JP2001069979A - Production of l-glutamic acid by fermentation - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new bacterium (variant) which expresses the molecule chaperon derived from a thermophilic bacterium, stably produces L-glutamic acid at a temperature near the upper limit of optimal growth temperature, and can be used for producing L-glutamic acid useful as the main ingredient of a seasoning, etc. SOLUTION: This is a new bacterium [e.g. Corynebacterium glutamicum strain 22337 (pAGC31) FERM BP-6785 or a variant thereof] which expresses the molecule chaperon derived from a thermophilic bacterium, and allows stably producing L-glutamic acid at a temperature near the upper limit of optimal growth temperature or higher, and can be used for stably even at a high temperature producing L-glutamic acid utilized in a large amount as the main ingredient of sodium L-glutamate which is a seasoning, etc. This bacterium is obtained by transducing a vector plasmid containing a gene coding for the molecule chaperon derived from the hyperthermophilic archaeon Pyrococcus sp. strain KOD1 into a L-glutamic acid-producing bacterium.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel L-glutamic acid-producing bacterium and a method for producing L-glutamic acid by a fermentation method using the same.

[0002]

2. Description of the Related Art L-glutamic acid is an L-flavoring seasoning.
-It is used in large quantities as the main raw material of sodium glutamate.

[0003] The production of L-glutamic acid by fermentation is
It is performed by L-glutamic acid producing bacteria. Glutamate-producing coryneform bacteria include Corynebacterium glutamicum (Corynebacterium).
glutamicum), Brevibacterium divaritamum
Ricatum) and Microbacterium ammonia
iafilum) are known, but according to recent reports, they are all Corynebacterium glutamicum (Corynebacterium glutamicum).
um), and are classified into the genus Corynebacterium as the same species (Liebl et al., Int. J. Sys.
t. Bacteriol. , Vol. 41, 255-26
0, [1991]).

The production of L-glutamic acid by a fermentation method is as follows:
It is performed by inoculating a medium with L-glutamic acid-producing bacteria and culturing it aerobically. It is known that L-glutamic acid hardly accumulates in a culture solution when cultured in a normal culture, particularly in a medium containing a large amount of biotin necessary for growth. In order to accumulate a significant amount of glutamic acid in the culture solution, (1) a method of culturing using a medium containing biotin slightly less than the amount required by L-glutamic acid-producing bacteria, (2) L-glutamic acid production A method of inducing glutamic acid fermentation by adding penicillin to a medium after culturing the bacterium in a medium containing a sufficient amount of biotin for a certain period of time; and (3) culturing L-glutamic acid-producing bacteria in a medium containing biotin for a certain period of time. A method of inducing L-glutamic acid fermentation by adding a surfactant to a medium after culturing, and the like are known.

In conventional L-glutamic acid fermentation, the production rate of L-glutamic acid decreases as the fermentation temperature approaches the maximum growth temperature of the microorganism used, and in some cases, the production of L-glutamic acid stops rapidly with the lysis phenomenon. Therefore, it was necessary to strictly control the temperature of the fermentation.

[0006] On the other hand, a protein molecule having a function of controlling the formation and stabilization of a higher-order structure of a protein called a molecular chaperone is known. Among the molecular chaperones, a protein family called chaperonin, in particular, is specifically produced when cells are exposed to high-temperature environments or stresses caused by chemicals, etc., and has been well studied as a “heat shock protein”. I have. For example, the hyperthermophilic archaeon, Pyrococcus sp.
ccus sp. ) It has been reported that chaperonin CpkB produced by the KOD1 strain has a strong effect of increasing the thermostability of proteins and significantly suppresses the heat inactivation of alcohol dehydrogenase in yeast (Yan et al., Appl.
ied and Environmental Micr
obiology, Vol. 63, No. 2, 785-789
P., [1997]). Japanese Patent Application Laid-Open No. Hei 9-173078 discloses a method for expressing a foreign protein, which is normally expressed as an insoluble and inactive protein, without insolubilizing it by applying the above characteristics of the molecular chaperone.

However, it is not known to express a large amount of a foreign molecular chaperone to increase the resistance of host bacteria to high temperatures or to stabilize the productivity of L-amino acids originally produced by the host bacteria. .

[0008]

An object of the present invention is to provide a conventional L-glutamic acid-producing bacterium which stably produces L-glutamic acid even at a high temperature at which the production rate of L-glutamic acid decreases.
The purpose is to establish a method capable of producing glutamic acid.

[0009]

Means for Solving the Problems As a result of intensive studies, the present inventors have introduced a vector plasmid containing a gene encoding a molecular chaperone derived from a hyperthermophilic archaeon into L-glutamic acid-producing bacteria, and A novel L-glutamic acid production method capable of stably producing L-glutamic acid even at a high temperature at which L-glutamic acid-producing bacteria before the introduction become unstable by expressing the molecular chaperone The present inventors have found that sex bacteria can be constructed, and have completed the present invention. In addition, many L
-The amino acid is produced by a fermentation method using a mutant of an L-glutamic acid producing bacterium or a cell bacteriologically related to the L-glutamic acid producing bacterium. Therefore, in the present specification, the case of L-glutamic acid will be described as a representative example,
The present invention can be applied to a method for producing other amino acids such as lysine, glutamine, arginine, methionine, serine, threonine and tryptophan.

[0010] That is, the present invention is characterized by using a recombinant plasmid containing a gene encoding a molecular chaperone derived from a thermophilic bacterium and a promoter operably connected upstream thereof, using an L-glutamic acid-producing bacterium as a host. The present invention provides a novel L-glutamic acid-producing bacterium that stably produces L-glutamic acid even at a high temperature by converting and expressing a molecular chaperone derived from a thermophilic bacterium.

(1) Host Bacteria The host cell used in the present invention may be any one that can produce L-glutamic acid and can be transformed with a molecular chaperone gene. For example, a coryneform bacterium, particularly Corynebacterium glutamicum (Cory), which has been conventionally used for producing L-glutamic acid by a fermentation method.
nebacterium glutamicum, Brevibacterium divarikatam
terium diverticatum and microbacterium ammonia phyllum (Microbact)
erium amoniaphilum), as well as variants thereof. As long as the production rate of L-glutamic acid is about the same, it is preferable to be able to grow at a relatively high temperature. For example, Corynebacterium glutamicum (Corynebacterium glutamic)
um) 22337 (FERM BP-6783) strain and its mutants. This bacterium is an aerobic, gram-positive bacillus, does not form spores, is non-motile,
Dividing cells show a V-shaped morphology. It also requires biotin for growth and accumulates a significant amount of L-glutamic acid in the medium by culturing under biotin restriction or adding a surfactant or penicillin. 16S ribosomal RNA of this strain
Shows a very high homology (over 99%) with that of known Corynebacterium glutamicum (Ruimy et al., Int. J. Syst. Bac).
terol. Vol. 45, No. 4, 740-746
P., [1995]).

[0012] The host bacterium described above has a gene that expresses a molecular chaperone derived from a thermophilic bacterium at least in the step of producing L-glutamic acid, at the upper limit of the normal growth temperature or at a temperature several degrees higher (for example, 4 ° C) than that. Operated.

(2) Molecular Chaperone In the present invention, the molecular chaperone to be expressed in L-glutamic acid-producing bacteria needs to have a function of enhancing the thermal stability of the protein, and is preferably a thermophilic bacterium. Particularly preferably, it is derived from a hyperthermophilic archaeon. A thermophilic bacterium is a microorganism capable of growing at about 60 ° C. or higher, and is, for example, a Thermus thermophilus (The Thermus).
rmus thermophilus). This Thermus thermophilus is known to have molecular chaperones such as GroEL and GroES (Protein Nucleic Acid Enzyme, Vol. 41, No. 7, pages 849-859 [1996]). The hyperthermophilic archaeon is an archaeon that can grow at about 80 ° C. or higher, for example, Pyrococcus species KOD1 strain. The chaperonin CpkB from this strain is a particularly preferred molecular chaperone for the present invention. Chaperonin CpkB is a protein composed of 546 amino acids and having a molecular weight of 59,140, and has a high homology with eukaryotic TCP-1 and prokaryotic GroEL. The gene encoding this chaperonin CpkB has been cloned by Yan et al.
It is known that the DNA is a single-base pair double-stranded DNA (Y
an et al., supra).

The molecular chaperone gene to be used can be easily isolated by a method well known to those skilled in the art. Further, those skilled in the art can easily isolate the gene encoding chaperonin CpkB based on the above-mentioned literature such as Yan.

In the present invention, the gene encoding the molecular chaperone can be used as it is for transformation of host bacteria. When a rare codon in the host bacterium is included in the molecular chaperone gene, the expression efficiency of the molecular chaperone may be increased by replacing the rare amino acid with a codon encoding the same amino acid and occurring more frequently in the host bacterium. For example, genes derived from hyperthermophilic archaeon include ATA-I which is a rare codon for L-glutamic acid producing bacteria.
le, AGA-Arg, AGG-Arg, etc., but these rare codons are replaced by other codons encoding the same amino acid, such as ATC-Ile and CGC-Ar
Replace with g. When a so-called stacking region (a transcribed mRNA is likely to have a secondary structure) is present in the molecular chaperone gene to be used, one or more bases in the region are replaced to express the molecular chaperone. Efficiency may be increased. Substitutions for rare codons and stacking regions include site-directed mutations (Nucleic
Acids Res. 10,6487-6500,1
A known technique such as 982) can be used. For example, PCR is performed using, as a primer, a synthetic DNA for mutagenesis established in a host-vector system using Escherichia coli as a primer and a gene encoding a target molecular chaperone inserted into an Escherichia coli vector. Note that P
When performing site-specific mutation by CR, nonspecific base substitution may occur at a certain frequency,
It is good to confirm the nucleotide sequence of the obtained mutant gene. Even when non-specific base substitution is observed, when no amino acid substitution is involved or when a substitution with a similar amino acid is involved, it can be used as a molecular chaperone gene as it is.

One specific example of the molecular chaperone gene that can be used in the present invention is shown in Example 1 (1) below. This is an improvement obtained by substituting all of about 30 parts considered to be particularly preferable to be substituted in a site related to a rare codon or a stacking region in an L-glutamic acid producing bacterium in a gene encoding a chaperonin CpkB. . Its base sequence is shown in SEQ ID NO: 30. This improved gene is novel and is particularly useful for expressing chaperonin CpkB in L-glutamic acid producing bacteria.

In the nucleotide sequence of SEQ ID NO: 30, one or more (preferably about 20 or less, more preferably 15
Or less), a gene consisting of a DNA having a base sequence in which bases are deleted, substituted or added, or a DNA consisting of a DNA which hybridizes with a DNA having the base sequence of SEQ ID NO: 30 under stringent conditions, is also a host bacterium. Any of those having a molecular chaperone activity can be used as a molecular chaperone gene in the present invention.
Here, the stringent conditions are a temperature of about 40 ° C. or more and a salt concentration of about 5 × SSC (1 × SSC = 15 mM sodium citrate buffer; pH 7.0; 0.15 M sodium chloride), preferably about 50 ° C. As mentioned above, the hybridization conditions are about 2 × SSC, more preferably about 65 ° C. or more and about 0.1 × SSC. However, the gene encoding the chaperonin CpkB and other known genes themselves are excluded from the scope of the present invention. The molecular chaperone activity refers to a property that enhances the thermal stability of a cell or a protein, and in the present invention, includes a property that enhances the thermal stability of L-glutamic acid production.

(3) Promoter The promoter used in the present invention may be any promoter that can function as a promoter of a molecular chaperone gene derived from a thermophilic bacterium in L-glutamic acid producing bacteria. Any of the promoters already reported as expression systems for L-glutamic acid-producing bacteria can be used. Preferably, the transfer efficiency is high, and
Those containing an SD sequence with high translation efficiency are preferred. Some promoters show high transcription efficiency during shaking culture, but in deep culture such as tank culture or jar fermenter, the transcription efficiency is extremely low.Therefore, some exhibit strong transcription efficiency even in deep culture. Good.

The promoter used in the present invention is particularly preferably one which has low transcriptional activity at the optimum growth temperature and is induced when cultured at a temperature higher than the optimum growth temperature. Generally, it is known that when a foreign protein is expressed in a large amount in a transformant, the transformant is subjected to a large amount of stress, and as a result, the introduced trait tends to be unstable. However, when a promoter induced at such a high temperature is used, the molecular chaperone derived from a thermophilic bacterium is not expressed in a large amount in a culture near the optimum growth temperature, so that stress applied to the property-transformant can be avoided.
The present inventors have determined that Corynebacterium.
It was found that the promoter of the gene encoding GroEL derived from Glutamicum 22337 was particularly effective. According to the study of the present inventors, when the Corynebacterium glutamicum 22337 strain was cultured at 30 ° C. to 35 ° C., the expression level of GroEL was low, but when the culture temperature was increased to 39 ° C. or higher, GroEL became ,
SDS-polyacrylamide gel electrophoresis gave the highest concentration band among all intracellular proteins.

The gene encoding GroEL (groE
The method of isolating the promoter of L) can also be performed by a method well known to those skilled in the art. That is, Corynebacterium glutamicum is cultured at a temperature near the optimal growth temperature and at a temperature higher than the optimal growth temperature to collect cells, and each cell is subjected to ultrasonic treatment or the like to extract cells. A liquid is prepared, and both bands are compared using SDS-polyacrylamide gel electrophoresis. A molecular weight of about 60 that appears specifically in cell extracts of bacterial cells cultured at high temperatures
Since the band of kDa is considered to be the band of the target GroEL protein, it can be confirmed by cutting out the gel and decoding the N-terminal amino acid sequence using an amino acid sequencer. Synthesizing a DNA having a base sequence encoding the N-terminal amino acid sequence,
Using this as a probe, DNA containing groEL can be isolated using a colony hybridization technique. In addition, Gro, which has been isolated from many bacteria,
The amino acid sequence of EL has a very high homology part (consensus sequence). A plurality of DNAs encoding these amino acid sequences are synthesized, and PCR is performed using these as primers to obtain a target DNA. It can also be isolated. Since the promoter of groEL is located upstream of the coding region, the isolated DNA is used as a probe to isolate DNA covering a wider range using colony hybridization, or the nucleotide sequence of the isolated DNA is determined. By carrying out inverse PCR using the primers originally designed, DNA containing the promoter can be isolated.

As the promoter to be induced at a high temperature, the DNA obtained by the above method may be used as it is, but if desired, as described in Example 1 (3) below,
By improving the sequence of the 35 region and / or the -10 region, the expression level during high-temperature culture can be further increased while maintaining the property of being high-temperature-inducible. Where gr
It is desirable to use the oEL promoter directly from the downstream of the promoter to the translation start point. The groEL gene has a sequence of AGGAG complementary to the 3 'end of 16S ribosomal RNA 10 to 14 bases upstream from the translation initiation site, and this is considered to be the SD sequence. This SD
Although the expression level is not affected even if the distance from the sequence to the translation start point is reduced by one base, the expression level is greatly reduced when this portion is replaced with a completely different sequence having the same number of bases. It has been found by the inventors.

SEQ ID NO: 42 shows an example of an improved promoter obtained by improving the sequence of the -35 region and -10 region of the groEL gene and reducing the distance from the SD sequence to the translation initiation site by one base. This promoter is novel and is particularly useful for expressing a gene encoding a molecular chaperone from a thermophilic bacterium in L-glutamic acid producing bacteria.

A gene consisting of a DNA having a base sequence in which one or more bases have been deleted, substituted or added in the base sequence of SEQ ID NO: 42, or a DNA having the base sequence of SEQ ID NO: 42, hybridized under stringent conditions. A gene consisting of soybean DNA can be used as a promoter in the present invention as long as it functions as a temperature-inducible promoter in L-glutamic acid-producing bacteria. Here, the stringent conditions are about 40 ° C. or more, about 5 × SSC, preferably about 50 ° C. or more,
About 2 × SSC, more preferably about 65 ° C. or higher, about 0.1
× Refers to hybridization conditions in SSC.

(4) Vector A vector for transformation generally has a selectable phenotypic marker such as auxotrophy, antibiotic resistance, chromogenicity and the like, and an appropriate restriction enzyme cleavage point. In addition, even if it cannot replicate in host bacteria or cannot replicate in host cells, it has a function of stably retaining foreign DNA by being integrated into host chromosomal DNA. Such vectors can be used in the present invention. For example, p
BR322, pUC18, and pUC119.
Preferably, a high copy type that can stably and independently replicate in L-glutamic acid-producing bacteria is preferable. An example is pAG50. This pAG50 has a tetracycline resistance marker and has BamHI,
EcoRI, HindIII, MluI, SalI, X
It has one cut point by baI. In addition, this plasmid was Corynebacterium glutamicum 2233.
7 can be independently replicated stably in many L-glutamic acid-producing bacteria, and can express tetracycline resistance. The origin of pAG50 and the like are described in detail in Japanese Patent Publication No. 24518/1990. pAG
Corynebacterium glutamicum 22337 (pAG50) (FERM BP-
6784) strains.

Further, pAGC31 is an example of a recombinant plasmid in which a high temperature-inducible promoter and a molecular chaperone gene derived from a thermophilic bacterium are incorporated into pAG50. This recombinant plasmid has a higher expression level of gr.
A gene encoding a chaperonin CpkB in which a rare codon and a stacking region have been substituted is connected downstream of a fragment containing the promoter and SD sequence of the oEL gene. The recombinant plasmid introduced into the host bacterium, even if it is of high copy type, may be dropped off during subculture or mass culture. Therefore, it is also desirable to consider stabilizing the introduced gene, for example, by inserting a sequence involved in distribution to daughter cells into the recombinant plasmid.

(5) Transformation Transformation of a host bacterium with the recombinant plasmid in the present invention can use techniques well known to those skilled in the art. Obtaining the transformed L-glutamic acid-producing bacterium of the present invention by preparing a recombinant plasmid containing a molecular chaperone gene derived from a thermophilic bacterium and introducing it into a host bacterium using a known technique. Can be. As an example, there is Corynebacterium glutamicum 22337 (pAGC31) into which pAGC31 has been introduced. This Corynebacterium glutamicum 22337
The (pAGC31) strain was deposited on July 21, 1999 with the Biotechnology Research Institute, and its accession number was FER.
No. MBP-6785.

The transformed L-glutamic acid producing bacterium of the present invention expresses a molecular chaperone derived from a thermophilic bacterium. It is thought that the expressed molecular chaperone derived from a thermophilic bacterium stabilizes the host bacterial protein even at a temperature higher than the normal growth temperature, and alleviates the influence of the temperature on the production of L-glutamic acid. The expression amount of the molecular chaperone may be an amount that can enhance the thermal stability of L-glutamic acid production. Specifically, when cultured at the upper limit of the growth temperature of the host bacterium or at a temperature several degrees higher (for example, 4 ° C.) than the upper limit, a certain amount or more of the total protein in the cell (preferably about 10% of the total protein in the cell) is obtained. And more preferably about 30% or more). For measurement of the total amount of protein and the expression of chaperonin in the cell, any protein measurement method known to those skilled in the art can be used.

(6) Production of L-glutamic acid L transformed by a molecular chaperone derived from a thermophilic bacterium
As a method for producing L-glutamic acid using a glutamic acid-producing bacterium, a conventional fermentation method using an L-glutamic acid-producing bacterium can be diverted. The transformed L-glutamic acid producing bacterium produces L-glutamic acid at a high temperature by the action of a molecular chaperone, that is, at a high temperature at which the production of L-glutamic acid is suppressed in the conventional L-glutamic acid producing bacterium. Can be. In particular, when using an L-glutamic acid-producing bacterium transformed by connecting a molecular chaperone gene downstream of a temperature-inducible promoter, the transformant to be used can grow well, and the expression of the molecular chaperone is so induced. After culturing for a certain period of time at a temperature that is not controlled, the culturing is preferably performed by shifting the culturing temperature to the upper growth limit temperature or a slightly higher temperature. Corynebacterium glutamicum 2
When the 2337 (pAGC31) strain is used, a significant amount of L-glutamic acid is accumulated by such a culture method without adding a surfactant or penicillin to the culture solution. This result is also seen when the cells are cultured in a medium using cane molasses containing excess biotin.

As a medium for the transformed L-glutamic acid-producing bacteria, a medium used for L-glutamic acid production by a conventional fermentation method can be used. A cane molasses medium having a high biotin content or a glucose-yeast extract medium having a low biotin content may be used. L due to temperature shift
-In the case of producing glutamic acid, culturing in a medium with a low biotin content tends to cause lysis after a high temperature shift, and in some cases, the effect of the molecular chaperone does not appear remarkably. Preferably, a medium containing a large amount of biotin and / or unsaturated fatty acids is used. For example, a cane molasses medium is mentioned.

[0030] Corynebacterium glutamicum 22337 (pAG50) and a transformant Corynebacterium glutamicum 22337 (pAGC31) are described below.
Examples will be described focusing on comparison of L-glutamic acid fermentation at a high temperature according to the present invention, but the present invention is not limited thereto.

[0031]

EXAMPLES Example 1 Corynebacterium glutamicum 22337 (pAG
C31) was produced in the following procedure.

(1) Preparation of molecular chaperone gene A recombinant plasmid containing a gene encoding the chaperonin CpkB derived from KOD1, ie, the cpkB gene (Applied and Envirom, Yan et al.)
entral Microbiology, Vol. 63,
No. 2, pages 785 to 789, [1997]) as template D
NA, and N-terminal translation initiation portion of the cpkB gene
Two types of primers (SEQ ID NO: 1 and SEQ ID NO: 2) were designed to add a coI site and an EcoRI site downstream of the C-terminus, and PCR was performed using these primers. The obtained DNA fragment was ligated with Nc of pUC19 in which an NcoI linker (pGCCATGGC) was incorporated at the SmaI cleavage point.
oI site, Escherichia coli XL1-Bl
ue strain was introduced by transformation. The nucleotide sequence of the inserted fragment in the plasmid prepared from this transformant was confirmed by sequence analysis by the dideoxy method using a fluorescently labeled M13 universal primer according to the conventional method.

Cpk integrated into plasmid pUC19
The site-directed mutagenesis operation was repeated for the B gene, and the rare codon and the base stacking region were replaced. That is, pUC1 into which the cpkB gene was inserted.
PCR was performed using 9 as a template and appropriately combining 25 rare codon replacement primers (SEQ ID NOS: 3 to 27) and 3 stacking region releasing primers (SEQ ID NOs: 28 to 29). After completion of the PCR reaction, the reaction solution was digested with a restriction enzyme DpnI to specifically digest the template DNA,
Using this DNA, Escherichia coli XL1-Blu
e strain was transformed. The nucleotide sequence of the plasmid prepared from this transformant was determined, and the above procedure was further repeated for those whose substitution of the desired base was confirmed. Finally, a recombinant plasmid containing the improved cpkB gene from which all rare codons and stacking regions were removed was obtained. SEQ ID NO: 30 shows the nucleotide sequence of the cpkB gene fragment inserted into this plasmid.

(2) Preparation of promoter Corynebacterium glutamicum 22337 was prepared by adding 5 g / l of polypeptone, 5 g / l of yeast extract, and 2 g of glucose.
The cells were cultured at 35 ° C. using a mini jar fermenter containing a medium containing 0 g / l, dipotassium hydrogen phosphate 2 g / l, and magnesium sulfate heptahydrate 0.5 g / l. The pH of the culture was constantly maintained at 7.4 by successively adding ammonia using a pH controller. After culturing for a certain period of time, a part of the culture solution was sampled, and then the culturing temperature was shifted to 40 ° C., and culturing was continued for 2 hours. The above-mentioned culture solution and the cells were collected from the culture solution and subjected to ultrasonic treatment in the presence of glass beads. The obtained cell-free extract was analyzed by SDS-polyacrylamide gel electrophoresis. As a result, the extract obtained by culturing at 40 ° C. showed the strongest protein band at about 60 kDa, but this band was very faint in the extract obtained by culturing at 35 ° C. It was not too much. Therefore,
Western blotting of the extract at 40 ° C. was performed. That is, SDS-polyacrylamide gel electrophoresis using a slightly larger gel was carried out on the extract at 40 ° C., and all protein bands were immobilized on the PVDF membrane. The position of the band was confirmed by staining with PonceauS, the band existing at the position of 60 kDa was cut out, and the N-terminal amino acid sequence was examined using an amino acid sequencer by an automatic Edman degradation method. The N-terminal sequence of this 60 kDa protein determined by the amino acid sequencer is shown in SEQ ID NO: 31 in the sequence listing. Since this sequence showed high homology with the N-terminus of known GroEL, this 60 kDa protein derived from Corynebacterium glutamicum 22337 was considered to be chaperonin GroEL.

A primer designed based on the N-terminal amino acid sequence of the obtained 60 kDa protein (SEQ ID NO: 3)
2) and a gene encoding a known GroEL (gr
oEL gene) using a primer (SEQ ID NO: 33) designed based on the amino acid sequence of the consensus portion of the chromosomal DNA of Corynebacterium glutamicum 22337.
Was used as a template for PCR. About 850 base pairs of DNA
Amplification was confirmed. The base sequence (SEQ ID NO: 34) of this DNA fragment showed 76% homology with the known groEL gene on a DNA basis and 83% on an amino acid basis. Two types of primers for inverse PCR (SEQ ID NOs: 35 and 36) were prepared based on the sequence near the BamHI cleavage point that was present at one place in this DNA fragment. Next, the chromosome D of Corynebacterium glutamicum 22337
NA was digested with PstI and self-ligated. Using this as a template and the above primers, PCR
Was performed to obtain a DNA fragment of about 1.6 kb. This fragment was inserted into the PstI site of pUC19 to prepare a recombinant plasmid, and its nucleotide sequence was examined. As a result, it was found that this fragment contained a portion consisting of about 710 base pairs upstream of the groEL translation initiation site. The obtained nucleotide sequence is shown in SEQ ID NO: 37.

PCR was carried out using the above-mentioned recombinant plasmid as a template and two kinds of synthetic DNAs (SEQ ID NOs: 38 and 39) as primers. The amplified fragment was replaced with XbaI
And NcoI, and place this at the SmaI site with Nc
Xba of pUC19 plasmid with oI linker inserted
Incorporated between I-NcoI. Introduction of NcoI site at translation start point, ie, from CACATGG to CCATGG
With the change to, the distance from the SD sequence to the translation start point was reduced by one base.

In the promoter of the groEL gene, there is a sequence of TTGCAC as a −35 region and a sequence of TAGAAA as a −10 region. These sequences were mutated by site-directed mutagenesis to TTGCCA,
Changed to AGAAT. Specifically, SEQ ID NOs: 40 and 4,
PCR was carried out using the mutation-introducing primer shown in Example 1, and the recombinant plasmid containing the improved promoter fragment into which the desired mutation was introduced was obtained by the same method as described in Example 1 (1). Obtained. The sequence of the promoter fragment contained in this plasmid is shown in SEQ ID NO: 42.

(3) Construction of Recombinant Plasmid An operation for removing unnecessary restriction enzyme cleavage points present in the vector plasmid pAG50 was performed. pAG50 to Bam
After digestion with HI and SalI, the ends were blunted using T4 DNA polymerase. Ligation this, B
A plasmid from which the amHI and SalI breakpoints had been removed was prepared. Further, after digesting this plasmid with HindIII, the plasmid was treated with T4 DNA polymerase and ligated to prepare a target plasmid in which the HindIII cleavage point was removed in the same manner.

XbaI of this plasmid pAG @ BSH
An XbaI-EcoRI fragment containing the improved promoter obtained in the above (2) is inserted between the -EcoRI and NcoI-EcoRI containing the improved cpkB gene obtained in the above (1) between NcoI and EcoRI downstream thereof.
The fragment pAG was introduced into the plasmid pAG for expressing the improved CpkB.
C31 was obtained (see FIG. 1).

Example 2 Corynebacterium glutamicum 22337 (pAG50) (control strain) and Corynebacterium glutamicum 22337 (pAGC31) were used using a mini-jar fermenter containing the medium described in Example 1 (2). Chaperonin-expressing strains) were each cultured at 35 ° C. After sampling a part of the culture solution, the culture temperature was shifted to 42 ° C., and the culture was further performed for 2 hours.

Cell-free extracts were prepared from the samples before and after the temperature shift, and analyzed by SDS-polyacrylamide gel electrophoresis. In the extracts from the 35 ° C. culture, no clear band was observed at around 60 kDa in both strains.
A band considered to be GroEL was observed near a, and a clearer band was observed in the chaperonin-expressing strain in addition to GroEL, which was slightly lower in molecular weight (FIG. 2).

Using the extracts of both strains at 42 ° C., a heat inactivation experiment of the protein was carried out. Dispense a small amount into each microcentrifuge tube and place on a heat block at 90 ° C for 0 min.
Heated for 0 and 60 minutes. Then, the mixture was quenched in ice water and the precipitate was removed by centrifugation. Each of the obtained solutions was analyzed by SDS-polyacrylamide gel electrophoresis.
In the solution derived from the control strain, most of the protein disappeared by heating for 30 minutes, whereas in the solution derived from the chaperonin-expressing strain, the soluble protein remained even after heating for 60 minutes (FIG. 3). This means that the CpkB protein was expressed in Corynebacterium glutamicum 22337 while maintaining its activity.

Corynebacterium glutamicum 223
37 (pAGC31) was cultured at 35 ° C. for a certain period of time in the same manner as described above, and then cultured at 42 ° C. A part of the culture solution was sampled at regular time intervals immediately after the temperature shift, and cell-free extracts were prepared from these samples. These extracts were subjected to heat treatment and centrifugation at 90 ° C. for 60 minutes and centrifuged, and subjected to SDS-polyacrylamide gel electrophoresis to examine changes in the amount of accumulated chaperonin and the thermal stability of proteins. As a result, when the accumulated amount of chaperonin was about 10% or more of the total protein (analyzed by the results of electrophoresis), a thermal stabilizing effect of the protein was observed. When the amount of chaperonin was about 30% or more of the total protein, It was confirmed that this effect was further enhanced.

Example 3 The effect of chaperonin when L-glutamic acid-producing bacteria were cultured at high temperature was examined.

Corynebacterium glutamicum 223
37 (pAG50) and Corynebacterium glutamicum 22337 (pAGC31) were obtained from cane molasses from Thailand (50% total sugar content) 160 g / l, phosphoric acid 2 g / l,
0.5 g / l of magnesium sulfate heptahydrate (pH 7.
4) Using a 1-liter jar fermenter containing 400 ml, the cells were cultured at 37 ° C. under the conditions of an aeration rate of 1 vvm and a stirring speed of 1200 rpm. Aqueous ammonia was successively added by the controller, and the pH of the culture solution was constantly kept at 7.4. When the turbidity of the culture at 660 nm reached 30, the culture temperature was shifted to 42 ° C. and 44 ° C., and the growth of each strain and the amount of L-glutamic acid accumulated at these temperatures were compared. The residual sugar concentration of the culture solution was about 50 g / total sugar concentration.
dl of molasses was added as appropriate to keep it at 1-2 g / dl.
FIG. 4 shows the results.

As shown in FIG. 4, after the culture temperature was shifted to 42 ° C., the growth of the control strain was almost completely stopped, and the turbidity was reduced by lysis. Continued to grow, and almost no lysis was observed. In both strains, accumulation of L-glutamic acid in the medium was observed after the shift. The production rates of L-glutamic acid were almost the same for both bacteria.

When the culture temperature was shifted to 44 ° C., remarkable lysis was observed in both strains. At this temperature pAG
Since the chaperonin was hardly accumulated in the cells even in the C31 strain, it was considered that when the temperature rapidly shifted to a temperature exceeding the upper limit of growth temperature, the cells were killed by heat prior to the induction of the expression of chaperonin. In both strains, L-glutamic acid was relatively rapidly accumulated in the culture solution immediately after the 44 ° C. temperature shift.
After time, L-glutamic acid production was completely stopped.

Example 4 Corynebacterium glutamicum (Melacecora) 801 (FERM BP-558), an L-glutamic acid-producing bacterium having a relatively low maximum growth temperature, was purified by pAGC.
31 and pAG50 were used to obtain Corynebacterium glutamicum 801 (pAGC31) and Corynebacterium glutamicum 801 (pAG50). These were cultured at 35 ° C. under the same conditions as in Example 3. When the turbidity of the culture at 660 nm became 20, the culture temperature was shifted to 40 ° C, 41 ° C and 42 ° C, respectively, and the culture was continued. The progress of the culture is shown in FIG.

As shown in FIG. 5, when the culture temperature was shifted to 40 ° C., the pAGC31 strain accumulated a large amount of chaperonin protein in the cells, and showed good growth even after the shift. Was slower than this.

When the temperature was shifted up to 41 ° C. and 42 ° C., growth stoppage and / or lysis of both bacteria were observed. There was almost no difference in growth between the two bacteria. pAG
The intracellular accumulation of chaperonin in the C31 strain was low.
It was thought that the cells died before the chaperonin was induced.

Example 5 Corynebacterium glutamicum 22337 (pAG
50) and Corynebacterium glutamicum 223
37 (pAGC31) was obtained under the same conditions as in Example 3.
Incubated at ℃. When the turbidity of the culture at 660 nm became 5, the culture temperature was shifted to 40 ° C. for 3 hours for the purpose of expressing a large amount of chaperonin. Thereafter, the culture temperature was further shifted to 42 ° C.
The growth of the bacteria and the accumulated amount of L-glutamic acid were compared. FIG. 6 shows the results.

As shown in FIG. 6, after shifting to 40 ° C., the chaperonin-expressing strain grew slightly faster than the control strain. After the shift to 42 ° C., the growth of the control strain almost stopped, and then turbidity was reduced by lysis.However, the chaperonin-expressing strain continued to grow little by little, and then stopped growing, but lysis was observed. Did not.

The control strain produced L-glutamic acid for a while after the temperature shift, but the production of L-glutamic acid gradually decreased from the time when the turbidity began to decrease. However, no lysis was observed in the chaperonin-expressing strain until the end of the culture, and L-glutamic acid production was maintained stably.

[0054]

The use of L-glutamic acid-producing bacteria transformed with a gene encoding a molecular chaperone reduces the production rate of L-glutamic acid when conventional L-glutamic acid-producing bacteria are used. Even at temperatures near or above the upper growth limit,
L-glutamic acid could be produced stably.

[Sequence List] SEQUENCE LISTING <110> Japan Tabacco Inc. <110> Imanaka, Tadayuki <120> Production method of L-glutamic acid by fermentation <130> 991409 <160> 41 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <400> 1 accatggccc agctcgcagg c 21 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <400> 2 cccatggcgg accctgaatt cagtcaaggt cgc 33 <210> 3 <211> 25 <212 > DNA <213> Artificial Sequence <400> 3 ttgctgcccg gattatcgcc gagac 25 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cccgagcatc atcatcaagg 20 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <400> 5 ccaggaaatc ctcgacgaga tcgccaagga c 31 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 cgctgagatc gcagttgag 19 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 cagctcatca agggtgtc 18 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <400> 8 gtacggcatc atggccgttc gacgggtcaa g 31 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <400> 9 gtcacaatcc tcatccgggg cggc 24 <210> 1 0 <211> 28 <212> DNA <213> Artificial Sequence <400> 10 gctgccatca tgatcctccg gatcgacg 28 <210> 11 <211> 52 <212> DNA <213> Artificial Sequence <400> 11 gagggaaccc agcgctatgt tggacgcgac gcccagcg tcaactct <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 ccgagacggt tcgcaccacc ctcgg 25 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <400> 13 ctcttcttga cgcggcgaac ggccatg 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <400> 14 gccggcgacc ttgcgctgct cgacgag 27 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <400> 15 attcttgctg cccgcattat cgccgag 27 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <400> 16 ggtgagcttc tgcgcaaggc tgaggag 27 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <400> 17 gacgtcgagg accgcgagat tctcaag 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <400> 18 gccgaggagg agcgcgagta cctcgct 27 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <400> 19 ggcatgccga agcgcgtcga gggtgct 27 <210> 20 <211> 27 <2 12> DNA <213> Artificial Sequence <400> 20 gacgccgaga tccgcatcac cagcccg 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <400> 21 gagaagatgc tccgcgagat ggtcgac 27 <210> 22 <211> 27 < 212> DNA <213> Artificial Sequence <400> 22 ctcggtgccg ccgcggatga ggattgt 27 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <400> 23 gtcctcaagg gcgcgctcga cctcatc 27 <210> 24 <211> 27 < 212> DNA <213> Artificial Sequence <400> 24 gtactcgtcg aggcggatgg cgagctc 27 <210> 25 <211> 27 <212> DNA <213> Artificial Sequence <400> 25 ctcggcgagg gtgcgcggga tgacctt 27 <210> 26 <211> 27 < 212> DNA <213> Artificial Sequence <400> 26 ctgcttcgga acgcggaccg gggcgat 27 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <400> 27 gacgtcgtcg atgcggagga tcatgat 27 <210> 28 <211> 27 < 212> DNA <213> Artificial Sequence <400> 28 gacgttgacg tggaagaccg cgagatt 27 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <400> 29 ggtctcgatc gggtccagac cggcgtt 27 <210> 30 <211> 1661 < 212> DNA <400> 30 ccatggccca gctcgcaggc cagccagttg ttattctgcc cgagggaacc cagcgctatg 60 ttggacgcga cgcccagcgc ctcaacattc ttgctgcccg cattatcgcc gagacggttc 120 gcaccaccct cggtccaaag ggaatggaca agatgctcgt tgacagcctc ggcgacatcg 180 tcatcaccaa cgacggtgca accattctcg acgagatgga catccagcac cctgctgcta 240 agatgatggt tgaggttgct aagactcagg acaaggaggc cggtgacgga accaccactg 300 ccgttgtcat cgccggtgag cttctgcgca aggctgagga gcttctcgac cagaacattc 360 acccgagcat catcatcaag ggttacgccc tcgcggcaga gaaagcccag gaaatcctcg 420 acgagatcgc caaggacgtt gacgtagaag accgcgagat tctcaagaag gccgcggtca 480 cctccatcac cggaaaggct gccgaggagg agcgcgagta cctcgctgag atcgcagttg 540 aggccgtcaa gcaggttgcc gagaaggttg gcgagaccta caaggtcgac ctcgacaaca 600 tcaagttcga gaagaaggaa ggtggaagcg tcaaggacac ccagctcatc aagggtgtcg 660 tcatcgacaa ggaggtcgtc cacccaggca tgccgaagcg cgtcgagggt gctaagatcg 720 ccctcatcaa tgaggccctc gaggtcaagg agaccgagac tgacgccgag atccgcatca 780 ccagcccgga gcagctccag gccttccttg agcaggagga gaagatgctc cgcgagatgg 840 tcgacaagat caaggaggtc ggcgcgaatg tcgtcttcg t ccagaagggc attgacgacc 900 tcgcccagca ctaccttgcc aagtacggca tcatggccgt tcgccgcgtc aagaagagcg 960 acatggagaa gctcgccaag gccaccggcg ccaagatcgt caccaacgtc cgcgacctca 1020 ctccggagga cctcggtgag gccgagctcg tcgagcagcg caaggtcgcc ggcgagaaca 1080 tgatcttcgt cgagggctgc aagaacccga aggccgtcac aatcctcatc cgcggcggca 1140 ccgagcacgt cgttgatgag gtcgagcgcg cccttgagga cgccgtcaag gtcgtcaagg 1200 acatcgtcga ggacggcaag atcgtcgccg ccggtggtgc tccggagatc gagctcgcca 1260 tccgcctcga cgagtacgcg aaggaggtcg gcggcaagga gcagctcgcc atcgaggcct 1320 ttgccgaggc cctcaaggtc atcccgcgca ccctcgccga gaacgccggt ctggacccga 1380 tcgagaccct cgttaaggtc atcgccgccc acaaggagaa gggaccgacc atcggtgttg 1440 acgtcttcga gggcgagccg gccgacatgc tcgagcgcgg cgttatcgcc ccggtccgcg 1500 ttccgaagca ggccatcaag agcgccagcg aggctgccat catgatcctc cgcatcgacg 1560 acgtcatcgc cgccagcaag ctcgagaagg acaaggaggg cggcaagggc ggtagcgagg 1620 atttcggaag cgaccttgac tgaattcagg gtccgccatg g 1661 <210> 31 <211 > 39 <212> prt <213> Corynebacterium glutamicum <400> 31 Met Ala Lys Ile Ile Ala Phe Asp Glu Glu Ala Arg Arg Gly Leu Glu 1 5 10 15 Lys Gly Leu Asn Thr Leu Ala Asp Ala Val Lys Val Thr Leu Gly Pro 20 25 30 Lys Gly Arg Asn Val Val Leu 35 <210> 32 <211> 29 <212> DNA <213> Artificial Sequence <400> 32 gaygargayg cncgngargg nytngaraa 29 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <400> 33 catngcyttn cgncgrtcnc craanccng 29 <210> 34 <211> 852 <212> DNA <213> Corynebacterium glutamicum <400> 34 gatgaagatg cgcgagaagg cctcgaaaag ggactgaaca ccctggctga cgctgttaag 60 gttactttgg gaccaaaggg ccgtaacgtc gttttggaaa aggcttgggg cgccccaacc 120 attaccaacg atggtgtcac catcgcacgt gagatcgagc ttgaggatcc ttacgagaag 180 atcggcgcag agctggtcaa ggaagtcgct aagaagactg atgacgtcgc gggcgatggc 240 accaccaccg ctaccgtatt ggcacaggct ctggttcggg aaggcctgcg caacgttgct 300 gctggctcta acccaatggg catcaagcgt ggcatcgaga aggctgttgc tcaggtaact 360 gagaagctgc tcgaggctgc gaaggaagtt gagaccgagg agcagatcgc tgctaccgc tgctacccgcag ggtatctcccgcag ggtatctccgcag ggcatccccagcagcagcagcag 480 ggcggtggca agctgaacaa ggattccgtc atcactgttg aagagtcgaa cactttcggt 540 gttgagctcg aggttactga gggtatgcgc tttgataagg gctacatctc cggttacttc 600 gcaaccgaca tggagcgcct cgaggctgtc ctggaagatc cttacatcct gctggtttcc 660 ggcaagatct ccaacatcaa ggacctgctc ccactgctgg agaaggtcat gcagtccggc 720 aagcctttgc tgatcatctc tgaggacgtc gagggcgagg ctctgtccac cctggttgtc 780 aacaagatcc gtggcacctt caagtctgtt gctgttaagg ctccggggtt tggagatcgc 840 cgaaaagcaa tg 852 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <400> 35 aggatcctta cgagaagatc ggcgcagag 29 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <400> 36 aggatcctca agctcgatct cacgtgcga 29 <210> 37 <211> 1589 <212> DNA <213> Corynebacterium glutamicum <400> 37 ctgcagtgct tggatgcgac gcatttgctg aaccagttca atcagcccct agctggtgaa 60 gaggcttatc cgttccagtg cttcgcggtg tctcctctgg gtgcaagtcc tgaaggtgat 120 cggattaatc gaagcggtat cgcaccgttt cgttgcctgg atccgttgag agagttgttc 180 tcggaaattg ggattctaga ggggctggag acgtcgaaaa gcaatatccc gcctgcccaa 240 cctgccccga ccagccagcc ggtagccgag gaggccccgg ttgaagaacc taaaaaacgt 300 ggattcctga ggtggtttaa atgagttttc agcatgccga aggcgtgagg cttgatgcgg 360 ttcgcgctga ggaagagttt gaggcgcagc gacaagccag gcgaaaggca cggaatcgtt 420 ctgcgatgtt gtggatcggc actggcattg cggcagccgt aattattgtg ctcgtgatgg 480 tttttatctg gtcacgtatc tgattagggc atttgaagct ataaaatctt gcactcacac 540 cccttgagtg ctagaaaagt agttagcact caactaatca gagtgccaat attgatcatc 600 aactgcttgg tgggtgaggt tggtccacac tcactaaccg tgccgtcgcg ggcgcctacc 660 gggcagaaga cgtgagtgtc gtcctacaaa tatttcagga gcacaaacac atggcaaaga 720 tcatcgcctt tgatgaggaa gcacgtcgtg gcctagaaaa gggactgaac accctggctg 780 acgctgttaa ggttactttg ggaccaaagg gccgtaacgt cgttttggaa aaggcttggg 840 gcgccccaac cattaccaac gatggtgtca ccatcgcacg tgagatcgag cttgaggatc 900 cttacgagaa gatcggcgca gagctggtca aggaagtcgc taagaagact gatgacgtcg 960 cgggcgatgg caccaccacc gctaccgtat tggcacaggc tctggttcgg gaaggcctgc 1020 gcaacgttgc tgctggctct aacccaatgg gcatcaagcg tggcatcgag aaggctgttg 1080 ctcaggtaac tgagaagctg ctcgagg ctg cgaaggaagt tgagaccgag gagcagatcg 1140 ctgctaccgc tggtatctcc gcagctgacc cagctatcgg cgcacagatt gctaaggcaa 1200 tgtacgcagt tggcggtggc aagctgaaca aggattccgt catcactgtt gaagagtcga 1260 acactttcgg tgttgagctc gaggttactg agggtatgcg ctttgataag ggctacatct 1320 ccggttactt cgcaaccgac atggagcgcc tcgaggctgt tctggaagat ccttacatcc 1380 tgctggtttc cggcaagatc tccaacatca aggacctgct cccactgctg gagaaggtca 1440 tgcagtccgg caagcctttg ctgatcatct ctgaggacgt cgagggcgag gctctgtcca 1500 ccctggttgt caacaagatc cgtggcacct tcaagtctgt tgctgttaag gctccaggct 1560 tcggcgaccg ccgtaaggct cagctgcag 1589 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <400> 38 tggatccgtt gagagagttg ttctcggaa 29 <210> 39 <211> 29 <212> DNA <212> DNA <400> 39 gccatggttt gtgctcctga aatatttgt 29 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <400> 40 ataaaatctt gccatcacac cccttg 26 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <400> 41 agtgctaact actattctag cactca 26 <210> 42 <211> 519 <212> DNA <400> 42 tctagagggg ctggagacgt cgaaaagcaa tatcccgcct gcccaacctg ccccgaccag 60 ccagccggta gccgaggagg ccccggttga agaacctaaa aaacgtggat tcctgaggtg 120 gtttaaatga gttttcagca tgccgaaggc gtgaggcttg atgcggttcg cgctgaggaa 180 gagtttgagg cgcagcgaca agccaggcga aaggcacgga atcgttctgc gatgttgtgg 240 atcggcactg gcattgcggc agccgtaatt attgtgctcg tgatggtttt tatctggtca 300 cgtatctgat tagggcattt gaagctataa aatcttgcca tcacacccct tgagtgctag 360 aatagtagtt agcactcaac taatcagagt gccaatattg atcatcaact gcttggtggg 420 tgaggttggt ccacactcac taaccgtgcc gtcgcgggcg cctaccgggc agaagacgtg 480 agtgtcgtcc tacaaatatt tcaggagcac aaaccatgg 519

[Brief description of the drawings]

FIG. 1 shows a procedure for preparing a recombinant plasmid. The following operations were performed in the steps with circled numbers in the figure. 1. pUC1
Insertion of NcoI linker at the SmaI breakpoint of 9. 2.
Insertion of restriction enzyme recognition sequences (NcoI, EcoRI) into the end of the cpkB gene using PCR. 3. NcoI digestion and ligase treatment. 4. Release of rare codon and stacking region by site-directed mutation. 5. Blunting of restriction enzyme cleavage points by T4 DNA polymerase and removal of restriction enzyme cleavage points. 6. XbaI + EcoRI digestion and ligase treatment. 7. Cloning of upstream region of groEL gene by PCR. 8. Insertion of NcoI recognition sequence downstream of groEL promoter by PCR. 9. XbaI
+ NcoI digestion and ligase treatment.

FIG. 2: Chaperonin Cp induced by high-temperature culture
3 shows the results of SDS-polyacrylamide gel electrophoresis of kB protein.

FIG. 3 shows the results of SDS-polyacrylamide gel electrophoresis showing suppression of heat inactivation of intracellular proteins by chaperonin.

FIG. 4 Corynebacterium glutamicum 2233
7 shows the progress of culturing when the culture temperature was shifted up to 42 ° C. and 44 ° C. after culturing 7 (pAGC31) and Corynebacterium glutamicum 22337 (pAG50) at 37 ° C. Each symbol represents Δ, Δ: turbidity at 660 nm, ○, ●: L-glutamic acid concentration, Δ, ▲: residual sugar. Open symbols indicate data of strains holding pAGC31, and black symbols indicate data of strains holding pAG50.

FIG. 5. Corynebacterium glutamicum (Meracecora) 801 (pAGC31) and Corynebacterium glutamicum (Meracecora) 801 (pAG50)
After culturing at 35 ° C., the culturing temperature was set at 40 ° C., 41 ° C.,
Shows the progress of culture when the upshift was performed. Each symbol is the same as in FIG.

FIG. 6 Corynebacterium glutamicum 2233
7 (pAGC31) and Corynebacterium glutamicum 22337 (pAG50) at 37 ° C.
The culture was shifted up to 0 ° C, and the culture temperature was further increased to 42 ° C.
The cultivation progress when shifting up to ° C is shown. Each symbol is the same as in FIG.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (reference) (C12P 13/14 C12R 1:15) F term (reference) 4B024 AA03 BA74 BA80 CA04 DA05 EA04 FA02 GA11 HA01 4B064 AE19 CA02 CA19 CC06 CC24 DA16 4B065 AA01Y AA24X AB01 AC02 BA02 CA17

Claims (16)

[Claims] The present invention expresses a molecular chaperone derived from a thermophilic bacterium.
-An L-glutamic acid-producing bacterium that stably produces glutamic acid or a mutant thereof. 2. An L-cell transformed with a recombinant DNA containing a gene encoding a molecular chaperone derived from a thermophilic bacterium and a promoter operably connected upstream thereof.
-A glutamate-producing bacterium or a mutant thereof. 3. The bacterium according to claim 1, wherein the molecular chaperone is derived from a hyperthermophilic archaeon. 4. The bacterium according to claim 3, wherein the molecular chaperone is chaperonin CpkB derived from the hyperthermophilic archaeon Pyrococcus species KOD1 strain. 5. The bacterium according to claim 4, wherein the gene encoding the molecular chaperone comprises the following DNA (a), (b) or (c): (a) DNA comprising the nucleotide sequence of SEQ ID NO: 30; (B) a DNA consisting of a base sequence in which one or more bases have been deleted, substituted or added in the base sequence of base sequence 30, and encoding a protein having molecular chaperone activity; and (c) a base sequence of SEQ ID NO: 30 A DNA that hybridizes with a DNA consisting of a sequence under stringent conditions and encodes a protein having molecular chaperone activity. 6. The bacterium according to claim 2, wherein the promoter is a temperature-inducible promoter. 7. The bacterium according to claim 6, wherein the promoter comprises the following DNA of (a), (b) or (c): (a) DNA having the nucleotide sequence of SEQ ID NO: 42; (b) SEQ ID NO: A DNA consisting of a base sequence in which one or more bases are deleted, substituted or added in the base sequence of 42, and having a temperature-inducible promoter activity;
And (c) a DNA that hybridizes with a DNA consisting of the nucleotide sequence of SEQ ID NO: 42 under stringent conditions and has a temperature-inducible promoter activity. 8. Corynebacterium glutamicum 22
The bacterium according to claim 7, which is 337 (pAGC31) FERM BP-6785 or a mutant thereof. 9. The following (a), (b) or (c) DN:
Gene consisting of A: (a) DNA consisting of the nucleotide sequence of SEQ ID NO: 30; (b) 1 or 20 in the nucleotide sequence of SEQ ID NO: 30
D which encodes a protein having a molecular chaperone activity in an L-glutamic acid-producing bacterium, comprising a base sequence in which not more than a plurality of bases have been deleted, substituted or added.
NA; and (c) a DNA which hybridizes with a DNA consisting of the nucleotide sequence of SEQ ID NO: 30 under stringent conditions and encodes a protein having molecular chaperone activity. 10. The following D of (a), (b) or (c):
Gene consisting of NA: (a) DNA consisting of the base sequence of SEQ ID NO: 42; (b) consisting of a base sequence in which one or more bases are deleted, substituted or added in the base sequence of SEQ ID NO: 42, and (C) a DNA having a temperature-inducible promoter activity in a glutamic acid-producing bacterium; and (c) a DNA that hybridizes under stringent conditions to a DNA consisting of the nucleotide sequence of SEQ ID NO: 42, and that is a temperature-inducible type in an L-glutamic acid-producing bacterium. DNA having promoter activity. 11. A method for producing L-glutamic acid by a fermentation method, wherein the transformed L-glutamic acid-producing bacterium according to any one of claims 1 to 8 is used, and L-glutamic acid before transformation is used. A method comprising culturing at a high temperature such that production of L-glutamic acid is limited in a producing bacterium. 12. L according to any one of claims 1 to 8
-Glutamate-producing bacteria are inoculated into the medium, and the bacteria are cultured near the optimal growth temperature, and then cultured at a temperature near the upper limit of the optimal growth temperature or at a temperature higher than that, so that L-glutamic acid can be added to the medium. And producing the L-glutamic acid. 13. A method for producing L-glutamic acid by a fermentation method, wherein the transformed L-glutamic acid-producing bacterium according to claim 1 is used; L-glutamic acid is contained in a culture solution. Conditions for accumulation are (1)
Raising the culture temperature, (2) limiting biotin to an amount required by the bacteria, (3) adding penicillin to the culture, (4) adding a surfactant to the culture, Or a combination of any one of (1) to (4); and culturing at a high temperature such that production of L-glutamic acid in L-glutamic acid-producing bacteria before transformation is limited. 14. A recombinant plasmid containing the gene according to claim 9. 15. A vector containing the gene according to claim 10. 16. A recombinant plasmid containing a gene obtained by binding the gene according to claim 10 upstream of the gene according to claim 9.