WO2006008097A2

WO2006008097A2 - Pef-ts expression units comprising corynebacterium glutamicum

Info

Publication number: WO2006008097A2
Application number: PCT/EP2005/007752
Authority: WO
Inventors: Oskar Zelder; Corinna Klopprogge; Burkhard Kröger; Hartwig Schröder; Stefan Haefner
Original assignee: Basf Aktiengesellschaft
Priority date: 2004-07-20
Filing date: 2005-07-16
Publication date: 2006-01-26
Also published as: JP5710096B2; EP1942198A2; US20140242704A1; ES2376035T3; ATE531819T1; DE102004035065A1; BRPI0513227A; US20070269871A1; WO2006008097A3; US20080176295A1; JP2008212156A; CN101230350A; US8735159B2; KR20070032076A; JP2008506400A; EP1942198A3; PL1942198T3; CN1989256A; EP1942198B1; EP1771574A2

Abstract

The invention relates to the use of nucleic acid sequences for regulating gene transcription and expression, said novel promoters and expression units, methods for modifying or inducing the transcription rate and/or expression rate of genes, expression cassettes containing said expression units, genetically modified microorganisms with a modified or induced transcription rate and/or expression rate, and methods for producing biosynthetic products by cultivating the genetically modified microorganisms.

Description

P _EF- τs expression units

description

The present invention relates to the use of nucleic acid sequences for the regulation of the transcription and expression of genes, the novel promoters and expression units themselves, methods for altering or causing the transcription rate and / or expression rate of genes, expression cassettes containing the expression units, genetically modified microorganisms altered or induced rate of transcription and / or rate of expression and methods for

Production of biosynthetic products by culturing the genetically modified microorganisms.

Various biosynthetic products, such as, for example, fine chemicals, such as, inter alia, amino acids, vitamins but also proteins, are produced in cells via natural metabolic processes and are used in many branches of industry, including foodstuffs, feedstuffs, cosmetics, feedstuffs and foods and pharmaceutical industry. Diole substances, which are collectively referred to as fine chemicals / proteins, include, among others, organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, as well as proteins and enzymes. Their production is most conveniently made on a large scale by culturing bacteria that have been developed to produce and secrete large quantities of the desired substance. Particularly suitable organisms for this purpose are coryneform bacteria, gram-positive non-pathogenic bacteria.

It is known that amino acids are produced by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of the great importance is constantly working. The improvement of the manufacturing process. Process improvements may include fermentation measures, such as stirring and supply of oxygen, or the composition of the nutrient media, such as the sugar concentration during fermentation, or the processing of the product, for example by ion exchange chromatography but also spray-drying, or the intrinsic performance characteristics of the microorganism concern yourself.

For several years, methods of recombinant DNA technology have also been used for strain improvement of fine chemical / protein-producing strains of Corynebacterium by amplifying individual genes and examining the effect on the production of fine chemicals / proteins. Other ways to develop a process for the production of fine chemicals, amino acids or proteins, or to increase or to improve the productivity of an already existing process for the production of fine chemicals, amino acids or proteins, are to increase the expression of one or more genes or to modify and / or to influence the translation of an mRNA by means of suitable polynucleotide sequences. Influencing may in this context include increasing, decreasing, or other parameters of expression of genes such as temporal expression patterns.

The skilled worker is aware of various constituents of bacterial regulatory sequences. A distinction is made between the binding sites of regulators, also called operators, the binding sites of RNA polymerase holoenzymes, also called -35 and -10 regions, and the binding site of ribosomal 16S RNA, also ribosomal binding site or Shine-Dalgamo Called sequence.

The sequence of a ribosomal binding site, also called Shine-Dalgarno sequence, for the purposes of this invention is understood to mean polynucleotide sequences which are up to 20 bases upstream of the initiation codon of the translation.

It is described in the literature (E. coli and S. typhimurium, Neidhardt FC 1995 ASM Press) that both the composition of the polynuclease sequence of the Shine-Delgarno sequence, the sequence sequence of the bases, but also the distance of one in the Shine Delgamo sequence contained polynucleotide sequence has a significant impact on the initiation rate of translation.

Nucleic acid sequences with promoter activity can influence the formation of mRNA in different ways. Promoters whose activity is independent of the physiological growth phase of the organism are called constitutive. Again other promoters react to external chemical as well as physical stimuli such as oxygen, metabolites, heat, pH, etc. Still others show a strong dependence of their activity in different growth phases. For example, in the literature promoters are described which show a particularly pronounced activity during the exponential growth phase of microorganisms, or else exactly in the stationary phase of microbial growth. Both characteristics of promoters can have a favorable effect on productivity for the production of fine chemicals and proteins depending on the metabolic pathway.

For example, one may use promoters which, during growth, turn off the expression of a gene, but turn it on after optimal growth, to regulate a gene that controls the production of a metabolite. Of the altered strain then has the same growth parameters as the Ausgangs¬ stem, but produces more product per cell. This type of modification can increase both the titer (g product / liter) and the C yield (g product / gC source).

In Corynebacterium species, it has already been possible to isolate those nucleotide sequences which can be used for increasing or weakening gene expression. These regulated promoters may increase or decrease the rate at which a gene is transcribed, depending on the internal and / or external conditions of the cell. In part, the presence of a particular factor, known as an inducer, may stimulate the rate of transcription from the promoter. Inducers may directly or indirectly affect transcription from the promoter. Another class of factors known as suppressors is capable of reducing or inhibiting transcription from the promoter. Like the inducer, the suppressors can act directly or indirectly. However, there are also promoters known that are regulated by temperature. Thus, for example, the level of transcription of such promoters may be increased or decreased by increasing the growth temperature above the normal growth temperature of the cell.

A small number of promoters from C. glutamicum have been described to date. The promoter of the malate synthase gene from C. glutamicum was described in DE 4440118. This promoter was preceded by a structural protein coding for a protein. After transformation of such a construct into a coryneform bacterium, the expression of the downstream structural gene is regulated. The expression of the structural gene is induced as soon as a corresponding inducer is added to the medium.

Reinscheid et al., Microbiology 145: 503 (1999) have described a transcriptional fusion between the pta-ack promoter from C. glutamicum and a reporter gene (chloramphenicol acetyltransferase). Cells of C. glutamicum containing such transcriptional fusion exhibited increased expression of the reporter gene upon growth on acetate-containing medium. In comparison, transformed cells which grew on glucose showed no increased expression of this reporter gene.

In Pa ^'tek et al, Microbiology 142:. 1297 (1996) described some DNA sequences from C. glutamicum, which can enhance len of a reporter gene in C. glutamicum Zel¬ the expression described. These sequences were compared to define consensus sequences for C. glutamicum promoters. Further DNA sequences from C. glutamicum, which can be used to regulate gene expression, have been described in the patent WO 02/40679. These isolated polynucleotides represent expression units from Corynebacterium glutamicum, which can be used either to increase or to reduce gene expression. Furthermore, recombinant plasmids are described in this patent, on which the expression units from Corynebacterium glutamicum are associated with heterologous genes. The method described here, fusion of a promoter from Corynebacterium glutamicum with a heterologous gene, can be used, inter alia, for regulating the genes of the amino acid biosynthesis.

The object of the invention was to provide further promoters and / or expression units with advantageous properties.

Accordingly, it has been found that nucleic acids with promoter activity, containing

A) the nucleic acid sequence SEQ. ID. NO. 1 or

B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 or

C) a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. NO. 1 hybridized under stringent conditions or

D) functionally equivalent fragments of the sequences under A), B) or C)

can use for the transcription of genes.

According to the invention, "transcription" is understood to mean the process by which a complementary DNA molecule is produced by a DNA template, in which process proteins such as RNA polymerase are involved in so-called sigma factors and transcriptional regulatory proteins then serves as a template in the process of translation, which then leads to the biosynthetically active protein.

The rate at which a biosynthetic active protein is produced is a product of the rate of transcription and translation. Both rates can be influenced according to the invention and thus influence the rate of formation of products in a microorganism. A "promoter" or a "nucleic acid with promoter activity" is understood as meaning according to the invention a nucleic acid which, in functional linkage with a nucleic acid to be transected, regulates the transcription of this nucleic acid.

In this context, a "functional linkage" is understood to mean, for example, the sequential arrangement of one of the nucleic acids according to the invention with promoter activity and a nucleic acid sequence to be transcribed and, if appropriate, further regulatory elements, for example nucleic acid sequences which ensure the transcription of nucleic acids, and for example Terminator such that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence.This does not necessarily require a direct linkage in the chemical sense.Genetic control sequences, such as for example enhancer sequences, can also function Preference is given to arrangements in which the nucleic acid sequence to be transcribed is positioned behind the (ie at the 3 'end) of the promoter sequence according to the invention rd, so that both sequences are covalently linked. The distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is preferably less than 200 base pairs, more preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.

According to the invention, "promoter activity" is understood as meaning the amount of RNA, that is to say the transcription rate, formed by the promoter in a specific time.

By "specific promoter activity" is meant according to the invention the amount of RNA per promoter formed by the promoter in a certain time.

The term "wild-type" is understood according to the invention as the corresponding starting microorganism.

Depending on the context, the term "microorganism" may be understood as meaning the starting microorganism (wild-type) or a genetically modified microorganism according to the invention or both.

Preferably and in particular in cases in which the microorganism or the wild type can not be unambiguously assigned, the term "wild-type" is used to change or cause the promoter activity or transcription rate, to change or cause the expression activity or expression rate, and for the Er¬ increase the content of biosynthetic products each understood a reference organism. In a preferred embodiment, this reference organism is Corynebacterium glutamicum ATCC 13032.

In a preferred embodiment, starting microorganisms are used which are already capable of producing the desired fine chemical. Among the particularly preferred microorganisms of the bacteria of the genus Corynebacteria and the particularly preferred fine chemicals L-lysine, L-methionine and L-threonine, those starting microorganisms which are already able to produce L-lysine, L-methionine and / or are particularly preferred To produce L-threonine. These are particularly preferably corynebacteria in which, for example, the gene coding for an aspartokinase (ask gene) is deregulated or the feed-back inhibition is stopped or reduced. For example, such bacteria have a mutation in the ask gene which leads to a reduction or abolition of the feedback inhibition, for example the mutation T3111.

With a "caused promoter activity" or transcription rate with respect to a gene compared to the wild type, the formation of a RNA is thus caused in comparison to the wild type, which was thus not present in the wild type.

In the case of an altered promoter activity or transcription rate with respect to a gene in comparison to the wild type, the amount of RNA formed is thus changed in a certain time compared to the wild type.

In this context, "changed" is preferably increased or decreased.

This can be done, for example, by increasing or reducing the specific promoter activity of the endogenous promoter according to the invention, for example by mutation of the promoter or by stimulation or inhibition of the promoter.

Furthermore, the increased promoter activity or transcription rate can be achieved, for example, by regulating the transcription of genes in the microorganism by nucleic acids according to the invention having promoter activity or by nucleic acids having increased specific promoter activity, the genes being heterologous with respect to the nucleic acids having promoter activity.

Vorzusgweise the regulation of the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with increased specific promoter activity is achieved by one or more nucleic acids according to the invention having promoter activity, where appropriate with altered specific promoter activity, are introduced into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the incorporated nucleic acid according to the invention having promoter activity is optionally altered specific promoter activity, or

introducing one or more genes into the genome of the microorganism so that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity, or

one or more nucleic acid constructs comprising a nucleic acid according to the invention having promoter activity, optionally with altered specific promoter activity, and functionally linking one or more nucleic acids to be transcribed into which microorganism introduces.

The nucleic acids according to the invention with promoter activity contain

A) the nucleic acid sequence SEQ. ID. NO. 1 or B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 or

D) functionally equivalent fragments of the sequences under A), B) or C)

The nucleic acid sequence SEQ. ID. NO. 1 represents the promoter sequence of the elongation factor TS (PEF-TS) from Corynebacterium glutamicum. SEQ. ID.NO. 1 corresponds to the wild-type promoter sequence.

The invention further relates to nucleic acids with promoter activity comprising a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 has.

Further natural examples according to the invention of promoters according to the invention can be prepared, for example, from various organisms whose genomic sequence is known by identity comparisons of the nucleic acid sequences from data Banks with the above-described sequences SEQ ID NO: 1 easily find.

Artificial promoter sequences according to the invention can easily be found starting from the sequence SEQ ID NO: 1 by artificial variation and mutation, for example by substitution, insertion or deletion of nucleotides.

The term "substitution" in the description refers to the replacement of one or more nucleotides by one or more nucleotides. "Deletion" is the replacement of a nucleotide by a direct bond Insertions are insertions of nucleotides into the nucleic acid sequence which formally replaces a direct bond with one or more nucleotides.

Identity between two nucleic acids is understood to mean the identity of the nucleotides over the entire nucleic acid length, in particular the identity which was determined by comparison with the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM Biosci 1989 Apr; 5 (2): 151-1) is calculated by setting the following parameters: and sensitive multiple sequence alignments on a microcomputer.

Multiple alignment parameters:

Gap opening penalty 10

Gap extension penalty 10

Gap Separation penalty ranks 8

Gap separation penalty off% identity for alignment deiay 40

Residue specific gaps off

Hydrophilic residues gap off

Transition weighing 0

Pairwise alignment parameter:

FAST algorithm on

K-tuplesize 1

Gap penalty 3

Window size 5 Number of best diagonal 5

A nucleic acid sequence which has an identity of at least 90% with the sequence SEQ ID NO: 1 is accordingly understood to mean a nucleic acid sequence which, in a comparison of its sequence with the sequence SEQ ID NO: 1, in particular special according to the above program logarithm with the above parameter set has an identity of at least 90%.

Particularly preferred promoters have with the nucleic acid sequence SEQ. ID. NO. 1 has an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, more preferably 99%.

Further natural examples of promoters can furthermore readily be found starting from the above-described nucleic acid sequences, in particular starting from the sequence SEQ ID NO: 1 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.

Another object of the invention therefore relates to nucleic acids with Promotoraktivi- tat, containing a nucleic acid sequence with the nucleic acid sequence SEQ. ID. No. 1 hybridized under stringent conditions. This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50, or more preferably more than 150 nucleotides.

The hybridization is carried out according to the invention under stringent conditions. Such

Hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd Edition, ColD Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biolgy, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:

By stringent hybridization conditions are meant in particular: The overnight incubation at 42 ° C in a solution consisting of 50% formamide, 5 x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6 ), 5x Denhardt solution, 10% dextran sulfate, and 20 g / ml denatured, sheared salmon sperm DNA, followed by washing the filter with 0.1x SSC at 65 ⁰ C.

A "functionally equivalent fragment" for nucleic acid sequences with promoter activity, fragments understood that have substantially the same or higher specific promoter activity as the starting sequence.

By "substantially the same" is meant a specific promoter activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, most preferably 95% of the specific promoter activity of the starting sequence. By "fragments" is meant partial sequences of the nucleic acids having promoter activity described by embodiment A), B) or C. Preferably, these fragments have more than 10, more preferably more than 12, 15, 30, 50 or more preferably more than 150 contiguous nucleotides of the nucleic acid sequence SEQ ID NO: 1.

Particularly preferred is the use of the nucleic acid sequence SEQ. ID. NO. 1 as a promoter, i. for the transcription of genes.

The SEQ. ID. NO. 1 has been described without function assignment in Genbank entry AP005283. Therefore, the invention further relates to the novel nucleic acid sequences according to the invention with promoter activity.

In particular, the invention relates to a nucleic acid with promoter activity containing

A) the nucleic acid sequence SEQ. ID. NO. 1 or

B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at nucleic acid level with the sequence SEQ. ID. NO. 1 or

D) functionally equivalent fragments of the sequences under A), B) or C),

with the proviso that the nucleic acid having the sequence SEQ. ID. NO. 1 is excluded.

All the above-mentioned nucleic acids with promoter activity can furthermore be produced in a manner known per se by chemical synthesis from the nucleotide units, for example by fragment condensation of individual overlapping, complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The An¬ storage of synthetic oligonucleotides and filling gaps with the Klenow fragment of the DNA polymerase and ligation reactions and general cloning procedures are in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Col. Spring Harbor Laboratory Press.

The invention further relates to the use of an expression unit comprising one of the nucleic acids according to the invention with promoter activity and additionally functional combines a nucleic acid sequence which ensures the translation of ribonucleic acids, for the expression of genes.

According to the invention, an expression unit is understood as meaning a nucleic acid with expression activity, ie a nucleic acid which, in functional linkage with a nucleic acid or gene to be expressed, regulates the expression, ie the transcription and the translation of this nucleic acid or gene.

In this context, a "functional linkage" is understood to mean, for example, the sequential arrangement of one of the expression units according to the invention and of a nucleic acid sequence to be expressed transgenically and, if appropriate, further regulatory elements such as, for example, a terminator such that each of the regulators regulates This does not necessarily require a direct link in the chemical sense: genetic control sequences, such as enhancer sequences, may also function from more distant locations or even from other DNA molecules Preference is given to arrangements in which the nucleic acid sequence to be transgenically expressed is positioned behind (ie at the 3 'end) of the expression unit sequence according to the invention, so that both sequences are covalently linked to one another between the expression unit sequence and the nucleic acid sequence to be expressed transgene less than 200 base pairs, more preferably less than 100 base pairs, most preferably less than 50 base pairs.

According to the invention, "expression activity" is understood to mean the amount of protein formed by the expression unit over a certain period of time, ie the expression rate.

According to the invention, "specific expression activity" is understood to mean the amount of protein per expression unit formed by the expression unit in a specific time.

With a "caused expression activity" or expression rate with respect to a gene compared to the wild type, the formation of a protein is thus caused in comparison to the wild type, which was not so present in the wild type.

In the case of an "altered expression activity" or expression rate with respect to a gene in comparison to the wild type, the amount of protein formed is thus changed in a specific time compared to the wild type. In this context, "changed" is preferably increased or decreased.

This can be done, for example, by increasing or reducing the specific activity of the endogenous expression unit, for example by mutation of the expression unit or by stimulation or inhibition of the expression unit.

Furthermore, the increased expression activity or expression rate can be achieved, for example, by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity, wherein the genes are heterologous with respect to the expression units.

Preferably, the regulation of the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity according to the invention is achieved by

one or more expression units according to the invention, optionally with altered specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the introduced expression units according to the invention, optionally with altered specific expression activity, or

introducing one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or

one or more nucleic acid constructs containing an expression unit according to the invention, optionally with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed into the microorganism.

The expression units according to the invention contain a nucleic acid according to the invention which is described above with promoter activity and additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids. This nucleic acid sequence, which ensures the translation of ribonucleic acids, preferably contains the nucleic acid sequence SEQ. ID. NO. 42 as a ribosomal binding site.

In a preferred embodiment, the expression unit according to the invention contains:

E) the nucleic acid sequence SEQ. ID. NO. 2 or

F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides having an identity of at least 90%

Nucleic acid level with the sequence SEQ. ID. NO. 2 or

G) a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. NO. 2 hybridized under stringent conditions or

H) functionally equivalent fragments of the sequences under E), F) or G).

The nucleic acid sequence SEQ. ID. NO. 2 represents the nucleic acid sequence of the expression unit of the elongation factor TS (PEF-TS) from Corynebacterium glutamicum. SEQ. ID.NO. 2 corresponds to the sequence of the expression unit of the wild-type.

The invention furthermore relates to expression units comprising a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 has.

Further natural examples according to the invention for expression units according to the invention can be easily found, for example, from various organisms whose genomic sequence is known by identity comparisons of the nucleic acid sequences from databases with the sequences SEQ ID NO: 2 described above.

Artificial sequences of the expression units according to the invention can be readily ascertained starting from the sequence SEQ ID NO: 2 by artificial variation and mutation, for example by substitution, insertion or deletion of nucleotides.

A nucleic acid sequence which has an identity of at least 90% with the sequence SEQ ID NO: 2 is accordingly understood to be a nucleic acid sequence which, in a comparison of its sequence with the sequence SEQ ID NO: 2, in particular above program logarithm with the above parameter set has an identity of at least 90%. Particularly preferred expression units have with the nucleic acid sequence SEQ. ID. NO. 2 has an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, most preferably 99%.

Further natural examples of expression units can furthermore easily be found starting from the above-described nucleic acid sequences, in particular starting from the sequence SEQ ID NO: 2 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.

A further subject of the invention therefore relates to expression units comprising a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. No. 2 hybridized under stringent conditions. This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 nucleotides.

By "hybridizing" is meant the ability of a poly or oligonucleotide to bind under stringent conditions to a nearly complementary sequence, while under these conditions nonspecific binding between non-complementary partners is avoided. For this purpose, the sequences should preferably be 90-100%, complementary. The property of complementary sequences to be able to specifically bind to one another, for example, in the Northern or Southern Blot technique or in the primer binding in PCR or RT-PCR advantage.

The hybridization is carried out according to the invention under stringent conditions. Such hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd Edition, ColD Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:

Under stringent hybridization conditions mean in particular: Overnight incubation at 42 ⁰ C in a solution of 50% formamide, 5 x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6 ), 5x denhardt solution, 10% dextran sulfate and 20 g / ml denatured, seeded

Salmon sperm DNA, followed by washing the filters with 0.1x SSC at 65 ° C.

The nucleotide sequences according to the invention also allow the generation of probes and primers which are useful for the identification and / or cloning of homologous sequences in other cell types and microorganisms. Such probes or primers usually comprise a nucleotide sequence region which hybridizes under stringent conditions to at least about 12, preferably at least about 25, such as about 40, 50 or 75 consecutive nucleotides of a sense strand of a nucleic acid sequence according to the invention or of a corresponding antisense strand ,

Also included according to the invention are those nucleic acid sequences which comprise so-called silent mutations or are altered according to the codon usage of a specific source or host organism, in comparison with a specifically mentioned sequence, as well as naturally occurring variants, such as e.g. Splice variants or allelic variants, of which

By a "functionally equivalent fragment" is meant for expression units, fragments having substantially the same or a higher specific expression activity as the starting sequence.

By "substantially the same" is meant a specific expression activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, most preferably 95% of the specific expression activity of the starting sequence.

"Fragments" are to be understood as meaning partial sequences of the expression units described by embodiment E), F) or G. Preferably, these fragments have more than 10, more preferably more than 12, 15, 30, 50 or, even more preferably, more than 150 contiguous nucleotides of the nucleic acid sequence SEQ ID NO: 1.

Particularly preferred is the use of the nucleic acid sequence SEQ. ID. NO. 2 as expression unit, i. for the expression of genes.

The invention further relates to the new expression units according to the invention.

In particular, the invention relates to an expression unit comprising a nucleic acid according to the invention with promoter activity additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids.

The invention particularly preferably relates to an expression unit containing

E) the nucleic acid sequence SEQ. ID. NO. 2 or F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at nucleic acid level with the sequence SEQ. ID. NO. 2 or

H) functionally equivalent fragments of the sequences under E), F) or G),

with the proviso that the nucleic acid having the sequence SEQ. ID. NO. 2 is excluded.

The expression units according to the invention comprise one or more of the following genetic elements: a minus 10 ("-10") sequence; a minus 35 ("-35") sequence; a transcription start, an enhancer region; and an operator region.

Preferably, these genetic elements are specific for the species Corynebacteria, especially for Corynebacterium glutamicum.

All of the abovementioned expression units can furthermore be prepared in a manner known per se by chemical synthesis from the nucleotide units, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, p. 896-897). The addition of synthetic oligonucleotides and filling in of gaps using the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Col. Spring Harbor Laboratory Press.

For the inventions in this patent, methods and techniques known to those skilled in microbiological and recombinant DNA techniques have been used. Methods and techniques for growth of bacterial cells, introduction of isolated DNA molecules into the host cell, and isolation, isolation, and sequencing of isolated nucleic acid molecules, etc., are examples of such techniques and methods. These methods are described in many standard literature references: Davis et al., Basic Methods In Molecular Biology (1986); JH Miller, Molecular Genetics Experiments, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, New York (1972); JH Miller, A Short Course in Bacterial Genetics, Gold Spring Harbor Laboratory Press, ColD Spring Harbor, New York (1992); M. Singer and P. Berg, Genes & Genomes, University Science Books, Mill Valley, Carlifornia (1991); J. Sambrook, EF Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2 ^πd ed., Colard Spring Harbor Laboratory Press, Col. Spring Harbor, New York (1989); PB Kaufmann et al., Handbook of Molecular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton, Florida (1995); Methods in Plant Molecular Biology and Biotechnology, BR Glick and JE Thompson, eds., CRC Press, Boca Raton, Florida (1993); and PF Smith-Keary, Molecular Genetics of Escherichia coli, The Guilford Press, New York, NY (1989).

All nucleic acid molecules of the present invention are preferably in the form of an isolated nucleic acid molecule. An "isolated" nucleic acid molecule is separated from other nucleic acid molecules present in the natural source of the nucleic acid and, moreover, may be substantially free of other cellular material or culture medium when produced by recombinant techniques or free of chemical precursors or other chemicals when chemically synthesized.

The invention further comprises the nucleic acid molecules complementary to the specifically described nucleotide sequences or a portion thereof.

The promoters and / or expression units according to the invention can be used, for example, with particular advantage in improved processes for the fermentative preparation of biosynthetic products as described below.

The promoters and / or expression units according to the invention have the particular advantage that they are induced in microorganisms by stress. By suitable control of the fermentation process, this stress induction can be controlled for an increase in the rate of inflammation / expression of desired genes. In particular, in the production of L-lysine, this stress phase is reached very early, so that here very early an increased transcription / expression rate of desired genes can be achieved.

The nucleic acids with promoter activity according to the invention can be used for modification, ie for increasing or reducing, or for causing the transcription rate of genes in microorganisms in comparison to the wild type.

The expression units according to the invention can be used for altering, that is to say for increasing or reducing, or for causing the expression rate of genes in microorganisms in comparison to the wild type.

Furthermore, the nucleic acids according to the invention with promoter activity and the expression units according to the invention can be used to regulate and enhance the biologic fertil of various biosynthetic products, such as Feinchemika¬ lien, proteins, in particular amino acids, serve in microorganisms, in particular in Corynebacterium species.

The invention therefore relates to a method for altering or causing the transcription rate of genes in microorganisms in comparison to the wild type

a) modification of the specific promoter activity in the microorganism of endogenous nucleic acids according to the invention with promoter activity, which regulate the transcription of endogenous genes, in comparison to the wild-type or

b) Regulation of the transcription of genes in the microorganism by erfindungs¬ according to nucleic acids with promoter activity or by nucleic acids with ver¬ changed specific promoter activity according to embodiment a), wherein the genes are heterologous with respect to the nucleic acids with promoter activity.

In accordance with embodiment a), the change or causation of the transcription rate of genes in microorganisms in comparison to the wild type can be achieved by modifying, ie increasing or decreasing, the specific promoter activity in the microorganism. This can be done, for example, by targeted mutation of the nucleic acid sequence according to the invention with promoter activity, that is to say by targeted substitution, de-insertion or insertion of nucleotides. Increased or decreased promoter activity can be achieved by exchanging the nucleotides in the binding site of the RNA polymerase holoenzyme binding sites (also known to the person skilled in the art as the -10 region and the region known). Furthermore, the fact that the distance between the described RNA polymerase holoenzyme binding sites to each other by DeIe- tions of nucleotides or insertions of nucleotides reduced or enlarged. Furthermore, binding sites (also known to the person skilled in the art as regulators) for regulatory proteins (known to the person skilled in the art as repressors and activators) are brought into spatial proximity to the binding sites of the RNA polymerase holoenzyme, that these regulators, after binding to a promotor. Sequence attenuate or enhance the binding and transcriptional activity of the RNA polymerase holoenzyme, or even under a new reguli¬ rule influence.

The nucleic acid sequence SEQ. ID. NO. 21 preferably represents the ribosomal binding site of the expression units according to the invention, the sequences SEQ. ID. NOs. 19 or 20 represent the -10 region of the expression units according to the invention. Changes in the nucleic acid sequence in these regions lead to a change in the specific expression activity. The invention therefore relates to the use of the nucleic acid sequence SEQ. ID. NO. 21 as a ribosomal binding site in expression units which enable the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.

Furthermore, the invention relates to the use of the nucleic acid sequences SEQ. ID. NOs. 19 or 20 as -10-region in expression units which allow the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.

In particular, the invention relates to an expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, comprising the nucleic acid sequence SEQ. ID. NO. 21. Preferably, the nucleic acid sequence SEQ. ID. NO. 21 used as a ribosomal binding site.

Furthermore, the invention relates to an expression unit which allows the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, containing at least one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20. Preferably, one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20 is used as the -10 region.

With regard to the "specific promoter activity", increasing or reducing in comparison with the wild type means an increase or reduction of the specific activity with respect to the nucleic acid according to the invention having promoter activity of the wild-type, that is to say, for example, with reference to SEQ ID NO.

In accordance with embodiment b), the transcription rate of genes in microorganisms can be changed or caused in comparison to the wild type by transcribing genes in the microorganism by nucleic acids according to the invention having promoter activity or by nucleic acids having modified specific promoter activity according to embodiment a). wherein the genes are heterologous with respect to the nucleic acids having promoter activity.

This is preferably achieved by one

b1) introducing one or more nucleic acids according to the invention with promoter activity, optionally with altered specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced nucleic acid having promoter activity, optionally with altered specific promoter activity, follows or

b2) introducing one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity, or

b3) one or more nucleic acid constructs containing an inventive

Nucleic acid with promoter activity, optionally with altered specific promoter activity, and functionally linked one or more, to be transkribie¬ rende nucleic acids in the microorganism brings.

It is thus possible to change the transcription rate of an endogenous gene of the wild-type, ie to increase or decrease it by

According to embodiment b1), one or more nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity, are introduced into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity, optionally with altered specific promoter activity , or

according to embodiment b2) introduces one or more endogenous genes into the genome of the microorganism such that the transcription of one or more of the introduced endogenous genes takes place under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity or

According to embodiment b3), one or more nucleic acid constructs comprising a nucleic acid according to the invention with promoter activity, optionally with altered specific promoter activity, and functionally linked one or more endogenous nucleic acids to be transcribed, into which microorganism introduces.

Furthermore, it is thus possible to cause the transcription rate of an exogenous gene compared to the wild type by

in accordance with embodiment b2) introduces one or more exogenous genes into the genome of the microorganism such that the transcription of one or more of the introduced exogenous genes under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with modified specific pro motor activity, or occurs

According to embodiment b3), one or more nucleic acid constructs comprising a nucleic acid according to the invention with promoter activity, optionally with altered specific promoter activity, and functionally linked one or more exogenous nucleic acids to be transcribed, into which microorganism introduces.

The insertion of genes according to embodiment b2) can be carried out so that the gene is integrated into coding regions or non-coding regions. Preferably, the insertion takes place in non-coding regions.

The insertion of nucleic acid constructs according to embodiment b3) can be carried out chromosomally or extrachromosomally. Preferably, the insertion of the nucleic acid constructs is chromosomal. A "chromosomal" integration is the insertion of an exogenous DNA fragment into the chromosome of a host cell, which is also used for homologous recombination between an exogenous DNA fragment and the corresponding region on the chromosome of the host cell.

In embodiment b) it is also preferred to use nucleic acids according to the invention with modified specific promoter activity according to embodiment a). These can be present in the microorganism in Example b), as described in embodiment a), and can be prepared or introduced into the microorganism in isolated form.

By "endogenous" is meant genetic information, such as genes, that are already contained in the wild-type genome.

By "exogenous" are meant genetic information, such as genes, which are not contained in the wild-type genome.

The term "genes" with regard to regulation of transcription by the nucleic acids having promoter activity according to the invention are preferably understood to be nucleic acids which have a region to be transcribed, for example a region which regulates translation, a coding region and optionally weitere Regulation.selemente, such as a terminator included.

The term "genes" with respect to the expression regulation described below by the expression units according to the invention are preferably understood as meaning nucleic acids which contain a coding region and optionally further regulatory elements, such as, for example, a terminator. By a "coding region" is meant a nucleic acid sequence encoding a protein.

By "heterologous" with reference to nucleic acids with promoter activity and genes is understood that the genes used in the wild type are not transcribed under regulation of the nucleic acids according to the invention with promoter activity, but that a new functional link not occurring in the wild type is produced and the functional combination of inventive nucleic acid with promoter activity and specific gene does not occur in the wild type.

By "heterologous" in terms of expression units and genes is meant that the genes used are not expressed in the wild-type under regulation of the expression units according to the invention, but that a new, not occurring in the wild type functional linkage is formed and the functional combination of inventive Expression unit and specific gene does not occur in the wild type.

The invention further relates in a preferred embodiment to a method for increasing or causing the transcription rate of genes in microorganisms compared to the wild type by

ah) the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity according to the invention which regulate the transcription of endogenous genes is increased in comparison to the wild-type or

bh) the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with increased specific promoter activity according to embodiment a) regulated, wherein the genes are heterologous with respect to the nucleic acids with promoter activity.

Preferably, the regulation of the transcription of genes in the microorganism is achieved by nucleic acids according to the invention with promoter activity or by nucleic acids according to the invention with increased specific promoter activity according to embodiment (ah) in that

bh1) introduces one or more nucleic acids according to the invention with promoter activity, optionally with increased specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced invention Nucleic acid with promoter activity, optionally with increased specific promoter activity, takes place or

bh2) introduces one or more genes into the genome of the microorganism such that the transcription of one or more of the genes introduced takes place under the control of the endogenous nucleic acids according to the invention with promoter activity, optionally with increased specific promoter activity, or

bh3) one or more nucleic acid constructs containing a nucleic acid according to the invention with promoter activity, optionally with increased specificity

Promoter activity, and functionally linked one or more, to transkribie¬ rende nucleic acids, brings in the microorganism.

The invention further relates, in a preferred embodiment, to a method for reducing the transcription rate of genes in microorganisms in comparison to the wild type, by

ar) the specific promoter activity in the microorganism of endogenous nucleic acids according to the invention with promoter activity, which regulate the transcription of the endogenous genes, is reduced in comparison with the wild-type or

br) introducing nucleic acids with reduced specific promoter activity according to embodiment a) into the genome of the microorganism, so that the transcription of endogenous genes takes place under the control of the incorporated nucleic acid with reduced promoter activity.

The invention further relates to a method for altering or causing the expression rate of a gene in microorganisms compared to the wild type

c) alteration of the specific expression activity in the microorganism of endogenous expression units according to the invention which regulate the expression of the endogenous genes in comparison to the wild-type or

d) Regulation of the Expression of Genes in the Microorganism by Expression Units According to the Invention or by Expression Units of the Invention with Altered Specific Expression Activity According to Embodiment c), wherein the genes are heterologous with respect to the expression units.

According to embodiment c), the change or causation of the expression rate of genes in microorganisms can take place in comparison to the wild type, that in the microorganism, the specific expression activity is changed, that is increased or decreased. This can be done, for example, by targeted mutation of the nucleic acid sequence according to the invention with promoter activity, ie by targeted substitution, deletion or insertion of nucleotides. For example, the extension of the distance between the Shine-Dalgamo sequence and the translational start codon usually leads to a change, a reduction or else an increase in the specific expression activity. A change in the specific expression activity can also be achieved by shortening or lengthening the sequence of the Shine-Dalgamo region (ribosomal binding site) in its distance from the translational start codon by deletions or insertions of nucleotides. But also by the fact that the sequence of the Shine-Dalgamo region is changed so that the homology to complementary 3 'Page 16S rRNA either increased or decreased.

With regard to the "specific expression activity", an increase or reduction in the specific activity relative to the wild-type expression unit according to the invention, ie with respect to SEQ ID NO.

In accordance with embodiment d), the change or causation of the expression rate of genes in microorganisms in comparison to the wild type can be effected by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units according to the invention with altered specific expression activity according to embodiment c) wherein the genes are heterologous with respect to the expression units.

This is preferably achieved by one

d1) introducing one or more expression units according to the invention, optionally with altered specific expression activity, into the genome of the microorganism such that the expression of one or more endogenous genes takes place under the control of the introduced expression units or

d2) introducing one or more genes into the genome of the microorganism, so that the expression of one or more of the genes introduced takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or

d3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with modified specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganisms are introduced.

It is thus possible to change the expression rate of an endogenous gene of the wild-type, ie to increase or decrease it by

According to embodiment d1), one or more expression units according to the invention, optionally with altered specific expression activity, are introduced into the genome of the microorganism such that expression of one or more endogenous genes takes place under the control of the introduced expression units or

according to embodiment d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or

according to embodiment d3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with modified specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.

Furthermore, it is thus possible to cause the expression rate of an exogenous gene compared to the wild type by

according to embodiment d2) one or more exogenous genes into the genome of the

Introduces microorganism, so that the expression of one or more of the incorporated genes takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or

according to embodiment d3), one or more nucleic acid constructs comprising an expression unit according to the invention, optionally with altered specific expression activity, and functionally linked one or more exogenous nucleic acids to be expressed, into which microorganism introduces.

The insertion of genes according to embodiment d2) can be carried out so that the gene is integrated into coding regions or non-coding regions. Vor¬ preferably the insertion into non-coding regions. 6

The insertion of nucleic acid constructs according to embodiment d3) can be effected chromosomally or extrachromosomally. Preferably, the insertion of the nucleic acid constructs is chromosomal.

The nucleic acid constructs are also referred to below as expression cassettes.

In embodiment d) it is also preferred to use expression units according to the invention with modified specific expression activity according to embodiment c). These can be present in the microorganism and prepared in embodiment d), as described in embodiment d), or introduced into the microorganism in isolated form.

The invention further relates in a preferred embodiment to a method for increasing or causing the expression rate of a gene in microorganisms compared to the wild type by

ch) the specific expression activity in the microorganism of endogenous expression units according to the invention which regulate the expression of the endogenous genes is increased in comparison to the wild-type or

ie) the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity on the basis of embodiment c), the genes being heterologous with respect to the expression units.

Preferably, the regulation of the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity according to embodiment c) is achieved by

dh1) introduces one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism such that the expression of one or more endogenous genes takes place under the control of the introduced expression units, if appropriate with increased specific expression activity, or

dh2) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the genes introduced under the control of the endogenous expression units according to the invention, given if increased specific expression activity, or

ie3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.

The invention further relates to a method for reducing the expression rate of genes in microorganisms compared to the wild type by

he) reduces the specific expression activity in the microorganism of endogenous expression units according to the invention which regulate the expression of the endogenous genes in comparison to the wild type or

dr) introduces expression units with reduced specific expression activity according to embodiment (s) into the genome of the microorganism, so that expression of endogenous genes takes place under the control of the introduced expression units with reduced expression activity.

In a preferred embodiment of the inventive method described above for altering or causing the transcription rate and / or expression rate of genes in microorganisms, the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of Feinchemi¬ kalien, wherein the genes optionally further regulatory elements can contain.

In a particularly preferred embodiment of the inventive method described above for altering or causing the transcription rate and / or expression rate of genes in microorganisms, the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, encoding nucleic acids a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, encoding nucleic acids Protein from the biosynthetic pathway of carbohydrate hydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, encoding nucleic acids a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, wherein the genes may optionally contain further regulatory elements. In a particularly preferred embodiment, the proteins from the biosynthesis path of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate Dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease , Transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystahionine beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyl Transferase, homoserine dehydrogenase, homoserine kinase, threonine synthase, T hreonine export carrier, threonine dehydratase, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase activity , Sulfatadenyltransferase subunits 1 and 2, phosphoadenosine phosphosulfate reductase, ferredoxin sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl t-RNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux Protein, serine hydroxymethyltransferase, fructose-1, 6-bisphosphatase, sulfate reduction protein RXA077, sulfate reduction protein RXA248, sulfate reduction protein RXA247, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase.

Preferred proteins and nucleic acids encoding these proteins of the above-described proteins from the biosynthetic pathway of amino acids are protein sequences or nucleic acid sequences of microbial origin, preferably from bacteria of the genus Corynebacterium or Brevibacterium, preferably from coryneform bacteria, particularly preferably from Corynebacterium glutamicum.

Examples of particularly preferred protein sequences and the corresponding nucleic acid sequences encoding these proteins from the biosynthetic pathway of amino acids, their reference document, as well as their name in the reference document are listed in Table 1: Table 1

Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the fructose-1,6-bisphosphatase 2, or also called fbr2, (SEQ ID NO. 23) and the corresponding nucleic acid sequence encoding a fructose-1, 6-bisphosphatase 2 (SEQ ID NO: 22).

Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the protein in sulfate reduction, or else called RXA077, (SEQ ID NO: 3) and the corresponding Nucleic acid sequence encoding a protein in sulfate reduction (SEQ ID NO: 4)

Further particularly preferred protein sequences from the biosynthesis pathway of amino acids each have the amino acid sequence given in Table 1 for this protein, the respective protein in each case at least one of the amino acid positions indicated in Table 2 / column 2 for this amino acid sequence another proteinogenic amino acid than the respective amino acid indicated in Table 2 / Column 3 in the same line. In a further preferred embodiment, the proteins have the amino acid indicated in Table 2 / Column 4 in the same row on at least one of the amino acid positions indicated in Table 2 / Column 2 for the amino acid sequence. The proteins indicated in Table 2 are mutated proteins of the biosynthetic pathway of amino acids which have particularly advantageous properties and are therefore particularly suitable for expression. sion of the corresponding nucleic acids by the promoter according to the invention and for the production of amino acids. For example, the T3111 mutation results in switching off the feedback inhibition from ask.

The corresponding nucleic acids which encode a mutated protein from Table 2 described above can be prepared by conventional methods.

The starting point for the preparation of the nucleic acid sequences encoding a mutated protein is, for example, the genome of a Corynebacterium glutamicum strain which is obtainable from the American Type Culture Collection under the name ATCC 13032 or the nucleic acid sequences referred to in Table 1. For the back translation of the amino acid sequence of the mutated proteins into the nucleic acid sequences encoding these proteins, it is advantageous to use the codon usage of the organism into which the nucleic acid sequence is to be introduced or in which the nucleic acid sequence is present. For example, it is preferable for Corynebacterium glutamicum to use the codon usage of Corynebacterium glutamicum. The codon usage of the particular organism can be determined in a manner known per se from databases or patent applications which describe at least one protein and a gene which codes for this protein from the desired organism.

The data in Table 2 are to be understood as follows:

Column 1 "Identification" lists a unique name for each sequence in relation to Table 1.

In column 2 "AS-POS" the respective number refers to the amino acid position of the corresponding polypeptide sequence from Table 1. A "26" in the column "AS-POS" therefore means the amino acid position 26 of the corresponding indicated polypeptide sequence. The counting of the position starts N-terminal at +1.

In column 3 "AS wild type" the respective letter designates the amino acid - represents in the one-letter code at the position indicated in column 2 at the ent speaking wild-type strain of the sequence from Table 1.

In column 4 "AS mutant" the respective letter designates the amino acid - represents in the one-letter code- at the position indicated in column 2 in the corresponding mutant strain. Column 5 "Function" lists the physiological function of the corresponding polypeptide sequence.

For a mutated protein with a specific function (column 5) and a specific starting amino acid sequence (table 1), at least one mutation is described in columns 2, 3 and 4, and several mutations are also described for some sequences. These multiple mutations always refer to the above-mentioned, closest starting amino acid sequence (Table 1). The term "at least one of the amino acid positions" of a particular amino acid sequence is preferably understood to mean at least one of the mutations described for this amino acid sequence in columns 2, 3 and 4.

One-letter code of proteinogenic amino acids:

A Alanine

C Cysteine

D aspartate

E glutamate

FPhenylalanine G glycine

H His

I isoleucine

K lysine

LLeucine M methionine

N asparagine

P proline

Q Glutamine

R arginine S serine

TThreonin

V Valin

W tryptophan

Y tyrosine Table 2

In the above-described method according to the invention for altering or causing the transcription rate and / or expression rate of genes in microorganisms and the methods for the production of genetically modified microorganisms described below, the genetically modified microorganisms described below and the methods for the preparation of biosynthetic products, the incorporation of the erfindungsge¬ according to nucleic acids with promoter activity, the expression units of the invention, the genes described above and the above-described Nucleic acid constructs or expression cassettes in the microorganism, in particular in corynefome bacteria, preferably by the SacB method.

The SacB method is known to the person skilled in the art and is described, for example, in Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A .; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of deficient deletions in the chromosomes of Corynebacterium glutamicum, Gene. 1994 JuI 22; 145 (1): 69-73 and Blomfield IC, Vaughn V, remainder RF ₁ Eisenstein Bl .; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC-101 replicon; Mol Microbiol. 1991 Jun; 5 (6): 1447-57.

In a preferred embodiment of the method according to the invention described above, the change or causation of the transcription rate and / or expression rate of genes in microorganisms is effected by introducing nucleic acids according to the invention having promoter activity or inventive expression units into the microorganism.

In a further preferred embodiment of the methods according to the invention described above, the change or causation of the transcription rate and / or expression rate of genes in microorganisms takes place by introduction of the above-described nucleic acid constructs or expression cassettes into the microorganism. The invention therefore further relates to an expression cassette comprising

at least one expression unit according to the invention

at least one further nucleic acid sequence to be expressed, ie a gene to be expressed, and

optionally further genetic control elements, such as a terminator,

wherein at least one expression unit and another nucleic acid sequence to be expressed are functionally linked to one another and the further nucleic acid sequence to be expressed is heterologous with respect to the expression unit.

Preferably, the nucleic acid sequence to be expressed is at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.

The nucleic acid sequence to be expressed is particularly preferably selected from the group of nucleic acids encoding a protein from the biosynthesis pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids , Nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes.

Preferred proteins from the biosynthetic pathway of amino acids are described above and their examples in Tables 1 and 2.

In the expression cassettes according to the invention, the physical position of the expression unit relative to the gene to be expressed is selected so that the expression unit regulates the transcription and preferably also the translation of the gene to be expressed and thus enables the formation of one or more proteins. The "enabling education" involves constitutively increasing the formation, weakening or blocking the formation under specific conditions and / or increasing the formation under specific conditions. The "conditions" include: (1) adding a component to the culture medium, (2) removing one (1) adding a component to the culture medium, (2) removing a component from the culture medium, (3) replacing a component in the culture medium with a second component, (4) increasing the temperature of the culture medium, (5) lowering the temperature of the culture medium Culture medium, and (6) regulation of atmospheric conditions, such as oxygen or nitrogen concentration, in which the culture medium is maintained.

The invention furthermore relates to an expression vector comprising an above-described expression cassette according to the invention.

Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985). Vectors other than plasmids are also to be understood as meaning all other vectors known to the person skilled in the art, such as, for example, phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be autonomously replicated in the host organism or replicated chromosomally.

Particularly suitable plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors, such. PZKE (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExi (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al. Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1. Other Plasmid¬ vectors, such as. B. pCLiK5MCS, or those based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (US-A 5,158,891), can be in be used in the same way.

Furthermore, those plasmid vectors by means of which one can apply the method of gene amplification by integration into the chromosome, as described for example by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication or amplification of the hom-thrB operon. In this method, the complete gene is cloned into a plasmid vector that can replicate in a host (typically E. coli) but not in C. glutamicum. Examples of vectors which are used are pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Berard et al. , Journal of Molecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al., 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342) Question. The plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation. Methods for transformation are described by Thierbach et al. (Ap Plied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican and Shivnan (Biotechnology 7, 1067-1070 (1989)) and Tauch et al. (FEMS Microbiological Letters 123,343-347 (1994)).

The invention further relates to a genetically modified microorganism, wherein the genetic modification leads to a change or causation of the transcription rate of at least one gene in comparison to the wild type and is conditioned by

a) modification of the specific promoter activity in the microorganism of at least one endogenous nucleic acid with promoter activity according to claim 1, which

Regulated transcription of at least one endogenous gene or

b) Regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with modified specific promoter activity according to embodiment a), wherein the genes are heterologous with respect to the nucleic acids with promoter activity.

As described above in the methods, the regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with altered specific promoter activity according to embodiment a) is achieved by

b1) introduces one or more nucleic acids with promoter activity according to claim 1, optionally with modified specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity according to An ¬ Speech 1, optionally with altered specific promoter activity, takes place or

b2) introducing one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with altered specific promoter activity, or

b3) one or more nucleic acid constructs containing a nucleic acid with Pro¬ motor activity according to claim 1, optionally with altered specific Promo¬ toraktivität, and functionally linked one or more nucleic acids to be transcribed into the microorganism brings. The invention further relates to a genetically modified microorganism having an increased or caused transcription rate of at least one gene in comparison to the wild type, wherein

ah) the specific promoter activity in the microorganism of endogenous nucleic acids having promoter activity according to claim 1, which regulate the transcription of endogenous genes, is increased in comparison with the wild-type, or

bh) the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with increased specific

Promoter activity according to embodiment ah), wherein the genes are heterologous with respect to the nucleic acids having promoter activity.

bh1) introduces one or more nucleic acids with promoter activity according to claim 1, where appropriate with increased specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under control of the introduced nucleic acid with promoter activity, optionally with increased specific promoter activity, or

bh2) introduces one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity, or

bh3) one or more nucleic acid constructs containing a nucleic acid with promoter activity according to claim 1, optionally with increased specific promoter activity, and functionally linked one or more nucleic acids to be transcribed into the microorganism.

The invention further relates to a genetically modified microorganism having a reduced transcription rate of at least one gene in comparison to the wild type, wherein

ar) the specific promoter activity in the microorganism of at least one endogenous nucleic acid with promoter activity according to claim 1, the transcription of or at least one endogenous gene is reduced compared to the wild type or

br) one or more nucleic acids with reduced promoter activity according to embodiment a) have been introduced into the genome of the microorganism, so that the

Transcription of at least one endogenous gene under the control of the introduced nucleic acid with reduced promoter activity takes place.

The invention further relates to a genetically modified microorganism, wherein the genetic modification leads to a change or causation of the Expressionsra¬ te of at least one gene in comparison to the wild type and is caused by

c) alteration of the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of at least one endogenous gene, in comparison to the wild-type or

d) Regulation of the expression of genes in the microorganism by Expressionsein¬ units according to claim 2 or 3 or by expression units according to claim 2 or 3 with altered specific expression activity according to embodiment a), wherein the genes are heterologous with respect to the expression units.

As described above in the methods, the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with altered specific expression activity according to embodiment a) is achieved by

d1) introduces one or more expression units according to claim 2 or 3, optionally with altered specific expression activity, into the genome of the microorganism such that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, optionally with altered specific expression activity, or

d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the genes introduced takes place under the control of the endogenous expressing units according to claim 2 or 3, optionally with altered specific expression activity, or

d3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with modified specific expression and functionally links one or more nucleic acids to be expressed, into which microorganisms are introduced.

The invention further relates to a genetically modified microorganism having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein

ch) the specific expression activity in the microorganism of at least one endogenous expression units according to claim 2 or 3, which regulates the expression of the endogenous genes, compared to the wild type increased or

ie) the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with increased specific expression activity according to embodiment a), wherein the genes are heterologous with respect to the expression units.

As described above in the methods, the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with increased specific expression activity according to embodiment a) is achieved by

dh1) introduces one or more expression units according to claim 2 or 3, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, if appropriate with increased specific expression activity, takes place or

dh2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to claim 2 or 3, optionally with increased specific expression activity, or

ie3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with increased specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganism introduces.

The invention further relates to a genetically modified microorganism having a reduced expression rate of at least one gene in comparison to the wild type, wherein it) the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of at least one edogenic gene, is reduced in comparison with the wild-type or

dr) one or more expression units according to claim 2 or 3 were introduced with reduced expression activity in the genome of the microorganism, so that the expression of at least one gene under the control of the introduced expression unit according to claim 2 or 3 takes place with reduced expression activity.

Furthermore, the invention relates to a genetically modified microorganism containing an expression unit according to claim 2 or 3 and functionally linked to a gene to be expressed, wherein the gene is heterologous with respect to the expression unit.

This genetically modified microorganism particularly preferably contains an expression cassette according to the invention.

The present invention particularly preferably relates to genetically modified microorganisms, in particular coryneform bacteria, which contain a vector, in particular

Shuttle vector or plasmid vector carrying at least one recombinant nucleic acid of the invention definition.

In a preferred embodiment of the genetically modified microorganisms, the genes described above are at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.

In a particularly preferred embodiment of the genetically modified microorganisms, the genes described above are selected from the group consisting of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthesis pathway of nucleotides and nucleosides, Nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthesis pathway of carbohydrates, nucleic acids encoding a protein the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, which genes may optionally contain further regulatory elements.

Preferred proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate Kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystahionine beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, Homoserine kinase, threonine synthase, threonine-exporter-carrier, threonine-dehydrata se, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase, cysteine synthase II coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase activity, sulfate adenyltransferase subunit 1 and 2, phosphoadenosine phosphosulfate Reductase, ferredoxin sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, Arginyl t-RNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux protein, serine hydroxymethyltransferase, fructose 1, 6-bisphosphatase, sulfate reduction protein RXA077, sulfate reduction protein RXA248, sulfate reduction protein RXA247, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase

Particularly preferred examples of the proteins and genes from the biosynthetic pathway of amino acids are described above in Table 1 and Table 2.

Preferred microorganisms or genetically modified microorganisms are bacteria, algae, fungi or yeasts.

Particularly preferred microorganisms are, in particular, coryneform bacteria.

Preferred coryneform bacteria are bacteria of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens or of the genus Brevibacterium, in particular of the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum. Particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are selected from the group Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium efficiens DSM 44548. Corynebacterium efficiens DSM 44549, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869, Brevibacterium divarica- tum ATCC 14020, Corynebacterium glutamicum KFCC10065 and Corynebacterium glutamicum ATCC21608.

The abbreviation KFCC means the Korean Federation of Culture Collection, the abbreviation ATCC means the American strain strain culture collection, with the abbreviation DSM the German Collection of Microorganisms.

Further particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are listed in Table 3:

The abbreviations have the following meaning:

ATCC: American Type Culture Collection, Rockville, MD ₁ USA

FERM: Fermentation Research Institute, Chiba, Japan

NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL

USA

CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain

NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK

CBS: Centraalbureau voor Schimmelcultures, Baarn, NL

NCTC: National Collection of Type Cultures, London, UK

DSMZ: German Collection of Microorganisms and Cell Cultures, Braunschweig,

germany

The inventive nucleic acids with promoter activity and the expression units according to the invention make it possible with the aid of the above-described inventive methods to regulate the metabolic pathways to specific biosynthetic products in the above-described inventive genetically modified microorganisms. For this purpose, for example, metabolic pathways which lead to a specific biosynthetic product by causing or increasing the transcription rate or expression rate of genes of this biosynthetic pathway in which the increased protein amount to increased total activity of these proteins of the desired biosynthetic pathway and thus to an increased metabolic flux to the gewün - leads biosynthetic product.

Furthermore, metabolic pathways which lead away from a specific biosynthetic product can be attenuated by reducing the transcription rate or expression rate of genes of this pathway leading to reduced total protein activity of these proteins of the unwanted biosynthetic pathway and thus in addition to increased metabolic activity selfluß leads to the desired biosynthetic product.

The genetically modified microorganisms according to the invention are, for example, able to produce biosynthetic products from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.

The invention therefore relates to a process for the production of biosynthetic products by culturing genetically modified microorganisms according to the invention.

Depending on the desired biosynthetic product, the transcription rate or expression rate of different genes must be increased or reduced. In general, it is advantageous to change the transcription rate or expression rate of several genes, i. to reduce the transcription rate or expression rate of a combination of genes to erhe and / or to reduce the transcription rate or expression rate of a combination of genes.

In the genetically modified microorganisms according to the invention, at least one altered, that is to say increased or reduced, transcription rate or expression rate of a gene can be attributed to a nucleic acid according to the invention having promoter activity or the expression unit according to the invention.

Further, additional modified, i. additionally increased or additionally reduced

Transcription rates or expression rates of further genes in the genetically modified microorganism can, but need not, go back to the nucleic acids according to the invention with promoter activity or the expression units according to the invention. The invention therefore furthermore relates to a process for the preparation of biosynthetic products by culturing genetically modified microorganisms according to the invention.

Preferred biosynthetic products are fine chemicals.

The term "fine chemical" is well known in the art and includes compounds produced by an organism and used in various industries, such as, but not limited to, the pharmaceutical, agricultural, cosmetics, food and feed industries. These compounds include organic acids such as tartaric acid, itaconic acid and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides and nucleotides (as described for example in Kuinaka, A. (1996) Nucleotides and Related Compounds, pp. 561-612, Biotechnology Vol. 6, Rehm et al., ed. VCH: Weinheim and the citations contained therein), lipids, saturated and unsaturated fatty acids (for example arachidonic acid), diols (for example propane). diol and butanediol), carbohydrates (for example hyaluronic acid and trehalose), aromatic compounds (for example aromatic amines, vanillin and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", Pp. 443-613 (1996) VCH: Weinheim and the citations therein; and Ong, AS, Niki, E. and Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO / Confederation of Scientific and Technological Gical Associations in Malaysia and the Society for Free Radical Research - Asia, held on 1-3 May. Enzymes and all others by Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 and the references cited therein. The metabolism and the uses of certain fine chemicals are further elucidated below.

I. Amino Acid Metabolism and Uses

The amino acids comprise the basic structural units of all proteins and are therefore essential for normal cell function. The term "amino acid" is known in the art. The proteinogenic amino acids, of which there are 20 species, serve as structural units for proteins in which they are linked via peptide bonds, whereas the non-proteinogenic amino acids (of which hundreds are known) usually do not occur in proteins (see Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97 VCH: Weinheim (1985)). The amino acids may be in the D or L configuration, although L-amino acids are usually the only type found in naturally occurring proteins. place. Biosynthesis and degradation pathways of each of the 20 proteinogenic amino acids are well characterized in both prokaryotic and eukaryotic cells (see, for example, Stryer, L. Biochemistry, 3rd Edition, pp. 578-590 (1988)). The "essential" amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine), referred to as having to be taken up with the nutrition due to the complexity of their biosynthesis, are synthesized by simple synthetic routes converted into the remaining 11 "nonessential" amino acids (alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine and tyrosine). Higher animals have the ability to synthesize some of these amino acids, however, the essential amino acids must be taken up with food for normal protein synthesis to take place.

Apart from their function in protein biosynthesis, these amino acids are interesting chemicals in themselves, and it has been discovered that many are used in various applications in the food, feed, chemical, cosmetic, agricultural and pharmaceutical industries come. Lysine is an important amino acid not only for human nutrition, but also for monogastric animals such as poultry and pigs. Glutamate is most commonly used as a flavor additive (monosodium glutamate, MSG) as well as widely used in the food industry, as are aspartate, phenylalanine, glycine and cysteine. Glycine, L-methionine and tryptophan are all used in the pharmaceutical industry. Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are used in the pharmaceutical and cosmetics industries. Threonine, tryptophan and D- / L-methionine are widely used feed additives (Leuchtenberger, W. (1996) Amino acids - technical production and use, pp. 466-502 in Rehm et al., (Ed.) Biotechnology Vol. 6, chapters 14a, VCH: Weinheim). It has also been discovered that these amino acids are also useful as precursors for the synthesis of synthetic amino acids and proteins such as N-acetylcysteine, S-carboxymethyl-L-cysteine, (S) -5-hydroxytryptophan and others in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97, VCH, Weinheim, 1985.

The biosynthesis of these natural amino acids in organisms which they can produce, for example bacteria, has been well characterized (for a review of bacterial amino acid biosynthesis and its regulation, see Umbarger, HE (1978) Ann. Rev. Biochem. 47: 533-606). Glutamate is produced by reductive amination of α-

Ketoglutarate, an intermediate in the citric acid cycle. Glutamine, proline and arginine are each produced sequentially from glutamate. The biosynthesis of serine takes place in a three-step process and begins with 3-phosphoglycerate (an intermediate in glycolysis), and after oxidation, transamination and hydrolysis steps yields this amino acid. Cysteine and Glycine are each from serine, the former by condensation of homocysteine with serine, and the latter by transfer of the side-chain β-carbon atom to tetrahydrofolate, in a serine transhydroxymethylase catalyzed reaction. Phenylalanine and tyrosine are synthesized from the precursors of the glycolysis and pentose phosphate pathway, erythrose 4-phosphate and phosphoenolpyruvate in a 9-step biosynthetic pathway that differs only in the last two steps after the synthesis of prephenate. Tryptophan is also produced from these two starting molecules, but its synthesis takes place in an 11-step pathway. Tyrosine can also be prepared from phenylalanine in a reaction catalyzed by phenylalanine hydroxylase. Alanine, valine and leucine are each biosynthesis products from pyruvate, the end product of glycolysis. Aspartate is formed from oxalacetate, an intermediate of the citrate cycle. Asparagine, methionine, threonine and lysine are each produced by conversion of aspartate. Isoleucine is formed from threonine. In a complex 9-step pathway, histidine is formed from 5-phosphoribosyl-1-pyrophosphate, an activated sugar.

Amino acids whose amount exceeds the protein biosynthetic needs of the cell can not be stored, and are instead degraded to provide intermediates for the cell's major metabolic pathways (for review, see Stryer, L., Biochemistry, 3rd Ed. Chapter 21 "Amino Acid Degradation and the Urea Cycle", S 495-516 (1988)). While the cell is capable of converting unwanted amino acids into useful metabolic intermediates, amino acid production is expensive in terms of energy, precursor molecules and the enzymes necessary for their synthesis. It is therefore not surprising that the amino acid biosynthesis is regulated by feedback inhibition, wherein the presence of a certain amino acid slows down or completely stops its own production (for a review of the feedback mechanism in amino acid biosynthetic pathways, see Stryer , L., Biochemistry, 3rd Ed., Chapter 24, "Biosynthesis of Amino Acids and Heme", pp. 575-600 (1988)). The release of a particular amino acid is therefore limited by the amount of this amino acid in the cell.

II. Vitamins, cofactors and nutraceutical metabolism and uses

Vitamins, cofactors and nutraceuticals comprise another group of molecules. Higher animals have lost the ability to synthesize them and thus need to ingest them, although they are readily synthesized by other organisms, such as bacteria. These molecules are either biologically active molecules per se or precursors of biologically active substances which serve as electron carriers or intermediates in a number of metabolic pathways. In addition to their nutritional value, these compounds also have a significant industrial value as dyes, xidants and catalysts or other processing aids. (For an overview of the structure, activity and industrial applications of these compounds see, for example, Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", Vol. A27, pp. 443-613, VCH: Weinheim, 1996). The term "vitamin" is known in the art and includes nutrients that are needed by an organism for normal function, but can not be synthesized by that organism itself. The group of vitamins may include cofactors and nutraceutical compounds. The term "cofactor" includes non-proteinaceous compounds that are necessary for the occurrence of normal enzyme activity. These compounds may be organic or inorganic; the cofactor molecules according to the invention are preferably organic. The term "nutraceutical" includes food additives that are beneficial to the health of plants and animals, especially humans. Examples of such molecules are vitamins, antioxidants and also certain lipids (eg polyunsaturated fatty acids).

The biosynthesis of these molecules in organisms capable of producing them, such as bacteria, has been extensively characterized (Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", Vol. A27, pp. 443-613, VCH: Weinheim, 1996). Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley, Ong, AS, Niki, E. and Packer, L. (1995) Nutrition, Lipids, Health and Disease Proceedings of the UNESCO / Confederation of Scientific and Technological Associations of Malaysia and the Society for Free Radical Research - Asia, held Sept. 1-3, 1994 in Penang, Malaysia, AOCS Press, Champaign, IL X, 374 S).

Thiamine (vitamin B ₁ ) is produced by chemical coupling of pyrimidine and thiazole

Formed units. Riboflavin (vitamin B ₂ ) is synthesized from guanosine 5'-triphosphate (GTP) and ribose 5'-phosphate. In turn, riboflavin is used to synthesize flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). The family of compounds collectively referred to as "vitamin B6" (eg, pyridoxine, pyridoxamine, pyridoxal-5'-phosphate and the commercially used pyridoxine hydrochloride) are all derivatives of the common structural unit 5-hydroxy-6-methylpyridine. Panthothenate (pantothenic acid, R - (+) - N- (2,4-dihydroxy-3,3-dimethyl-1-oxobutyl) -β-alanine) can be prepared either by chemical synthesis or by fermentation. The last steps in pantothenate biosynthesis consist of the ATP-driven condensation of β-alanine and pantoic acid. The enzymes responsible for the biosynthesis steps for the conversion into pantoic acid, into β-alanine and for the condensation in pantothenic acid are known. The metabolically active form of pantothenate is coenzyme A, whose biosynthesis proceeds through 5 enzymatic steps. Pantothenate, pyridoxal-5'-phosphate, cysteine and ATP are the precursors of coenzyme A. These enzymes not only catalyze the formation of pantothenate, but also also the production of (R) -pantoic acid, (R) -pantolactone, (R) -panthenol (provitamin B ₅ ), pantethein (and its derivatives) and coenzyme A.

The biosynthesis of biotin from the precursor molecule pimeloyl-CoA in microorganisms has been extensively studied, and several of the genes involved have been identified. It has been found that many of the corresponding proteins are involved in Fe cluster synthesis and belong to the class of nifS proteins. The lipoic acid is derived from octanoic acid and serves as a coenzyme in energy metabolism, where it becomes part of the pyruvate dehydrogenase complex and of the α-ketoglutarate dehydrogenase complex. The folates are a group of substances which are all derived from folic acid, which in turn is derived from L-glutamic acid, p-aminobenzoic acid and 6-methylpterin. The biosynthesis of folic acid and its derivatives, starting from the metabolic intermediates guanosine 5'-triphosphate (GTP), L-glutamic acid and p-aminobenzoic acid, has been extensively studied in certain microorganisms.

Corrinoids (such as the Cobalamine and especially Vitamin Bi ₂ ) and the porphyrins belong to a group of chemicals that are characterized by a tetrapyrrole ring system. The biosynthesis of vitamin B ₁₂ is sufficiently complex that it has not yet been fully characterized, however, a large part of the participating enzymes and substrates is now known. Nicotinic acid (nicotinate) and nicotinamide are pyridine derivatives, also referred to as "niacin". Niacin is the precursor of the important coenzymes NAD (Ntkotinamidadenine dinucleotide) and NADP (Nicotinamide Nadeinucleotide Phosphate) and their reduced forms.

The large scale production of these compounds relies largely on cell-free chemical syntheses, although some of these chemicals have also been produced by the large-scale growth of microorganisms such as riboflavin, vitamin B ₆ , pantothenate and biotin. Only Vitamin Bi ₂ is only produced by fermentation due to the complexity of its synthesis. In vitro methods require a considerable expenditure of materials and time and often at high costs.

III. Purine, pyrimidine, nucleoside and nucleotide metabolism and uses

Genes for purine and pyrimidine metabolism and their corresponding proteins are important targets for the treatment of tumors and viral infections. The term "purine" or "pyrimidine" includes nitrogen-containing bases which are part of the nucleic acids, coenzymes and nucleotides. The term "nucleotide" includes the basic structural units of the nucleic acid molecules which comprise a nitrogen-containing base, a pentose sugar (in the case of RNA, the sugar is ribose, in the case of DNA the sugar D is Deoxyribose) and phosphoric acid. The term "nucleoside" includes molecules which serve as precursors of nucleotides, but unlike the nucleotides have no phosphoric acid moiety. By inhibiting the biosynthesis of these molecules or mobilizing them to form nucleic acid molecules, it is possible to inhibit RNA and DNA synthesis; If this activity is purposefully inhibited in cancerous cells, the ability to divide and replicate tumor cells can be inhibited.

There are also nucleotides that do not form nucleic acid molecules but serve as energy stores (i.e., AMPs) or coenzymes (i.e., FAD and NAD).

Several publications have described the use of these chemicals for these medical indications, whereby the purine and / or pyrimidine metabolism is influenced (for example Christopherson, Rl and Lyons, SD (1990) "Potential inhibitors of de novo pyrimidines and purine biosynthesis as chemotherapeutic agents ", Med. Res. Reviews 10: 505-548). Studies on enzymes involved in purine and pyrimidine metabolism have focused on the development of new medicaments which may be used, for example, as immunosuppressants or antiproliferants (Smith, JL "Enzymes in Nucleotide Synthesis" Curr. Opin. Struct. Biol. 5 (1995) 752-757; Biochem. Soc. Transact. 23 (1995) 877-902). The purine and pyrimidine bases, nucleosides and nucleotides, however, also have other possibilities of use: as intermediates in the biosynthesis of various fine chemicals (eg thiamine, S-adenosylmethionine, folates or riboflavin), as energy carrier for the cell (for example ATP or GTP) and chemicals themselves are commonly used as flavor enhancers (eg, IMP or GMP) or for many medical applications (see, for example, Kuninaka, A. (1996) Nucleotides and Related Compounds in Biotechnology Vol. Weinheim, pages 561-612). Enzymes involved in purine, pyrimidine, nucleoside or nucleotide metabolism are also increasingly serving as targets against which chemicals are used plant protection, including fungicides, herbicides and insecticides.

The metabolism of these compounds in bacteria has been characterized (for reviews, see, for example, Zalkin, H. and Dixon, JE (1992) "De novo purin nucleotide biosynthesis" in Progress in Nucleic Acids Research and Molecular Biology, Vol. 42, Academic Press, pp. 259-287; and Michal, G. (1999) "Nucleotides and Nucleosides", Chap. 8 in: Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, Wiley, New York). Purine metabolism, the object of intesive research, is essential to the normal functioning of the cell. Disturbed purine metabolism in higher animals can cause severe diseases, for example gout. The purine nucleotides are made via a series of steps via the intermediate lnosine 5'-phosphate (IMP) from ribose-5-phosphate, resulting in the production of guanosine 5'-monophosphate (GMP) or adenosine 5'-monophosphate (AMP), from which the triphosphate forms used as nucleotides can be easily prepared. These compounds are also used as energy stores, so that their degradation provides energy for many different biochemical processes in the cell. The Pyrimidinbiosynthe- se via the formation of uridine 5'-monophosphate (UMP) from ribose-5-phosphate. In turn, UMP is converted to cytidine 5'-triphosphate (CTP). The deoxy forms of all nucleotides are prepared in a one-step reduction reaction from the diphosphate ribose form of the nucleotide to the diphosphate-deoxyribose form of the nucleotide. After phosphorylation, these molecules can participate in DNA synthesis.

IV. Trehalose Metabolism and Uses

Trehalose consists of two molecules of glucose linked together by α, α-1, 1 bonding. It is commonly used in the food industry as a sweetener, as an additive for dried or frozen foods, and in beverages. However, it is also used in the pharmaceutical, cosmetics and biotechnology industries (see, for example, Nishimoto et al., (1998) US Patent No. 5,759,610; Singer, MA and Lindquist, S. Trends Biotech 16 (1998) 460-467; Paiva, CLA and Panek, AD Biotech Ann. Rev. 2 (1996) 293-314; and Shiosaka, MJ Japan 172 (1997) 97-102). Trehalose is produced by enzymes from many microorganisms and naturally released into the surrounding medium from which it can be recovered by methods known in the art.

Particularly preferred biosynthetic products are selected from the group of organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromati cal compounds, vitamins and cofactors, enzymes and proteins.

Preferred organic acids are tartaric acid, itaconic acid and diaminopimelic acid

Preferred nucleosides and nucleotides are described, for example, in Kuninaka, A. (1996) Nucleotides and Related Compounds, pp. 561-612, Biotechnology Vol. 6, Rehm et al., Ed. VCH: Weinheim and the citations contained therein.

Preferred biosynthetic products are also lipids, saturated and unsaturated fatty acids, such as, for example, arachidonic acid, diols, for example propanediol and butanediol, carbohydrates, for example hyaluronic acid and trehalose, aromatic compounds, for example aromatic amines, vanillin and indigo, Vitamins and cofactors as described, for example, in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the citations contained therein; and Ong, AS, Niki, E. and Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO / Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research - Asia , held on 1.-3. Sept. 1994 in Penang, Malysia, AOCS Press (1995)), Enzyme Polyketides (Cane et al. (1998) Science 282: 63-68), and all others by Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 and the references cited therein.

Particularly preferred biosynthetic products are amino acids, more preferably essential amino acids, in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid , L-serine, L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine, L-histidine, L-arginine, L-asparagine, L-aspartic acid and L-threonine, L-homoserine, in particular L-lysine, L-methionine and L-threonine. In the following, among an amino acid such as lysine, methionine and threonine, both the L and the D form of the amino acid, preferably the L-form, that is, for example, L-lysine, L-methionine and L-threonine stood.

The invention relates in particular to a process for the preparation of lysine by cultivating genetically modified microorganisms with an increased or caused expression rate of at least one gene in comparison to the wild type, wherein

ch) the specific expression activity in the microorganism of at least one endogenous expression unit according to the invention which regulates the expression of the endogenous genes is increased in comparison to the wild type or

ie) the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment (ch), whereby the genes are heterologous with respect to the expression units,

and wherein the genes are selected from the group consisting of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a diaminopimelate dehydrogenase, nucleic acids encoding a diaminopimelate decarboxylase, nucleic acids encoding a dihydrodipicolinate synthetase, encoding nucleic acids a dihydridipicolinate reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvic acid vat carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a transcriptional regulator LuxR, nucleic acids encoding a transcriptional regulator LysR1, nucleic acids encoding a transcriptional regulator LysR2, nucleic acids encoding a malate quinone oxodoreductase, nucleic acids encoding a glucose-6 Phosphate de-dehydrogenase, nucleic acids encoding a 6-phosphogluconate dehydrognease, nucleic acids encoding a transketolase, nucleic acids encoding a transaldolase, nucleic acids encoding a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding an arginyl t-RNA synthetase, Nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding a fructose-1,6-bisphosphatase, nucleic acids encoding an OPCA protein, nucleic acids encoding a 1-phosphofructokinase and nucleic acids encoding a 6-phosphofructokinase.

As described above in the methods, the regulation of the expression of these genes in the microorganism by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment ch) is achieved by

dh1) brings one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism such that the expression of one or more of these endogenous genes under the control of the introduced expression units according to the invention, if appropriate with increased specific expression activity, done or

dh2) introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity, or

ie3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganisms are introduced.

A further preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase Activity, diaminopilate dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipic colinate synthetase activity, dihydridipicolinate Rductase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, activity of the transcriptional regulator LuxR, activity of the Transcriptional Regulators LysR1, Transcriptional Regulators Activity LysR2, Malate Quinone Oxodoreductase Activity, Glucose-6-phosphate Deydrognease Activity, 6-Phosphogluconate Dehydrognease Activity, Transketolase Activity, Transaldolase Activity, Lysine Exporter Activity, Arginol t-RNA synthetase activity, phosphoenolpyruvate carboxylase activity, fructose 1, 6-bisphosphatase activity, protein OpcA activity, 1-phosphofructokinase activity, 6-phosphofructokinase activity and biotiri ligase activity exhibit.

A further particularly preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, O-acetyl homoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity, threonine efflux protein Activity, asparaginase activity, aspartate decarboxylase activity and threonine synthase activity.

These additional, increased or reduced activities of at least one of the above-described activities may, but need not, be caused by a nucleic acid according to the invention having promoter activity and / or an expression unit according to the invention.

The invention further relates to a process for the production of methionine by cultivating genetically modified microorganisms having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein

ie) the expression of genes in the microorganism by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment ch), the genes being heterologous with respect to the expression units, and wherein the genes are selected from the group of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a homoserine dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, encoding nucleic acids Pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homologous O-acetyltransferase, nucleic acids encoding a cystahionin gamma synthase, nucleic acids encoding a cystahionin beta-lyase, nucleic acids encoding a serine hydroxymethyltransferase, encoding nucleic acids an O-acetylhomoserine sulfhydrylase, nucleic acids encoding a methylene tetrahydrofolate reductase, nucleic acids encoding a phosphoserine aminotransferase, nucleic acids encoding a phosphoserine phosphatase, nucleic acids encoding a serine acetyl trans ferase nucleic acids encoding a cysteine synthase activity I ₁ nucleic acids encoding a cysteine synthase activity II, nucleic acids encoding a coenzyme B12-dependent methionine synthase activity, nucleic acids encoding a coenzyme B12-independent methionine synthase activity, nucleic acids encoding a sulfate adenylyltransferase Activity, nucleic acids encoding a phosphoadenosine phosphosulfate reductase activity, nucleic acids encoding a ferredoxin sulfite reductase activity, nucleic acids encoding a ferredoxin NADPH reductase activity, nucleic acids encoding a ferredoxin activity, nucleic acids encoding a protein of sulfate reduction RXA077 , Nucleic acids encoding a protein of the sulfate reduction RXA248, nucleic acids encoding a protein of the sulfate reduction RXA247, nucleic acids encoding a, RXA0655 regulator and nucleic acids encoding a RXN2910 regulator.

dh1) brings one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism so that the expression of one or more of these endogenous genes under the control of the incorporated expression units according to the invention, optionally with increased specific expression activity, done or

dh2) introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the genes introduced takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity, or ie3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganism introduces.

A further preferred embodiment of the method for producing methionine described above is characterized in that the genetically modified microorganisms in comparison to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase Activity, homoserine dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxyiase activity, triosephosphate isomerase activity, homosein O-acetyltransferase activity, cystahionine gamma synthase activity , Cystahionin beta-lyase activity, serine hydroxymethyltransferase activity, O-acetyl homoserine sulfhydrylase activity, methylene tetrahydrofolate reductase activity, phosphoserine aminotransferase activity, phosphoserine phosphatase activity, serine acetyltransferase activity, cysteine Synthase activity, cysteine syntha se II activity, coenzyme B12-dependent methionine synthase activity, coenzyme B12-independent methionine synthase activity, sulfate adenylyltransferase activity, phosphoadenosine

Phosphosulfate reductase activity, ferredoxin sulfite reductase activity, ferredoxin NADPH reductase activity, ferredoxin activity activity protein of sulfate reduction RXA077, activity of a sulfate-reducing protein RXA248, activity of a protein of sulfate reduction RXA247, activity an RXA655 regulator and activity of an RXN2910 regulator

A further particularly preferred embodiment of the method for the production of methionine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the homoserine kinase activity, threonine Dehydratase activity, threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase activity, and diaminopicolinate decarboxylase activity.

These additional, increased or reduced activities of at least one of the above-described activities can, but need not, be caused by a nucleic acid according to the invention having promoter activity and / or an expression unit according to the invention. The invention further relates to a process for the production of threonine by cultivating genetically modified microorganisms having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein

and wherein the genes are selected from the group of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase , Nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine kinase, nucleic acids encoding a threonine synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, Nucleic acids encoding a malate quinone oxidoreductase, nucleic acids encoding a 6-phosphogluconate dehydrogenase, nucleic acids encoding a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleus encoding a threonine efflux protein, nucleic acids encoding a fructose-1,6-bisphosphatase, nucleic acids encoding an OpcA protein, nucleic acids encoding a 1-phosphofructokinase, nucleic acids encoding a 6-phosphofructokinase, and nucleic acids encoding one Homoserine dehydrogenase

ie1) one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism ein¬, so that the expression of one or more of these endogenous genes under the control of the introduced expression units according to the invention, given if increased specific expression activity, or

A further preferred embodiment of the method for the production of threonine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase activity , Glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, threonine export carrier activity, transaldolase activity, transketolase Activity, glucose-6-phosphate dehydrogenase activity, malate-quinone oxidoreductase activity, homoserine kinase activity, biotin ligase activity, phosphoenolpyruvate carboxylase activity, threonine efflux protein activity, protein OpcA- Activity, 1-phosphofructokinase activity, 6-phosphofructokinase activity, fructose 1 , 6-bisphosphatase activity, 6-phosphogluconate dehydrogenase and homoserine dehydrogenase activity.

A further particularly preferred embodiment of the above-described method for the production of threonine is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrodipolinate reductase Activity, asparaginase activity, aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol-Aid reductoisomerase activity, branched chain aminotransferase activity, coenzyme B12-dependent methionine synthase activity, coenzyme B12 independent methion synth ase- having dihydroxy-acid dehydratase activity and diaminopicolinate decarboxylase activity.

The term "activity" of a protein in enzymes means the enzyme activity of the corresponding protein, in other proteins, for example structure or transport proteins, the physiological activity of the proteins.

The enzymes are usually able to convert a substrate into a product or to catalyze this conversion step.

Accordingly, the "activity" of an enzyme is understood to mean the amount of substrate or amount of product converted by the enzyme in a specific time.

With an increased activity in comparison to the wild type, the amount of substrate or the amount of product formed is thus increased by the enzyme compared to the wild type in a certain time.

Preferably, this increase in "activity" in all the activities described above and below is at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the "wild-type activity".

With a reduced activity in comparison to the wild type, the amount of substrate or the amount of product formed is thus reduced by the enzyme compared to the wild type in a certain time.

A reduced activity is preferably understood to mean the partial or substantially complete interruption or blocking of the functionality of this enzyme in a microorganism based on different cell biological mechanisms.

A reduction in activity includes a reduction in the amount of an enzyme to a substantially complete absence of the enzyme (ie lack of detectability of the corresponding activity or lack of immunological Detectability of the enzyme). Preferably, the activity in the microorganism is reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100%, compared to the wild type. In particular, "reduction" also means the complete absence of the corresponding activity.

The activity of certain enzymes in genetically modified microorganisms and in the wild type and thus the increase or reduction of the enzyme activity can be determined by known methods, such as enzyme assays.

For example, a pyruvate carboxylase is understood as meaning a protein which has the enzymatic activity of converting pyruvate into oxaloacetate.

Accordingly, a pyruvate carboxylase activity is understood as meaning the amount of pyruvate or amount of oxaloacetate converted in a certain time by the protein pyruvate carboxylase.

In the case of an increased pyruvate carboxylase activity compared to the wild type, the amount of pyruvate reacted or the amount of oxaloacetate formed is thus increased by the protein pyruvate carboxylase compared to the wild type in a specific time.

Preferably, this increase in pyruvate carboxylase activity is at least 5%, more preferably at least 20%, more preferably at least 50%, even more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, especially at least 600% of the pyruvate carboxylase. Activity of the wild type.

Furthermore, we understand, for example, a phosphoenolpyruvate carboxykinase activity as the enzyme activity of a phosphoenolpyruvate carboxykinase.

By a phosphoenolpyruvate carboxykinase is meant a protein having the enzymatic activity of converting oxaloacetate to phosphoenolpyruvate.

Accordingly, phosphoenolpyruvate-carboxykinase activity is understood as meaning the amount of oxaloacetate reacted or the amount of phosphoenolpyruvate formed in a certain time by the protein phosphoenolpyruvate.

With a reduced phosphoenolpyruvate carboxykinase activity compared to the wild type is thus compared to the wild type in a certain time by the protein Phosphoenolpyruvat carboxykinase reduces the reacted amount of oxaloacetate or the amount of phosphoenolpyruvate formed.

A reduction in phosphoenolpyruvate carboxykinase activity includes a quantitative reduction of a phosphoenolpyruvate carboxykinase to an essentially complete absence of phosphoenolpyruvate carboxykinase (ie, lack of detectability of phosphoenolpyruvate carboxykinase activity or lack of immunological detectability of phosphoenolpyruvate carboxykinase ). Preferably, the phosphoenolpyruvate carboxykinase activity is reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100% as compared to the wild-type. In particular, "reduction" also means the complete absence of the phosphoenolpyruvate carboxykinase activity.

The additional increase of activities can take place by different ways, for example by switching off inhibitory regulation mechanisms on expression and protein level or by increasing the gene expression of nucleic acids coding the proteins described above against the wild type.

The increase in the gene expression of the nucleic acids encoding the above-described proteins relative to the wild-type can also be effected by various means, for example by inducing the gene by activators or as described above by increasing the promoter activity or increasing the expression activity or by introducing one or more gene copies into the microorganism.

By increasing the gene expression of a nucleic acid encoding a protein, the manipulation of the expression of the microorganism's own endogenous proteins is also understood according to the invention.

This can be achieved, for example, as described above by changing the promoter and / or expression unit sequences of the genes. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deletion or insertion of DNA sequences.

It is possible, as described above, to alter the expression of the endogenous proteins by the application of exogenous stimuli. This can be done by special physiological conditions, ie by the application of foreign substances. To achieve an increase in gene expression, the person skilled in the art can take further different measures individually or in combination. For example, the copy number of the respective genes can be increased, or the promoter and regulatory region or ribosome binding site located upstream of the structural gene can be mutated. By inducible promoters it is additionally possible to increase the expression in the course of fermentative production. Measures to extend the lifetime of the mRNA also improve the expression. Furthermore, by preventing degradation of the enzyme protein, enzyme activity is also enhanced. The genes or gene constructs may either be present in different copy number plasmids or be integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can be achieved by changing the composition of the medium and culture.

For instructions on this, the skilled person will find, inter alia, in Martin et al. (Biontechnolgy 5, 137-146 (1987)), Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio / Technology 6, 428-430 (1988)), in Eikmanns et al. (Gene 102, 93-98 (1991)), European Patent 0472869, U.S. Patent 4,601,893, Schwarzer and Pühler (Biotechnology 9, 84-87 (1991), Remscheid et al. (Applied and Environmental Microbiology 60,126-132 (1994), in LaBarre et al., (Journal of Bacteriology 175, 1001-1007 (1993)), in the patent application WO 96/15246, in Malumbres et al., (Gene 134, 15-24 (1993)), Japanese Laid-Open Patent Publication JP-A-10-229891, Jensen and Hammer (Biotechnology and Bioengineering 58, 1991-195 (1998)), Makrides (Microbiological Reviews 60: 512-538 (1996) and in well-known textbooks of genetics and molecular biology.

Furthermore, it may be advantageous for the production of biosynthetic products, in particular L-lysine, L-methionine and L-threonine, to eliminate unwanted side reactions in addition to the expression or amplification of a gene (Nakayama: "Breeding of Amino Acid Producing Microorganisms". , in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).

In a preferred embodiment, the gene expression of a nucleic acid encoding one of the proteins described above is increased by introducing at least one nucleic acid encoding a corresponding protein into the microorganism. Introduction of the nucleic acid can be chromosomally or extrachromosomally, ie by increasing the copy number on the chromosome and / or a copy of the gene on a replicating plasmid in the host microorganism. The introduction of the nucleic acid, for example in the form of an expression cassette containing the nucleic acid, preferably takes place chromosomally, in particular by the SacB method described above.

In principle, any gene encoding one of the proteins described above can be used for this purpose.

For genomic nucleic acid sequences from eukaryotic sources containing introns, in the event that the host microorganism is unable or unable to express the corresponding proteins, preferably already processed nucleic acid sequences, such as the corresponding cDNAs to use.

Examples of the corresponding genes are listed in Tables 1 and 2.

Preferably, the reduction of the above-described activities in microorganisms is carried out by at least one of the following processes:

Introducing at least one sense ribonucleic acid sequence for inducing a cosuppression or an expression cassette ensuring its expression

Introducing at least one DNA- or protein-binding factor against the corresponding gene, RNA or protein or an expression cassette ensuring its expression

Introducing at least one viral nucleic acid sequence causing RNA degradation or an expression cassette ensuring its expression

Introducing at least one construct for generating a loss of function, for example the generation of stop codons or a shift in the reading frame, on a gene, for example by generating an insertion, deletion, inversion or mutation in a gene. Knockout mutants can preferably be obtained by targeted insertion into the desired target gene by homologous recombination or introduction of sequence-specific

Nucleases are generated against the target gene.

Introducing a promoter with reduced promoter activity or an expression unit with reduced expression activity. It is known to the person skilled in the art that other methods within the scope of the present invention can also be used to reduce its activity or function. For example, the introduction of a dominant-negative variant of a protein or of an expression cassette which ensures its expression can also be advantageous.

Each of these methods can cause a reduction in the amount of protein, mRNA amount and / or activity of a protein. A combined application is also conceivable. Other methods are known in the art and may include inhibiting or inhibiting processing of the protein, transport of the protein or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an RNA degrading enzyme and / or inhibition of translation elongation or termination ,

In the method according to the invention for the production of biosynthetic products, the step of cultivating the genetically modified microorganisms is preferably followed by isolating biosynthetic products from the microorganisms or from the fermentation broth. These steps may take place simultaneously and / or preferably after the culturing step.

The genetically modified microorganisms according to the invention can be used continuously or discontinuously in the batch process (batch culturing) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the production of biosynthetic products, in particular L-lysine, L-methionine and L-threonine, to be cultured. A summary of known cultivation methods is in the textbook by Chmiel (Bioprozesstechnik 1. Introduction to the bioprocess engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)).

The culture medium to be used must suitably satisfy the requirements of the respective strains. Descriptions of culture media for various-organisms Mik¬ contained in the handbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington DC USA _1, 1981).

These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements. Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Very good sources of carbon are, for example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugar can also be added to the media via complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources. Other possible sources of carbon are oils and fats such. B. soybean oil. Sunflower oil. Peanut oil and coconut fat, fatty acids such. As palmitic acid, stearic acid or linoleic acid, alcohols such. As glycerol, methanol or ethanol and organic acids such. As acetic acid or lactic acid.

Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds. Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soybean meal, soy protein, yeast extract, meat extract and others. The nitrogen sources can be used singly or as a mixture.

Inorganic salt compounds which may be included in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron

As sulfur source for the production of fine chemicals, in particular of methionine, it is possible to use inorganic compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds, such as mercaptans and thiols.

Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the phosphorus source.

Chelating agents can be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.

The fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine. Growth factors and salts are often derived from complex me- serving components such as yeast extract, molasses, corn steep liquor and the like. In addition, suitable precursors can be added to the culture medium. The exact composition of the media compounds will depend heavily on the particular experiment and will be decided on a case by case basis. Information about the media optimization is available from the textbook "Applied Microbiol Physiology, A Practical Approach" (Ed PM Rhodes, PF Stanbury, IRL Press (1997) pp 53-73, ISBN 0 19 963577 3). Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.

All media components are sterilized either by heat (20 min at 1, 5 bar and 121 ⁰ C) or by sterile filtration. The components can either be sterilized together or, if necessary, sterilized separately. All media components may be present at the beginning of the culture or added randomly or in batches as desired.

The temperature of the culture is normally between 15 ° C and 45 ° C, preferably at 25 ° C to 40 ⁰ C and can be kept constant or changed during the experiment. The pH of the medium should be in the range of 5 to 8.5, preferably around 7.0. The pH for cultivation can be controlled during cultivation by addition of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid. To control the development of foam anti-foaming agents, such as. As fatty acid polyglycol, are used. In order to maintain the stability of plasmids, suitable selective substances, such as e.g. As antibiotics, are added. In order to maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such. B. ambient air, registered in the culture. The temperature of the culture is usually 2O ⁰ C to 45 ° C. The culture is continued until a maximum of the desired product has formed. This goal is usually reached within 10 hours to 160 hours.

The fermentation broths thus obtained usually have a dry matter content of 7.5 to 25% by weight.

In addition, it is also advantageous if the fermentation is driven sugar-limited at least at the end, but in particular over at least 30% of the fermentation time. This means that during this time the concentration of utilizable sugar in the fermentation medium is maintained at 0 to 3 g / l, or lowered. The isolation of biosynthetic products from the fermentation broth and / or the microorganisms takes place in a manner known per se in accordance with the physicochemical properties of the biosynthetic desired product and the biosynthetic by-products.

The fermentation broth can then be further processed, for example. Depending on the requirement, the biomass may be wholly or partly by Separationsmetho¬ the, such. As centrifugation, filtration, decantation or a combination of these methods from the fermentation broth or be completely left in it.

Subsequently, the fermentation broth with known methods, such as. B. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or aufkon¬ centered. This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.

However, it is also possible to further purify the biosynthetic products, in particular L-lysine, L-methionine and L-threonine. For this purpose, after separation of the biomass, the product-containing broth is subjected to chromatography with a suitable resin, the desired product or impurities being wholly or partially retained on the chromatography resin. If necessary, these chromatographic steps can be repeated using the same or different chromatography resins. The person skilled in the art is familiar with the choice of suitable chromatography resins and their most effective use. The purified product may be concentrated by filtration or ultrafiltration and stored at a temperature at which the stability of the product is maximized.

The biosynthetic products can be obtained in different forms, for example in the form of their salts or esters.

The identity and purity of the isolated compound (s) can be determined by techniques of the prior art. These include high performance liquid chromatography (HPLC), spectroscopic methods, staining procedures, thin layer chromatography, NIRS, enzyme assay or microbiological assays. These analytical methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp. 559-566, pp. 575-581 and pp. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17.

The invention will now be described in more detail by means of the following non-limiting examples:

example 1

Preparation of vector pCUK5MCS

First, ampicillin resistance and origin of replication of the vector pBR322 with the oligonucleotide primers SEQ ID NO 5: and SEQ ID NO 6: were amplified by means of the polymerase chain reaction (PCR).

SEQ ID NO 5:

5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACA G-3 '

SEQ ID NO 6: 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3 '

In addition to the sequences complementary to pBR322, the oligonucleotide primer SEQ ID NO 5: contains in 5'-3 'direction the sites for the restriction endonucleases Smal, BamHI, Nhel and Ascl and the oligonucleotide primer SEQ ID NO 6: in 5'-3' direction Interfaces for the restriction endonucleases Xbal, Xhol, Notl and Dral. The PCR reaction was carried out by standard method as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA). The resulting DNA fragment, approximately 2.1 kb in size, was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The blunt ends of the DNA fragment were ligated together with the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the Hersteilers and the ligation mixture by standard methods as in Sambrook et al. (Molecular Corning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on ampicillin (50 μg / ml) -containing LB agar (Lennox, 1955, Viroiogy, 1: 190). The plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests. The resulting plasmid is named pCLiKI.

Starting from the plasmid pWLT1 (Liebl et al., 1992) as a template for a PCR reaction, a kanamycin resistance cassette was amplified using the oligonucleotide primers SEQ ID NO: 7 and SEQ ID NO: 8.

SEQ ID NO: 7: 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-S '

SEQ ID NO: 8 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-S '

In addition to the pWLT1 complementary sequences, the oligonucleotide primer SEQ ID NO: 7 in 5'-3 'direction contains the cut portions for the restriction endonucleases Xbal, Smal, BamHI, NheI and the oligonucleotide primer SEQ ID NO: 8 in 5'-3' direction the Interfaces for the restriction endonucleases Ascl and Nhel. The PCR reaction was carried out by standard method as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with Pf uTurbo polymerase (Stratagene, La JoIIa, USA). The resulting DNA fragment, approximately 1.3 kb in size, was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The DNA fragment was cut with the restriction endonucleases XbaI and AscI (New England Biolabs, Beverly, USA) and then again with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to cleaned by the manufacturer. The vector pCLJKI was also cut with the restriction endonucleases XbaI and AscI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (about 2.1 kb) was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Rosche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on ampicillin (50 μg / ml) and kanamycin (20 μg / ml) -containing LB agar (Lennox, 1955, Virolgy, 1: 190). The plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests. The resulting plasmid is named pCLiK2.

The vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, a ca. 2.3 kb vector fragment was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture was purified by standard methods as described in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Colard Spring Harbor, supra; 989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 μg / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).

The plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests. The resulting plasmid is named pCLiK3.

Starting from the plasmid pWLQ2 (Liebl et al., 1992) as a template for a PCR reaction, the replication origin pHM1519 was amplified using the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10.

SEQ ID NO: 9: δ'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-S '

SEQ ID NO: 10: 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-S '

In addition to the sequences complementary to pWLQ2, the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10 contain cleavage sites for the restriction endonuclease NotI. The PCR reaction was carried out by standard method, such as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA). The resulting 2.7 kb DNA fragment was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The DNA fragment was cleaved with the restriction endonuclease Notl (New England Bio¬ labs, Beverly, USA) and subsequently again with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to cleaned by the manufacturer. The vector pCLiK3 was likewise cut with the restriction endonuclease NotI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (approximately 2.3 kb) was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture by standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Colard Spring Harbor, described (1989)), in competent E. coli XL-1 Blue (Stratagene, La JoIIa ₁

USA). Selection for plasmid-carrying cells was achieved by Aus¬ plating on kanamycin (20 ug / ml) containing LB agar (Lennox, 1955, Virology, 1: 190).

The plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests. The resulting plasmid is named pCLiKδ.

For the extension of pCLiKδ by a multiple cloning site (MCS), the two synthetic, largely complementary oligonucleotides SEQ ID NO: 11 and SEQ ID NO: 12, the restriction endonuclease sites Swal, Xhol, Aatl, Apal, Asp718 containing MluI, NdeI, SpeI, EcoRV, SalI, ClaI, BamHI, XbaI and SmaI, by heating together at 95 ⁰ C and cooling slowly to a double-stranded DNA fragment pooled.

SEQ ID NO: 11: 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATAT

GACTAGTTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCTGCGTTAATTAA- CAATTGGGATCCTCTAGACCCGGGATTTAAAT-3 '

SEQ ID NO: 12: 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAG

CATCGATGTCGACGATATCCCTAGGTCCGAACTAGTCATATGACGCGTGG- TACCGGGCCCGACGTCAGGCCTCTCGAGATTTAAAT-3 '

The vector pCLiKδ was cut with the restriction endonuclease Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (about 5.0 kb) was isolated with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the synthetic double-stranded DNA fragment and the ligation onsansatz according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 μg / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).

The plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests. The resulting plasmid is named pCLiK5MCS.

Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated by means of ABI Prism 377 (PE Applied Biosystems, Weiterstadt).

The resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 13.

Example 2

Preparation of the plasmid P EF-TS metA

Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primers BK 1849 SEQ ID NO 14 and BK 1862 SEQ ID NO 15 33, the chromosomal DNA as template and Pfu Turbo Polymerase (Strata genes) was using the polymerase chain reaction (PCR) by standard methods, as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Acadic Press, amplified the metA gene encoding homoserine O-acetyltransferase.

BK 1849 SEQ ID NO 14 5'- gtgtgtcgacttagatgtagaactcgatgtag -3 'and

BK 1862 SEQ ID NO 15 5'-atgcccaccctcgcgcc -3 ' The obtained DNA fragment of about 1134 bp size was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.

The oligonucleotide primers Haf 26 SEQ ID NO 16 and Haf 27 SEQ ID NO 17, the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, the expression unit of the gene (SEQ ID 2), which codes for the elongation factor TS, amplified.

Haf 26 SEQ ID NO 16 5'-gagaggatcccccccacgacaatggaac-3 'and Haf 27 SEQ ID NO 17

5'-cctgaaggcgcgagggtgggcattacggggcgatcctccttatg -3 '

The obtained DNA fragment of about 195 bp size was purified with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.

The primers Haf 27 and BK 1862 contain an overlapping sequence and are homologous to each other at their 5 'ends.

The PCR products obtained above were used as templates for a further PCR in which the primers BK 1849 (SEQ ID NO 14) and Haf 26 (SEQ ID NO 16) were used.

With this approach, a DNA fragment corresponding to the expected size of 1329 bp could be amplified. This P EF-TS / metA-fusion was then cloned via the restriction sites BamHI and Sali into the vector pClik 5a MCS (SEQ ID NO: 13).

The vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 μg / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190). The preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated by ABI Prism 377 (PE Applied Biosystems, Wei¬ terstadt).

The resulting plasmid was designated pClik 5a MCS P EF-TS metA (SEQ ID NO: 18).

Example 3 MetA activities

The strain Corynebacterium glutamicum ATCC13032 was in each case transformed with the plasmids pClikδ MCS, pClik MCS EF-TS metA according to the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303). The transformation mixture was plated on CM plates which additionally contained 20 mg / l kanamycin to achieve selection for plasmid-containing cells. Obtained Kan-resistant clones were picked and separated.

C. glutamicum strains containing one of these plasmid constructs were dissolved in MMA medium (40 g / l sucrose, 20 g / l (NH ₄ ) ₂ SO ₄ , 1 g / l KH ₂ PO ₄ , 1 g / l K ₂ HPO ₄ , 0.25 g / l MgSO ₄ x 7H ₂ O, 54 g aces, 1 ml CaCl 2 (10 g / l), 1 ml protocatechoate (300 mg / 10 ml), 1 ml of trace element solution (10 g / l FeSO 4) ₄ x / H ₂ 0, 10 g / l MnSO ₄ × H ₂ 0, 2 g / l ZnSO ₄ × 7 H ₂ O, 0.2 g / l CuSO ₄ , 0.02 g / l NiCl ₂ × 6 H ₂ O) ₁ IOO // g / l vitamin B _12, 0.3 mg / l thiamine, 1 mM leucine, 1 mg / l pyridoxal HCl, 1 ml of biotin (100 mg / l), pH 7.0) at 30 ⁰ C. The cells were removed by centrifugation at 4 ° C. and washed twice with cold Tris-HCl buffer (0.1%, pH 8.0) After renewed centrifugation, the cells were poured into cold Tris-HCl buffer (0.1%, pH 8.0) and set an OD ₆₀₀ of 160. For the cell disruption, 1 ml of this cell suspension was transferred to 2 ml Ribolyser tubes from Hybaid and incubated in a Ribolyser from Hybaid at a rotation setting of 6 , Three lysed for each 30 sec. The lysate wur¬ de by 30 min centrifugation at 15,000 rpm at 4 ⁰ C in a Eppendorfzentrif u- ge clarified and the supernatant into a new Eppendororfcup transferred. The protein content was determined by Bradford, MM (1976) Anal. Biochem. 72: 248-254.

The measurement of the enzymatic activity of MetA was carried out as follows. Reactions of 1 ml contained 100 mM potassium phosphate buffer (pH 7.5), 5 mM MgCl 2, 100 mM acetyl CoA, 5 mM L-homoserines, 500 μM DTNB (Ellman's reagent). and cell extract. The test was started by addition of the respective protein lysate and incubated at room temperature. Kinetics were then recorded at 412 nm for 10 min.

The results are shown in Table 4.

Table 4

The activity of MetA could be improved by the use of the heterologous expression unit P _EF . _{TS are} significantly increased.

Claims

claims

1. Use of a nucleic acid with promoter activity, containing

A) the nucleic acid sequence SEQ. ID. NO. 1 or

B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at nucleic acid level with the sequence SEQ. ID. NO. 1 or C) a nucleic acid sequence which coincides with the nucleic acid sequence SEQ. ID. NO.

1 hybridized under stringent conditions or

D) functionally equivalent fragments of the sequences under A), B) or C)

for the transcription of genes.

2. Use of an expression unit comprising a nucleic acid with Pro¬ motor activity according to claim 1 and additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids, for the expression of genes.

3. Use according to claim 2, characterized in that the expression unit contains:

E) the nucleic acid sequence SEQ. ID. NO. 2 or F) one of this sequence by substitution, insertion or deletion of

Nucleotide-derived sequence having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 or G) has a nucleic acid sequence which corresponds to the nucleic acid sequence SEQ. ID. NO.

2 hybridizes under stringent conditions or H) functionally equivalent fragments of the sequences under E), F) or G).

4. Use according to claim 3, characterized in that the expression unit from a nucleic acid of the sequence SEQ. ID. NO. 2 exists.

5. Nucleic acid with promoter activity containing

A) the nucleic acid sequence SEQ. ID. NO. 1 or

B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90%

Sequ. at the nucleic acid level with the sequence SEQ. ID. NO. 1 or C) a nucleic acid sequence which coincides with the nucleic acid sequence SEQ. ID. NO.

1 hybridizes under stringent conditions or D) functionally equivalent fragments of the sequences under A) ₁ B) or C),

6. Expression unit containing a nucleic acid with promoter activity according to

Claim 5 and additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids.

7. Expression unit according to claim 6, containing

E) the nucleic acid sequence SEQ. ID. NO. 2 or

F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at nucleic acid level with the sequence SEQ. ID. NO. 2 or G) has a nucleic acid sequence which corresponds to the nucleic acid sequence SEQ. ID. NO.

2 hybridized under stringent conditions or

H) functionally equivalent fragments of the sequences under E), F) or G),

8. A method for altering or causing the transcription rate of genes in microorganisms in comparison to the wild type by

a) alteration of the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity according to claim 1, which regulate the transcription of endogenous genes, compared to the wild type or

9. The method according to claim 8, characterized in that the regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with altered specific promoter activity according to embodiment a) is achieved by that he

b1) one or more nucleic acids with promoter activity according to claim 1, optionally with modified specific promoter activity, in the Ge nom of the microorganism brings, so that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity according to claim 1, optionally with altered specific promoter activity, or

b2) introducing one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes is under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with altered specific promoter activity, or

b3) one or more nucleic acid constructs containing a nucleic acid with promoter activity according to claim 1, optionally with altered specific promoter activity, and functionally linked to one or more nucleic acids to be transcribed into which microorganism introduces.

10. The method according to claim 8 or 9, characterized in that one for

Increase or cause the transcription rate of genes in microorganisms compared to the wild type

ah) the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity according to claim 1, which regulate the transcription of endogenous genes, increased as compared to the wild-type or

bh) the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or regulated by nucleic acids with increased specific promoter activity according to embodiment a), wherein the genes are heterologous with respect to the nucleic acids with promoter activity.

11. The method according to claim 10, characterized in that the regulation of the transcription of genes in the microorganism by nucleic acids with Promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with increased specific promoter activity according to embodiment a) is achieved by

bh1) one or more nucleic acids with promoter activity according to claim

1, optionally with increased specific promoter activity, introduced into the Ge nom of the microorganism, so that the transcription of one or more endogenous genes under the control of introduced nucleic acid with promoter activity according to claim 1, optionally with increased specific promoter activity occurs, or

bh2) introduces one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes is under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity, or

bh3) one or more nucleic acid constructs containing a nucleic acid with promoter activity according to claim 1, optionally with increased specific promoter activity, and functionally linking one or more nucleic acids to be transcribed into which microorganism introduces.

12. The method according to claim 8 or 9, characterized in that one for reducing the transcription rate of genes in microorganisms in comparison to the wild type

ar) reduces the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity according to claim 1, which regulate the transcription of endogenous genes, compared to the wild type or

br) Nucleic acids with reduced specific promoter activity according to

Embodiment a) introduces into the genome of the microorganism, so that the transcription endogenous genes under the control of the introduced nucleic acid with reduced promoter activity occurs.

13. A method for altering or causing the expression rate of a gene in microorganisms compared to the wild type by c) alteration of the specific expression activity in the microorganism of endogenous expression units according to claim 2 or 3, which regulate the expression of the endogenous genes, compared to the wild-type or the

d) Regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with altered specific expression activity according to embodiment c), wherein the genes are heterologous with respect to the expression units.

14. The method according to claim 13, characterized in that the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with altered specific expression activity according to Ausführungs¬ form a) is achieved by

d1) introducing one or more expression units according to claim 2 or 3, optionally with altered specific expression activity, into the genome of the microorganism so that the expression of one or more endogenous genes takes place under the control of the introduced expression units or

d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes under the control of the endogenous expression units according to claim 2 or 3, optionally with altered specific expression activity, follows or follows

d3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with modified specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.

15. The method according to claim 13 or 14, characterized in that one for

Increase or cause the expression rate of a gene in microorganisms compared to the wild type

ch) the specific expression activity in the microorganism of endogenous expression units according to claim 2 or 3, the expression of the regulate endogenous genes, compared to the wild type increased or

ie) the expression of genes in the microorganism by Expressionseinhei¬ th according to claim 2 or 3 or by expression units according to claim 2 or 3 with increased specific expression activity according to

Embodiment a) regulated, wherein the genes are heterologous with respect to the Expressi¬ onseinheiten.

16. The method according to claim 15, characterized in that the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with increased specific expression activity according to Ausführungs¬ form a) is achieved by

ie1) introduces one or more expression units according to claim 2 or 3, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the introduced expression units, optionally with increased specific expression activity or

dh2) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the introduced genes under the control of the endogenous expression units according to claim 2 or 3, optionally with increased specific expression activity occurs, or

ie3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed into which microorganism brings.

17. The method according to claim 13 or 14, characterized in that one for reducing the expression rate of genes in microorganisms in comparison to the wild type

he) the specific expression activity in the microorganism of endogenous, expression units according to claim 2 or 3, the expression of the regulate endogenous genes, reduced or compared to the wild type

dr) introduces expression units with reduced specific expression activity according to embodiment (s) into the genome of the microorganism such that the expression of endogenous genes takes place under the control of the introduced expression units with reduced expression activity.

18. The method according to any one of claims 8 to 17, characterized in that the genes are selected from the group of nucleic acids encoding a Prote¬ in from the biosynthetic pathway of proteinogenic and non-proteinogenic Ami¬ nosäuren, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthesis pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of Carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, the Ge ne may optionally contain further regulatory elements.

19. The method according to claim 18, characterized in that the proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3 Phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate Dehydrognease, transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystahionine beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase , Serine acetyltransferase, homoserine dehydrogenase, homoserin kinase, threoni n-synthase, threonine-exporter-carrier, threonine-dehydratase, pyruvate-oxidase, lysine-exporter, biotin-ligase, cysteine Synthasel, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase, sulfatronyltransferase subunits 1 and 2, phosphoadenosine phosphosulfate reductase, ferredoxin sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydroge- Nase, RXA00655 Regulator, RXN2910 Regulator, Arginyl-t-RNA synthetase,

Phosphoenolpyruvate carboxylase, threonine effiux protein, serine hydroxy methyltransferase, fructose 1, 6-bisphosphatase, sulfate reduction protein RXA077, sulfate reduction protein RXA248, sulfate reduction protein RXA247, protein OpcA, 1-phosphofructokinase and 6 -Phosphofruktokinase.

20. Expression cassette comprising

a) at least one expression unit according to claim 2 or 3 and

b) at least one further nucleic acid sequence to be expressed, and

c) where appropriate, other genetic control elements,

wherein at least one expression unit and another nucleic acid sequence to be expressed are functionally linked together and the further nucleic acid sequence to be expressed is heterologous with respect to the expression unit.

21. Expression cassette according to claim 20, characterized in that the further nucleic acid sequence to be expressed is selected from the group

Nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the Biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthesis pathway of diols, nucleic acids encoding a protein from the biosynthesis pathway of carbohydrates, nucleic acids encoding a protein from the biosynthesis pathway of aromatic compound, nucleic acids encoding a protein the biosynthetic pathway of vitamins, encoding nucleic acids

Protein from the biosynthetic pathway of cofactors and nucleic acids codie¬ rend a protein from the biosynthetic pathway of enzymes

22. Expression cassette according to claim 21, characterized in that the proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimidine dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde -3-phosphate

Dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, Transketolase, transaldolase, homoserine O

Acetyltransferase, cystahionine gamma synthase, cystahionine beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, Homoserin kinase, threonine synthase, threonine-exporter-carrier, threonine

Dehydratase, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12 independent methionine synthase activity, sulfatadyl transferase subunit 1 and 2, phosphoadenosine Phosphosulfate reductase, ferredoxin sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl t-RNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux protein, serine hydroxymethyltransferase, Fructose-1, 6-bisphosphatase, sulfate reduction protein RXA077, sulfate reduction protein RXA248, sulfate reduction protein RXA247, protein OpcA, 1-phosphofructokinase and 6-

phosphofructokinase

23. Expression vector containing an expression cassette according to one of claims 20 to 22.

24. Genetically modified microorganism, wherein the genetic modification leads to a change or causation of the transcription rate of at least one gene in comparison to the wild type and is caused by

a) alteration of the specific promoter activity in the microorganism of at least one endogenous nucleic acid with promoter activity according to claim 1, which regulates the transcription of at least one endogenous gene or b) Regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with modified specific promoter activity according to embodiment a), wherein the genes are heterologous with respect to the nucleic acids with promoter activity.

25. Genetically modified microorganism according to claim 24, characterized in that the regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with modified specific promoter activity according to embodiment a). achieved by that one

26. Genetically modified microorganism according to claim 24 or 25 with increased or caused transcription rate of at least one gene in comparison to the wild type, characterized in that

ah) the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity according to claim 1, which regulate the transcription of endogenous genes, is increased in comparison with the wild type bh) the transcription of genes in the microorganism is regulated by nucleic acids with promoter activity according to claim 1 or by nucleic acids with increased specific promoter activity according to embodiment ah), the genes being heterologous with respect to the nucleic acids having promoter activity.

27. Genetically modified microorganism according to claim 26, characterized in that the regulation of the transcription of genes in the microorganism by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with modified specific promoter activity according to embodiment a). achieved by that one

bh1) introduces one or more nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity, into the genome of the microorganism, so that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity, optionally with increased specific promoter activity, or

bh3) one or more nucleic acid constructs containing a nucleic acid with promoter activity according to claim 1, optionally with increased specific promoter activity, and functionally linked one or more nucleic acids to be transcribed into which microorganism introduces.

28. A genetically modified microorganism according to claim 24 or 25 having a reduced transcription rate of at least one gene in comparison to the wild type, characterized in that

ar) the specific promoter activity in the microorganism of at least one endogenous nucleic acid with promoter activity according to claim 1, which regulates the transcription of at least one endogenous gene, is reduced in comparison with the wild-type or br) one or more nucleic acids with reduced promoter activity according to embodiment a) have been introduced into the genome of the microorganism such that the transcription of at least one endogenous gene takes place under the control of the incorporated nucleic acid with reduced promoter activity.

29. Genetically modified microorganism, wherein the genetic modification leads to a change or causation of the expression rate of at least one gene compared to the wild type and is caused by

c) alteration of the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of at least one endogenous gene, in comparison to the wild type or

d) Regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with altered specific expression activity according to embodiment a), wherein the genes are heterologous with respect to the expression units.

30. Genetically modified microorganism according to claim 29, characterized gekenn¬ characterized in that the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression on units according to claim 2 or 3 with modified specific expression onsaktivität according to embodiment a). achieved by that one

d1) introduces one or more expression units according to claim 2 or 3, optionally with altered specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, optionally with modified speci¬ fischer expression activity takes place, or

d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes under the control of the endogenous expression units according to claim 2 or 3, optionally with altered specific expression activity, follows or follows d3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with modified specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.

31. Genetically modified microorganism according to claim 29 or 30 with increased or caused expression rate of at least one gene in comparison to the wild type, characterized in that

ch) the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of the endogenous genes, in comparison to the wild type er¬ erhht or

32. Genetically modified microorganism according to claim 31, characterized gekenn¬ characterized in that the regulation of the expression of genes in the microorganism by expression units according to claim 2 or 3 or by Expressi¬ onseinheiten according to claim 2 or 3 with increased specific expression activity according to embodiment a). achieved by that one

dh1) introduces one or more expression units according to claim 2 or 3, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes under the control of the incorporated expression units according to claim 2 or 3, optionally with increased specific expression activity, takes place or

dh2) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the introduced genes under the control of the endogenous expression units according to claim 2 or 3, optionally with increased specific expression activity, er¬ follows or ie3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.

33. Genetically modified microorganism according to claim 29 or 30 having a reduced expression rate of at least one gene in comparison to the wild type, characterized in that

he) the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of at least one edogenic gene, compared to the wild-type is reduced, or

(d) one or more expression units according to claim 2 or 3 having reduced expression activity were introduced into the genome of the microorganism such that the expression of at least one gene under the control of the introduced expression unit according to claim 2 or 3 takes place with reduced expression activity.

34. A genetically modified microorganism comprising an expression unit according to claim 2 or 3 and functionally linked to a gene to be expressed, wherein the gene is heterologous with respect to the expression unit.

35. A genetically modified microorganism according to claim 34, containing a

Expression cassette according to one of claims 20 to 22.

36. Genetically modified microorganism according to one of claims 24 to 35, characterized in that the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthesis pathway of carbohydrates, encoding nucleic acids a protein from the biosynthesis pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthesis pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, which genes may optionally contain further regulatory elements.

37. Genetically modified microorganism according to claim 36, characterized in that the proteins selected from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinates Reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional

LuxR regulator, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, transketolase, transaldolase, homoserin-O-acetyltransferase, cystahionine-gamma synthase , Cystahionin beta-lyase, serine hydroxymethyltransferase, O-acetyl homoserine sulfhydrylase,

Methylene tetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, homoserine kinase, threonine synthase, threonine-exporter-carrier, threonine dehydratase, pyruvate oxidase, lysine exporter, Biotin ligase, cysteine synthase, cysteine synthase II, coenzyme B12-dependent

Methionine Synthase, Coenzyme B12 Independent Methionine Synthase Activity, Sulfatadenyltransferase Subunits 1 and 2, Phosphoadenosine Phosphosulfate Reductase, Ferredoxin Sulfite Reductase, Ferredoxin NADP Reductase, 3-Phosphoglycerate Dehydrogenase, RXA00655 Regulator, RXN2910 Regulator, Arginyl t-RNA synthetase, phosphoenolpyruvate carboxylase,

Threonine efflux protein, serine hydroxymethyltransferase, fructose-1, 6-bisphosphatase, sulfate reduction protein RXA077, sulfate reduction protein RXA248, sulfate reduction protein RXA248, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase.

38. A process for the production of biosynthetic products by culturing genetically modified microorganisms according to any one of claims 24 to 37.

39. Process for the preparation of lysine by culturing genetically modified microorganisms according to claim 24, 25, 31 or 32, characterized in that the genes are selected from the group nucleic acids encoding an aspartate kinase, encoding nucleic acids Aspartate-semialdehyde dehydrogenase, nucleic acids encoding a diamino-imidate dehydrogenase, nucleic acids encoding a diaminopimelate Decarboxylase, nucleic acids encoding a dihydrodipicolinate synthetase, nucleic acids encoding a dihydridipicolinate reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase,

Nucleic acids encoding a transcriptional regulator LuxR, nucleic acids encoding a transcriptional regulator LysR1, nucleic acids encoding a transcriptional regulator LysR2, nucleic acids encoding a malate quinone oxodoreductase, nucleic acids encoding a glucose-6-phosphate de-dehydrogenase, nucleic acids encoding a 6-phosphogluconate

Dehydrognease, nucleic acids encoding a transketolase, nucleic acids encoding a transaldolase, nucleic acids encoding a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding an arginyl t-RNA synthetase, nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding a fructose 1, 6-bisphosphatase,

Nucleic acids encoding a protein OPCA, nucleic acids encoding a 1-phosphofructokinase and nucleic acids encoding a 6-phosphofructokinase,

40. The method according to claim 39, characterized in that the genetically modified microorganisms in comparison to the wild-type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, diaminopimelate Dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipicolinate synthetase activity, dihydridipicolinate

Reductase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, trisphosphate isomerase activity, transcriptional regulator activity LuxR, activity of transcriptional regulator LysR1, activity of transcriptional regulator LysR2, malate-quinone oxo-reductase activity,

Glucose-6-phosphate de-dehydrogenase activity, 6-phosphogluconate dehydrognease activity, transketolase activity, transaldolase activity, lysine exporter activity, arginyl-t-RNA synthetase activity, phosphoenolpyruvate carboxylase Activity, fructose-1, 6-bisphosphatase activity, protein OpcA activity, 1-phosphofructokinase activity, 6-phosphofructokinase activity and biotin ligase activity.

41. Method according to claim 39 or 40, characterized in that the genetically modified microorganisms in addition to the wild type additionally have a reduced activity, at least one of the activities selected from the Threonine dehydratase activity group, homoserine O-acetyltransferase activity, O-acetylhomoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity , Threonine efflux protein activity, asparaginase activity, aspartate

Have decarboxylase activity and threonine synthase activity.

42. A process for the preparation of methionine by culturing genetically modified microorganisms according to any one of claims 24, 25, 31 or 32, characterized in that the genes are selected from the group Nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate Semialdehyde dehydrogenase, nucleic acids encoding a Homo¬ serine dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a Ho¬ moserin O- Acetyltransferase, nucleic acids encoding a cystagionin gamma synthase, nucleic acids encoding a cystahionine beta-lyase, nucleic acids encoding a serine hydroxymethyltransferase, nucleic acids encoding an O-acetylhomoserine sulfhydrylase, nucleic acids encoding a methylene tetrahydrofolate red uktase, nucleic acids encoding a phosphoserine aminotransferase, nucleic acids encoding a phosphoserine phosphatase, nucleic acids encoding a serine acetyl transferase nucleic acids encoding a cysteine synthase I, nucleic acids encoding a cysteine synthase II, nucleic acids encoding a coenzyme

B12-dependent methionine synthase, nucleic acids encoding a coenzyme B12-independent methionine synthase, nucleic acids encoding a sulfate adenylyltransferase, nucleic acids encoding a phosphoadenosine phosphosulfate reductase, nucleic acids encoding a ferredoxin sulfite reductase, nucleic acids encoding a ferredoxin NADPH reductase .

Nucleic acids encoding a ferredoxin activity, nucleic acids encoding a protein of the sulfate reduction RXA077, nucleic acids encoding a protein of the sulfate reduction RXA248, nucleic acids encoding a protein of the sulfate reduction RXA247, nucleic acids encoding a RXA0655 regulator and nucleic acids encoding a RXN2910 regulator.

43. The method according to claim 42, characterized in that the genetically modified microorganisms in comparison to the wild type additionally increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, Ho moserin dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, homoserine O-acetyltransferase activity, cystahionine gamma synthase activity, cystahionin beta-lyase activity serine hydroxymethyltransferase activity, O-acetyl homoserine sulfhydrylase

Activity, methylene tetrahydrofolate reductase activity, phosphoserine aminotransferase activity, phosphoserine phosphatase activity, serine acetyltransferase activity, cysteine synthase activity I activity, cysteine synthase activity II, coenzyme B12-dependent methionine synthase Activity, coenzyme B12-independent methionine synthase activity, sulfate adenylyltransferase

Activity, phosphoadenosine phosphosulfate reductase activity, ferredoxin sulfite reductase activity, ferredoxin NADPH reductase activity, ferredoxin activity, sulfate reduction protein activity RXA077, sulfate reduction activity RXA248, protein activity sulfate reduction RXA247, activity of an RXA655 regulator and activity of an RXN2910

Regulators have.

44. Method according to claim 42 or 43, characterized in that the genetically modified microorganisms in addition to the wild type additionally have a reduced activity, at least one of the activities selected from the

Group homoserine kinase activity, threonine dehydratase activity, threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase Activity and diaminopicolinate decarboxylase activity.

45. A process for preparing threonine by culturing genetically modified microorganisms according to any one of claims 24, 25, 31 or 32, characterized in that the genes are selected from the group of nucleic acids encoding an aspartate kinase, encoding nucleic acids

Aspartate-semialdehyde dehydrogenase, nucleic acids encoding a glycerol aldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine kinase, encoding nucleic acids threonine

Synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, nucleic acids encoding a malate quinone oxidoreductase, nucleic acids encoding a 6-phosphogluconate dehydrogenase , Encoding nucleic acids a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding a threonine efflux protein, nucleic acids encoding a fructose 1, 6-bisphosphatase, nucleic acids encoding an OpcA protein, nucleic acid encoding a 1-phosphofructokinase, encoding nucleic acids

Phosphofructokinase, and nucleic acids encoding a homoserine dehydrogenase

46. The method according to claim 45, characterized in that the genetically modified microorganisms in comparison to the wild-type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, glycine-aldehyde 3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, threonine export carrier activity, trans-dolalse activity, transketolase activity, glucose-6 Phosphate Dehydrogenase Activity, Malate-Qinone Oxidoreductase Activity, Homoserine Kinase Activity, Biotin Ligase Activity, Phosphoenolpyruvate Carboxylase Activity, Threonine Efflux Protein Activity, Protein OpcA Activity, 1-Phosphofructokinase Activity, 6-phosphofructokinase activity, fructose 1, 6 bisphosphatase

Activity, 6-phosphogluconate dehydrogenase and homoserine dehydrogenase activity exhibit.

47. The method according to claim 45 or 46, characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, serine Hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrodipicolinate reductase activity, asparaginase activity, Aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol-Aid reductoisomerase activity, branched chain aminotransferase activity, coenzyme B12-dependent methionine synthase activity, coenzyme B12-independent methionine synthase activity

Activity, dihydroxy-acid dehydratase activity and Diaminopicolinat decarboxylate activity exhibit.

48. The method according to any one of claims 38 to 47, characterized in that the biosynthetic products after and / or during the cultivation Step from the culture medium isolated and optionally aufgerb¬ nigt.

49. Use of the nucleic acid sequence SEQ. ID. NO. 21 as ribosomal binding moieties in expression units which enable the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.

50. Use of the Nucleic Acid Sequences SEQ. ID. NOs. 19 or 20 as -10-region in expression units, which allow the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.

51. Expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, comprising the nucleic acid sequence SEQ. ID. NO. 21st

52. Expression unit according to claim 51, characterized in that the nucleic acid sequence SEQ. ID. NO. 21 is used as a ribosomal binding site ver¬.

53. Expression unit expressing the expression of genes in bacteria of the genus

Corynebacterium or Brevibacterium, containing at least one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20.

54. Expression unit according to claim 53, characterized in that one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20 is used as -10 region ver¬.