anti-apoptosis inhibitory effect and tumor angiogenesis action of Pim-l.

[3] A drug for preventing or treating cancer comprising the molecule according to [1].

[4] A drug for preventing or treating cancer comprising the molecule according to any one of (a) to (e) below.

(a) a compound or a salt thereof that inhibits the activity of a transcription factor that regulates transcription of the Pim-1 gene

(b) heat shock protein involved in the degradation of Pim-1 protein

(c) A compound or salt thereof that inhibits the action of Pim-1 protein by activating the ubiquitin-proteasome degradation system

(d) Pim-1 protein and vascular endothelial cell receptor that inhibits tumor angiogenesis of Pim-1 protein Compound or salt thereof that inhibits interaction with body

(e) Compound or salt thereof that inhibits signal transduction leading to tumor angiogenesis by the action of Pim-1 protein

[5] The drug according to [3] or [4], further comprising a cancer chemotherapeutic agent.

[6] The drug according to any one of [3] to [5], wherein the cancer is a solid cancer.

[7] The drug according to any one of [5], wherein the cancer is spleen cancer, [3] the force is also [5].

[8] The drug according to any one of [5] and [5], wherein the treatment or prevention of cancer is by inhibiting tumor angiogenesis.

[9] A method for preventing or treating cancer, wherein the drug according to [3] or [4] is administered to a patient. [10] The method according to [9], wherein a cancer chemotherapeutic agent is used in combination.

[11] The method according to [9] or [10], wherein the cancer is a solid cancer.

[12] The method according to [9] or [10], wherein the cancer is spleen cancer.

[13] A screening method for drug candidates for cancer prevention or treatment,

(a) providing a cell into which an expression vector containing a reporter gene operably linked to the promoter region of Pim-1 is introduced;

(b) contacting the test substance with the cell and detecting the expression of a reporter gene in the cell;

(c) selecting a test substance that reduces the expression of the reporter gene as compared to the case of detection in the absence of the test substance.

[14] Furthermore, (d) a step of detecting whether or not the test substance selected in step (c) inhibits tumor angiogenesis action; and (e) a test substance that inhibits tumor angiogenesis action. The method according to [13], comprising a step of selecting

[15] A kit for use in the method according to [13] or [14], comprising a cell into which an expression vector containing a reporter gene operably linked to the promoter region of Pim-1 has been introduced.

[16] A drug for the prevention or treatment of cancer, comprising a compound obtained by the method according to [13] or [14], or a compound obtained by using the kit according to [15]. [17] The drug according to [16], wherein the cancer is a solid cancer.

[18] The drug according to [16], wherein the cancer is spleen cancer.

Brief Description of Drawings

[0009] FIG. 1 is a photograph showing increased expression of Pim-1 protein in the presence of a proteasome inhibitor.

FIG. 2 is a photograph showing Dominant negative Pim-1 protein expression in a Dominant negative Pim-1 introduced strain.

FIG. 3 is a photograph showing the result of staining vascular endothelial cells.

FIG. 4 is a graph showing the therapeutic effect of secretory dominant negative Pim-1.

FIG. 5 is a diagram showing an outline of the screening method of the present invention using a Pim-l promoter and a reporter gene.

BEST MODE FOR CARRYING OUT THE INVENTION

In the present invention, “serine Z threonine kinase Pim-1” (hereinafter also referred to as “Pim-l” in the present specification) is a polypeptide having serine Z threonine kinase activity. Pim-1 was also identified as a gene activated by muLV insertion in T cell lymphoma caused by murine leukemia virus (MuLV) (Cuypers, HT, Selten, u., Quint, W ., Zijlstra, M., Maandag, ER, Boelens, W., van Wezenoee, P., Melief, C, Berns, A. Murine leukemia virus-induced T— cell lymphomagenesis: integration of proviruses in a distinct chromosomal region. , 37: 141-150, 1984)

[0011] A compound that inhibits the activity of Pim-1 is a candidate for a drug that induces apoptosis, and its application to treatment / prevention of cancer (including application as an apoptosis inducer or an anticancer drug enhancer) is considered.

[0012] As a compound that inhibits the activity of Pim-1, the present invention provides Dominant negative Pim-1. Dominant negative Pim-1 in the present invention is a polypeptide comprising the same or substantially the same amino acid sequence as the polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3.

[0013] The polypeptide having the amino acid sequence represented by SEQ ID NO: 3 is a polypeptide having the amino acid sequence represented by SEQ ID NO: 1 and lacking the Pim-1 kinase active domain. Yes, it is a polypeptide in which SEQ ID NO: 1 1 is deleted from the 80th amino acid residue. The polypeptide having the amino acid sequence represented by SEQ ID NO: 3 is a polypeptide lacking the kinase active domain, and in the presence of this polypeptide, the activity of Pim-1 is inhibited. As a result, the polypeptide It can be used as a drug for the treatment or prevention of cancer.

[0014] The polypeptide having the amino acid sequence represented by SEQ ID NO: 3 or the polypeptide substantially identical to the polypeptide having the amino acid sequence represented by SEQ ID NO: 3 may be a synthetic polypeptide. ,.

[0015] The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 3 is about 50% or more, preferably about 60% or more, more preferably the amino acid sequence represented by SEQ ID NO: 3. About 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more (eg, 96% or more, 97% or more, 98% or more, 99% or more) Examples thereof include homologous amino acid sequences.

[0016] The polypeptide consisting of the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 3 is, for example, one or more of the amino acid sequence represented by SEQ ID NO: 3 (for example, 1 A protein having an amino acid sequence in which about 50 amino acids, preferably about 1 to 30 amino acids have been deleted, one or more in the amino acid sequence represented by SEQ ID NO: 1 (for example, about 1 to 100, A protein having an amino acid sequence to which about 1 to 30 amino acids have been added, 1 or 2 or more (for example, about 1 to 100, preferably about 1 to 30) in the amino acid sequence represented by SEQ ID NO: 1. A protein having an amino acid sequence in which amino acids are inserted), one or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 (for example, about 1 to 100, preferably about 1 to 30) other amino acids Proteins and the like containing the amino acid sequence of a combination peptide, or those having an amino acid sequence which is substituted with an amino acid are also included. When the amino acid is inserted, substituted or deleted, the position of the insertion, substitution or deletion is not particularly limited.

[0017] Dominant negative Pim-1 of the present invention has a C-terminal that is any of a carboxyl group (one COOH), a carboxylate (one COO "), an amide (one CONH) or an ester (one COOR).

2

Also good. Examples of R in the ester include methyl, ethyl, n-propyl, Alkyl groups having 1 to 6 carbon atoms such as sopropyl and n-butyl, cycloalkyl groups having 3 to 8 carbon atoms such as cyclopentyl and cyclohexyl, phenol, α-naphthyl and the like having 6 carbon atoms — 12 aryl groups, cycloalkyl, benzyl, phenethyl and other alkyl groups, α-naphthylmethyl and other α-naphthylalkyl groups, C 7-14 aralkyl groups, bivalyloxymethyl groups, etc. Can be mentioned. When the protein represented by SEQ ID NO: 1 has a carboxyl group (or carboxylate) other than the terminal end, the carboxyl group may be amidated or esterified. Examples of esters in this case include the above-mentioned C-terminal esters. Further, in the protein represented by SEQ ID NO: 3, the amino acid residue at the terminal amino acid (eg, methionine residue) is a protecting group (formyl group, acetyl group, alkanoyl having a carbon number of 11 to 16, etc.) Protected by 1 to 6 carbon acyl groups, etc.), produced by cleavage in vivo グル Terminal glutamine residue is pyroglutamate, amino acid side chain in the molecule The above substituents (—OH, —SH, amino group, imidazole group, indole group, guazino group, etc.) are suitable protecting groups (for example, formyl group, acetyl group, etc. Protected with an alkanoyl group, etc. (Cacyl group with _{6 to 6} carbon atoms, etc.), or a sugar chain is bound! /, Or complex proteins such as loose glycoproteins! /.

The Dominant negative Pim-1 of the present invention may be in the form of a salt. Examples of such salts include physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts). And the like, and physiologically acceptable acid addition salts are particularly preferred. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid). , Succinic acid, tartaric acid, succinic acid, malic acid, succinic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid). The polypeptide or salt thereof used in the present invention can also be produced from the aforementioned human or warm-blooded animal cells or tissues by a known protein purification method. It can also be produced by culturing a transformant containing a DNA encoding a protein (for example, a DNA comprising the base sequence represented by SEQ ID NO: 4). Moreover, it can also manufacture according to the well-known peptide synthesis method. Human mammal tissue or cell force When manufacturing, human mammal tissue or cells are homogenized. Then, extraction is performed using an acid or the like, and the resulting extract can be purified and isolated by combining chromatography such as reverse phase chromatography or ion exchange chromatography.

[0019] Dominant negative Pim-1 of the present invention can also be synthesized by a known peptide synthesis method. For peptide synthesis, commercially available protein synthesis rosin can be used. Examples of such resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4 methylbenzhydrylamine resin, PAM resin, 4-hydroxymethyl methyl phenacetamide methyl resin, polyacrylamide resin, 4- (2 ', 4, dimethoxyphenol-hydroxymethyl) phenoxy resin, 4 (2, 4, And -dimethoxyphenol-Fmoc aminoethyl) phenoxy resin. Using such a rosin, an amino acid appropriately protected with a amino group and a side chain functional group is condensed on the rosin according to various known condensation methods according to the sequence of the target protein. At the end of the reaction, the protein or partial peptide is excised from the coconut resin and at the same time, various protecting groups are removed to obtain the target protein or partial peptide or a salt thereof. Regarding the condensation of the above-mentioned protected amino acids, various active reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Examples of carbodiimides include DCC, N, N, -diisopropylcarbodiimide, N-ethyl-N,-(3-dimethylaminoprolyl) carbodiimide, and the like. For the activity caused by these, a protected amino acid is added directly to the resin together with a racemization inhibitor (for example, HOBt, HOOBt), or as a symmetrical anhydride, HOBt ester or HOOBt ester. It can be added to the resin after it has been activated.

[0020] The solvent used in the condensation of the protected amino acid with the active resin can be appropriately selected as a solvent power known to be usable in the protein condensation reaction. For example, N, N-dimethylformamide, N, N-dimethylacetamide, acid amides such as N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and blackform, alcohols such as trifluoroethanol , Sulfoxides such as dimethyl sulfoxide, ethers such as pyridine, dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitryl In addition, esters such as methyl acetate and ethyl acetate or appropriate mixtures thereof may be used. The reaction temperature is appropriately selected from the range known to be used for protein bond forming reactions, and a range force of about -20 ° C-50 ° C is usually selected as appropriate. Activated amino acid derivatives are usually used in 1.5-4 fold excess. If the condensation is insufficient as a result of a test using the ninhydrin reaction, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. If sufficient condensation is not obtained even if the reaction is repeated, sometimes the unreacted amino acid is acetylated using acetic anhydride or acetyl imidazole so as not to affect the subsequent reaction. it can.

Examples of the protecting group for the starting amino group include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, C1 Z, Br Z, adamantyloxy. Carbon, trifluoroacetyl, phthaloyl, formyl, 2-nitrophenolsulfur, diphenylphosphinothioyl, Fmoc, etc. are used. The carboxyl group is, for example, alkyl esterified (for example, linear, branched, or methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl, etc. Cyclic alkyl esterification), aralkyl esterification (eg, benzyl ester, 4-trobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl ester), phenacyl esterification, benzyl It can be protected by oxycarboxyl hydrazide, t-butoxycarboxyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine can be protected by ester or ether. Suitable groups for this ester group include, for example, lower (such as 1 to 16 carbon atoms) alkanoyl groups such as an acetyl group, aroyl groups such as a benzoyl group, carbonates such as a benzyloxycarbonyl group, and an ethoxycarbonyl group. Substituents that also induce force can be used. Examples of the substituent suitable for etherification include a benzyl group, a tetrahydrovinyl group, and a tbutyl group. Examples of protecting groups for the phenolic hydroxyl group of tyrosine include Bzl, C1-Bz

2

1,2-Trobenzyl, Br-Z, t-butyl, etc. are used. As the protecting group for imidazole of histidine, for example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfol, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used. Examples of the activated carboxyl group of the raw material include the corresponding acid anhydride, azide, active ester [alcohol (pentachlorophenol, 2, 4, 5-trichlorophenol, 2 , 4-di-trophenol, cyanomethyl alcohol, para-trophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, ester with HOBt)] and the like. Examples of the activated amino group of the starting material include the corresponding phosphoric acid amide. Examples of the method for removing (eliminating) the protecting group include catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, anhydrous hydrogen fluoride, methanesulfonic acid, trifluoro. Use acid treatment with romethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., or reduction with sodium in liquid ammonia. Is possible. Such elimination reaction by acid treatment is generally performed at a temperature of about −20 ° C. to 40 ° C. In acid treatment, for example, azole, phenol, thioainol, metacresol, para It is effective to add a cation scavenger such as cresol, dimethylsulfide, 1,4 butanedithiol, 1,2-ethanedithiol. The 2,4-dinitrophenol group used as the imidazole protecting group of histidine was removed by thiophenol treatment, and the formyl group used as the indole protecting group of tributophane was the 1,2-ethanedithiol and 1,4-butanedithiol described above. In addition to the deprotection by acid treatment in the presence of etc., it can be removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

[0023] Protection of the functional group that should not be involved in the reaction of the raw material and the activity of the protective group, elimination of the protective group, and the functional group involved in the reaction are appropriately selected from known substituents or known means power Yes. As another method for obtaining an amide form of a protein or partial peptide, for example, first, the α carboxyl group of the carboxy terminal amino acid is protected by amidation, and then the peptide (protein) chain is placed on the amino group side to the desired chain length. Then, the protein or partial peptide and the protein or partial peptide from which only the protecting group of the carboxyl group at the C-terminus has been removed are prepared by removing only the protecting group of the a-amino group at the terminus of the peptide chain. These proteins or peptides are condensed in a mixed solvent as described above. The details of the condensation reaction are the same as described above. Protected protein obtained by condensation Alternatively, after purification of the peptide, all protecting groups can be removed by the above method to obtain the desired crude protein or peptide. This crude protein or peptide can be purified using various known purification means, and the main fraction can be lyophilized to obtain an amide form of the desired protein or peptide. In order to obtain a protein or peptide ester, for example, the α-carboxyl group of the carboxy terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then the desired amide of the protein or peptide is obtained. An ester of a protein or peptide can be obtained.

[0024] Dominant negative Pim-1 of the present invention can be produced according to a known peptide synthesis method. Alternatively, it can be produced by cleaving Pim-1 with an appropriate peptidase. As a peptide synthesis method, for example, either a solid phase synthesis method or a liquid phase synthesis method may be used. That is, the partial peptide or amino acid that can constitute the partial peptide used in the present invention is condensed with the remaining portion, and when the product has a protective group, the target peptide is produced by removing the protective group. be able to.

[0025] In addition, the Dominant negative Pim-1 of the present invention comprises, for example, a DNA encoding a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 3 (for example, a base sequence represented by SEQ ID NO: 4). It can also be produced by culturing a transformant transformed with an expression vector containing DNA) and recovering from the transformant. Examples of the DNA include genomic DNA, genomic DNA library, cDNA derived from the cells / tissues described above, cDNA library derived from the cells / tissues described above, and synthetic DNA. As the vector used for the library, nocteriophage, plasmid, cosmid, phagemid and the like are used. In addition, a totalRNA or mRNA fraction can be prepared from the above-mentioned cell tissue, and 7 of these can be used. Reverse Transcriptase Polymerase can be amplified by hain reaction (hereinafter abbreviated as RT-PCR method). .

[0026] In the production of Dominant negative Pim-1 of the present invention, not only DNA containing the base sequence represented by SEQ ID NO: 4, but also DNA having the base sequence represented by SEQ ID NO: 4 It is also possible to use DNA containing a nucleotide sequence that can be hybridized under highly stringent conditions.

[0027] Under the highly stringent conditions with the nucleotide sequence represented by SEQ ID NO: 4, Examples of DNA that can be used include, for example, about 50% or more, preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably the nucleotide sequence represented by SEQ ID NO: 4. Or about 90% or more, most preferably about 95% or more (for example, 96% or more, 97% or more, 98% or more, 99% or more). Hybridization can be performed according to a known method or a method analogous thereto. For example, it can be performed according to the method described in Molecular Cloning 2nd (J. Sambrook et al. Cold Spring Harbor Lab. Press, 1989). In addition, when using a commercially available library, it can be carried out according to the method described in the attached instruction manual. More preferably, it can be performed according to high stringent conditions. The highly stringent conditions are, for example, conditions in which the sodium concentration is 19 to 40 mM, preferably 19 to 20 mM, and the temperature is 50 to 70 ° C, preferably 60 to 65 ° C. In particular, it is most preferable when the sodium concentration is 19 mM and the temperature is 65 ° C.

[0028] As a means of cloning DNA that completely encodes the polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3, a part of the base sequence encoding the polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3 is used. A DNA encoding a part or the entire region of a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3 may be amplified by PCR method using a synthetic DNA primer having DNA or incorporated into a suitable vector D Selection can be performed by hybridization with NA fragments or those labeled with synthetic DNA. The hybridization method can be performed, for example, according to the method described in Molecular Cloning; 2nd (J. Sambrook et al., Cold bpnng Harbor Lab. Press, 1989). When using a commercially available library, it can be performed according to the method described in the attached instruction manual.

[0029] The DNA base sequence is converted by PCR using a known kit such as Mutan ™ -superExpress Km (Takara Shuzo), Mutan ™ -K (Takara Shuzo), etc. It can be carried out according to a known method such as the Gapped duplex method and the Kunkel method, or a method analogous thereto. The DNA encoding the cloned protein can be used as it is depending on the purpose, or digested with a restriction enzyme or added with a linker if desired. The DNA has ATG as a translation initiation codon at the 5 'end, and at the 3' end. TAA, TGA or TAG as a translation termination codon may be included. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.

[0030] The recombinant vector expressing Dominant negative Pim-1 of the present invention can be produced by ligating a polynucleotide fragment encoding Dominant negative Pim-1 to the downstream of the promoter in an appropriate expression vector. it can. Examples of the vector include a plasmid derived from E. coli (eg, pBR322, pBR325, pUC18 or pUC118), a plasmid derived from Bacillus subtilis (eg, pUB110, pTP5 or pC194), a plasmid derived from yeast (eg, pSH19 or pSH15), λ phage PAl-11, pXTl, pRc / CMV, pRc / RSV, pcDNAlZNeo, etc. are used in addition to animal viruses such as butteriophage, etc., retrovirus, vaccinia virus and baculovirus. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when the host is Escherichia coli, trp promoter, lac promoter, recA promoter, λ PL promoter, lpp promoter, T7 promoter motor, T3 promoter, araBAD promoter, etc. When the host that prefers the SP01 promoter, penP promoter, XYL promoter, HWP promoter, CWP promoter, etc. is Bacillus subtilis, the host that prefers the SPOl promoter, SP02 promoter, penP promoter, etc. is yeast PH05 promoter, PGK promoter, GAP promoter, ADH promoter, etc. are preferred. When an animal cell is used as the host, SR _a promoter, SV40 flop port motor, _LTR promoter, CMV promoter, HSV-TK promoter and the like are used good Mashiku. When insect cells are used as hosts, polyhedrin promoter, OplE2 promoter and the like are used.

[0031] Recombinant vectors include, as desired, enhancers, splicing signals, poly-A-linked signals, selectable markers, SV40 replication origins (hereinafter sometimes abbreviated as SV4 Oorgdi) and the like known in the art. Can be added. In addition, if necessary, the protein encoded by the DNA of the present invention can be expressed as a fusion protein with other proteins (for example, dartathione S transphrase and protein A). The Such fusion proteins can be cleaved using site-specific proteases and separated into their respective proteins. Examples of the selection marker include dihydr oleate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistance gene (hereinafter sometimes abbreviated as Amp ¹ "), Neomycin resistance gene (hereinafter sometimes abbreviated as Neo ^f , G418 resistance), etc. In particular, when using dhfr gene-deficient Chinese nomstar cells as a selection marker, For example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells, etc. As host cells, specific examples of Escherichia include: Escherichia coli K12-DHl (Proc. Natl. Acad. Sci. USA, 60 卷, 160 (1968)), JM 103 (Nucleic Acids Research, 9 卷, 309 (1981)), J A221 (Journal of Molecular Biology, 120 卷, 517 (1978)), HB101 (Journal of Molecular Biology, 41 卷, 459 (1969)), C600 (Genetics, 39 卷, 440 (1954), DH5 α and JM109 isotropic Examples of the genus Bacillus include Bacillus subtilis MI114 (Gene, 24 卷, 255 (1983)), 207-21 [Journal of Biochemistry, 95 87, 87 (1984)] and Bacillus. 'Brevis, etc. are used. Examples of yeasts include Saccharomyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D, 20Β-12, Schizosaccaromyces pombe NCYC1913, NCYC2036, NCYC2036 Pastoris (Pichia pastoris) M71, Hansenula polymorpha (Hansenula polymorpha), etc. As insect cells, for example, when the virus is AcNPV, a larvae-derived cell line (Spodoptera frugiperda cell; Sf Cell), Trichoplusia ni MG1 cells derived from the midgut, High Five ™ cells derived from egg of Trichoplusia ni, cells and the like from a cell or Estigmena acrea derived from Mamestra brassicae is Ru is used. When the virus is BmNPV, sputum-derived cell lines (Bombyx mori N cells; BmN cells) and the like are used. Examples of the Sf cells include Sf9 cells (ATCC CRL1711), Sf21 cells (above, Vaughn, J 丄. Et al., In Vivo, 13, 213-217, (1977)). . Examples of insects include silkworm larvae [Maeda et al., Nature, 315 卷, 592 (1985)]. Examples of mammalian cells include monkey cells COS-7, Vero , Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), dhfr gene-deficient Chinese nomster cell CHO (hereinafter abbreviated as CHO (dhfr—) cell), mouse L cell, mouse AtT-20, mouse myeloma cell, Rat GH3, human FL cells, etc. are used. Further, if necessary, a polynucleotide encoding a signal sequence suitable for the host cell may be attached to the 5, terminal side of the polynucleotide encoding dominant negative Pim-1. When using Escherichia as a host cell, PhoA 'signal sequence, ΟπιρΑ · signal sequence, etc. are used. When using Bacillus as a host cell, α amylase' signal sequence, subtilisin 'signal sequence, etc. are used. When yeast is used as a host cell, MF o; signal sequence, SUC2 'signal sequence, etc. are used. When animal cells are used as host cells, insulin' signal sequence, Signal sequences such as 'signal sequence, antibody molecule' signal sequence and the like are used. Using the expression vector containing the polynucleotide encoding the polypeptide of the present invention thus constructed, a transformant can be produced.

[0033] The above-described transformation of host cells can be performed according to a method known in the art. For example, methods for transforming host cells are described in the following documents. Proc. Natl. Acad. Sci. USA, 69 卷, 2110 (1972); Gene, 17 卷, 107 (1982); Molecular & General Genetics, 168 卷, 111 (1979); Methods in Enzymology, 194 卷, 182— 187 (1991); Proc. Natl. Acad. Sci. USA), 75 卷, 1929 (1978); Cytology Separate Volume 8 New Cell Engineering Experimental Protocol. 263-267 (1995) (published by Shujunsha); and Virology , 52 卷, 456 (1973).

[0034] The method of introducing the recombinant vector into a bacterium such as E. coli is not particularly limited as long as it can introduce DNA into the bacterium. For example, a method using calcium ions (Cohen, SN et al. : Proc. Natl. Acad. Sci., USA, 69: 2110 (1972), electoral position method and the like.

[0035] In the case of using yeast as a host, the method for introducing the recombinant vector into the yeast is not particularly limited as long as it is a method capable of introducing DNA into the yeast. For example, the electopore position method, the spheroplast method And the lithium acetate method.

[0036] When an animal cell is used as a host, a method for introducing a recombinant vector into the animal cell is described in The method is not particularly limited as long as it can introduce DNA into the vesicle, and examples thereof include an electrovolution method, a calcium phosphate method, and a lipofusion method.

[0037] When an insect cell is used as a host, the method for introducing the recombinant vector into the insect cell is not particularly limited as long as it can introduce DNA into the insect cell. For example, the calcium phosphate method , Lipofusion method, elect mouth position method and the like.

[0038] As a method for confirming whether or not a gene has been incorporated into a host, for example, a PCR method, Southern hybridization method, Northern hybridization method or the like can be used. For example, DNA is prepared from transformants, and DNA-specific primers are designed and PCR is performed. Next, the amplified product was subjected to agarose gel electrophoresis, polyatrylamide gel electrophoresis, capillary electrophoresis, etc., stained with bromide zyme, SYBR Green solution, etc., and then the amplified product was detected as a single band and transformed. Can be confirmed. PCR products may be detected using primers previously labeled with a fluorescent dye or the like to detect amplification products. Further, after the amplification product is bound to a solid phase such as a microplate, a method of confirming the amplification product using fluorescence or an enzyme reaction is used.

[0039] Dominant negative Pim-1 of the present invention includes a step of culturing the above host cell under conditions suitable for polypeptide expression and recovering the polypeptide from the obtained culture medium.

[0040] Specifically, after homogenizing the above-described host cells, extraction with an acid or the like is performed, and the extract is publicly known by combining chromatography such as reverse phase chromatography or ion exchange chromatography. The protein purification method can be used.

[0041] When the obtained polypeptide is a free form, it can be converted into an appropriate salt by a known method. Moreover, when obtained as a salt, it can be converted into a free form or other salt by a known method.

[0042] DNA encoding Dominant negative Pim-1 of the present invention is a naked DNA obtained by incorporating the DNA into a plasmid-type expression vector, and is used as a compound that inhibits the activity of Pim-1, for the prevention or treatment of cancer. It can be used as a medicine.

[0043] The present invention also provides a gene encoding Pim-1 as a compound that inhibits the activity of Pim-1.

That is, two of the polynucleotides having the nucleotide sequence represented by SEQ ID NO: 2 Strand RNA (hereinafter also referred to as short interfering RNA) (SEQ ID NO: 5-10) and antisense nucleotide (SEQ ID NO: 11-13) are provided. SEQ ID NOs: 5-13 list representative examples, and they are included in the present invention as long as they inhibit Pim-1 expression even if the sequences are different.

[0044] The double-stranded RNA against the polynucleotide having the base sequence ability represented by SEQ ID NO: 2 suppresses the expression of the polynucleotide having the base sequence represented by SEQ ID NO: 2, and as a result, Pim-1 Is suppressed, and Pim-1 activity can be inhibited. As such a double-stranded RNA, a short interference RNA of 21-23 base pairs is preferable. As a method for preparing double-stranded RNA, a conventionally known method can be used without particular limitation. For example, it can be produced using a Silencer si RNA construction kit (manufactured by Ambion).

[0045] Examples of the double-stranded RNA for the polynucleotide having the nucleotide sequence ability represented by SEQ ID NO: 2 include, for example, a polynucleotide having the sequence ability represented by SEQ ID NO: 5 (5 '— aaugaugaagucgaagagaucccugucucc-3), Polynucleotide (5— aagaucucuucgacuucaucaccugucuc— 3), which is expressed as U-force, represented by U number: 6; g, double-stranded RNA, sequence 3 Polynucleotide (5 '

— Aaaucuaaugagaugcugacaccugucuc— 3) and eyes il 歹 U number: 8 目 3 歹 U »Polynucleotides (5— aaugucagcaucucauuagauccugucucuc— 3); g, linari double stranded RNA, eyes 3 歹 [J No .: Polynucleotide (5 ')

— Aaauccauggaugguucuggaccugucucc— 3) and self-column number: 10 .

In the present invention, the compound that inhibits the activity of Pim-1 includes, in addition to the above-described molecule, (a) a compound that inhibits the activity of a transcription factor that controls transcription of the Pim-1 gene, or Its salt, (b) heat shock protein involved in the degradation of Pim-1 protein

(c) A compound or salt thereof that inhibits the action of Pim-1 protein by activating the ubiquitin-proteasome degradation system, (d) Pim-1 protein and vascular endothelial cells that inhibit the tumor angiogenesis action of Pim-1 protein A compound or salt thereof that inhibits the interaction with the above receptor, or (e) It is also conceivable to use a compound or a salt thereof that inhibits signal transduction leading to tumor angiogenesis by the action of Pim-1 protein. Therefore, the present invention also provides these molecules as compounds that inhibit the activity of Pim-1.

[0047] The compound that inhibits the above-mentioned Pim-1 activity and the compound identified by the screening described below can be administered by being formulated by a known pharmaceutical method in addition to direct administration to a patient. is there. For example, a pharmacologically acceptable carrier or medium, specifically, sterilized water, physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, etc. may be formulated and administered as appropriate. it can. Administration to a patient can be performed, for example, by intraarterial injection, intravenous injection, subcutaneous injection, or the like, intranasally, transbronchially, intramuscularly, or orally by methods known to those skilled in the art. The dosage varies depending on the weight and age of the patient, the administration method, etc., but those skilled in the art can appropriately select an appropriate dosage.

[0048] When the compound that inhibits the activity of Pim-1 is a polypeptide, it is preferably purified to 90%, more preferably 95% or more, more preferably 98% or more, and most preferably 99% or more. It is preferred to use a polypeptide. The above-mentioned polypeptide can be used, for example, as tablets, capsules, elixirs, microcapsules, etc. with sugar coating as needed, or aerosolized in the form of an inhalant, or water or other drugs. It can be used parenterally in the form of a sterile solution with a liquid that is pharmaceutically acceptable, or an injection such as a suspension.

[0049] A thread-replaceable vector into which a polynucleotide encoding the above polypeptide is inserted is formulated in the same manner as described above, and is usually used parenterally. Since the preparation thus obtained is safe and has low toxicity, for example, warm-blooded animals (for example, humans, rats, mice, guinea pigs, rabbits, birds, birds, pigs, horses, horses, cats, cats) , Monkeys, chimpanzees, etc.).

[0050] A compound that inhibits the activity of Pim-1 is particularly useful as a drug for preventing or treating cancer. Examples of target cancers include spleen cancer, esophageal cancer, stomach cancer, liver cancer, biliary tract cancer, spleen cancer, kidney cancer, bladder cancer, uterine cancer, ovarian cancer, testicular cancer, thyroid cancer, spleen cancer, brain tumor and It is particularly effective for solid tumors that include blood tumors, etc., and in which intracellular oxygen levels are low. A compound that inhibits the above-mentioned Pim-1 activity as a drug for the prevention and treatment of cancer When used, the drug may include a cancer chemotherapeutic agent. The preferred embodiment of the drug for preventing or treating cancer according to the present invention is that it exhibits the effect of preventing or treating cancer by inhibiting the anti-apoptotic inhibitory action and tumor angiogenic action of Pim-1. It is.

[0051] The present invention also provides a method for preventing or treating cancer, wherein the above-mentioned drug is administered to a patient. When gene therapy is performed on a patient, in vivo methods and ex vivo methods are included in the treatment method of the present invention. That is, for a cancer patient or the like, an expression vector under the control of a promoter capable of functioning a therapeutic polynucleotide in a target cell is administered to the patient, and the polypeptide of the present invention is administered in vivo. Or by introducing a therapeutic polynucleotide into cells taken out of the patient in the same manner as described above, and expressing the polypeptide, and then transplanting the cells into the patient. Can do. In gene therapy, therapeutic polynucleotides may be administered alone or after insertion into a suitable vector such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, etc., followed by conventional means. ,.

[0052] As shown in Example 1, the ubiquitin-proteanome proteolytic system is involved in the regulation of the expression level of the Pim-1 protein, and the compound that activates the proteolytic system such as ubiquitin-proteasome Induces loss of Plm-1 protein. Therefore, prevention and treatment of cancer using a protein degradation system activator such as Geldanamydn or an acupuncture therapy may be effective.

[0053] The present invention also provides a method for screening candidate compounds for the prevention or treatment of cancer using the Pim-1 promoter. Specifically, the promoter region of Pim-1 (SEQ ID NO: 14) is ligated to a reporter gene expression vector and introduced into a host cell. This method comprises a step of detecting a Pim-1 production inhibitor by culturing this transformed cell with a test substance (preferably cultured under hypoxia) and measuring the reporter activity.

[0054] The reporter gene is not particularly limited, but a reporter gene that is stable and capable of easily quantifying activity is preferable. Such reporter genes include, for example, luciferase, 13 galactosidase, j8-glucuronidase, chloramphee-cholacetyltransferase, peroxidase, HIS3 gene, green fluorescent protein (GF Examples include DNA encoding P), but not limited to these!

[0055] That is, in the screening method described above, when the test substance has an activity of suppressing Pim-1 production, the expression of the reporter gene is suppressed or inhibited. By detecting, it is possible to detect whether the test substance has the ability to promote or inhibit Pim-1 production.

[0056] Screening is performed by confirming the presence of the active substance as compared with the activity in the absence of the test substance. By this method, it is possible to screen for an apoptosis-inducing agent.

[0057] In the screening method of the present invention, it is further detected whether or not the test substance selected by the screening inhibits the tumor angiogenesis action, and the test substance that inhibits the tumor angiogenesis action is selected. Including, to do.

[0058] Examples of test samples used in the screening method of the present invention include cell extracts, plant extracts, purified or crude proteins, peptides, non-peptidic compounds, synthetic low-molecular compounds, natural compounds. And a gene library.

[0059] The present invention also provides a kit for the screening of the present invention. The screening kit of the present invention is a kit containing a cell into which an expression vector containing a reporter gene operably linked to the promoter region of Pim-1 has been introduced. Here, “functionally linked” means that the promoter region of the Pim-1 and the reporter gene are expressed so that the linked reporter gene is expressed in response to the activity of the promoter region of Pim-1. It means that they are bonded. The kit may include instructions for use if necessary. By using such a kit, it becomes possible to efficiently screen for drug candidate compounds for the prevention and treatment of cancer.

Example

[0060] Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.

[0061] ¾fine

It was examined whether Pim-1 was degraded by proteases under normoxic partial pressure. PCI-43 cells were cultured under low oxygen partial pressure and normoxic partial pressure. Low acid The cells cultured under the partial pressure were sampled before culturing and after 4 hours, 12 hours and 24 hours from the start of culturing, and the same operation as in Example 5 was performed, and Western plot analysis was performed. In the culture under normoxic partial pressure, the proteasome inhibitor N-acety 卜 L-leuciny 卜 L-leuciny 卜 L-norleucinal (ALLN) was added to the medium at a concentration of 50 μΜ. In the culture under normoxic partial pressure, sampling was performed before the start of culture, 6 hours after the start of culture, and 12 hours after the start of the culture, and Western plot analysis was performed. The results are shown in Figure 1. As shown in Fig. 1, in culture under low oxygen partial pressure, the amount of Pim-1 increased with the passage of time after exposure to low oxygen partial pressure, and even under normal oxygen partial pressure, The amount of Pim-1 increased over time. This indicates that the Pim-1 protein is degraded under certain circumstances, which is not a proteasome inhibitor.

[0062] Jewelery 12

In order to clarify the role of Pim-1, we established a dominant negative Pim-1 transfectant. The Pim-1 transfectant is a peptide that lacks the kinase activity domain of wild-type Pim-1, that is, the peptide represented by SEQ ID NO: 3.

[0063] The dominant negative Pim-1 cDNA lacking the kinase active domain was amplified from the RT product of mRNA purified from PCI-10 cells and cloned into PCR4-TOPO. Plasmid sequencing was performed using an ABI377 automated sequencing system (Applied Biosystems) and DyeDeoxy Terminator kit (Perkin-Elmer). Ligated to the cloned fragment (Invitrogen). The RT-PCR method is briefly described below.

[0064] 75 mM KC1, 50 mM Tris-HCl (pH 8.3), 3 mM MgCl, lOmM dithiothreitol,

2

From each RNA sample (5 μg), incubate at 37 ° C for 1 hour in a reaction mixture containing 0.5 mM each dNTP, 2 μ random primer, and 1000 U AMLV reverse transcriptase (G¾co BRL). Amplification was performed. PCR amplification of cDNA is performed using 50 mM KC1, 10 mM Tris—HCl (pH 9.0), 2.5 mM MgCl, 0.1% Triton X—100, 200 μM each dNTP

2

, 10 / z M each specific primer and 1 U Taq polymerase (G¾co BrL) in a reaction mixture. PCR was performed in a DNA thermal cycler (Barnstead / Thermolyne) for 35 cycles (94 ° C, 1 minute, 60 ° C, 1 minute, 72 ° C, 2 minutes). [0065] The following PCR primers were used.

dnpim- 1 Fo ~~ do: 5 '

Five)

Reverse: 5,-GTACTATTTGCTGGGCCCCGGCGAC-3 (SEQ ID NO: 16)

[0066] The obtained vector was transduced into an expression vector using PCI-43 cells and Lipofuctamine (Life Technologies). Transfectants were selected with 1,200 gZml of G-418 and then cloned by limiting dilution to obtain dominant negative transfectants dnp3, dnp4 and dnplO. The transfectant was then maintained in the presence of 600 g / ml G-418.

[0067] The obtained transformed cells were subjected to protein electrophoresis. Sample preparation using l% NP-40 lysis buffer (50 ^ Μ Tris s 7.5, 150ηΜ NaCl, 2 μ EDTA, 1 μ 1, EGTA, 50 NaF, 1 μ 1 Na VO, 1 μΜ PMSF) I did it.

3 4

As a control, a vector transformed was also used.

[0068] The results are shown in FIG. Figure 2 shows the results of protein electrophoresis of transformed cells. As shown in Fig. 2, peaks representing the presence of Pim-1 lacking the kinase domain were detected for dnp3, dnp4, and dnplO. For those transformed with vector only (v3 and v4), this peak was not detected.

[0069] Jewelery 13

5 × 10 ⁶ V3, dnp3, dnp4 and dnplO were subcutaneously injected into the right flank of SCID mice. After subcutaneous injection, tumor size was observed every 3 days until day 21. The tumor size was measured by measuring the short diameter and the long diameter using a caliper, and calculating the volume by the following formula to obtain the tumor size.

(Minor axis) X (minor axis) X (major axis) Z

Tumor cells were excised from the mice 6 days after subcutaneous injection, and immunohistochemical staining was performed to determine the number of CD31 positive cells. The results are shown in Figure 3.

In FIG. 3, a is an anti-CD31 stained image of a tumor tissue of a mouse subcutaneously injected with V3, and b is an anti-CD31 stained image stained image of a tumor tissue of a mouse subcutaneously injected with dnP4. Shown in Figure 3 Thus, v3 CD31 staining-positive cells were observed, but dnP4 CD31 staining-positive cells were not observed.

[0071] Example 4

5 × 10 ⁶ spleen cancer cell lines BxPc3 were subcutaneously injected into the right flank of SCID mice. After subcutaneous injection, the expression vector was administered intramuscularly every 14 days from day 5 and the size of the tumor was observed until day 35. The tumor size was measured by measuring the short diameter and the long diameter with a caliper, and calculating the volume by the following calculation formula to obtain the tumor size.

(Minor axis) X (minor axis) X (major axis) Z2

The results are shown in Fig. 4. FIG. 4 is a graph showing changes in tumor size when various vectors are administered.

[0072] In the graph of FIG. 4, the horizontal axis is the number of days elapsed after subcutaneous injection, and the vertical axis is the size of the tumor.

(mm ³ ). The graph of FIG. 4 shows the mean and standard deviation in an experiment conducted using five SCID mice. As shown in Figure 4, in the group administered v3, the tumor size increased with the passage of days. In contrast, in the group administered dominant negative Pim-1, the tumor size also decreased on the 20th day after administration. This indicates that dominant negative Pim-1 lacks tumorigenicity.

[0073] Decoration 15

FIG. 5 shows the screening method. As shown in the upper part of the figure, one region of the Pim-1 promoter is inserted into a reporter utterance vector such as luciferase and expressed in cells. Incubate for 24 hours. On the other hand, 293 normal cell lines are seeded at 10,000 cells / well as shown in the bottom row, and the test substance is added in the same manner for culture. A test substance added in a well in which a decrease in reporter activity is observed becomes a candidate substance. On the other hand, substances that are toxic to normal cells are excluded.

[0074] As detailed above, the amount of Pim-1 was increased in various cancer cells exposed to low oxygen partial pressure, and Pim-1 was degraded under normoxic partial pressure. When the protein degradation system was inhibited, the amount of Pim-1 increased even under normoxic partial pressure. Inhibition of Pim-1 gene function by dominant negative Pim-1 reduces tumor angiogenesis Tumor-forming ability decreased.

[0075] From these facts, by inhibiting the function of the Pim-1 protein or the Pim-1 gene, it is possible to exert cancer treatment, apoptosis induction, and an anticancer drug enhancing effect. Therefore, dominant negative Pim -1 and Pim-1 function compounds that inhibit protein expression are effective in the treatment of cancer.

Industrial applicability

The molecule that inhibits the function of Pim-1 provided by the present invention (particularly dominant negative Pim-1 and naked DNA that expresses it) is useful in the prevention and treatment of cancer. It is particularly effective when used effectively against cancer cells and solid cancers in which the anticancer drug has become ineffective. In addition, according to the screening system of the present invention using the promoter of the Pim-1 gene, it is possible to efficiently screen for compounds useful in the prevention and treatment of cancer.

Claims

The scope of the claims

[I] The molecule according to any one of (a) to (d) below.

, A) Dominant negative Pim-1

(b) the anti-sense DNA according to SEQ ID NO: 11-13

(c) the short interference RNA according to any one of SEQ ID NOs: 5-10

[2] The molecule according to claim 1, which is used for the prevention or treatment of cancer by inhibiting the anti-apoptosis inhibitory effect and tumor angiogenesis action of Pim-1.

[3] A drug for preventing or treating cancer, comprising the molecule according to claim 1.

(b) heat shock protein involved in the degradation of Pim-1 protein

(d) A compound or salt thereof that inhibits the tumor angiogenesis action of Pim-1 protein, and that inhibits the interaction between Pim-1 protein and a receptor on vascular endothelial cells.

[5] The drug according to claim 3 or 4, which further comprises Sarasuko and a cancer chemotherapeutic agent.

6. The drug according to any one of claims 3 to 5, wherein the cancer is a solid cancer.

7. The drug according to any one of claims 3 to 5, wherein the cancer is spleen cancer.

[8] The agent according to any one of claims 3 to 5, wherein the treatment or prevention of cancer is by inhibiting tumor angiogenesis.

[9] A method for preventing or treating cancer, wherein the drug according to claim 3 or 4 is administered to a patient.

[10] The method according to claim 9, wherein a cancer chemotherapeutic agent is used in combination.

[II] The method according to claim 9 or 10, wherein the cancer is a solid cancer.

[12] The method according to claim 9 or 10, wherein the cancer is spleen cancer.

[13] A screening method for drug candidate compounds for the prevention or treatment of cancer,

[14] Furthermore, (d) a step of detecting whether the test substance selected in step (c) inhibits tumor angiogenesis action, and (e) a test substance that inhibits tumor angiogenesis action 14. The method of claim 13, comprising the step of selecting.

[15] A kit for use in the method according to claim 13 or 14, comprising a cell into which an expression vector containing a reporter gene operably linked to the promoter region of Pim-1 has been introduced.

[16] A drug for preventing or treating cancer, comprising a compound obtained by the method according to claim 13 or 14, or a compound obtained by using the kit according to claim 15.

[17] The drug according to claim 16, wherein the cancer is a solid cancer.

18. The drug according to claim 16, wherein the cancer is spleen cancer.