WO2006032279A1 - Subtilases - Google Patents

Subtilases Download PDF

Info

Publication number
WO2006032279A1
WO2006032279A1 PCT/DK2005/000598 DK2005000598W WO2006032279A1 WO 2006032279 A1 WO2006032279 A1 WO 2006032279A1 DK 2005000598 W DK2005000598 W DK 2005000598W WO 2006032279 A1 WO2006032279 A1 WO 2006032279A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
subtilase
polypeptide
acid sequence
Prior art date
Application number
PCT/DK2005/000598
Other languages
English (en)
Inventor
Preben Nielsen
Poul Erik Pedersen
Helle Outtrup
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Priority to DE602005026541T priority Critical patent/DE602005026541D1/de
Priority to AT05784169T priority patent/ATE499439T1/de
Priority to US11/575,544 priority patent/US7811979B2/en
Priority to EP05784169A priority patent/EP1794297B1/fr
Publication of WO2006032279A1 publication Critical patent/WO2006032279A1/fr
Priority to US12/856,964 priority patent/US7993900B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase

Definitions

  • Sequence listing The present invention comprises a sequence listing.
  • the deposit DSM16711 contain a plasmid comprising a fragment of DNA encoding the open reading frame of the hybrid subtilase gene (JP170/CDJ120 hybrid), whereas the deposit DSM16721 contain a plasmid comprising a fragment of DNA encoding the mature segment the subtilase gene (CDJ120).
  • the present invention relates to novel JP170 like subtilases from wild-type bacteria, hybrids thereof and to methods of construction and production of these proteases. Further, the present invention relates to use of the claimed subtilases in detergents, such as a laundry detergent or an automatic dishwashing detergent.
  • Enzymes have been used within the detergent industry as part of washing formulations for more than 30 years. Proteases are from a commercial perspective the most relevant enzyme in such formulations, but other enzymes including lipases, amylases, cellulases, hemicellulases or mixtures of enzymes are also often used.
  • proteases with appropriate properties include both discovery of naturally occurring proteases, i.e. so called wild-type proteases but also alteration of well-known proteases by e.g. genetic manipulation of the nucleic acid sequence encoding said proteases.
  • subtilisin family was further divided into the subgroups of "true subtilisins (I-S1)", “high alkaline proteases (I-S2)” and “intracellular proteases”. Siezen and Leunissen identified also some proteases of the subtilisin family, but not belonging to any of the subgroups.
  • the true subtilisins include proteases such as subtilisin BPN' (BASBPN), subtilisin Carlsberg (ALCALASE ® , NOVOZYMES A/S) (BLSCAR), mesentericopeptidase (BMSAMP) and subtilisin DY (BSSDY).
  • the high alkaline proteases include proteases such as subtilisin 309 (SAVINASE ® , NOVOZYMES A/S) (BLSAVI) subtilisin PB92 (BAALKP), subtilisin BL or BLAP (BLSUBL), subtilisin 147 (ESPERASE ® , NOVOZYMES A/S), subtilisin Sendai (BSAPRS) and alkaline elastase YaB.
  • the TY145 like subtilisins include proteases such as TY145 (a subtilase from Bacillus sp. TY145, NCIMB 40339 described in WO 92/17577) (BSTY145), subtilisin TA41 (BSTA41 ), and subtilisin TA39 (BSTA39).
  • the JP170 subtilase type was first described as protease A in WO 88/01293 to Novozymes A/S disclosing four strains producing this type of protease.
  • US patent 5,891 ,701 to Novozymes Biotech disclosed the amino acid sequence of JP170 and the DNA sequence encoding it.
  • the patents JP7-62152 and JP 4197182 to Lion Corp. disclosed the alkaline protease Yb produced by Bacillus sp. Y that is homologous to JP170 and the DNA sequence encoding Yb. Bacillus sp. Y also produces the protease Ya (Geneseq P entry AAR26274).
  • the inventors have isolated novel proteases belonging to the JP170 like proteases subgroup of the subtilisin family that possess advantageous properties, such as improved detergent stability.
  • the inventors have inserted truncated forms of the genes encoding various members of this subgroup into the gene encoding the JP170 protease thereby creating hybrid JP170 like proteases exhibiting improved performance in cor.. n -.
  • the invention therefore in a further embodiment provides hybrid proteases.
  • subtilases refer to a sub-group of serine proteases according to Siezen et al., Protein Engng. 4 (1991 ) 719-737 and Siezen et al. Protein Science 6 (1997) 501-523.
  • Serine proteases or serine peptidases is a subgroup of proteases characterised by having a serine in the active site, which forms a covalent adduct with the substrate.
  • the subtilases (and the serine proteases) are characterised by having two active site amino acid residues apart from the serine, namely a histidine and an aspartic acid residue.
  • the subtilases may be divided into 6 sub-divisions, i.e. the Subtilisin family, the Thermitase family, the Proteinase K family, the Lantibiotic peptidase family, the Kexin family and the Pyrolysin family.
  • subtilisin family (EC 3.4.21.62) may be further divided into 3 sub-groups, i.e. I-S1 ("true” subtilisins), I-S2 (highly alkaline proteases) and intracellular subtilisins. Definitions or grouping of enzymes may vary or change, however, in the context of the present invention the above division of subtilases into sub-division or sub-groups shall be understood as those described by Siezen et al., Protein Engng. 4 (1991) 719-737 and Siezen et al. Protein Science 6 (1997) 501-523.
  • parent is in the context of the present invention to be understood as a protein, which is modified to create a protein variant.
  • the parent protein may be a naturally occurring (wild-type) polypeptide or it may be a variant thereof prepared by any suitable means.
  • the parent protein may be a variant of a naturally occurring protein which has been modified by substitution, chemical modification, deletion or truncation of one or more amino acid residues, or by addition or insertion of one o. amino acid sequence, of a naturally-occurring polypeptide.
  • parent subtilase refers to a subtilase which is modified to create a subtilase variant.
  • hybrid is in the context of this invention to be understood as a protein that has been modified by replacing one or more segments of the gene encoding the parent protein with corresponding segments derived from genes encoding another protein.
  • core in the context of this invention is to be understood as a segment that comprises a substantial part of the subtilase gene including the part encoding the active site and a substantial part of the rest of the subtilase molecule, to provide unique traits to a hybrid.
  • modification(s) or “modified” is in the context of the present invention to be understood as to include chemical modification of a protein as well as genetic manipulation of the DNA encoding a protein. The modification(s) may be replacement(s) of the amino acid side chain(s), substitution(s), deletion(s) and/or insertions in or at the amino acid(s) of interest.
  • modified protein e.g. "modified subtilase”
  • modified subtilase is to be understood as a protein which contains modification(s) compared to a parent protein, e.g. subtilase.
  • Identities can be extracted from the same calculation.
  • the output from the routine is besides the amino acid alignment the calculation of the "Percent Identity" and the "Similarity” between the two sequences.
  • the numbers calculated using UWGCG package version 9.1 is slightly different from the version 8.
  • position is in the context of the present invention to be understood as the number of an amino acid in a peptide or polypeptide when counting from the N-terminal end of said peptide/polypeptide.
  • the position numbers used in the present invention refer to different subtilases depending on which subgroup the subtilase belongs to. DETAILED DESCRIPTION OF THE INVENTION
  • Degenerated primers were constructed from an alignment of genes of already known proteases such as Ya, KAO KSM-43 and JP170. The primers were degenerated in order to allow screening for protease gene fragments different from Ya, KAO KSM-43 and JP170.
  • PCR screening using the primers SF16A767F and SF16A1802R.
  • the expected size of the PCR product was 1050 nucleotides. All PCR products of the expected size were sequenced in two sequence reaction using one of each of the same two primers. The nucleotide sequences were translated to amino acid sequences, and the diversity analysed by comparative peptide sequence analysis.
  • the inventors decided to move on with a dual approach; expression of the PCR product by in frame fusions to N and C terminal parts of the known protease of Bacillus halmapalus strain JP170 and inverse PCR to get the full sequences of selected enzymes.
  • SOE PCR Splicing by Overlapping Extension
  • hybrid gene products comprising 5 segments were generated as described in Example 2.
  • the hybrid subtilase genes are used for production of a mature protease enzyme of about 433 amino-acids and a molecular weight of approximately 45 kd.
  • the first segment is the nucleotide sequence encoding the pro sequence of JP170 protease (that is not a part of the mature protease) and 40 amino acids of the N terminal of the mature JP170 protease.
  • This is followed by a fusion primer segment encoding 8 amino acids (this segment may contain sequence variation due to the degeneration of the primer SF16A767F).
  • the third segment is encoding the approximately 343 amino acid long core.
  • This segment includes the sequence encoding the active site of the protease. This is followed by a fusion primer segment encoding 7 amino acids (this segment may contain variation due to the degeneration of the prime. _. . -. -, is encoding the 35 amino acids of the C terminal of the JP170 protease.
  • the core of the subtilase of the invention may comprise 50-420 amino acid residues, preferably 50-100 amino acid residues, 100-150 amino acid residues, 150-200 amino acid residues 200-250 amino acid residues, 250-300 amino acid residues, 300-350 amino acid residues, 350-400 amino acid residues, 400-420 amino acid residues.
  • a core segment comprising approximately 343 amino acid residues.
  • the N terminal end of the core segment is located in one of positions 1-10, 10-20, 20- 30, 30-40, 40-50, 50-60 or 60-70 of the subtilase of SEQ ID NO:4.
  • the C terminal end of the core segment is located in one of positions 70-80, 80-90, 90-100, 100-150, 150-200, 200-250, 250-300, 300-320, 320-340, 340-360, 360-380, 380-400, 400-420 of the subtilase of SEQ ID NO:4.
  • the core of the subtilase of the invention comprises the amino acids in position 49-392 of the hybrid JP170/CDJ120 (SEQ ID NO:4).
  • the core seq uence preferably has 99.2% identity with the amino acids in position 49- 392 of SEQ ID N0:4. More preferably the core sequence has 99.3% identity, 99.5% identity, 99.7% identity or 99.9% identity with SEQ ID NO:4.
  • the corresponding nucleotides encoding the core segment can be seen in SEQ ID NO:3.
  • the core of the subtilase of the invention is encoded by the nucleotides in position 145-1177 of the hybrid JP170/CDJ120 (SEQ ID NO:3).
  • the N and C terminals of the hybrids of the present invention could equally well be selected from other subtilases, such as BLSCAR, BMSAMP, BASBPN or BSSDY of 1-S1, BLSAVI, BAALKP, BLSUBL or subtilisin 147 of I-S2, a members of the TY145 like subtilases, or another member of the JP170 like subtilases.
  • subtilases such as BLSCAR, BMSAMP, BASBPN or BSSDY of 1-S1, BLSAVI, BAALKP, BLSUBL or subtilisin 147 of I-S2, a members of the TY145 like subtilases, or another member of the JP170 like subtilases.
  • the lengths of the N and C terminal sequences vary from 1 to approximately 150 amino acid residues.
  • the length of the terminals are 1-20 amino acid residues, 20- 40 amino acid residues, 40-60 amino acid residues, 60-80 amino acid residues, 80-100 amino acid residues, 100-120 amino acid residues, 120-150 amino acid residues.
  • subtilase hybrids of the invention are preferable produced by use of the fusion primers described in Example 2, but other suitable primers may equally well be used.
  • the PCR fragment was cloned into plasmid pDG268NeoMCS- PramyQ/Prcrylll/cryl llAstab/Sav (United States Patent: 5,955,310) and transformed in Bacillus subtilis. Protease positive colonies were selected and the .. - ⁇ . _ ., enzyme from the expression construct was confirmed by DNA sequence analysis.
  • subtilase genes were amplified with specific primers with restriction sites in the 5' end of primers that allow gene fusion with the Savinase signal peptide of plasmid pDG268NeoMCS-PramyQ/Prcryll 1/crylllAstab/Sav (United States Patent: 5,955,310). Protease positive colonies were selected and the coding sequence of the expressed enzyme from the expression construct was confirmed by DNA sequence analysis.
  • the subtilase of the present invention include the members of the novel subgroup of Figure 1 : CDJ120. According to the identity matrix of Figure 2 the sequence identity of the closest related prior art subtilase is 98.2%. Thus, the subtilase of the present invention is at least 98.5% identical with SEQ ID NO:
  • subtilase may be at least 99% or at least 99.5% identical with SEQ ID NO:2 or SEQ ID NO:4.
  • the subtilase of the present invention is encoded by an isolated nucleic acid sequence, which nucleic acid sequence has at least 91% identity with SEQ ID NO:1 or SEQ ID NO:3.
  • said nucleic acid sequence has at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97% , at least 98%, or at least 99% identity with the nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3.
  • isolated nucleic acid sequence encoding a subtilase of the invention hybridizes with a complementary strand of the nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 preferably under low stringency conditions, at least under medium stringency conditions, at least under medium/high stringency conditions, at least under high stringency conditions, at least under very high stringency conditions.
  • Suitable experimental conditions for determining hybridization between a nucleotide probe and a homologous DNA or RNA sequence involves presoaking of the filter containing the DNA fragments or RNA to hybridize in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al. 1989) for 10 min, and prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution (Sambrook et al. 1989), 0.5 % SDS and 100 ⁇ g/ml of denatured sonicated salmon sperm DNA (Sambrook et al. 1989), followed by hybridization in the same solution containing a concentration of 10ng/ml of a random-primed (Feinberg, A. P.
  • the present invention also encompasses any of the above mentioned subtilase variants in combination with any other modification to the amino acid sequence thereof. Especially combinations with other modifications known in the art to provide improved properties to the enzyme are envisaged.
  • Such combinations comprise the positions: 222 (improves oxidation stability), 218 (improves thermal stability), substitutions in the Ca 2+ -binding sites stabilizing the enzyme, e.g. position 76, and many other apparent from the prior art.
  • subtilase variant described herein may advantageously be combined with one or more modification(s) in any of the positions:
  • a particular interesting variant is a variant, which, in addition to modifications according to the invention, contains the following substitutions: S101 G+S103A+V104I+G159D+A232V+Q236H+Q245R+N248D+N252 K.
  • subtilase variants of the main aspect(s) of the invention are preferably combined with one or more modification(s) in any of the positions 129, 131 and 194, preferably as 129K, 131 H and 194P modifications, and most preferably as P129K, P131 H and A194P modifications. Any of those modification(s) are expected to provide a higher expression level of the subtilase variant in the production thereof.
  • the above mentioned host cells transformed or transfected with a vector comprising a nucleic acid sequence encoding an enzyme of the present invention are typically cultured in a suitable nutrient medium under conditions permitting the production of the desired molecules, after which these are recovered from the cells, or the culture broth.
  • the medium used to culture the host cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). The media may be prepared using procedures known in the art (see, e.g., references for bacteria and yeast; Bennett, J.W. and LaSure, L, editors, More Gene Manipulations in Fungi, Academic Press, CA, 1991). If the enzymes of the present invention are secreted into the nutrient medium, they may be recovered directly from the medium. If they are not secreted, they may be recovered from cell lysates.
  • the enzymes of the present invention may be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gelf i ltration chromatography, affinity chromatography, or the like, dependent on the enzyme in question.
  • the enzymes of the invention may be detected using specific for these proteins. These detection methods include use of specific anti bodies, formation of a product, or disappearance of a substrate. For example, an enzyme assay may be used to determine the activity of the molecule. Procedures for determining various kinds of activity are known in the art.
  • the enzymes of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J-C Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation), or extraction
  • IEF isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • extraction see, e.g
  • heterologous host cell When an expression vector comprising a DNA sequence encoding an enzyme of the present invention is transformed/transfected into a heterologous host cell it is possible to enable heterologous recombinant production of the enzyme.
  • An advantage of using a heterologous host cell is that it is possible to make a highly purified enzyme composition, characterized in being free from homologous impurities, which are often present when a protein or peptide is expressed in a homologous host cell.
  • homologous impurities mean any impurity (e.g. other polypeptides than the enzyme of the invention) which originates from the homologous cell where the enzyme of the invention is originally obtained from.
  • the enzyme of the invention may be added to and thus become a component of a detergent composition.
  • the detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition , or be formulated as a detergent composition for use in general household hard surface cleaning operations, or be formulated for hand or machine dishwashing operations, especially for automatic dish washing (ADW).
  • the invention provides a detergent additive comprising the enzyme of the invention.
  • the detergent additive as well as the detergent composition may comprise one or more other enzymes such as a protease, a lipase, a cutinase, an amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an arabinase, a galactanase, a xylanase, an oxidase, e.g., a laccase, and/or a peroxidase.
  • the properties of the chosen enzyme(s) should be compatible ⁇ /vith the selected detergent, (i.e.
  • proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included.
  • the protease may be a serine protease or a metallo protease, preferably an alkaline microbial protease or a trypsin-like protease.
  • alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
  • trypsin-like proteases are trypsin (e.g. of porcine or bovine origin) and the Fusarium protease described in WO 89/06270 and WO 94/25583.
  • useful proteases are the variants described in WO 92/19729, WO
  • Preferred commercially available protease enzymes include AlcalaseTM, SavinaseTM, PrimaseTM, DuralaseTM, EsperaseTM, and KannaseTM (Novozymes A/S), MaxataseTM, MaxacalTM, MaxapemTM, ProperaseTM, PurafectTM, Purafect OxPTM, FN2TM, and FN3TM (Genencor International Inc.).
  • Suitable lipases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful lipases include lipases from
  • Humicola (synonym Thermomyces), e.g. from H. lanuginosa (T. lanuginosus) as described in
  • Pseudomonas lipase e.g. from P. alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP 331 376), P. stutzeh (GB 1 ,372,034), P. fluorescens, Pseudomonas sp. strain SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis (WO 96/12012), a Bacillus lipase, e.g. from S. subtilis (Dartois et al. (1993), Biochemica et Biophysica Acta, 1131 , 253-360), B. stearothermophilus (JP 64/744992) or 6. pumilus (WO 91/16422).
  • lipase variants such as those described in WO 92/05249, WO
  • LipolaseTM and Lipolase UltraTM
  • Amylases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, ⁇ -amylases obtained from Bacillus, e.g. a special strain of B. licheniformis, described in more detail in GB 1,296,839. Examples of useful amylases are the variants di
  • Suitable cellulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g. the fungal cellulases produced from Humicola insolens, Myceliophthora thermophila and Fusarium oxysporum disclosed in US 4,435,307, US 5,648,263, US 5,691,178, US 5,776,757 and WO 89/09259.
  • cellulases are the alkaline or neutral cellulases having colour care benefits.
  • Examples of such cellulases are cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940.
  • Other examples are cellulase variants such as those described in WO 94/07998, EP 0 531 315, US 5,457,046, US 5,686,593, US 5,763,254, WO 95/24471, WO 98/12307 and PCT/DK98/00299.
  • cellulases include CelluzymeTM, Renozyme ® and CarezymeTM (Novozymes A/S), ClazinaseTM, and Puradax HATM (Genencor International Inc.), and KAC- 500(B)TM (Kao Corporation).
  • Peroxidases/Oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful peroxidases include peroxidases from Coprinus, e.g. from C. cinereus, and variants thereof as those described in WO 93/24618, WO 95/10602, and WO 98/15257.
  • peroxidases include GuardzymeTM (Novozymes A/S).
  • the detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more enzymes, or by adding a combined additive comprising all of these enzymes.
  • a detergent additive of the invention i.e. a separate additive or a combined additive, can be formulated e.g. as a granulate, a liquid, a slurry, etc.
  • Preferred detergent additive formulations are granulates, in particular non-dusting granulates, liquids, in particular stabilized liquids, or slurries.
  • Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and 4,661 ,452 and may optionally be coated by methods known in the art.
  • waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contain! in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids.
  • film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591.
  • Liquid enzyme preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods.
  • Protected enzymes may be prepared according to the method disclosed in EP 238,216.
  • the detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid.
  • a liquid detergent may be aqueous, typically containing up to 70 % water and 0-30 % organic solvent, or non-aqueous.
  • the detergent composition comprises one or more surfactants, which may be non-ionic including semi-polar and/or anionic and/or cationic and/or zwitterionic.
  • the surfactants are typically present at a level of from 0.1% to 60% by weight.
  • the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate, alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid or soap.
  • an anionic surfactant such as linear alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate, alpha-
  • the detergent When included therein the detergent will usually contain from about 0.2% to about 40% of a non-ionic surfactant such as alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside, alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N-alkyl derivatives of glucosamine (“glucamides").
  • a non-ionic surfactant such as alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside, alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N-alkyl derivatives of glucosamine (“glucamides”).
  • glucamides N-acyl N-alkyl derivatives of glucosamine
  • the detergent may contain 0-65 % of a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered silicates (e.g. SKS-6 from Hoechst).
  • a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered silicates (e.g. SKS-6 from Hoechst).
  • the detergent may comprise one or more polymers.
  • examples are carboxymethylcellulose, poly(vinylpyrrolidone), poly (ethylene glycol), polyvinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacrylates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid copolymers.
  • the detergent may contain a bleaching system which may comprise a H 2 O 2 source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate.
  • a bleaching system may comprise peroxyacids of e.g. the amide, imide, or sulfone type.
  • the enzyme(s) of the detergent composition of the invention may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivath or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid, and the composition may be formulated as described in e.g. WO 92/19709 and WO 92/19708.
  • stabilizing agents e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivath or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid
  • the detergent may also contain other conventional detergent ingredients such as e.g. fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil redeposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
  • fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil redeposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
  • any enzyme in particular the enzyme of the invention, may be added in an amount corresponding to 0.01-100 mg of enzyme protein per litre of wash liquor, preferably 0.05-5 mg of enzyme protein per litre of wash liquor, in particular 0.1-1 mg of enzyme protein per litre of wash liquor.
  • the enzyme of the invention may additionally be incorporated in the detergent formulations disclosed in WO 97/07202 which is hereby incorporated as reference.
  • Typical powder detergent compositions for automated dishwashing include: 1)
  • Nonionic surfactant e.g. alcohol ethoxylate 1 - 2%
  • NTA Nitrilotrisodium acetate
  • Powder and liquid dishwashing compositions with cleaning surfactant system typically include the following ingredients:
  • Ci 2 -C 15 ethoxylated alcohols with an average degree of ethoxylation of 9 0 - 6.5%
  • Non-aqueous liquid automatic dishwashing compositions typically include the following ingredients:
  • Liquid nonionic surfactant e.g. alcohol ethoxylates
  • Liquid carrier selected from higher glycols, polyglycols, polyoxides, glycolethers 25.0 - 45.0%
  • Stabilizer e.g. a partial ester of phosphoric acid and a Ci 6 -C 18 alkanol
  • Foam suppressor e.g. silicone 0 1.5%
  • Liquid nonionic surfactant e.g. alcohol ethoxylates
  • Stabilizing system e.g . mixtures of finely divided silicone and low molecular weight dialkyl polyglycol ethers
  • Clay gel thickener e.g. bentonite 0.0 - 10.0%
  • Thixotropic liquid automatic dishwashing compositions typically include the following ingredients:
  • Liquid automatic dishwashing compositions typically include the following ingredients: 10)
  • Oleic acid 0 - 10%
  • Liquid automatic dishwashing compositions containing protected bleach particles typically include the following ingredients:
  • the manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 369, 1994, pp. 637- 639.
  • the present invention provides a method of producing an isolated enzyme according to the invention, wherein a suitable host cell, which has been transformed with a DNA sequence encoding the enzyme, is cultured under conditions permitting the production of the enzyme, and the resulting enzyme is recovered from the culture.
  • a suitable host cell which has been transformed with a DNA sequence encoding the enzyme
  • the resulting enzyme is recovered from the culture.
  • the expressed subti lase may con ⁇ veniently be secreted into the culture medium and may be recovered there-from by well-known procedures including separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulfate, followed by chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
  • Example 1 PCR screening The core part of protease gene was amplified in a PCR reaction that included 50U/ml of
  • Ampli-taqTM DNA polymerase (Perkin Elmer) 1Ox Amplitaq buffer (final concentration of MgCI 2 is 1.5 mM) 0.2 mM of each of the dNTPs (dATP, dCTP, dTTP and dGTP) 0.2 pmol/ ⁇ l of the primers SF16A767F (CNATGCATGAAGCNTTCCGCGG, SEQ ID NO:5) ("N" is degeneration introduced by insertion of inosine)) and SF16A1802R (CNACGTTGTTNCNGCCATCCC, SEQ ID NO:6) and 1 ⁇ l template DNA.
  • dNTPs dATP, dCTP, dTTP and dGTP
  • Template DNA was recovered from the various Bacillus strains using HighPureTM PCR template preparation kit (Boehringer Mannheim art. 1796828) as recommended by the manufacturer for DNA recovery from bacteria. The quality of the isolated template was evaluated by agarose gel electrophoresis. If a high molecular weight band was present the quality was accepted. PCR was run in the following protocol: 94°C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68 0 C for 1 minute] completed with 68°C for 10 minutes. PCR products were analysed on a 1% agarose gel in TAE buffer stained with Ethidium bromide to confirm a single band of app. 1050 nucleotides.
  • the PCR product was recovered by using QiagenTM PCR purification kit as recommended by the manufacturer.
  • the nucleotide sequences were determined by sequencing on an ABI PRISMTM DNA sequencer (Perkin Elmer).
  • a PCR product of CDJ 120 was determined.
  • the nucleotide sequences were translated to amino acid sequences, and the diversity analysed by comparative peptide sequence analysis. As can be seen in Figure 1 the diversity by far exceeded that of the prior art.
  • Template DNA was recovered from the various Bacillus strains using HighPureTM PCR template preparation kit (Boehringer Mannheim art. 1796828) as recommended by the manufacturer for DNA recovery from bacteria. The quality of the isolated template was evaluated by agarose gel electrophoresis. If a high molecular weight band was present the quality was accepted.
  • PCR was run in the following protocol: 94 0 C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68 0 C for 1 minute] completed with 68°C for 10 minutes. PCR products were analysed on a 1% agarose gel in TAE buffer stained with Ethidium bromide to confirm a single band of app. 700 nucleotides.
  • PEP201 ⁇ '-TTAAACGCGTTTAATGTACAATCGCTAAAGAAAAG -3' (SEQ ID NO: 15) and 1 ⁇ l template DNA.
  • Template DNA was recovered from the various Bacillus strains using HighPureTM PCR template preparation kit (Boehringer Mannheim art. 1796828) as recommended by the manufacturer for DNA recovery from bacteria. The quality of the isolated template was evaluated by agarose gel electrophoresis. If a high molecular weight band was present the quality was accepted.
  • PCR was run in the following protocol: 94°C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68°C for 1 minute] completed with 68°C for 10 minutes. PCR products were analysed on a 1 % agarose gel in TAE buffer stained withi Ethidium bromide to confirm a single band of app. 370 nucleotides.
  • PCR reaction the three PCR products are mixed and a fused product is amplified in a standard PCR protocol using the primers PEP200 and PEP201 and 1 ⁇ l template DNA.
  • Template DNA is a mixture of the three PCR products described above (1-3). These PCR products may be recovered using Qiaquick tm spin colu
  • PCR was run in the following protocol: 94°C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68°C for 1 minute] completed with 68 0 C for 10 minutes. PCR products were analysed on a 1% agarose gel in TAE buffer stained with Ethidium bromide to confirm a single band of app. 1850 nucleotides.
  • the digested and purified PCR fragment was ligated to the CIa I and MIu I digested plasmid pDG268NeoMCS-PramyQ/Prcrylll/crylIIAstab/Sav (United States Patent: 5,955,310).
  • the ligation mixture was used for transformation into E. coli TOP10F' (Invitrogen BV, The Netherlands) and several colonies were selected for miniprep (QIAprep ® spin, QIAGEN GmbH, Germany).
  • the purified plasmids were checked for insert before transformation into a strain of Bacillus subtilis derived from S.
  • subtilis DN 1885 with disrupted apr, npr and pel genes (Diderichsen et al (1990), J. Bacterid. , 172, 4315-4321).
  • the disruption was performed essentially as described in "Bacillus subtilis and other Gram-Positive Bacteria," American Society for Microbiology, p.618, eds. A.L. Sonenshein, J.A. Hoch and Richard Losick (1993).
  • Transformed cells were plated on 1% skim milk LB-PG agar plates, supplemented with 6 ⁇ g/ml chloramphenicol. The plated cells were incubated over night at 37 0 C and protease containing colonies were identified by a surrounding clearing zone. Protease positive colonies were selected and the coding sequence of the expressed enzyme from the expression construct was confirmed by DNA sequence analysis.
  • CDJ120 PCR Forward CCGAACGGAAACCAAGGATGGG (SEQ ID NO:7)
  • CDJ120 PCR Reverse GGAGCCGTTTCCTAATACAGAG (SEQ ID NO:8)
  • CDJ120 Forward Sequencing TTGGACCTTGTCATTACCGC (SEQ ID NO:9) CDJ120 Reverse Sequencingl AGACCTCCAAGTCCTCCACC (SEQ ID NO:10) CDJ120 Reverse Sequencing2 CATTGCTTGCTGCGTATTGG (SEQ ID NO:11)
  • SEQ ID NO:1 The gene sequence encoding the mature part of the protease gene of strain CDJ 120 is shown in SEQ ID NO:1.
  • JP170 subtilase gene was amplified using primers JP170_CDJ120_SOE_R CAATGCCACGGGCCACGTCATT (SEQ ID NO:18).
  • Template DNA was recovered from the various Bacillus strains using HighPureTM PCR template preparation kit (Boehringer Mannheim art. 1796828) as recommended by the manufacturer for DNA recovery from bacteria. The quality of the isolated template was evaluated by agarose gel electrophc band was present the quality was accepted.
  • PCR Both PCR were run in the following protocol: 94°C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68°C for 1 minute] completed with 68°C for 10 minutes. PCR products were analysed on a 1% agarose gel in TAE buffer stained with Ethidium bromide to confirm a single band of app. 700 nucleotides.
  • PCR was run in the following protocol: 94 0 C, 2 minutes 40 cycles of [94°C for 30 seconds, 52°C for 30 seconds, 68°C for 1 minute] completed with 68°C for 10 minutes.
  • PCR products were analysed on a 1% agarose gel in TAE buffer stained with Ethidium bromide to confirm a single band of app. 1850 nucleotides.
  • the digested and purified PCR fragment was ligated to the CIa I and MIu I digested plasmid pDG268NeoMCS-PramyQ/Prcrylll/crylllAstab/Sav (United States Patent: 5,955,310).
  • the ligation mixture was used for transformation into E. coli TOP10F' (Invitrogen BV, The Netherlands) and several colonies were selected for miniprep (QIAprep® spin, QIAGEN GmbH, Germany).
  • the purified plasmids were checked for insert before transformation into a strain of Bacillus subtilis derived from S.
  • subtilis DN 1885 with disrupted apr, npr and pel genes (Diderichsen et al (1990), J. Bacterid., 172, 4315-4321 ).
  • the disruption was performed essentially as described in "Bacillus subtilis and other Gram-Positive Bacteria," American Society for Microbiology, p.618, eds. A.L. Sonenshein, J.A. Hoch and Richard Losick (1993).
  • Transformed cells were plated on 1 % skim milk LB-PG agar plates, supplemented with 6 ⁇ g/ml chloramphenicol. The plated cells were incubated over night at 37°C and protease containing colonies were identified by a surrounding clearing zone. Protease positive colonies were selected and the coding sequence of the expressed enzyme from the expression construct was confirmed by DNA sequence analysis.
  • This procedure relates to purification of a 2 liter scale fermentation for the production of the subtilases of the invention in a Bacillus host cell.
  • the filtrates are concentrated to approximately 400 ml using an Amicon ® CH2A UF unit equipped with an Amicon ® S1Y10 UF cartridge.
  • the UF concentrate is centrifuged and filtered prior to absorption at room temperature on a Bacitracin affinddle eluted from the Bacitracin column at room temperature using 25% 2-propanol and 1 M sodium chloride in a buffer solution with 0.01 dimethylglutaric acid, 0.1 M boric acid and 0.002 M calcium chloride adjusted to pH 7.
  • fractions with protease activity from the Bacitracin purification step are combined and applied to a 750 ml Sephadex ® G25 column (5 cm dia.) equilibrated with a buffer containing 0.01 dimethylglutaric acid, 0.2 M boric acid and 0.002 m calcium chloride adjusted to pH 6.5.
  • Fractions with proteolytic activity from the Sephadex ® G25 column are combined and applied to a 150 ml CM Sepharose ® CL 6B cation exchange column (5 cm dia.) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid, and 0.002 M calcium chloride adjusted to pH 6.5.
  • protease is eluted using a linear gradient of 0-0.1 M sodium chloride in 2 litres of the same buffer.
  • subtilase containing fractions from the CM Sepharose ® column are combined and concentrated in an Amicon ® ultrafiltration cell equipped with a
  • the stability of the produced subtilases was evaluated in a standard Western European dishwashing tablet detergent without other enzymes than the experimentally added subtilases.
  • the stability of the subtilases is determined as the residual proteolytic activity after incubation of the subtilase in a detergent.
  • proteolytic activity was determined with casein as substrate.
  • Casein Protease Unit CPU is defined as the amount of protease liberating about 1 ⁇ M of primary amino groups (determined by comparison with a serine standard) per mi ⁇ incubation for about 30 minutes at about 25 0 C at pH 9.5.
  • the proteolytic activity may also be determined by measuring the specific hydrolysis of succinyl-Ala-Ala-Pro-Leu-p-nitroanilide by said protease.
  • the substrate is initially dissolved in for example, DMSO (Dimethyl Sulfoxide) and then diluted about 50 fold in about 0.035 M borate buffer, about pH 9.45. All protease samples may be diluted about 5-10 fold by the same borate buffer. Equal volumes of the substrate solution and sample are mixed in a well of an ELISA reader plate and read at about 405 nm at 25 0 C. All sample activities and concentrations are normalized to the standard protease solution activity and concentration, respectively.
  • a typical Western European tablet detergent for automated dishwashing was dissolved
  • subtilases were diluted to a concentration of 2-4 CPU/ml in Britten Robinson buffer (Britten Robinson buffer is: 40 mM Phosphate, 40 mM Acetate and 40 mM Borate) pH9.5.
  • Britten Robinson buffer is: 40 mM Phosphate, 40 mM Acetate and 40 mM Borate pH9.5.
  • subtilase sample was diluted 1:9 in detergent solution (detergent concentration in the stability test is 5 g/L) these samples were incubated at 55°C for 30 minutes prior to analysis by addition of casein substrate.
  • the assay was started by addition of 2 volumes of casein substrate (casein substrate was 2 g of casein (Merck, Hammerstein grade) in 100 ml of Britten Robinson buffer pH 9.5, pH was re-adjusted to 9.5 when the casein is in solution). Samples are kept isothermic at 25 0 C for 30 minutes.
  • TCA solution is 89.46 g of Tri-chloric acid, 149.48 g of Sodium acetate-tri-hydrate and 94.5 ml of glacial acetic acid in 2.5 L of deionised water.
  • TCA solution is 89.46 g of Tri-chloric acid, 149.48 g of Sodium acetate-tri-hydrate and 94.5 ml of glacial acetic acid in 2.5 L of deionised water.
  • the samples are incubated at ambient temperature for at least 20 minutes and filtered through Whatman ® paper filter no. 42.
  • OPA reagent is composed of: 3.812 g of borax, 0.08% EtOH, 0.2% DTT and 80 mg of o-phthal-dialdehyd in 100 ml water. Absorption at 34OnM is measured and CPU is calculated from the concentration of free amines on a standard of a solution of 0.01% L-serine (Merck art. 7769).
  • subtilases of the invention exhibit improved stability in a detergent as compared to the prior art.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Detergent Compositions (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

L'invention concerne de nouvelles subtilases de type JP170 issues de bactéries de type sauvage, leurs hybrides ainsi que des procédés de construction et de production de ces protéases. Par ailleurs, l'invention concerne l'utilisation de ces subtilases dans des détergents, tels que les détergents à lessive ou les détergents de lave-vaisselle automatique.
PCT/DK2005/000598 2004-09-21 2005-09-21 Subtilases WO2006032279A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
DE602005026541T DE602005026541D1 (de) 2004-09-21 2005-09-21 Subtilasen
AT05784169T ATE499439T1 (de) 2004-09-21 2005-09-21 Subtilasen
US11/575,544 US7811979B2 (en) 2004-09-21 2005-09-21 Subtilases
EP05784169A EP1794297B1 (fr) 2004-09-21 2005-09-21 Subtilases
US12/856,964 US7993900B2 (en) 2004-09-21 2010-08-16 Subtilases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA200401430 2004-09-21
DKPA200401430 2004-09-21

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US11/575,544 A-371-Of-International US7811979B2 (en) 2004-09-21 2005-09-21 Subtilases
US12/856,964 Division US7993900B2 (en) 2004-09-21 2010-08-16 Subtilases

Publications (1)

Publication Number Publication Date
WO2006032279A1 true WO2006032279A1 (fr) 2006-03-30

Family

ID=35285565

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2005/000598 WO2006032279A1 (fr) 2004-09-21 2005-09-21 Subtilases

Country Status (5)

Country Link
US (2) US7811979B2 (fr)
EP (1) EP1794297B1 (fr)
AT (1) ATE499439T1 (fr)
DE (1) DE602005026541D1 (fr)
WO (1) WO2006032279A1 (fr)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7666618B2 (en) 2004-07-16 2010-02-23 Danisco A/S Lipolytic enzyme: uses thereof in the food industry
US7718408B2 (en) 2003-12-24 2010-05-18 Danisco A/S Method
US7718204B2 (en) 1998-07-21 2010-05-18 Danisco A/S Foodstuff
US7807398B2 (en) 2003-01-17 2010-10-05 Danisco A/S Method of using lipid acyltransferase
WO2010126156A2 (fr) * 2009-04-30 2010-11-04 Kao Corporation Variants de protéase alcaline
US7906307B2 (en) 2003-12-24 2011-03-15 Danisco A/S Variant lipid acyltransferases and methods of making
US7955814B2 (en) 2003-01-17 2011-06-07 Danisco A/S Method
US7960150B2 (en) 2007-01-25 2011-06-14 Danisco A/S Production of a lipid acyltransferase from transformed Bacillus licheniformis cells
US8012732B2 (en) 2004-03-12 2011-09-06 Danisco A/S Fungal lypolytic and amylase enzyme composition and methods using the same
US8030044B2 (en) 2003-12-24 2011-10-04 Danisco A/S Lipid acyltransferases
USRE43135E1 (en) 2001-05-18 2012-01-24 Danisco A/S Method of improving dough and bread quality
USRE43341E1 (en) 1995-06-07 2012-05-01 Danisco A/S Method of improving the properties of a flour dough, a flour dough improving composition and improved food products
US8652809B2 (en) 2007-08-17 2014-02-18 Dupont Nutrition Biosciences Aps Method for producing ultra-heat treatment milk

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1794296T3 (da) 2004-09-21 2012-07-30 Novozymes As Subtilaser
US9302294B2 (en) 2013-08-02 2016-04-05 Babcock Noell Gmbh Separating radioactive contaminated materials from cleared materials resulting from decommissioning a power plant

Citations (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1296839A (fr) 1969-05-29 1972-11-22
GB1372034A (en) 1970-12-31 1974-10-30 Unilever Ltd Detergent compositions
GB1483591A (en) 1973-07-23 1977-08-24 Novo Industri As Process for coating water soluble or water dispersible particles by means of the fluid bed technique
US4106991A (en) 1976-07-07 1978-08-15 Novo Industri A/S Enzyme granulate composition and process for forming enzyme granulates
US4435307A (en) 1980-04-30 1984-03-06 Novo Industri A/S Detergent cellulase
EP0218272A1 (fr) 1985-08-09 1987-04-15 Gist-Brocades N.V. Enzymes lipolytiques et leur usage dans des compositions détergentes
US4661452A (en) 1984-05-29 1987-04-28 Novo Industri A/S Enzyme containing granulates useful as detergent additives
EP0238216A1 (fr) 1986-02-20 1987-09-23 Albright & Wilson Limited Systèmes d'enzymes protégés
WO1988001293A1 (fr) 1986-08-14 1988-02-25 Novo Industri A/S Protease alcaline derivee de la production de bacillus et son utilisation
EP0258068A2 (fr) 1986-08-29 1988-03-02 Novo Nordisk A/S Additif enzymatique pour détergent
EP0260105A2 (fr) 1986-09-09 1988-03-16 Genencor, Inc. Préparation d'enzymes à activité modifiée
EP0305216A1 (fr) 1987-08-28 1989-03-01 Novo Nordisk A/S Lipase recombinante de humicola et procédé de production de lipases recombinantes de humicola
WO1989006279A1 (fr) 1988-01-07 1989-07-13 Novo-Nordisk A/S Genes de subtilisine mutes
WO1989006270A1 (fr) 1988-01-07 1989-07-13 Novo-Nordisk A/S Detergent enzymatique
EP0331376A2 (fr) 1988-02-28 1989-09-06 Amano Pharmaceutical Co., Ltd. ADN recombinant, bactérie du genre pseudomonas le contenant et son utilisation dans un procédé de production de lipase
WO1989009259A1 (fr) 1988-03-24 1989-10-05 Novo-Nordisk A/S Preparation de cellulase
EP0407225A1 (fr) 1989-07-07 1991-01-09 Unilever Plc Enzymes et compositions détergentes enzymatiques
WO1991016422A1 (fr) 1990-04-14 1991-10-31 Kali-Chemie Aktiengesellschaft Lipases bacillaires alcalines, sequences d'adn de codage pour celles-ci et bacilles produisant ces lipases
WO1992005249A1 (fr) 1990-09-13 1992-04-02 Novo Nordisk A/S Variantes lipasiques
EP0495257A1 (fr) 1991-01-16 1992-07-22 The Procter & Gamble Company Compositions de détergent compactes contenant de la cellulase de haute activité
WO1992017577A1 (fr) 1991-04-03 1992-10-15 Novo Nordisk A/S Nouvelles proteases
WO1992019729A1 (fr) 1991-05-01 1992-11-12 Novo Nordisk A/S Enzymes stabilisees et compositions detergentes
WO1992019709A1 (fr) 1991-04-30 1992-11-12 The Procter & Gamble Company Detergents liquides contenant un adjuvant et un complexe polyol acide borique qui sert a inhiber l'enzyme proteolytique
WO1992019708A1 (fr) 1991-04-30 1992-11-12 The Procter & Gamble Company Detergents liquides comprenant un ester de borate aromatique servant a inhiber l'enzyme proteolytique
EP0531372A1 (fr) 1990-05-09 1993-03-17 Novo Nordisk As Preparation de cellulase comprenant un enzyme d'endoglucanase.
EP0531315A1 (fr) 1990-05-09 1993-03-17 Novo Nordisk As Enzyme capable de degrader la cellulose ou l"hemicellulose.
WO1993024618A1 (fr) 1992-06-01 1993-12-09 Novo Nordisk A/S Variante de peroxydase avec stabilite amelioree vis-a-vis du peroxyde d'hydrogene
WO1994001541A1 (fr) 1992-07-06 1994-01-20 Novo Nordisk A/S Lipase de c. antarctica et variantes lipasiques
WO1994002597A1 (fr) 1992-07-23 1994-02-03 Novo Nordisk A/S Alpha-amylase mutante, detergent, agent de lavage de vaisselle et de liquefaction
WO1994007998A1 (fr) 1992-10-06 1994-04-14 Novo Nordisk A/S Variantes de cellulase
WO1994018314A1 (fr) 1993-02-11 1994-08-18 Genencor International, Inc. Alpha-amylase stable a l'oxydation
WO1994025583A1 (fr) 1993-05-05 1994-11-10 Novo Nordisk A/S Protease recombinee de type trypsine
WO1994025578A1 (fr) 1993-04-27 1994-11-10 Gist-Brocades N.V. Nouveaux variants de lipase utilises dans des detergents
JPH0762152A (ja) 1993-08-20 1995-03-07 Bridgestone Corp 耐カット性が優れたタイヤ
WO1995006720A1 (fr) 1993-08-30 1995-03-09 Showa Denko K.K. Nouvelle lipase, micro-organisme la produisant, procede de production de cette lipase, et utilisation de ladite lipase
WO1995010602A1 (fr) 1993-10-13 1995-04-20 Novo Nordisk A/S Variants de peroxydase stables par rapport a h2o¿2?
WO1995014783A1 (fr) 1993-11-24 1995-06-01 Showa Denko K.K. Gene de lipase et lipase variante
WO1995022615A1 (fr) 1994-02-22 1995-08-24 Novo Nordisk A/S Procede pour preparer un variant d'une enzyme lipolytique
WO1995024471A1 (fr) 1994-03-08 1995-09-14 Novo Nordisk A/S Nouvelles cellulases alcalines
WO1995030744A2 (fr) 1994-05-04 1995-11-16 Genencor International Inc. Lipases a resistance aux tensioactifs amelioree
WO1995035381A1 (fr) 1994-06-20 1995-12-28 Unilever N.V. Lipases modifiees provenant de pseudomonas et leur utilisation
WO1996000292A1 (fr) 1994-06-23 1996-01-04 Unilever N.V. Pseudomonas lipases modifiees et leur utilisation
WO1996011262A1 (fr) 1994-10-06 1996-04-18 Novo Nordisk A/S Enzyme et preparation enzymatique presentant une activite endoglucanase
WO1996012012A1 (fr) 1994-10-14 1996-04-25 Solvay S.A. Lipase, micro-organisme la produisant, procede de preparation de cette lipase et utilisation de celle-ci
WO1996013580A1 (fr) 1994-10-26 1996-05-09 Novo Nordisk A/S Enzyme a activite lipolytique
WO1996023873A1 (fr) 1995-02-03 1996-08-08 Novo Nordisk A/S Alleles d'amylase-alpha
WO1996027002A1 (fr) 1995-02-27 1996-09-06 Novo Nordisk A/S Nouveau gene de lipase et procede de production de lipase a l'aide de celui-ci
WO1996029397A1 (fr) 1995-03-17 1996-09-26 Novo Nordisk A/S Nouvelles endoglucanases
WO1997004079A1 (fr) 1995-07-14 1997-02-06 Novo Nordisk A/S Enzyme modifiee a activite lipolytique
WO1997007202A1 (fr) 1995-08-11 1997-02-27 Novo Nordisk A/S Nouvelles enzymes lipolytiques
US5648263A (en) 1988-03-24 1997-07-15 Novo Nordisk A/S Methods for reducing the harshness of a cotton-containing fabric
WO1997043424A1 (fr) 1996-05-14 1997-11-20 Genencor International, Inc. α-AMYLASES MODIFIEES POSSEDANT DES PROPRIETES MODIFIEES DE FIXATION DU CALCIUM
WO1998008940A1 (fr) 1996-08-26 1998-03-05 Novo Nordisk A/S Nouvelle endoglucanase
WO1998012307A1 (fr) 1996-09-17 1998-03-26 Novo Nordisk A/S Variants de cellulase
WO1998015257A1 (fr) 1996-10-08 1998-04-16 Novo Nordisk A/S Derives de l'acide diaminobenzoique en tant que precurseurs de matieres tinctoriales
WO1998020116A1 (fr) 1996-11-04 1998-05-14 Novo Nordisk A/S Variants de subtilase et compositions
WO1998020115A1 (fr) 1996-11-04 1998-05-14 Novo Nordisk A/S Variants et compositions de subtilase
WO1998034946A1 (fr) 1997-02-12 1998-08-13 Massachusetts Institute Of Technology Daxx, nouvelle proteine fixatrice de fas activant une jnk (kinase n-terminale de jun) et l'apoptose
WO1998056927A2 (fr) 1997-06-12 1998-12-17 Novo Nordisk Biotech, Inc. Acides nucleiques codant des polypeptides a fonction protease
US5955310A (en) 1998-02-26 1999-09-21 Novo Nordisk Biotech, Inc. Methods for producing a polypeptide in a bacillus cell
EP1029920A1 (fr) 1997-10-07 2000-08-23 Kao Corporation Protease alcaline
WO2000071691A1 (fr) 1999-05-20 2000-11-30 Novozymes A/S Enzymes de subtilase des sous-groupes i-s1 et i-s2 possedant au moins un residu supplementaire d'acide amine entre les positions 125 et 126
EP1209233A2 (fr) 2000-11-22 2002-05-29 Kao Corporation Protéases alcalines
US20040072321A1 (en) 2002-06-26 2004-04-15 Kao Corporation Alkaline protease
WO2004067737A2 (fr) * 2003-01-30 2004-08-12 Novozymes A/S Subtilases
JP4197182B2 (ja) 2005-07-15 2008-12-17 近畿車輌株式会社 鉄道車両の袖仕切り構造

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04197182A (ja) 1990-11-28 1992-07-16 Lion Corp アルカリプロテアーゼＹａ酵素をコードするＤＮＡ及び該ＤＮＡを用いたアルカリプロテアーゼＹａの製造方法
US7727756B2 (en) * 2003-03-21 2010-06-01 Novozymes A/S Subtilases
DK1794296T3 (da) 2004-09-21 2012-07-30 Novozymes As Subtilaser
US7741095B2 (en) * 2004-09-21 2010-06-22 Novozymes A/S Subtilases

Patent Citations (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1296839A (fr) 1969-05-29 1972-11-22
GB1372034A (en) 1970-12-31 1974-10-30 Unilever Ltd Detergent compositions
GB1483591A (en) 1973-07-23 1977-08-24 Novo Industri As Process for coating water soluble or water dispersible particles by means of the fluid bed technique
US4106991A (en) 1976-07-07 1978-08-15 Novo Industri A/S Enzyme granulate composition and process for forming enzyme granulates
US4435307A (en) 1980-04-30 1984-03-06 Novo Industri A/S Detergent cellulase
US4661452A (en) 1984-05-29 1987-04-28 Novo Industri A/S Enzyme containing granulates useful as detergent additives
EP0218272A1 (fr) 1985-08-09 1987-04-15 Gist-Brocades N.V. Enzymes lipolytiques et leur usage dans des compositions détergentes
EP0238216A1 (fr) 1986-02-20 1987-09-23 Albright & Wilson Limited Systèmes d'enzymes protégés
WO1988001293A1 (fr) 1986-08-14 1988-02-25 Novo Industri A/S Protease alcaline derivee de la production de bacillus et son utilisation
EP0258068A2 (fr) 1986-08-29 1988-03-02 Novo Nordisk A/S Additif enzymatique pour détergent
EP0260105A2 (fr) 1986-09-09 1988-03-16 Genencor, Inc. Préparation d'enzymes à activité modifiée
EP0305216A1 (fr) 1987-08-28 1989-03-01 Novo Nordisk A/S Lipase recombinante de humicola et procédé de production de lipases recombinantes de humicola
WO1989006279A1 (fr) 1988-01-07 1989-07-13 Novo-Nordisk A/S Genes de subtilisine mutes
WO1989006270A1 (fr) 1988-01-07 1989-07-13 Novo-Nordisk A/S Detergent enzymatique
EP0331376A2 (fr) 1988-02-28 1989-09-06 Amano Pharmaceutical Co., Ltd. ADN recombinant, bactérie du genre pseudomonas le contenant et son utilisation dans un procédé de production de lipase
US5691178A (en) 1988-03-22 1997-11-25 Novo Nordisk A/S Fungal cellulase composition containing alkaline CMC-endoglucanase and essentially no cellobiohydrolase
US5776757A (en) 1988-03-24 1998-07-07 Novo Nordisk A/S Fungal cellulase composition containing alkaline CMC-endoglucanase and essentially no cellobiohydrolase and method of making thereof
WO1989009259A1 (fr) 1988-03-24 1989-10-05 Novo-Nordisk A/S Preparation de cellulase
US5648263A (en) 1988-03-24 1997-07-15 Novo Nordisk A/S Methods for reducing the harshness of a cotton-containing fabric
EP0407225A1 (fr) 1989-07-07 1991-01-09 Unilever Plc Enzymes et compositions détergentes enzymatiques
WO1991016422A1 (fr) 1990-04-14 1991-10-31 Kali-Chemie Aktiengesellschaft Lipases bacillaires alcalines, sequences d'adn de codage pour celles-ci et bacilles produisant ces lipases
EP0531372A1 (fr) 1990-05-09 1993-03-17 Novo Nordisk As Preparation de cellulase comprenant un enzyme d'endoglucanase.
US5686593A (en) 1990-05-09 1997-11-11 Novo Nordisk A/S Enzyme capable of degrading cellulose or hemicellulose
US5457046A (en) 1990-05-09 1995-10-10 Novo Nordisk A/S Enzyme capable of degrading cellullose or hemicellulose
EP0531315A1 (fr) 1990-05-09 1993-03-17 Novo Nordisk As Enzyme capable de degrader la cellulose ou l"hemicellulose.
US5763254A (en) 1990-05-09 1998-06-09 Novo Nordisk A/S Enzyme capable of degrading cellulose or hemicellulose
WO1992005249A1 (fr) 1990-09-13 1992-04-02 Novo Nordisk A/S Variantes lipasiques
EP0495257A1 (fr) 1991-01-16 1992-07-22 The Procter & Gamble Company Compositions de détergent compactes contenant de la cellulase de haute activité
WO1992017577A1 (fr) 1991-04-03 1992-10-15 Novo Nordisk A/S Nouvelles proteases
WO1992019709A1 (fr) 1991-04-30 1992-11-12 The Procter & Gamble Company Detergents liquides contenant un adjuvant et un complexe polyol acide borique qui sert a inhiber l'enzyme proteolytique
WO1992019708A1 (fr) 1991-04-30 1992-11-12 The Procter & Gamble Company Detergents liquides comprenant un ester de borate aromatique servant a inhiber l'enzyme proteolytique
WO1992019729A1 (fr) 1991-05-01 1992-11-12 Novo Nordisk A/S Enzymes stabilisees et compositions detergentes
WO1993024618A1 (fr) 1992-06-01 1993-12-09 Novo Nordisk A/S Variante de peroxydase avec stabilite amelioree vis-a-vis du peroxyde d'hydrogene
WO1994001541A1 (fr) 1992-07-06 1994-01-20 Novo Nordisk A/S Lipase de c. antarctica et variantes lipasiques
WO1994002597A1 (fr) 1992-07-23 1994-02-03 Novo Nordisk A/S Alpha-amylase mutante, detergent, agent de lavage de vaisselle et de liquefaction
WO1994007998A1 (fr) 1992-10-06 1994-04-14 Novo Nordisk A/S Variantes de cellulase
WO1994018314A1 (fr) 1993-02-11 1994-08-18 Genencor International, Inc. Alpha-amylase stable a l'oxydation
WO1994025578A1 (fr) 1993-04-27 1994-11-10 Gist-Brocades N.V. Nouveaux variants de lipase utilises dans des detergents
WO1994025583A1 (fr) 1993-05-05 1994-11-10 Novo Nordisk A/S Protease recombinee de type trypsine
JPH0762152A (ja) 1993-08-20 1995-03-07 Bridgestone Corp 耐カット性が優れたタイヤ
WO1995006720A1 (fr) 1993-08-30 1995-03-09 Showa Denko K.K. Nouvelle lipase, micro-organisme la produisant, procede de production de cette lipase, et utilisation de ladite lipase
WO1995010602A1 (fr) 1993-10-13 1995-04-20 Novo Nordisk A/S Variants de peroxydase stables par rapport a h2o¿2?
WO1995014783A1 (fr) 1993-11-24 1995-06-01 Showa Denko K.K. Gene de lipase et lipase variante
WO1995022615A1 (fr) 1994-02-22 1995-08-24 Novo Nordisk A/S Procede pour preparer un variant d'une enzyme lipolytique
WO1995024471A1 (fr) 1994-03-08 1995-09-14 Novo Nordisk A/S Nouvelles cellulases alcalines
WO1995030744A2 (fr) 1994-05-04 1995-11-16 Genencor International Inc. Lipases a resistance aux tensioactifs amelioree
WO1995035381A1 (fr) 1994-06-20 1995-12-28 Unilever N.V. Lipases modifiees provenant de pseudomonas et leur utilisation
WO1996000292A1 (fr) 1994-06-23 1996-01-04 Unilever N.V. Pseudomonas lipases modifiees et leur utilisation
WO1996011262A1 (fr) 1994-10-06 1996-04-18 Novo Nordisk A/S Enzyme et preparation enzymatique presentant une activite endoglucanase
WO1996012012A1 (fr) 1994-10-14 1996-04-25 Solvay S.A. Lipase, micro-organisme la produisant, procede de preparation de cette lipase et utilisation de celle-ci
WO1996013580A1 (fr) 1994-10-26 1996-05-09 Novo Nordisk A/S Enzyme a activite lipolytique
WO1996023873A1 (fr) 1995-02-03 1996-08-08 Novo Nordisk A/S Alleles d'amylase-alpha
WO1996027002A1 (fr) 1995-02-27 1996-09-06 Novo Nordisk A/S Nouveau gene de lipase et procede de production de lipase a l'aide de celui-ci
WO1996029397A1 (fr) 1995-03-17 1996-09-26 Novo Nordisk A/S Nouvelles endoglucanases
WO1997004079A1 (fr) 1995-07-14 1997-02-06 Novo Nordisk A/S Enzyme modifiee a activite lipolytique
WO1997007202A1 (fr) 1995-08-11 1997-02-27 Novo Nordisk A/S Nouvelles enzymes lipolytiques
WO1997043424A1 (fr) 1996-05-14 1997-11-20 Genencor International, Inc. α-AMYLASES MODIFIEES POSSEDANT DES PROPRIETES MODIFIEES DE FIXATION DU CALCIUM
WO1998008940A1 (fr) 1996-08-26 1998-03-05 Novo Nordisk A/S Nouvelle endoglucanase
WO1998012307A1 (fr) 1996-09-17 1998-03-26 Novo Nordisk A/S Variants de cellulase
WO1998015257A1 (fr) 1996-10-08 1998-04-16 Novo Nordisk A/S Derives de l'acide diaminobenzoique en tant que precurseurs de matieres tinctoriales
WO1998020115A1 (fr) 1996-11-04 1998-05-14 Novo Nordisk A/S Variants et compositions de subtilase
WO1998020116A1 (fr) 1996-11-04 1998-05-14 Novo Nordisk A/S Variants de subtilase et compositions
WO1998034946A1 (fr) 1997-02-12 1998-08-13 Massachusetts Institute Of Technology Daxx, nouvelle proteine fixatrice de fas activant une jnk (kinase n-terminale de jun) et l'apoptose
WO1998056927A2 (fr) 1997-06-12 1998-12-17 Novo Nordisk Biotech, Inc. Acides nucleiques codant des polypeptides a fonction protease
US5891701A (en) 1997-06-12 1999-04-06 Novo Nordisk Biotech Inc. Nucleic acids encoding a polypeptide having protease activity
EP1029920A1 (fr) 1997-10-07 2000-08-23 Kao Corporation Protease alcaline
US6376227B1 (en) 1997-10-07 2002-04-23 Kao Corporation Alkaline protease
US5955310A (en) 1998-02-26 1999-09-21 Novo Nordisk Biotech, Inc. Methods for producing a polypeptide in a bacillus cell
WO2000071691A1 (fr) 1999-05-20 2000-11-30 Novozymes A/S Enzymes de subtilase des sous-groupes i-s1 et i-s2 possedant au moins un residu supplementaire d'acide amine entre les positions 125 et 126
EP1209233A2 (fr) 2000-11-22 2002-05-29 Kao Corporation Protéases alcalines
US20040072321A1 (en) 2002-06-26 2004-04-15 Kao Corporation Alkaline protease
WO2004067737A2 (fr) * 2003-01-30 2004-08-12 Novozymes A/S Subtilases
JP4197182B2 (ja) 2005-07-15 2008-12-17 近畿車輌株式会社 鉄道車両の袖仕切り構造

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
"Efficient manganese catalysts for low-temperature bleaching", NATURE, vol. 369, 1994, pages 637 - 639
A. MAURER, DETERGENT PROTEASES. CURR OPINION IN BIOTECH, vol. 15, 2004, pages 330 - 334
DARTOIS ET AL., BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1131, 1993, pages 253 - 360
DATABASE EMBL [online] 2 September 2003 (2003-09-02), "Bacillus sp. KSM-9865 gene for protease, complete cds.", XP002354927, retrieved from EBI accession no. EM_PRO:AB084155 Database accession no. AB084155 *
DIDERICHSEN ET AL., J. BACTERIOL., vol. 172, 1990, pages 4315 - 4321
FEINBERG, A. P.; VOGELSTEIN, B., ANAL. BIOCHEM., vol. 132, 1983, pages 6 - 13
MAURER KARL-HEINZ: "Detergent proteases.", CURRENT OPINION IN BIOTECHNOLOGY. AUG 2004, vol. 15, no. 4, August 2004 (2004-08-01), pages 330 - 334, XP002355089, ISSN: 0958-1669 *
S.B. NEEDLEMAN; C.D. WUNSCH, JOURNAL OF MOLECULAR BIOLOGY, vol. 48, 1970, pages 443 - 445
SAEKI KATSUHISA ET AL: "Novel oxidatively stable subtilisin-like serine proteases from alkaliphilic Bacillus spp.: Enzymatic properties, sequences, and evolutionary relationships", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 279, no. 2, 20 December 2000 (2000-12-20), pages 313 - 319, XP002238277, ISSN: 0006-291X *
SIEZEN ET AL., PROTEIN ENGNG., vol. 4, 1991, pages 719 - 737
SIEZEN ET AL., PROTEIN SCIENCE, vol. 6, 1997, pages 501 - 523
SIEZEN R.J.; LEUNISSEN J.A.M., PROTEIN SCIENCE, vol. 6, 1997, pages 501 - 523

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USRE43341E1 (en) 1995-06-07 2012-05-01 Danisco A/S Method of improving the properties of a flour dough, a flour dough improving composition and improved food products
US7972638B2 (en) 1998-07-21 2011-07-05 Danisco A/S Foodstuff
US7718204B2 (en) 1998-07-21 2010-05-18 Danisco A/S Foodstuff
US7781001B2 (en) 1998-07-21 2010-08-24 Danisco A/S Foodstuff
US8163315B2 (en) 1998-07-21 2012-04-24 Danisco A/S Foodstuff
USRE43135E1 (en) 2001-05-18 2012-01-24 Danisco A/S Method of improving dough and bread quality
US8278062B2 (en) 2003-01-14 2012-10-02 Dupont Nutrition Biosciences Aps Method of using lipid acyltransferase
US8003095B2 (en) 2003-01-17 2011-08-23 Danisco A/S Method of using lipid acyltransferase
US7807398B2 (en) 2003-01-17 2010-10-05 Danisco A/S Method of using lipid acyltransferase
US7955813B2 (en) 2003-01-17 2011-06-07 Danisco, A/S Method of using lipid acyltransferase
US7955814B2 (en) 2003-01-17 2011-06-07 Danisco A/S Method
US8440435B2 (en) 2003-12-24 2013-05-14 Dupont Nutrition Biosciences Aps Method for reducing 1,2-diglyceride content of an edible oil
US7906307B2 (en) 2003-12-24 2011-03-15 Danisco A/S Variant lipid acyltransferases and methods of making
US8030044B2 (en) 2003-12-24 2011-10-04 Danisco A/S Lipid acyltransferases
US7718408B2 (en) 2003-12-24 2010-05-18 Danisco A/S Method
US8012732B2 (en) 2004-03-12 2011-09-06 Danisco A/S Fungal lypolytic and amylase enzyme composition and methods using the same
US7666618B2 (en) 2004-07-16 2010-02-23 Danisco A/S Lipolytic enzyme: uses thereof in the food industry
US8192782B2 (en) 2004-07-16 2012-06-05 Danisco A/S Enzymatic oil-degumming method
US8535900B2 (en) 2004-07-16 2013-09-17 Dupont Nutrition Biosciences Aps Lipolytic enzyme uses thereof in the food industry
US8889371B2 (en) 2004-07-16 2014-11-18 Dupont Nutrition Biosciences Aps Lipolytic enzyme: uses thereof in the food industry
US7960150B2 (en) 2007-01-25 2011-06-14 Danisco A/S Production of a lipid acyltransferase from transformed Bacillus licheniformis cells
US8652809B2 (en) 2007-08-17 2014-02-18 Dupont Nutrition Biosciences Aps Method for producing ultra-heat treatment milk
WO2010126156A2 (fr) * 2009-04-30 2010-11-04 Kao Corporation Variants de protéase alcaline
CN102421893A (zh) * 2009-04-30 2012-04-18 花王株式会社 碱性蛋白酶变体
WO2010126156A3 (fr) * 2009-04-30 2011-01-06 Kao Corporation Variants de protéase alcaline
US8778650B2 (en) 2009-04-30 2014-07-15 Kao Corporation Alkaline protease variants
EP3061817A1 (fr) * 2009-04-30 2016-08-31 Kao Corporation Variants de protéase alcaline

Also Published As

Publication number Publication date
US20100311635A1 (en) 2010-12-09
US20090148889A1 (en) 2009-06-11
DE602005026541D1 (de) 2011-04-07
US7993900B2 (en) 2011-08-09
US7811979B2 (en) 2010-10-12
ATE499439T1 (de) 2011-03-15
EP1794297A1 (fr) 2007-06-13
EP1794297B1 (fr) 2011-02-23

Similar Documents

Publication Publication Date Title
US7811979B2 (en) Subtilases
US7951574B2 (en) Subtilases
EP1409659B1 (fr) Variants de subtilase
AU773066B2 (en) Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
US8658410B2 (en) Subtilases
US7951573B2 (en) Subtilases
EP1141256A1 (fr) Enzymes subtilases des sous groupes i-s1 et i-s2 possedant un residu acide amine supplementaire dans un region en boucle de site actif
EP1183343A1 (fr) Enzymes de subtilase des sous-groupes i-s1 et i-s2 possedant au moins un residu supplementaire d'acide amine entre les positions 125 et 126
EP1920053B1 (fr) Subtilases
EP1141260A1 (fr) Enzymes substilases des sous-groupes i-s1 et i-s2 ayant un residu d'acide amine additionnel dans une region boucle de site actif
WO2000037624A1 (fr) Enzymes subtilases des sous-groupes i-s1 et i-s2 ayant un residu d'acide amine additionnel dans une region boucle de site actif
EP1141259A1 (fr) Enzymes subtilases des sous-groupes i-s1 et i-s2 ayant un residu d'acide amine additionnel dans une region boucle de site actif

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2005784169

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11575544

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWP Wipo information: published in national office

Ref document number: 2005784169

Country of ref document: EP