WO2006017929A1 - Protein production method utilizing yebf - Google Patents

Protein production method utilizing yebf Download PDF

Info

Publication number
WO2006017929A1
WO2006017929A1 PCT/CA2005/001249 CA2005001249W WO2006017929A1 WO 2006017929 A1 WO2006017929 A1 WO 2006017929A1 CA 2005001249 W CA2005001249 W CA 2005001249W WO 2006017929 A1 WO2006017929 A1 WO 2006017929A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
yebf
encodes
expression vector
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2005/001249
Other languages
English (en)
French (fr)
Inventor
Joel Weiner
Guijin Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Alberta
Original Assignee
University of Alberta
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Alberta filed Critical University of Alberta
Priority to AU2005274628A priority Critical patent/AU2005274628A1/en
Priority to AT05774845T priority patent/ATE512230T1/de
Priority to CA002576083A priority patent/CA2576083A1/en
Priority to JP2007526148A priority patent/JP2008509682A/ja
Priority to EP05774845A priority patent/EP1791961B1/en
Publication of WO2006017929A1 publication Critical patent/WO2006017929A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion

Definitions

  • the present invention relates to the field of secretion of proteins by host cells, into a growth medium.
  • Protein secretion from bacteria plays an important role in many aspects of the bacterial life cycle, including the formation of pili and flagella, the secretion of extracellular enzymes to digest polymers for nutritional purposes and the secretion of toxins to kill host cells in infections of humans, animals and plants. It is generally accepted that non-pathogenic laboratory strains of E. coli, particularly K12 strains, do not naturally secrete proteins into the extracellular medium under routine growth conditions 6 ' 8 , although gene sequence analysis implies the possible existence of a protein secretion pathway 6 . Pugsley has postulated that this system has been lost as a result of prolonged laboratory passage and storage over many decades 6 .
  • Bacillus subtilis has a well characterized protein excretion system for extracellular enzymes such as ⁇ -amylase and subtilin and this organism has been used as an alternative for the extracellular production of recombinant proteins 7 .
  • B. subtilis has several disadvantages including plasmid instability, lack of suitable expression control systems and degradation of the recombinant proteins in the culture medium by the high level of proteolytic enzymes that are also secreted from these cells 7 .
  • plasmid instability plasmid instability
  • suitable expression control systems and degradation of the recombinant proteins in the culture medium by the high level of proteolytic enzymes that are also secreted from these cells 7 .
  • a relatively long culture period is required for B. subtilis.
  • Pugsley's group has also shown that the secretion of an endogenous E. coli chitinase into the medium can occur by co-expressing a cluster of E. coli gsp genes carried on a second plasmid in PAP5066, an hns- inactivated E. coli K12 strain.
  • the gsp genes encode the putative type II secretion machinery proteins of E. coli and are silenced by H- NS protein, a global regulator and nucleoid-structuring protein 11 . Overall, these excretion studies required the artificial induction of secretion machinery proteins.
  • E. coli K12 there are 2 well-identified protein transport pathways across the cytoplasmic membrane- the sec-dependent pathway or the general secretion pathway (GSP) and the sec-independent Mtt/Tat pathway 12 .
  • the GSP of gram-negative bacteria has at least six different terminal branches depending on the secretion pathway in the outer membrane 13 .
  • Genomic analysis of E. coli has identified genes that are homologous to genes encoding secretion proteins in other bacteria. These include gsp and yacC (gspS) homologous to Klebsiella pulS 11 , found at 74.5 and 2.95 minutes on the E. coli chromosome, respectively. Although these genes appear to encode functional proteins 14 , their transcription is turned off under standard growth condition 6 .
  • gsp genes for example, are silenced by H-NS as mentioned above 11 .
  • E. coli is the most widely used bacterium for protein expression both in research and in industry.
  • investigators have explored different ways of producing recombinant proteins in the medium 5 .
  • the accumulation of recombinant proteins in the culture medium has the potential to offer a number of benefits including, increased protein production and purity, reduction in cellular toxicity of over-expressed proteins, avoidance of the formation of inclusion bodies and protein degradation by cytoplasmic proteolytic enzymes. It has also been found that proper recombinant protein folding is enhanced by the more favorable redox potential in the medium 5 .
  • the E. coli yebF gene is predicted to encode a small lipoprotein (Blattner B 1847 or Swiss-Prot P33219) of unknown function attached to the membrane.
  • the yebF gene is part of the yebGFE operon that is negatively regulated by LexA 1 ' 9 .
  • yebF gene expression has been observed under several stress conditions including UV irradiation 2 and DNA damage induced by mitomycin C 3 ' 9 . However, little else has been reported.
  • YebF is a small (10.8 kD) soluble endogenous protein that is naturally secreted into the culture medium by E. coli cells.
  • Commonly used laboratory strains HBlOl (a hybrid of E. coli K12 and B strains), BL21(D ⁇ 3) (a B strain) and MG1655 (a K12 strain) secrete YebF into the medium under standard laboratory conditions.
  • YebF can be used to transport proteins into the growth medium. Fusion proteins comprising YebF and human interleukin-2 (hIL2), the short form of B, subtilis X23 ⁇ - amylase gene 8 lacking the signal sequence and leaderless E. coli alkaline phosphatase, have been expressed and secreted in E. coli. Therefore, YebF can be used to direct the secretion of proteins, polypeptides and peptides into the medium. Further, the secreted fusion proteins are active.
  • hIL2 human interleukin-2
  • hIL2 is a 15kD hydrophobic protein 15
  • the short form of ⁇ -amylase is a 48 kD hydrophilic protein
  • leaderless E. coli alkaline phosphatase is a hydrophilic protein. Therefore, YebF can direct the secretion of both hydrophobic and hydrophilic proteins to the medium. Further, YebF can carry proteins of varying size to the medium. However, it was noted that the secreted YebF-hIL2 fusion was sensitive to proteolytic degradation in the medium.
  • the secreted fusion protein can be readily purified from the medium, for example by affinity chromatography, or it can be readily identified, for example with a fluorescent antibody.
  • Expression of a fusion protein into the culture medium provides a starting material for purification wherein the secreted fusion protein is relatively pure, as compared to proteins expressed in the cytoplasm. Therefore subsequent purification steps may be simpler and less expensive. Further, production of secreted fusion proteins in the medium could reduce the contamination of these proteins with lipopolysaccharides in the purified product . Therefore, in one aspect this invention is a method of producing a protein, polypeptide or peptide of interest that comprises:
  • the bacterial cell can be Escherichia coli.
  • the method may further comprise the step of purifying a secreted fusion protein from the medium in which the bacterial cell is growing.
  • the fusion protein may further comprise at least one tag or at least one protein cleavage site.
  • the invention is a method of secreting a protein, polypeptide or peptide of interest from a bacterial cell into the growth medium comprising:
  • the bacterial cell may be Escherichia coli.
  • the recombinant DNA molecule may further comprise at least one nucleotide sequence that encodes a tag or a protein cleavage site.
  • the invention is the use of YebF, or a biologically active variant or portion thereof to direct the secretion of a protein, polypeptide or peptide of interest into bacterial growth medium.
  • the YebF, or a biologically active variant or portion thereof may be part of a fusion protein that further comprises the protein, polypeptide or peptide of interest.
  • the YebF, or a biologically active variant or portion thereof may be fused amino-terminally to the protein, polypeptide or peptide of interest.
  • the invention is an expression vector that encodes YebF, or a biologically active variant or portion thereof operatively linked to control nucleotide sequences that direct the transcription and the synthesis of the YebF or a biologically active variant or portion thereof.
  • the invention is an expression vector that encodes a fusion protein comprising YebF, or a biologically active variant or portion thereof and a protein, polypeptide or peptide of interest.
  • the nucleotide sequence that encodes the protein, polypeptide or peptide of interest may be located downstream of the nucleotide sequence that encodes YebF, or a biologically active variant or portion thereof.
  • the expression vector may be for use in Escherichia coli.
  • the expression vector may further encode a fusion protein that further comprises at least one tag.
  • FIG. 14 Alignment of the leader sequences of E. coli YebF protein and homologues from other bacteria.
  • E. coli SEQ ID NO: 14
  • S. flexne ⁇ SEQ ID NO: 15
  • S. typhi SEQ ID NO: 16
  • Y. pestis SEQ ID NO: 17
  • P. luminescens SEQ ID NO: 18
  • FIG. 1 Western blot demonstrating the subcellular localization of E. coli YebF and mature YebF. Symbols: S, spheroplasts; P, periplasm; H, hypertonic solution; M, medium (Panel A). Western blot demonstrating secretion of mature YebF protein from E. coli cells over time. Lanes 1-7 show the cells (0 - 180 min) and lanes 8-14 show the medium (0 - 180 min) at 30 min time intervals. Lane F is purified YebF-His 6 (Panel B)
  • FIG. 1 Protein profiles in the medium from HBlOl cells harbouring pMS119EH (Ctr lanes) or pYebFH 6 /MS (YebF lanes). Samples were collected at the times indicated after induction with 0.1 mM IPTG. Proteins were separated on a 10% SDS-Tricine gel.
  • Figure 4 Maldi-TOF linear mode mass spectrometry of purified E. coli YebF protein with a 6-histidine tag.
  • Figure 5. Western blot demonstrating localization of YebF and mature YebF and CRP in cells (C) or medium (M), over time. YebF and mature YebF were detected with anti-His antibody (Panel A), CRP was detected with anti-CRP antibody (Panel B). Lane F in panel A is the purified YebF-His 6 .
  • Panel A ⁇ -amylase activity of the various fluids and subcellular fractions of HBlOl cells harboring: (a) a short form ⁇ -amylase gene fused to yebF gene (pYebF-
  • AmyH 6 (b) a short form ⁇ -amylase gene fused to the sec-leader sequence of yebF (pLS- AmyH 6 ), and (c) a short form ⁇ -amylase gene (pAmyH 6 ). Data is the average of three replicates with the standard deviation shown.
  • Panel B Protein profiles in the medium. HBlOl cells harbouring pAmyH 6 (A lanes), pLS-AmyH 6 (B lanes) and pYebF-AmyH 6 (C lanes) were grown in TB. Protein samples from the medium harvested at the indicated time after induction were prepared as in Methods and Materials. Proteins were separated on 10% SDS-PAGE.
  • Figure 7 Distribution of YebF- ⁇ -amylase and alkaline phosphatase, a periplasmic enzyme. Activities shown are the average of two determinations (Panel A). MIC (Minimum Inhibitory Concentrations) test of HBlOl cells harboring the plasmids for the antibiotics indicated in the Table. (Panel B) pBR322-tet and pYebFH ⁇ s/MS-tet are tetracycline resistant. The remainder are amp-resistant.
  • FIG. 1 Western blotting demonstrating secretion of mature YebF from E. coli HB101/pYebFH/MS (HB), BL21(DE3)/pYebFH/T7 (BL) and MG1655/pYebFH/MS (MG) cells. Lane F, purified YebF-His 6 .
  • Figure 9 Western blotting demonstrating the secretion of mature YebF-hIL2 fusion protein from HBlOl harboring pYebF-hIL2H 6 /MS.
  • Panel A shows the localization of YebF-hIL2 by immunoblotting using an anti-6xhistidine tag antibody. Lane Ml, medium + 1OmM DTT; Cl, cells + 1OmM DTT; M2, medium - DTT; C2, cells - DTT.
  • Panel B shows the activities of the secreted mature YebF-hIL2 fusion protein in the diluted medium.
  • the bar labeled "600 units/ml” corresponds to standard hIL-2 with the well containing 50 ⁇ l of 600 units of hIL-2/ml in RHFM medium (see Materials and Methods) and 50 ⁇ l of CTLL-2 cells.
  • the bar labeled "negative” is a negative control in which RHFM without hIL-2 was used.
  • the bar labeled "medium” corresponds to ten times diluted medium from HB101/pMS119EH.
  • the E. coli culture medium harvested 3 hours after induction was filtered through a 0.22 ⁇ m Millipore filter and then diluted with RHFM at the ratios indicated. Each bar was averaged from triplicate wells.
  • Figure 10 Secretion of mature YebF- ⁇ -amylase fusion protein over time from HBlOl harboring pYebF-AmyH 6 . Samples were taken at 2 hour intervals following 0.1 mM IPTG induction and assayed for ⁇ -amylase activity. Growth was monitored with a Klett spectrophotometer equipped with a red filter, ⁇ -amylase activity in the cells and the medium was expressed in units per ml of the original culture.
  • FIG. 11 The sequence of pYebFH6/MS (SEQ ID NO: 19).
  • the ribosome binding site is in bold, and the YebF coding region with a 6-histidine tag is underlined.
  • Figure 12 The physical map of pYebFH6/MS.
  • a method for secreting a protein, polypeptide or peptide of interest into bacterial growth medium Also disclosed herein is a method of producing a protein, polypeptide or peptide of interest.
  • the method utilizes YebF, or a biologically active variant or portion thereof, to direct or cause the protein, polypeptide or peptide of interest, to be secreted as a fusion protein into the bacterial growth medium.
  • the fusion protein comprises YebF, or a biologically active variant or portion thereof fused to a protein, polypeptide or peptide of interest.
  • the fusion protein may optionally be tagged and may optionally comprise an amino acid sequence that permits cleavage of the YebF encoded portion and/or the tag, from the protein, polypeptide or peptide of interest.
  • nucleotide refers to a ribonucleotide or a deoxyribonucleotide.
  • Nucleic acid refers to a polymer of nucleotides and may be single- or double-stranded.
  • Polynucleotide refers to a nucleic acid that is twelve (12) or more nucleotides in length.
  • nucleotide sequence of interest refers to any nucleotide sequence that encodes a "protein, polypeptide or peptide sequence of interest", the production of which may be deemed desirable for any reason, by one of ordinary skill in the art.
  • nucleotide sequences include, but are not limited to, coding sequences of structural genes (e.g., reporter genes, selection marker genes, oncogenes, drug resistance genes, growth factor genes, etc.), regulatory genes (e.g., genes encoding activator protein 1 (API), activator protein 2 (AP2), SpI, etc.), antibody genes, enzyme genes, etc., or portions thereof.
  • the nucleotide sequence of interest may comprise the coding sequence of a gene from one of many different organisms (e.g., mammalian, insect, bacterial, and viral genes).
  • a nucleotide sequence "encodes” or “codes for” a protein if the nucleotide sequence can be translated to the amino acid sequence of the protein.
  • the nucleotide sequence does not have to contain an actual translation start codon or termination codon.
  • a “protein, polypeptide or peptide sequence of interest” is encoded by the "nucleotide sequence of interest".
  • the protein, polypeptide or peptide may be a protein from any organism, including but not limited to, mammals, insects, micro-organisms such as bacteria and viruses. It may be any type of protein, including but not limited to, a structural protein, a regulatory protein, an antibody, an enzyme, an inhibitor, a transporter, a hormone, a hydrophilic or hydrophobic protein, a monomer or dimer, a therapeutically- relevant protein, an industrially-relevant protein, or portions thereof.
  • “Secretion” as used herein refers to the excretion of the fusion protein that is expressed in a bacterium, into the bacterial growth medium.
  • YebF is a reference to the protein having the following amino acid sequence (SEQ ID NO: 1)
  • “Mature YebF” is a reference to the protein having the following amino acid sequence (SEQ ID NO: 2) AMSTET SKSVTFPKCE DLDAAGIAAS VKRDYQQNRV ARWADDQKIV GQADPVAWVS LQDIQGKDDK WSVPLTVRGK SADIHYQVSV DCKAGMAEYQ RR
  • yebF is a reference to a nucleic acid or a nucleotide sequence having the following sequence (SEQ ID NO: 3):
  • modified refers to: (a) a nucleotide sequence in which one or more nucleotides have been added or deleted, or substituted with different nucleotides or modified bases (e.g., inosine, methylcytosine) or to (b) a protein, peptide or polypeptide in which one or more amino acids have been added or deleted, or substituted with a different amino acid.
  • a variant may be naturally occurring, or may be created experimentally by one of skill in the art.
  • a variant of YebF or yebF may be a protein, peptide, polypeptide or polynucleotide that differs (i.e., an addition, deletion or substitution) in one or more amino acids or nucleotides from the sequence of YebF or yebF, respectively.
  • a variant of YebF has a secretory function
  • a variant of YebF has a secretory function
  • Modifications of protein properties such as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation, or the tendency to aggregate with carriers or into multimers may be assayed by methods well known to one of skill in the art.
  • Variants may be created experimentally using random mutagenesis, oligonucleotide- mediated (or site-directed) mutagenesis, PCR mutagenesis and cassette mutagenesis.
  • Oligonucleotide-mediated mutagenesis is well known in the art as, for example, described by Adelman using vectors that are either derived from bacteriophage Ml 3, or that contain a single-stranded phage origin of replication as described by Viera et al. Production of single-stranded template is described, for example, in Sambrook.
  • the single-stranded template may be generated by denaturing double- stranded plasmid (or other DNA) using standard techniques.
  • linker-scanning mutagenesis of DNA may be used to introduce clusters of point mutations throughout a sequence of interest that has been cloned into a plasmid vector.
  • linker-scanning mutagenesis of DNA may be used to introduce clusters of point mutations throughout a sequence of interest that has been cloned into a plasmid vector.
  • Region-specific mutagenesis and directed mutagenesis using PCR may also be employed to construct variants according to the invention.
  • reference may be made, for example, to
  • biologically active when made in reference to a variant or portion of YebF, refers to a protein, polypeptide or peptide possessing at least the secretory function of YebF.
  • a biologically active variant or portion of YebF has at least about 5%, preferably at least about 25%, more preferably at least about 50% and most preferably at least about 75% of the secretory activity of YebF. Whether the variant or portion of the YebF protein has secretory activity may be determined, for example, by the methods disclosed in the Materials and Methods, and Examples disclosed herein.
  • a biologically active variant or portion of YebF may either be secreted into the growth medium, or may effect the secretion a fusion protein (of which it comprises part) into the growth medium, and both of these activities are considered to be a secretory activity.
  • portion when used in reference to a protein refers to fragments of that protein.
  • the fragments may range in size from four amino acid residues to the entire amino acid sequence of the protein, minus one amino acid.
  • a “peptide” is polymer of four to 20 amino acids, a “polypeptide” is a polymer of 21 to 50 amino acids and a “protein” is a polymer of more than 50 amino acids.
  • a fusion protein is a recombinant protein comprising regions derived from at least two different proteins.
  • the term "fusion protein” as used herein refers to a protein molecule in which a protein, polypeptide or peptide of interest is fused to: YebF, a biologically active variant of YebF, or a biologically active portion of YebF (herein a "YebF, or a biologically active variant or portion thereof).
  • “Fused” in one context means that nucleic acid encoding YebF, or a biologically active variant or portion thereof, is joined in frame to the nucleic acid encoding the protein, polypeptide or peptide of interest, to provide for a single amino acid chain when transcription and translation occur.
  • “fused” may also be a reference to the joining of a protein, polypeptide or peptide of interest to YebF, or a biologically active variant or portion thereof.
  • a "secreted fusion protein” is the part of the fusion protein that is secreted into the bacterial growth medium. As is apparent, a secreted fusion protein will likely lack the amino acids that comprise the leader sequence of YebF, specifically MKKRGA FLGLLLVSAC ASVF (SEQ ID NO: 20).
  • an "expression vector” refers to a recombinant DNA molecule containing the appropriate control nucleotide sequences (e.g., promoters, enhancers, repressors, operator sequences and ribosome binding sites) necessary for the expression of an operably linked nucleotide sequence in a particular host cell.
  • control nucleotide sequences e.g., promoters, enhancers, repressors, operator sequences and ribosome binding sites
  • the expression vector may be self-replicating, such as a plasmid, and may therefore carry a replication site, or it may be a vector that integrates into a host chromosome either randomly or at a targeted site.
  • the expression vector may contain a selection gene as a selectable marker for providing phenotypic selection in transformed cells.
  • the expression vector may also contain sequences that are useful for the control of translation.
  • Purified or “to purify” refers to the removal of undesired components from a sample.
  • to purify the secreted fusion protein from the bacterial growth medium may mean to remove other components of the medium (i.e., proteins and other organic molecules) thereby increasing the percentage of the secreted fusion protein.
  • the present invention utilizes YebF, or a biologically active variant or portion thereof, to direct the secretion of a protein, polypeptide or peptide of interest, into the bacterial growth medium. This may be accomplished by generating a fusion protein, which comprises YebF or a biologically active variant or portion thereof, and the protein, polypeptide or peptide of interest.
  • a recombinant DNA molecule that encodes the fusion protein can be made, for example, by ligating a nucleic acid that encodes the protein, polypeptide or peptide of interest (a nucleotide sequence of interest), in frame, to a nucleic acid that encodes the YebF protein, or a biologically active variant or portion thereof.
  • the nucleic acid that encodes the protein, polypeptide or peptide of interest may be ligated to the 3 '-end (i.e., downstream) of the nucleic acid that encodes the YebF protein, or a biologically active variant or portion thereof.
  • the nucleic acid that encodes the protein, polypeptide or peptide of interest may not be ligated directly to the 3'-end of the YebF protein, or a biologically active variant or portion thereof. Rather, a spacer nucleotide sequence may separate the 3 '-end of the nucleotide sequence encoding the YebF protein, or a biologically active variant or portion thereof, and the 5 '-end of the nucleotide sequence that encodes the protein, polypeptide or peptide of interest.
  • the spacer nucleotide sequence encodes one or more amino acids that may or may not be functional (i.e., a tag, or a cleavage site, or no function at all but to separate the two parts).
  • the protein, polypeptide or peptide of interest is located carboxy-terminally to the YebF protein, or a biologically active variant or portion thereof.
  • Methods of generating this recombinant DNA molecule are known to those of skill in the art, examples of which are provided by the methods disclosed in the Materials and Methods, and Examples disclosed herein, or the references cited herein.
  • nucleotide sequence that encodes the YebF protein, or a biologically active variant or portion thereof, or the nucleotide sequence that encodes the protein, polypeptide or peptide of interest may additionally comprise transcriptional and translational control regions, which are short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription and translation. These regions include promoters, operator sequences and ribosome binding sites, and are known to those of skill in the art.
  • fusion protein or the secreted fusion protein may also be desirable to tag the fusion protein or the secreted fusion protein with at least one tag that may be useful for purifying the secreted fusion protein from the growth medium, for identifying the secreted fusion protein, or for some other purpose.
  • Useful tags include epitope tags that are recognized by a specific antibody, thereby permitting the fusion protein to be purified by affinity chromatography, or to be identified, for example with a fluorescent antibody. Examples of a useful eptiopes are: glutathione-S-transferase, c-myc, poly-histidine, FLAG®, maltose binding protein, influenza A virus haemagglutinin, ⁇ -galactosidase and GAL4, or portions thereof.
  • Preferred may be a polyhistidine (poly-His tag).
  • Cognate antibodies that recognize these epitope tags are known to those of skill in the art.
  • polyhistidine is recognized by an anti-His Mab available from Qiagen
  • FLAG ® is recognized by Anti-FLAG Ml, M2 and M5 Mabs, available from Sigma/Kodak. Therefore, contemplated herein may be the inclusion, in the recombinant DNA molecule, of at least one nucleotide sequence that encodes a tag amino acid sequence.
  • the tag may be anywhere on the fusion protein, with the possible exception of at the amino-terminal end, or in the leader sequence, of the YebF protein, or a biologically active variant or portion thereof.
  • the secreted fusion protein may also be desirable to later cleave the secreted fusion protein, in order to separate the YebF portion (i.e., the mature YebF protein, or a biologically active variant or portion thereof) and/or the tag, from the protein, polypeptide or peptide of interest.
  • the YebF portion and/or tag interferes with the biological activity of the protein, polypeptide or peptide of interest, it may be preferred to cleave either or both of them from the fusion protein.
  • contemplated herein may be the inclusion, in the recombinant DNA molecule, of at least one nucleotide sequence that encodes an amino acid sequence, which amino acid sequence facilitates the cleavage of the YebF portion and/or epitope tag and/or the protein, polypeptide or peptide, from the fusion protein.
  • Suitable amino acid sequences for cleavage by specific proteases are: (a) Factor Xa Protease- recognizes the amino acid sequence Ile-Glu-Gly-Arg and cleaves the peptide bond C-terminal of the arginine residue ' ; (b) Tobacco Etch Virus (TEV) NIa protease- recognizes a seven amino acid consensus sequence, Glu-X-X-Tyr-X-Gln/Ser, where X can be various amino acyl residues, and cleaves between the conserved GIn and Ser residues ; (c) PreScissionTM Protease- cleaves between the GIn and GIy residues of
  • a recombinant DNA molecule contemplated herein comprises a nucleotide sequence that encodes the YebF protein, or a biologically active variant or portion thereof and a nucleotide sequence that encodes the protein, polypeptide or peptide of interest, and optionally at least one nucleotide sequence that encodes a tag, and/or optionally at least one nucleotide sequence that encodes a protein cleavage site.
  • these various nucleotide sequences are in frame with one another. Therefore, the fusion protein and secreted fusion protein contemplated herein comprise optionally, at least one tag and/or optionally at least one cleavage site.
  • the resultant recombinant DNA molecule may then be inserted into an expression vector.
  • Useful vectors for practicing the invention disclosed herein are plasmids, for example pMS119EH, which comprises a lac promoter, and pT7-5, which comprises a T7 promoter.
  • the expression vector selected will depend on which bacterial strain or species is to be used to express the fusion protein.
  • the above sequence of events need not be practiced in the above order, nor need the above methods be used, in order to generate the expression vector comprising the recombinant DNA molecule.
  • the nucleic acid that encodes the protein, polypeptide or peptide of interest may be inserted into the expression vector, followed by the insertion of the nucleic acid that encodes the YebF protein, or a biologically active variant or portion thereof, or vice versa (see Materials and Methods, herein).
  • a nucleic acid that encodes the tag or the protein cleavage site, if used, may be inserted before or after either of the above components of the recombinant DNA molecule are inserted into the expression vector.
  • the expression vector may already comprise a nucleic acid that encodes a tag sequence, obviating the need to add this component separately (see Materials and Methods, herein).
  • the expression vector comprising the recombinant DNA molecule is then transfected into the appropriate bacterial host, for expression of the fusion protein. Examples of how this can be accomplished are provided examples provided in the Materials and Methods, and Examples herein.
  • the expression vector may be transfected into HBlOl, BL21 or MG1655.
  • pMS119EH comprising an insert can be used in HBlOl or MG1655
  • pT7-5 comprising an insert can be used in BL21.
  • Preferred for use herein may be an expression vector that replicates extrachromosomally, as a greater number of copies of the fusion protein nucleic acid construct can be generated, which will generally result in higher levels of expression and hence secretion.
  • the present invention contemplates the secretion of many different proteins, polypeptides or peptides of interest. Contemplated herein are peptides as small as 4 amino acids. Also contemplated herein is any protein or polypeptide that can be secreted by the methods disclosed herein, regardless of the size. In the Examples provided, a protein of 48 kD was secreted, suggesting that large proteins can readily be secreted by the method disclosed herein.
  • hydrophilic and hydrophobic proteins may be secreted by the method disclosed herein.
  • a hydrophobic protein hIL2
  • a hydrophilic protein ⁇ -amylase or alkaline phosphatase
  • the bacterial cells are grown in growth medium, such as terrific broth, until such time as is desired to harvest the secreted fusion protein from the medium.
  • the time required depends upon a number of factors relating to the bacterial expression system being used and to the fusion protein being produced.
  • the rate of growth of a particular bacterial strain or species, the rate at which the secreted fusion protein accumulates in the medium, the stability of the secreted- fusion protein in the medium, and the time at which bacterial lysis begins to occur are non-limiting examples of the types of considerations that will affect when the secreted fusion protein is harvested from the culture medium.
  • the secreted fusion protein may be further purified, for example by affinity chromotography.
  • the YebF portion and/or the tag may be cleaved from the secreted fusion protein, in order to generate the protein, polypeptide or peptide of interest, alone.
  • YebF can be used to direct the secretion of proteins, polypeptides and peptides, as fusion proteins, into the medium.
  • the inventors have cloned three different nucleotide sequences of interest into a vector that comprises the nucleotide sequence for yebF.
  • an expression vector that comprises a nucleic acid encoding YebF operatively linked to control nucleic acid sequences needed to initiate, regulate or otherwise direct transcription and the synthesis of YebF.
  • the expression vector may comprise restriction endonuclease sites, or other sites, downstream of the YebF coding region, useful for easy in frame insertion of a nucleic acid encoding a protein, polypeptide or peptide of interest.
  • the expression vector may also comprise a tag nucleotide sequence, as shown in the Materials and Methods herein, or a nucleotide sequence encoding a protein cleavage site.
  • the leader sequence of YebF may be used to direct the transport of a protein into the periplasm.
  • an expression vector that comprises a nucleic acid encoding the leader sequence of YebF operatively linked to control nucleic acid sequences needed to initiate, regulate or otherwise direct transcription and the synthesis of the YebF leader sequence.
  • the expression vector may comprise restriction endonuclease sites, or other sites, downstream of the YebF leader coding region, useful for easy in frame insertion of a nucleic acid encoding a protein, polypeptide or peptide of interest.
  • the expression vector may also comprise a tag nucleotide sequence, as shown in the Materials and Methods herein, or a nucleotide sequence encoding a protein cleavage site. Also disclosed herein is the use of the YebF leader sequence to direct transport of a protein, peptide or polypeptide to the periplasm. Also disclosed herein is a method for expressing a protein, polypeptide or peptide of interest in the periplasm, which method comprises providing an expression vector that encodes a protein comprising the protein, polypeptide or peptide of interest located carboxy-terminally to YebF leader sequence, and expressing the protein in a suitable bacterial cell.
  • the E. coli strains used in this study were HBlOl (supE44 hsd20(r B ⁇ mB ) recA13 ara-14 proA2 lacYl gaIK2 rpsL20 xyl-5 mtl-1), BL21(DE3)( ⁇ rf5 gal( ⁇ clts851 indl Sam7 nin5 lac ⁇ JV5-T7 gene 1), and MG1655(F- ⁇ - UvG- ⁇ -50 rph-l). Cells were grown at 30 0 C in Terrific broth (TB).
  • Antibiotics were added at the following concentrations: 100 ⁇ g/ml of ampicillin (Amp) and 80 ⁇ g/ml chloramphenicol (Cm). Expression of genes under lac promoter control was induced with 0.ImM isopropyl- ⁇ -D-thiogalactopyranoside (IPTG).
  • the yebF gene was amplified from HBlOl chromosomal DNA using the following forward and reverse oligomers, respectively, with the indicated restriction sites underlined: yebF5, 5'-GAGAATTCGGAGAAAAACATGAAAAAAAG-S' containing EcoRl (SEQ ID NO: 4); and yebF3, 5'-ATATCTCGAGACGCCGCTGATATTC-B (Xhol) (SEQ ID NO: 5).
  • yebFH ⁇ To tag the gene with 6 histidines at its 3'-end (yebFH ⁇ ), the amplified DNA, after digestion with EcoRl and Xhol, was cloned into pCITE-2a(+) (Novagen, US) cut with the same enzymes.
  • the EcoRl- Hind III fragment carrying yebFH ⁇ was then subcloned into pMSl 19EH to generate pYebFH ⁇ /MS, or into pT7-5
  • the mature truncated form of the ⁇ -amylase gene (GenBank accession no. AB015592) of Bacillus subtilis X-23 4 was amplified from pAC92 kindly provided by Dr. Spartaco Astolfi-Filho, University of Brasilia, Brazil using the following oligos: amy5, 5'- TAGAATTCAGGAGAAAAACATGGTCGACTCGGTCA AAAACGGG-3' (SEQ ID NO: 6) engineered with an EcoRl site, a ribosomal binding site (bold), the in-frame initiation codon ATG and Sa/ 1; amy3, 5 ' -ATATCTCG AG ATGAGGCGC ATT TCC-3 (Xhol) (SEQ ID NO: 7).
  • the amplified DNA was cut with EcoRl and Xhol and replaced the yebF fragment (EcoRl-Xhol) in pYebFH6/MS to create pAmyH 6 .
  • pYebF-AmyH ⁇ containing the yebF-amy fusion gene was created by replacing the EcoRl- SaIl fragment in pAmyH ⁇ with the EcoRl-Xhol fragment carrying the yebF gene from pYebFH ⁇ /MS. Between the yebF nucleotide sequence and the amy nucleotide sequence, there is encoded an additional two amino acids- LE- which will link the two proteins.
  • the leader sequence was first amplified by PCR using pYebFIVMS as the template with FIs (5'- ATATCTCGAGAGCGAAAACTGATGC-3 ' ) (SEQ ID NO: 8) containing an Xhol restriction site and yebF5 (above) as the oligomers. After digestion with EcoRl and Xhol, the amplified DNA fragment was inserted into pAmyH ⁇ to replace the EcoRl- Sail sequence, which generated pLS-AmyH 6 . The sequence of this hybrid gene was verified by sequencing.
  • hIL-2 gene was amplified by PCR from pBM806, a plasmid containing an hIL-2 gene provided by Biomira Inc. (Edmonton, Canada) using the following oligonucleotides: hil5 with Sail, GATCATGTCGACGCTCCGACCTCCAGC (SEQ ID NO: 9)and hil3 with Xhol, ATATCTCGAGGGTCAGGGTGGAGAT (SEQ ID NO: 10).
  • the Sall-Xhol fragment of the PCR product was inserted into Xhol site in pYebFH6/MS to generate pYebF-hIL2H 6 .
  • Between the yebF nucleotide sequence and the hIL-2 nucleotide sequence there is encoded an additional two amino acids- LE- which will link the two proteins, which is then followed by the six histidine residues as the tag.
  • amino acid sequence of mature hIL-2 ⁇ i.e., lacking the 20 amino acid leader sequence
  • the phoA gene was PCR-amplified with the following oligos: phoA5 with Xhol, GCATATCTCGAGCGGAC ACC AGAA ATGCC (SEQ ID NO: 12); and phoA3 with SaZl, CGATAGTCGACTTTCAGCCCCAGAGC (SEQ ID NO: 13).
  • the Xhol-Sall fragment of the PCR product was inserted into Xhol site in pYebFH 6 /T7 to generate pYebF-pho AH 6 ZTl.
  • Protein expression and treatment of samples A single colony from LB plates or a small aliquot of cold cell suspension stored in 40% glycerol at -20 0 C was inoculated into 1.5 ml of TB and grown overnight at 30 0 C. After harvesting by centrifugation the cells were washed once in 1.5 ml of fresh TB, and were suspended in 1.5 ml of fresh TB and inoculated at 1% by volume into fresh TB for expression studies. Protein expression was induced by addition of 0.ImM IPTG or 0.5 mM IPTG at 0.6 OD 600 . Cells were harvested at the indicated time points in the experiments.
  • ⁇ -amylase activity assay This assay is based on the 3,5-dinitrosalicylic acid method as described by Ohdan et al.* using starch as the substrate for the enzyme.
  • the reaction was stopped by adding 200 ⁇ l of DNSA in 0.4N NaOH to 200 ⁇ l of the reaction mixture after 10 minutes incubation at 58°C with shaking once per minute.
  • the mixture was boiled for 5 minutes thereafter, diluted with 1 ml of water, and spun for 1 minute to pellet starch. Finally, readings were taken at 540nm.
  • the enzyme activity was expressed in moles of glucose released per minute that is equivalent to the amount of reducing sugar released by the enzyme from starch in the reaction. A pair of every sample to be assayed was set up. One is for the reaction, the other for background reading, to which 200 ⁇ l of DNSA was added before the reaction starts.
  • the liquid was directly added to the reaction mixture.
  • the cell suspension or the spheroplast suspension in 1OmM Tris-HCl (pH7.0) was mixed with equal volume of lysis buffer (pH 8.0) consisting of 70 ⁇ g/ml lysozyme, 6 mM EDTA, 2% Triton X-100 to break cells or spheroplasts.
  • Alkaline phosphatase activity assay 1 ml of the reaction consists of 10OmM Tris-HCl (pH8.0), 1OmM MgCl 2 , 2mM ZnCl 2 and 0.04% pNPP.
  • This partially purified protein was further purified using a reversed-phase HPLC on a 3O ⁇ A C8 column (lmm x 15 cm) eluted with a gradient of acetonitrile from 0% to 2% in the presence of 0.05% TFA at the flow rate of 100 ⁇ l/min. A single major peak was observed at the 25th min. This peak fraction was collected and used for both MALDI-TOF linear mode mass spectrometry (Voyager 6064, Applied Biosystems) and N-terminal amino acid sequence determination using Routine 3.0 on a Hewlett Packard GlOOOA Protein Sequencer.
  • Protein electrophoresis and Western blotting The protein samples from either the culture medium or the cells were prepared by precipitation with 5% trichloroacetic acid (TCA). After centrifugation in an Eppendorf tube at 14,900 rpm at room temperature for 5 minutes, the pellet was washed once by suspending it in 1 ml of water and centrifuging for 5 minutes to remove residual TCA. To almost completely extract TCA from the pellets, 1.5 ml of -20 0 C cold acetone was added to each tube. The tube was then vortexed and kept at -20 0 C for 20 minutes before centrifugation as above. The pellet was retained and subjected to one additional acetone wash.
  • TCA trichloroacetic acid
  • the final pellet was dissolved in 50 mM Tris- HCl, pH 8.0 before adding an equal volume of electrophoresis loading buffer. Proteins were separated on 8.5% SDS-Tricine gel 22 and then transferred to a nitrocellulose membrane for immunoblotting.
  • monoclonal mouse antibody against histidine tag Qiagen
  • CRP was detected using a rabbit polyclonal antiserum against CRP, kindly provided by Dr.Hiroji Aiba, Nagoya University, Japan. Immunoblots were developed by enhanced chemiluminescence using the ECL kit (Amersham).
  • IL-2 bioassay The biological assay of YebF-hIL2 was based on the Lei et al. method 23 using the IL-2 dependent T lymphocyte cell line CTLL-2 with modifications. Prior to the assay, the YebF-hIL2 sample was prepared by passing the E. coli culture medium harvested 3 hours after induction with 0.ImM IPTG from either or pMS119EH (control) through a 0.22 ⁇ m Millipore filter.
  • the cell culture medium (RHFM) for CTLL-2 uses RPMI 1640 supplemented with 10% (v/v) fetal calf serum, 0.1 mM ⁇ -mercaptoethanol, 25mM HEPES pH7.5, 2 mM L-glutamine.
  • the yebF gene was cloned in the expression vector pMS119EH under lac promoter control starting from nucleotide G (Blattner coordinate 1928424) without addition of a ribosome binding site and with the addition of a 6-histidine tag at the carboxyl terminus.
  • the His-tagged YebF protein was positively expressed as shown by immunoblotting (see below).
  • the N- terminal amino acid sequence of E. coli YebF is as follows:
  • This sequence resembles the motif characteristic of lipoproteins 4 , including the fatty acid- acylation site (Cys-6). This motif is also conserved in YebF from Shigella flexneri (97% identity). However, this Cys is missing in other similar proteins such as STY2087 from Salmonella typhi (Jl% identity), YebF from Salmonella typhimurium (76% identity), YPO 1779 from Yersinia pestis (43% identity) and PLU2692 from Photorhabdus luminescens (40% identity). Therefore, YebF may not be a lipoprotein as suggested in several databases (B 1847 at NCBI and P33219 at Swiss-Prot). The amino terminal sequence of the E.
  • coli YebF protein also contains a typical 21 amino acid .sec-leader peptide including 3 basic residues (-20 Lys-Lys-Arg-18) at the N-terminal end, followed by a 16 residue long hydrophobic core and a small residue (AIa-I) which could serve as the leader peptidase I cleavage site (Fig.l).
  • a similar leader sequence was found in all YebF related proteins (Fig.l) suggesting that E. coli YebF may be secreted to the periplasm.
  • a 200 ml culture of HBlOl/pYebFIVMS was grown in TB at 30 0 C until the optical density at 600 nm reached 0.6.
  • the culture was induced with 0.1 mM IPTG and harvested 4 hours after induction and washed once at room temperature with 200 ml of 100 mM MOPS (pH7.0).
  • Cells were subjected to cold osmotic shock (Neu and Heppel, 1965) to separate periplasm from the cytoplasm. Protein samples from these resulting fractions and immunoblotting were prepared as described in Materials and Methods.
  • YebF was located in the periplasm and surprisingly also in the culture medium. No YebF was detected in the spheroplasts after cold osmotic shock (Fig. 2A).
  • HBlOl/pYebFH ⁇ /MS cells were grown as described for Fig. 2A. After harvesting, cells were washed once with 35 ml of fresh TB and suspended in 10 ml of fresh TB containing 80 ⁇ g chloramphenicol/ml. 1.5 ml of cells were taken at the time points indicated in Fig. 2B. Cells and medium were separated by centrifugation at room temperature to avoid cold shock. Immunoblotting was conducted as described in the Materials and Methods using a monoclonal antibody directed against the HiS 6 tag.
  • YebF-His 6 The secreted YebF-His 6 in both the periplasm and culture medium migrated on SDS- Tricine polyacrylamide gels at a molecular weight corresponding to the mature His-tagged protein (-12 kD) (Fig. 3).
  • YebF-His 6 was purified from the culture medium as described in the Materials and Methods and N-terminal amino acid sequence analysis revealed the sequence to be Ala-Asn-Asn-Glu-Thr-Ser-Lys-Ser-Val-Thr. This result indicates that YebF is cleaved immediately after the 21 -amino acid sec-leader and not preceding the Cys at position -6 (Fig. 1).
  • the presence of YebF in the culture medium could be a result of cell lysis, leakage through the outer membrane, a natural cell secretion process or some combination.
  • immunoblotting was used to compare the subcellular localization of YebF and catabolite repressor protein (CRP), a well-known DNA binding protein residing in the cytoplasm.
  • CCP catabolite repressor protein
  • E. coli HB 101/p YCbFH 6 MS was grown in 50 ml of TB at 3O 0 C until OD 60O reached 0.6 and induced with 0.1 mM IPTG. Ten ml of cell culture was harvested at 2, 4 and 6 hours after induction.
  • the cells were washed once in 10 ml of 100 mM MOPS and suspended in 10 ml of the same MOPS buffer. The medium was filtered through a 0.22 ⁇ m Millipore filter. Both cell suspension and medium were mixed with 2.5 ml of 25% trichloroacetic acid (TCA) to precipitate proteins. TCA trapped in the pellets was removed by two extractions using -20 0 C acetone. Protein samples were loaded onto two parallel gels which were subsequently subjected to immunoblotting.
  • TCA trichloroacetic acid
  • two chimeric genes were constructed in the vector pMS119EH, under / ⁇ c-promoter control, by fusing the leaderless, mature ⁇ -amylase gene from Bacillus subtilis to either the 3' end of the yebF gene (pYebF-AmyH ⁇ ) or directly to the sec-leader sequence of yebF (pLS-AmyH 6 ).
  • the leaderless mature ⁇ -amylase gene in the same vector (pAmyH 6 ) was used as a control.
  • the mature ⁇ -amylase without any signal sequence should remain in the cytoplasm.
  • Cells were grown in HBlOl and induced as in Fig. 2. Cells were harvested 4 hours after induction with 0.ImM IPTG, prior to any cell lysis and subjected to cold osmotic shock 21 and ⁇ -amylase activity quantitated as described in Materials and Methods.
  • HBlOl cells with pMS119EH produced an undetectable level of ⁇ -amylase either in the medium or in the cells (data not shown). Only ⁇ -amylase fused to full-length YebF could be found in the medium with 35% of the total activity in the medium. The leaderless ⁇ - amylase and ⁇ -amylase fused to the leader peptide of YebF were expressed but remained inside cells, and less than 5% of each on average were detected in the medium (Fig. ⁇ A). These data were confirmed by the protein profile in the medium shown in Fig. 6B.
  • the periplasm of cells was separated from the cytoplasm. As shown in Fig. ⁇ A, over 68% of the ⁇ -amylase fused to the leader of YebF was recovered in the periplasm. 85% of leaderless ⁇ -amylase remained in the cytoplasm. 12 % of the leaderless ⁇ -amylase found in the periplasm could be due to cell breakage during the cold osmotic shock.
  • the YebF- ⁇ -amylase fusion protein was able to cross the outer membrane from the periplasm (Fig 6A). This demonstrates that YebF played an essential role in targeting the fusion protein for secretion across the outer membrane to the medium.
  • Fig. 2 shows no apparent difference in the mobility of YebF protein in the periplasm or in the culture medium. This indicates that no additional cleavage occurred during secretion across outer membrane. This is also supported by the coincidence of the molecular weight calculated from the sequence (11,860 dalton) with that determined by mass spectrometry (11,829 dalton).
  • GZ39T/pYebF-AmyH 6 was grown in 25 ml of TB at 3O 0 C.
  • Cells were harvested at 7 hours after induction with 0.05 mM IPTG, washed with 100 mM MOPS (pH7.0) and suspended in 1.5 ml of 30 mM Tris-HCl (pH8.0). 200 ⁇ l of the cells were mixed with 300 ⁇ l of cell lysis buffer (see Methods and Materials). This cell lysate was used for both ⁇ - amylase and alkaline phosphatase activity assays. To measure ⁇ -amylase activity in the medium, 35 ⁇ l of the medium was directly used.
  • alkaline phosphatase activity 8 ml of the medium was filtered three times through an Amicon ultracentrifugal filter (MWCO 30KD) with 50 mM MOPS (pH7.0) to reduce phosphate and colored substances and finally concentrated to 0.6 ml. 200 ⁇ l of this preparation was used for the assay (see Methods and Materials). Alkaline phosphatase was assayed at 37°C for 60 minutes in the dark. The results are shown in Fig. 7A, which shows that 42.6% of YebF- ⁇ -amylase was secreted to the medium compared to only 5.6% of alkaline phosphatase.
  • MG1655 (a K12 strain), BL21(DE3) (a B strain) and HBlOl (a hybrid of K12 and B) all secrete YebF into the medium, although the efficiency varied (Fig. 8).
  • BL21(DE3) (a B strain)
  • HBlOl a hybrid of K12 and B
  • Fusion protein gene constructs of leaderless ⁇ -amylase of B. subt ⁇ lis X-23 8 (48kD), leaderless E. coli alkaline phosphatase (94 kD as a dimer) and the medically relevant protein human interleukin-2 (hIL-2) (15 kD) to the carboxy terminus of YebF were made as described in the Materials and Methods. These represent both hydrophilic ( ⁇ -amylase and alkaline phosphatase) and hydrophobic (hIL-2) proteins. All three passenger proteins carried a HiS 6 tag at their C-terminus.
  • Cells comprising these fusion protein gene constructs were grown in 25 ml of TB at 30 0 C. 10 mM DTT was added to one culture at the same time as 0.05 mM IPTG was added to induce expression. Samples were taken 3 hours after induction.
  • Fig. 9A shows the expression of mature YebF-hIL2 fusion protein in HBlOl/pYebF- ML2H 6 .
  • the fusion protein was secreted to the medium at 3 hours after induction under regular growth conditions. With the presence of 10 mM DTT in the medium, however, cells did not secrete the fusion protein to the medium, although comparable expression inside cells was seen.
  • Activity assays for the YebF-hIL-2 fusion protein based on the growth of CTLL-2 T-lymphocytes in vitro showed the secreted protein in the medium was active (Fig. 9B).
  • the activity of the fusion protein was 43,800 units of hIL-2/ml of medium.
  • Fig. 10 shows that by 9 hours after induction 75% of mature YebF- ⁇ -amylase fusion protein was secreted from cells. It also appears that the fusion protein was stable in the medium and the maximal secretion of the YebF- ⁇ -amylase occurred after the culture reached stationary phase. From a 1 -liter scale experiment, 31 mg of the purified YebF- ⁇ - amylase fusion protein with a specific activity of 380.7 ⁇ mol Glucose/min/mg protein was obtained, using nickel affinity chromatography.
  • the specific activity of ⁇ -amylase in the initial culture medium varies with the time after induction from 150 mol Glucose/min/mg protein at 4 hours to 85 mole Glucose/min/mg protein at 9 hours after induction. It is 3.4
  • Mature YebF-alkaline phosphatase fusion protein was also expressed from pYebF- phoAH/T7 plasmid in BL21(DE3) cells under the control of the T7 promoter. 23% was secreted to the medium at 7 hours after induction with IPTG.
  • Zaccolo M et al An approach to random mutagenesis of DNA using mixtures of triphosphate derivatives of nucleoside analogues. J. MoI. Biol. 255(4):589-603 (1996).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/CA2005/001249 2004-08-18 2005-08-12 Protein production method utilizing yebf Ceased WO2006017929A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2005274628A AU2005274628A1 (en) 2004-08-18 2005-08-12 Protein production method utilizing YebF
AT05774845T ATE512230T1 (de) 2004-08-18 2005-08-12 Proteinherstellungsverfahren unter nutzung von yebf
CA002576083A CA2576083A1 (en) 2004-08-18 2005-08-12 Protein production method utilizing yebf
JP2007526148A JP2008509682A (ja) 2004-08-18 2005-08-12 Yebfを利用するタンパク質の製造方法
EP05774845A EP1791961B1 (en) 2004-08-18 2005-08-12 Protein production method utilizing yebf

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52212504P 2004-08-18 2004-08-18
US60/522,125 2004-08-18

Publications (1)

Publication Number Publication Date
WO2006017929A1 true WO2006017929A1 (en) 2006-02-23

Family

ID=35907194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2005/001249 Ceased WO2006017929A1 (en) 2004-08-18 2005-08-12 Protein production method utilizing yebf

Country Status (7)

Country Link
US (1) US20060246539A1 (https=)
EP (1) EP1791961B1 (https=)
JP (1) JP2008509682A (https=)
AT (1) ATE512230T1 (https=)
AU (1) AU2005274628A1 (https=)
CA (1) CA2576083A1 (https=)
WO (1) WO2006017929A1 (https=)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1916305A1 (de) 2006-10-25 2008-04-30 Wacker Chemie AG DNS-Konstrukt und Verfahren zur fermentativen Herstellung von Fusionsproteinen
US9499593B2 (en) 2011-05-11 2016-11-22 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US9616114B1 (en) 2014-09-18 2017-04-11 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US10435697B2 (en) * 2014-11-03 2019-10-08 Nanyang Technological University Recombinant expression system that senses pathogenic microorganisms
US10973908B1 (en) 2020-05-14 2021-04-13 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine
US11013793B2 (en) 2018-09-12 2021-05-25 Affinivax, Inc. Multivalent pneumococcal vaccines
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11305001B2 (en) 2017-03-28 2022-04-19 The Children's Medical Center Corporation Multiple antigen presenting system (MAPS)-based Staphylococcus aureus vaccine, immunogenic composition, and uses thereof
US11471497B1 (en) 2019-03-13 2022-10-18 David Gordon Bermudes Copper chelation therapeutics
US11576958B2 (en) 2013-02-07 2023-02-14 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US11612647B2 (en) 2017-06-23 2023-03-28 University Of Maryland, Baltimore Immunogenic compositions
US12036276B2 (en) 2021-09-09 2024-07-16 Affinivax, Inc. Multivalent pneumococcal vaccines
US12129283B2 (en) 2018-09-12 2024-10-29 The Children's Medical Center Corporation Pneumococcal fusion protein vaccines
US12378536B1 (en) 2015-05-11 2025-08-05 David Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US12537071B1 (en) 2020-07-22 2026-01-27 David Gordon Bermudes Bacteria having boolean control pathways expressing therapeutic proteins including immunotherapeutic cytotoxins
US12616723B1 (en) 2023-11-13 2026-05-05 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017087827A1 (en) * 2015-11-19 2017-05-26 President And Fellows Of Harvard College Method of making recombinant silk andsilk-amyloid hybrid proteins using bacteria
US12351805B2 (en) 2015-11-19 2025-07-08 Northeastern University Method of making recombinant silk and silk-amyloid hybrid proteins using bacteria
JP7517707B2 (ja) * 2019-02-15 2024-07-17 オンコシミス バイオテック プライベート リミテッド タンパク質分泌増強のための細菌発現ベクター
EP3927733A4 (en) * 2019-02-24 2022-07-06 Oncosimis Biotech Private Limited PROCESS FOR THE CONTINUOUS PRODUCTION OF RECOMBINANT GLP-1 PEPTIDE BY BACTERIA

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000066756A1 (en) 1999-05-04 2000-11-09 Timo Korpela Microbial protein expression system
US6733997B1 (en) * 1998-10-30 2004-05-11 National University Of Singapore Isolated nucleic acids encoding a secretory signal for expression and secretion of heterologous recombinant proteins

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1335357C (en) * 1987-10-30 1995-04-25 Timothy M. Rose Expression systems for preparation of polypeptides in prokaryotic cells
US5646016A (en) * 1991-02-06 1997-07-08 Genetics Institute, Inc. Peptide and protein fusions to thioredoxin, thioredoxin-like molecules, and modified thioredoxin-like molecules
US6033877A (en) * 1995-11-02 2000-03-07 Research Foundation Of State University Of New York Peptide expression and delivery system
US6022952A (en) * 1998-04-01 2000-02-08 University Of Alberta Compositions and methods for protein secretion
AU2001261242B2 (en) * 2000-05-03 2006-12-14 Expressive Constructs, Inc. A method for improving recombinant protein stability and solubility
WO2002038739A1 (en) * 2000-11-09 2002-05-16 Univ Queensland Bacterial expression systems
US20040142429A1 (en) * 2001-01-25 2004-07-22 Grant Chris W.M. Method for the expression, purification, and structure recovery and handling of hydrophobic proteins, polypeptides or peptides
DE60238532D1 (de) * 2001-05-04 2011-01-20 Cornell Res Foundation Inc Schnell spaltbares sumofusionsprotein-expressionssystem für schwer zu exprimierende proteine
KR100447530B1 (ko) * 2001-08-14 2004-09-08 한국과학기술원 OmpF를 이용하여 목적 단백질을 대장균 세포외로분비생산하는 방법
US6790051B1 (en) * 2003-12-20 2004-09-14 Lear Corporation Connector for printed circuit board

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6733997B1 (en) * 1998-10-30 2004-05-11 National University Of Singapore Isolated nucleic acids encoding a secretory signal for expression and secretion of heterologous recombinant proteins
WO2000066756A1 (en) 1999-05-04 2000-11-09 Timo Korpela Microbial protein expression system

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
ADELMAN JP ET AL.: "In vitro deletional mutagenesis for bacterial production of the 20,000-dalton form of human pituitary growth hormone", DNA, vol. 2, no. 3, 1983, pages 183 - 93, XP009065879
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995, JOHN WILEY & SONS INC NY
BATISSON I ET AL.: "Full capacity of recombinant Escherichia coli heat-stable enterotoxin fusion proteins for extracellular secretion, antigenicity, disulfide bond formation, and activity", INFECTION AND IMMUNITY, AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 68, no. 7, 1 July 2007 (2007-07-01), pages 4064 - 74, XP002171524, DOI: doi:10.1128/IAI.68.7.4064-4074.2000
BRAUN P. ET AL.: "Proteome-scale purification of human proteins from bacteria", PROC NATL ACAD SCI USA, vol. 99, no. 5, 5 March 2002 (2002-03-05), pages 2654 - 2659, XP008113935 *
BROKX SJ ET AL.: "Genome-wide analysis of lipoprotein expression in Escherichia coli MG1655", J. BACTERIOL, vol. 86, no. 10, May 2004 (2004-05-01), pages 3254 - 3258, XP008113936 *
BROKX SJ ET AL.: "Genome-Wide Analysis of Lipoprotein Expression in Escherichia coli MG1655", J. BACTERIOL., vol. 186, 2004, pages 3254 - 3258, XP008113936, DOI: doi:10.1128/JB.186.10.3254-3258.2004
CHANG JY ET AL.: "Thrombin specificity. Selective cleavage of antibody light chains at the joints of variable with joining regions and joining with constant regions", EUR. J. BIOCHEM., vol. 151, no. 2, 1985, pages 225 - 30
COLLINS-RACIE, LA ET AL.: "Production of recombinant bovine enterokinase catalytic subunit in Escherichia coli using the novel secretory fusion partner DsbA", BIOTECHNOLOGY, vol. 13, no. 9, 1995, pages 982 - 7, XP002156881, DOI: doi:10.1038/nbt0995-982
COURCELLE J ET AL.: "Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli", GENETICS, vol. 158, 2001, pages 41 - 64
LOMBA MR ET AL.: "Identification of yebG as a DNA damage-inducible Escherichia coli gene", FEMS MICROBIOL. LETT., vol. 156, 1997, pages 119 - 122
POQUET I. ET AL.: "Stable periplasmic secretion intermediate in the general secretory pathway of Escherichia coli.", THE EMBO J., vol. 12, no. 1, January 1993 (1993-01-01), pages 271 - 278, XP008113934 *
PUGSLEY AP; FRANCETIC O: "Protein secretion in Escherichia coli K-12: dead or alive?", CELL MOL. LIFE SCI., vol. 54, 1998, pages 347 - 52
SHAFIKHANI S ET AL.: "Generation of large libraries of random mutants in Bacillus subtilis by PCR-based plasmid multimerization", BIOTECHNIQUES, vol. 23, no. 2, 1997, pages 304 - 10, XP002094373
SHOKRI A ET AL.: "Cell and process design for targeting of recombinant protein into the culture medium of Escherichia coli", APPL. MICROBIOL. BIOTECHNOL., vol. 60, 2003, pages 654 - 664
SHOKRI A. ET AL.: "Cell and process design for targeting of recombinant protein into the culture medium of Escherichia coli.", APPL MICROBIOL BIOTECHNOL, vol. 60, 2003, pages 654 - 664, XP009078758 *
STEMMER WP: "DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution", PROC. NATL. ACAD. SCI. USA, vol. 91, no. 22, 1994, pages 10747 - 51, XP002170160, DOI: doi:10.1073/pnas.91.22.10747
VAN DYK TK ET AL.: "A genomic approach to gene fusion technology", PROC. NATL. ACAD. SCI. USA., vol. 98, 2001, pages 2555 - 2560, XP002285714, DOI: doi:10.1073/pnas.041620498
VIERA ET AL., METHODS ENZYMOL., vol. 153, 1987, pages 3
ZACCOLO M ET AL.: "An approach to random mutagenesis of DNA using mixtures of triphosphate derivatives of nucleoside analogues", J. MOL. BIOL., vol. 255, no. 4, 1996, pages 589 - 603, XP000612902, DOI: doi:10.1006/jmbi.1996.0049

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1916305A1 (de) 2006-10-25 2008-04-30 Wacker Chemie AG DNS-Konstrukt und Verfahren zur fermentativen Herstellung von Fusionsproteinen
US7943341B2 (en) 2006-10-25 2011-05-17 Wacker Chemie Ag DNA construct and process for the fermentative production of fusion proteins
US11560410B2 (en) 2011-05-11 2023-01-24 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US9499593B2 (en) 2011-05-11 2016-11-22 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US10017548B2 (en) 2011-05-11 2018-07-10 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US11976097B2 (en) 2011-05-11 2024-05-07 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US10611805B2 (en) 2011-05-11 2020-04-07 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US11981708B2 (en) 2011-05-11 2024-05-14 Children's Medical Center Corporation Multiple antigen presenting immunogenic composition, and methods and uses thereof
US10766932B2 (en) 2011-05-11 2020-09-08 The Children's Medical Center Corporation Multiple antigen presenting immunogenic composition, and methods and uses thereof
US12545710B2 (en) 2011-05-11 2026-02-10 Children's Medical Center Corporation Multiple antigen presenting immunogenic composition, and methods and uses thereof
US12083173B2 (en) 2013-02-07 2024-09-10 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US11576958B2 (en) 2013-02-07 2023-02-14 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US10828356B1 (en) 2014-09-18 2020-11-10 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US11813295B1 (en) 2014-09-18 2023-11-14 Theobald Therapeutics LLC Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US9616114B1 (en) 2014-09-18 2017-04-11 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US11633435B1 (en) 2014-09-18 2023-04-25 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US10729731B1 (en) 2014-09-18 2020-08-04 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US10435697B2 (en) * 2014-11-03 2019-10-08 Nanyang Technological University Recombinant expression system that senses pathogenic microorganisms
US12378536B1 (en) 2015-05-11 2025-08-05 David Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11305001B2 (en) 2017-03-28 2022-04-19 The Children's Medical Center Corporation Multiple antigen presenting system (MAPS)-based Staphylococcus aureus vaccine, immunogenic composition, and uses thereof
US11612647B2 (en) 2017-06-23 2023-03-28 University Of Maryland, Baltimore Immunogenic compositions
US11701416B2 (en) 2018-09-12 2023-07-18 Affinivax, Inc. Multivalent pneumococcal vaccines
US12129283B2 (en) 2018-09-12 2024-10-29 The Children's Medical Center Corporation Pneumococcal fusion protein vaccines
US12370247B2 (en) 2018-09-12 2025-07-29 Affinivax, Inc. Multivalent pneumococcal vaccines
US11013793B2 (en) 2018-09-12 2021-05-25 Affinivax, Inc. Multivalent pneumococcal vaccines
US11471497B1 (en) 2019-03-13 2022-10-18 David Gordon Bermudes Copper chelation therapeutics
US12144833B1 (en) 2019-03-13 2024-11-19 David Gordon Bermudes Copper chelation therapeutics
US10973908B1 (en) 2020-05-14 2021-04-13 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine
US11406702B1 (en) 2020-05-14 2022-08-09 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated Salmonella as a vaccine
US12537071B1 (en) 2020-07-22 2026-01-27 David Gordon Bermudes Bacteria having boolean control pathways expressing therapeutic proteins including immunotherapeutic cytotoxins
US12036276B2 (en) 2021-09-09 2024-07-16 Affinivax, Inc. Multivalent pneumococcal vaccines
US12377140B2 (en) 2021-09-09 2025-08-05 Affinivax, Inc. Multivalent pneumococcal vaccines
US12616723B1 (en) 2023-11-13 2026-05-05 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity

Also Published As

Publication number Publication date
ATE512230T1 (de) 2011-06-15
JP2008509682A (ja) 2008-04-03
AU2005274628A1 (en) 2006-02-23
US20060246539A1 (en) 2006-11-02
EP1791961A1 (en) 2007-06-06
EP1791961B1 (en) 2011-06-08
CA2576083A1 (en) 2006-02-23
EP1791961A4 (en) 2008-11-19

Similar Documents

Publication Publication Date Title
EP1791961B1 (en) Protein production method utilizing yebf
DK1354056T3 (en) IMPROVED secretion of a polypeptide by a microorganism
Figueroa-Bossi et al. Caught at its own game: regulatory small RNA inactivated by an inducible transcript mimicking its target
Chevalier et al. Membrane targeting of a bacterial virulence factor harbouring an extended signal peptide
CN111278979B (zh) 重组大肠杆菌天冬酰胺酶的生产方法
CN101967493A (zh) 一种原核表达载体及其应用
US20110097737A1 (en) Methods and Compositions for Targeting Proteins of Interest to the Host Cell Envelope
CN103797122A (zh) 用于大肠杆菌中异源蛋白质生产的新的表达和分泌载体系统
AU2016256579B2 (en) Uncoupling growth and protein production
AU777246B2 (en) Microbial protein expression system
US20140154742A1 (en) Novel expression and secretion vector systems for heterologous protein production in escherichia coli
JP4546089B2 (ja) 融合タンパク質
Van der Wal et al. Optimization of bacteriocin-release-protein-induced protein release by Escherichia coli: extracellular production of the periplasmic molecular chaperone FaeE
KR101677090B1 (ko) 목적 단백질의 정제용 폴리펩타이드 및 이의 용도
KR102809778B1 (ko) 조절가능한 리보솜 번역 속도를 위한 조성물 및 사용 방법
Díaz et al. Intein-mediated expression of cecropin in Escherichia coli
US11124555B2 (en) Fusion polypeptides comprising one or more inclusion body tags, methods and uses
He et al. Expression of honeybee prepromelittin as a fusion protein in Escherichia coli
HK1194431A (en) Novel expression and secretion vector systems for heterologous protein production in escherichia coli
Kumamoto et al. Signal Recognition Particle-Dependent

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2576083

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2005274628

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2007526148

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2005774845

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2005274628

Country of ref document: AU

Date of ref document: 20050812

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005274628

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2005774845

Country of ref document: EP