WO2005118804A1

WO2005118804A1 - Method of specifically detecting bacterium belonging to the genus alicyclobacillus

Info

Publication number: WO2005118804A1
Application number: PCT/JP2005/010259
Authority: WO
Inventors: Yoshihiko Tsuda; Fumihiro Arakawa
Original assignee: San-Ei Gen F.F.I., Inc.
Priority date: 2004-06-03
Filing date: 2005-06-03
Publication date: 2005-12-15
Also published as: JPWO2005118804A1

Abstract

It is intended to provide a quick, convenient and low-cost method of specifically detecting a bacterium belonging to the genus Alicyclobacillus in distinction from other bacteria. Namely, a method of specifically detecting a bacterium belonging to the genus Alicyclobacillus which comprises: (1) the step wherein a test sample is subjected to PCR with the use of a primer set comprising an oligonucleotide having the base sequence represented by SEQ ID NO:1 with an oligonucleotide having the base sequence represented by SEQ ID NO:2, or a primer set comprising an oligonucleotide having the base sequence represented by SEQ ID NO:3 with an oligonucleotide having the base sequence represented by SEQ ID NO:4; (2) the step wherein the PCR product thus obtained is hybridized with a probe comprising an oligonucleotide having a base sequence represented by SEQ ID NO:5 or 6; and (3) the step of detecting the hybridization product obtained above.

Description

Specification

Alicyclobacillus Species Specific Detection Method

Technical field

The present invention relates to a method for specifically detecting Alicyclobacillus bacteria, particularly Alicyclobacillus acidoterrestris. Furthermore, the present invention relates to a primer for amplifying a DNA sequence specific to a bacterium belonging to the genus Alicyclobacillus, particularly Alicyclobacillus acidoterrestris, a probe for specifically labeling the DNA sequence, and a combination of the primer and the probe. . Background art

[0002] Alicyclobacillus bacteria are bacteria that have characteristics of growing well under acidic and high temperature conditions and forming spores. Alicyclobacillus bacteria are classified as Bacillus because of their spore formation.Proposed as a new genus independent of Bacillus in 1992, based on their unique properties and 16S rDNA gene sequence. Was done.

[0003] As described above, the genus Alicy clobacillus was initially attracting much attention as a basic research material because of its unique property of favoring acidity under high temperature conditions. When it became clear that Alicyclobacillus acidoterrestris (A. acidoterrestris) was responsible for the large-scale microbial contamination of apple juice in West Germany in 1984, the bacterium was identified as a bacterium causing food accidents. It became so. Thereafter, in Japan, an accident of contaminating acidic beverages (offensive odor) caused by A. acidoterr estris has been reported (Non-Patent Document 1).

[0004] Conventionally, as a method for detecting A. acidoterrestris, a peroxidase method ((Japan) Juice Association), a heat and acidophilic bacterium unified test method, March 17, 2003, and Patent Document 1 ) And the temperature difference method (Japan Fruit Juice Association, Heat and Acidophilic Bacteria Unified Test Method, see March 17, 1995).

[0005] The peroxidase method is a method based on the ability of A. acidoterrestris to assimilate vanillic acid to produce guaial alcohol. In this method, the determination is made by measuring the absorbance of tetraguai alcohol produced by treating guaia alcohol with hydrogen peroxide and peroxidase. This method, while working, However, there is a drawback that the determination result is likely to be false positive or false negative because it depends on the nature of the determination.

[0006] The temperature difference method is a method based on the difference in the optimal growth temperature between A. addoterrestris and other thermostable eosinophilic bacteria. In this method, the test bacteria are cultured simultaneously at different temperatures, and the determination is made by observing the presence or absence of colony formation at each culture temperature. However, this method has the disadvantage that it requires 3-4 days before results are obtained.

[0007] The force sequence method is conventionally used as a method for detecting the presence or absence of bacterial contamination. In this method, the base sequence of the DNA (for example, 16S rDNA) of the test bacterium is determined, the obtained sequence is compared with a database, and the homologous bacteria are identified (for example, Non-Patent Document 2). . However, such a method for identifying a bacterial species based on a nucleotide sequence can almost certainly identify a bacterium, but requires three to four days to obtain a result, and the operation is complicated. There is a problem that it is expensive and expensive.

[0008] In recent years, as consumers' awareness of food safety has increased, it has become even more important to take measures to prevent food accidents. Therefore, there is a strong demand for a quicker and lower-cost means for specifically detecting Alicyclobadllus bacteria that can cause food contamination such as A. acidoterrestris.

Patent document 1: Japanese Patent Application Laid-Open No. 2004-201668

Non-patent document 1: Kei Goto-thermophilic eosinophilic spore-forming bacterium: Alicyclobadllus bacterium bacteriostatic fungus Vol.28 No.8 499-508 (2000)

Non-Patent Document 2: Tsugio Sasaki, Kenichi Tanamoto, 2001 Research Report on "Testing Methods in the Japanese Pharmacopoeia", Rapid Identification of Microorganisms by Genetic Analysis, Pharmaceutical Research 33 (12) 7 63-769 (2002)

Disclosure of the invention

Problems to be solved by the invention

[0009] An object of the present invention is to provide a rapid and simple method for specifically detecting Alicyclobadllus bacteria distinguished from other bacteria. Another object of the present invention is to provide a tool used for suitably implementing a powerful method.

Means for solving the problem

[0010] The present inventors have developed a novel method for specifically detecting bacteria of the genus Alicyclobadllus. Diligent research was done to radiate. As a result, by performing PCR using an oligonucleotide having a specific sequence as a primer, it is possible to amplify a DNA sequence specifically possessed by a bacterium belonging to the genus Alicyclobacillus. It was found that by using tide as a probe, the resulting amplified DNA product (PCR product) could be selectively labeled, thereby making Alicyclobacillus genus bacteria other than Escherichia coli, Bacillus subtilis, Staphylococcus aureus and Salmonella bacteria. It was confirmed that it can be specifically detected separately from bacteria belonging to the genus. Furthermore, the present inventors can specifically detect A. acidoterrestris, which has been regarded as a problem that causes a food accident among bacteria of the genus Alicyclobacillus, by using such primers and probes. It was confirmed. The present invention has been completed based on strong knowledge.

That is, the present invention has the following aspects.

Item 1.

(1) For the test sample, an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A primer set that also has an oligonucleotide power having the following characteristics, or an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3 and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4 Performing a PCR using a primer set consisting of an oligonucleotide having the base sequence shown,

(2) hybridizing the obtained PCR product with a probe consisting of an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 5 or 6, and

(3) Step of detecting the hybridized product obtained above

A method for specifically detecting Alicyclobacillus bacteria.

Section 2.

(1) Test sample! A primer set comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2, Or PCR using an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 4 as a primer set,

(2) a step of hybridizing the obtained PCR product with an oligonucleotide probe having the nucleotide sequence shown in SEQ ID NO: 5 or 6, and

(3) Step of detecting the hybridized product obtained above

Item 2. The method for specifically detecting Alicyclobadllus bacteria according to Item 1, which comprises:

Section 3.

Item 2. The method for specific detection of Alicyclobadllus bacteria according to Item 1, wherein the probe is immobilized on a solid phase.

Section 4.

(3) a step of immobilizing the ribonucleic acid product on a solid phase before the detection step

Section 5.

Item 2. The method according to Item 1, wherein the bacterium belonging to the genus Alicyclobadllus has vanillin utilization.

Section 6.

Alicyclobacillus J¾ Itoda fungus is Alicyclobacillus acidoterrestris, the method described in section 5 Item 7.

(1 ′) For the test sample, an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A step of performing PCR using a primer set that also has the ability of an oligonucleotide having a sequence,

(2 ′) a step of hybridizing the obtained PCR product with a probe having an oligonucleotide power having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 6, and

(3 ') a step of detecting the above-obtained and hybridized products

Has or (1 ") For the test sample, an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3 and a nucleotide having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4 A step of performing PCR using a primer set that also has the ability of an oligonucleotide having a sequence,

(2 ") a step of hybridizing the obtained PCR product with a probe consisting of an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 5 or 6, and

(3 ") Step of detecting the hybridized product obtained above

A method for specifically detecting Alicyclobacillus acidoterrestris, comprising:

Section 8.

(1 ') Test sample! A step of performing PCR using a primer set consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 2,

(2 ′) a step of hybridizing the obtained PCR product with a probe consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 6, and

(3 ') a step of detecting the above-obtained and hybridized products

Has or

(1 ") performing a PCR on a test sample using a primer set consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 4,

(2 ") a step of hybridizing the resulting PCR product with an oligonucleotide probe having the nucleotide sequence shown in SEQ ID NO: 5 or 6, and

(3 ") Step of detecting the hybridized product obtained above

Item 8. The method for specifically detecting Alicyclobacillus acidoterrestris according to Item 7, comprising:

Section 9.

Item 8. The method for specifically detecting Alicyclobacillus acidoterrestris according to Item 7, wherein the probe is immobilized on a solid phase.

Section 10. Item 8. The method for specific detection of Alicyclobacillus acidoterrestris according to Item 7, wherein the method further comprises a step of immobilizing the product of ibridis on a solid phase before the detection step of (3 ′) or (3 ″).

Section 11.

Item 8. The method for specifically detecting Alicyclobacillus acidoterrestris according to Item 7, wherein the test sample is a food or drink, a cosmetic, a hair care cosmetic, a dental care product, or a raw material thereof.

Section 12.

(1 "') For the test sample, an oligonucleotide having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A step of performing PCR using a primer set that also has oligonucleotide power having a base sequence,

(2 "′) a step of hybridizing the obtained PCR product with a probe having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 5, which also has an oligonucleotide power; and

(3 "') Step of detecting the hybridized product obtained above

A method for specifically detecting a bacterium belonging to the genus Alicyclobacillus having vanillin assimilation, comprising:

Item 13.

(1 "') performing a PCR on a test sample using a primer set comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2,

(2 "') a step of hybridizing the obtained PCR product with an oligonucleotide probe having the nucleotide sequence shown in SEQ ID NO: 5, and

(3 "') Step of detecting the hybridized product obtained above

Item 13. The method for specific detection of a bacterium belonging to the genus Alicyclobacillus having vanillin assimilation according to Item 12, which comprises:

Section 14.

Item 13. The method for specific detection of a bacterium belonging to the genus Ali cyclobacillus having vanillin utilization, according to Item 12, wherein the probe is immobilized on a solid phase.

Item 15. Item 13. The method for specifically detecting a bacterium belonging to the genus Alicyclobadllus capable of assimilating vanillin according to Item 12, which comprises a step of immobilizing the hybridized product on a solid phase before the detection step (3 "'). .

Item 13. The method for specifically detecting bacteria of the genus Alicyclobacillus having vanillin assimilation according to Item 12, wherein the test sample is food and drink, cosmetics, hair care cosmetics, dental care products, or raw materials thereof.

Section 17.

An oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: An oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3 and an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4. A primer for amplifying a DNA sequence specific to a bacterium of the genus Alicyclobacillus, comprising at least one oligonucleotide selected.

Item 18.

An oligonucleotide having the base sequence shown in SEQ ID NO: 1, an oligonucleotide having the base sequence shown in SEQ ID NO: 2, an oligonucleotide having the base sequence shown in SEQ ID NO: 3, and a base sequence shown in SEQ ID NO: 4 Item 18. The primer for amplifying a DNA sequence specific to a bacterium belonging to the genus Alicyclobacillus according to Item 17, wherein the primer comprises at least one oligonucleotide selected from the group consisting of oligonucleotides having the same.

Item 19.

Primer set for amplifying the DNA sequence specific to Alicyclobacillus genus bacteria in (a ') or (b') below:

(a ′) an oligonucleotide forward primer having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A primer set having a reverse primer consisting of an oligonucleotide having a base sequence of (b ′) an oligonucleotide forward primer having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3, and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4 A primer set having a reverse primer consisting of an oligonucleotide having the nucleotide sequence of

Clause 20.

A primer set for amplifying a DNA sequence specific to a bacterium belonging to the genus Alicyclobacillus according to item 19, which is either! Or (b) below:

(a) a primer set having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 1 and a reverse primer consisting of the oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 2,

(b) a primer set comprising a forward primer having an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and a reverse primer comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4;

Section 21.

Probes for marking DNA sequences specific to Alicyclobacillus bacteria, either (c ') or (d') below:

(c ′) an oligonucleotide probe having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 5,

(d ') An oligonucleotide probe having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 6.

Section 22.

A probe for labeling a DNA sequence specific to an Alicyclobacillus genus bacterium according to item 21 described in item (c) or (d) below:

(c) a probe consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 5,

(d) a probe comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 6. Section 23.

(A) and (b) described in Item 17 and (a ') and (b') described in Item 18 at least one primer set selected from the group consisting also of power, and (c) described in Item 19 And (d) and paragraph 2 A reagent kit for specifically detecting bacteria of the genus Alicyclobadllus, comprising at least one probe selected from the group consisting of (c ′) and (d ′) described in 0.

Clause 24.

An oligonucleotide having the base sequence shown in SEQ ID NO: 1, an oligonucleotide having the base sequence shown in SEQ ID NO: 2, an oligonucleotide having the base sequence shown in SEQ ID NO: 3, and a base sequence shown in SEQ ID NO: 4 Use of at least one oligonucleotide selected from the group consisting of oligonucleotides having as a primer in PCR for amplifying a DNA sequence specific to a bacterium belonging to the genus Alicyclobadllus.

Clause 25.

Use of any of the following primer sets (a) or (b) in PCR to amplify DNA sequences specific to Alicyclobacillus bacteria:

Section 26.

Use of the following probes (c) or (d) for labeling a DNA sequence specific to Alicyclobacillus bacteria:

(d) a probe comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 6. Section 27.

A primer set having an oligonucleotide primer having the nucleotide sequence represented by SEQ ID NO: 1 and a reverse primer having an oligonucleotide primer having the nucleotide sequence represented by SEQ ID NO: 2, and a nucleotide sequence represented by SEQ ID NO: 6 An oligonucleotide probe having

Oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 1 A primer set having a reverse primer having the oligonucleotide sequence having the nucleotide sequence shown in SEQ ID NO: 2, and a probe having the oligonucleotide sequence having the nucleotide sequence represented by SEQ ID NO: 5 or 6,

For the specific detection of Alicyclobacillus acidoterrestris.

Section 28.

A primer set having an oligonucleotide primer having the nucleotide sequence represented by SEQ ID NO: 1 and a reverse primer having an oligonucleotide primer having the nucleotide sequence represented by SEQ ID NO: 2, and a nucleotide sequence represented by SEQ ID NO: 6 Use of a probe consisting of an oligonucleotide having the following for specific detection of a bacterium belonging to the genus Alicyclobacillus capable of assimilating vanillin.

Hereinafter, the present invention will be described in more detail.

[0013] The present invention provides a method for specifically detecting a bacterium belonging to the genus Alicyclobacillus (hereinafter, also simply referred to as a bacterium of the genus Alicyclobacillus) in a test sample. The method of the present invention basically comprises: (l) a step for amplifying a DNA sequence uniquely owned by a bacterium belonging to the genus Alicy clobacillus using PCR (Polymerase Chain Reaction) (PCR step); A step of hybridizing the DNA sequence (PCR product) unique to the genus Alicyclobacillus bacterium amplified by the PCR step with the probe (a hybridization step), and (3) a step obtained by the hybridization step. (Detection step) for detecting the hybridized product (PCR product-probe).

[0014] (l) PCR step

The PCR step is basically performed by repeatedly performing at least three steps of (I) denaturation, (II) annealing, and (III) extension. In the PCR step used in the method of the present invention, in the annealing step (II), a primer consisting of an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and a primer comprising SEQ ID NO: A primer consisting of an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in 2 or an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3 And an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4 A primer consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and a primer consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 2, or more preferably A primer comprising an oligonucleotide having the base sequence shown in SEQ ID NO: 3 and a primer comprising the oligonucleotide having the base sequence shown in SEQ ID NO: 4 are used as primer sets.

[0015] These primers may be oligonucleotides whose 5 'end is labeled. When a 5'-end labeled oligonucleotide is used as a primer, a PCR product can be obtained in a manner in which the 5 'end is labeled. The label at the 5 'end is not limited, but includes, for example, digoxigenin (DIG), biotin, avidin, streptavidin, enzymes (such as horseradish peroxidase (HRP), alkaline phosphatase (AP)), and radioisotopes. body ^{^{^{(32 P, 131 I, 3}}} , 45 Ca, 3 H, W C , etc.), fluorescent dyes (e.g., CyDye, Furuo receptacle in isothiocyanate Xia sulfonate (FITC), tetra methylol Honoré rhodamine isothiocyanate Xia sulfonate (TRIT C ) Etc.) can be used similarly. Preferably, they are digoxigenin and biotin.

[0016] The most preferred primer set includes a primer set comprising a forward primer and a reverse primer, as shown in the following (A) or (B). In addition, the forward primer and the reverse primer may be oligonucleotides each having a labeled 5 ′ end, as described above.

(A) Primer set

forward Fufima ~~: cacgtgggcaatctgccttt (Rooster column number 1 J

reverse puffima ¹ ~~: gagccgttacctcaccaact (column C ¾ · number 2)

(B) Primer set

forward Pfima ¹ ~~: cagactggaataacactcgg (eye cl column ¾ · d)

reverse fufima ~~ ： ctacgcatcgtcgccttggt (Rooster column number 4)

Each of these primers can be prepared by a conventional method (for example, the formamide method (Beaucage and Carruthers, Tetra. Letts. 22: 1859-1862, 1981)) or the triester method (Matteucci and Caruthers J. Amer. Chem. So, 103, 3185, 1981). )). Conveniently, automatic It can also be synthesized using a synthesizer, or a synthetic product can be obtained from a contractor.

Here, the test sample to be subjected to PCR is not particularly limited as long as it can contain bacteria of the genus Alicyclobacillus. In addition, "may include" does not need to actually include Alicyclobacillus genus bacteria as long as it may contain Alicyclobacillus genus bacteria. Such test samples are not particularly limited, but are products whose commercial value and safety are impaired by containing Alicyclobacillus bacteria such as food and drink, cosmetics, hair care cosmetics, dental care products, and raw materials thereof. Particularly preferred are foods and drinks.

[0018] Before the powerful test sample is subjected to the PCR step, it may be subjected to operations such as DNA extraction, lysis, incubation, stationary culture, shaking culture, concentration, dilution, and homogenization as necessary. May be performed.

In the PCR step, (I) denaturation is a step of dissociating double-stranded DNA into single-stranded DNA. Although it is not limited as long as it is carried out, it can be usually carried out by treating at 92 to 96 ° C, preferably around 94 ° C for about 0.5 to 1 minute, preferably about 0.5 minute. The subsequent (II) annealing is a reaction for forming a double strand by binding an oligonucleotide having a complementary base sequence to the single-stranded DNA dissociated by denaturation. Such annealing (II) is performed in the presence of the aforementioned primer set, most preferably the forward primer and the reverse primer of the primer set of the above (A) or (B). Although there is no limitation, the annealing step (II) can be carried out usually by treating at 50 to 68 ° C, preferably around 60 ° C for about 0.5 to 1 minute, preferably about 0.5 minute. At this time, if the base sequence complementary to the base sequence of the primer used above is present on the single-stranded DNA formed in the above (I) modification step, the primer is complementary to the single-stranded DNA. It binds to a basic base sequence site. The subsequent (III) extension step is a step of extending the base sequence from the primer bound to the single-stranded DNA as a starting point to the single-stranded DNA in a 铸 shape. The brute force step is performed in the presence of DNA polymerase and four bases (doxynucleoside triphosphate (dNTP mixture): dATP, dCTP, dGTP and dTTP). Although not particularly limited, the (III) elongation step can be carried out usually by treating at 70 to 74 ° C, preferably around 72 ° C, for 0.5 to 2 minutes, preferably for about 1 minute.

[0020] In general, the PCR step including the above steps (I) to (: III) is at least a type III DNA. In a reaction solution containing the test sample containing the obtained DNA, PCR buffer, primer set, dNTP mixture, and DNA polymerase, raise and lower the temperature (for example, around 94 ° C → around 55 ° C → around 72 ° C → 94 (Around ° C), and so on, thus causing a chain reaction of DNA synthesis. In the reaction solution, the DNA contained in the test sample is used as a template and the forward primer and the reverse primer are used. It becomes possible to amplify DNA having a specific base sequence sandwiched between them. The number of PCR cycles is not particularly limited, but is usually 20 to 40, preferably 25 to 35.

[0021] In the above reaction, DNA polymerase is a power capable of widely using a DNA polymerase generally used in PCR. A commercially available thermostable polymerase such as Taq (manufactured by Promega), KOD (manufactured by TOYOBO) ), Pfo (manufactured by Promega), Vent (manufactured by NEB) and the like can be preferably used.

[0022] When the PCR product is obtained in a labeled form, an oligonucleotide having a 5'-end labeled as described above may be used as a primer. The dNTP mixture (mixture of deoxynucleoside triphosphates) used is dATP (5, -deoxyadenosine 5'-triphosphate), dCTP (5, -deoxycytidine 5'-triphosphate), dGTP ( DIG obtained by adding dexoxigenin (DIG) or biotin (Biotin) to a mixture of d-TPG (5, -deoxyguanosine 5'-triphosphate) and dTTP (5, -deoxythymidine 5'-triphosphate) -Those containing dUTP labeled with an arbitrary labeling agent, such as 11-dUTP (5, -deoxyperidine 5'-triphosphate) and Biotin-16-dUTP, can also be used. As a dNTP mixture, a mixture of at least one of dATP, dCTP, dGTP and dTTP labeled with any labeling agent such as a radioisotope (RI), a chemiluminescent agent, or a fluorescent dye may be used. Monkey

[0023] The PCR buffer can be appropriately prepared depending on the type of the DNA polymerase to be used and the like. For convenience, a commercially available product can also be used.

[0024] The above PCR reaction conditions (reaction temperature, reaction time, reaction cycle, etc.) are merely examples, and may vary depending on the type of DNA polymerase used, the size of the target PCR product, the Tm value of each primer, and the like. Can be appropriately set and adjusted.

[0025] The temperature control of the PCR reaction is simply performed by using a commercially available thermal cycler (for example, iCy cler Thermal Cycler (manufactured by Bio-Rad Laboratory), TaKaRa PCR Thermal Cycler (manufactured by TaKa Ra) or the like.

(2) Hybridization process

In the present invention, the hybridization step is a step of hybridizing the DNA sequence (PCR product) amplified by the PCR step with an oligonucleotide probe (hybridization probe) that specifically recognizes the DNA sequence. It is.

[0027] Here, the oligonucleotide used as a probe includes an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 5, and an oligonucleotide having at least 90% nucleotide sequence shown in SEQ ID NO: 6. Oligonucleotides having the base sequence of SEQ ID NO: 5, and more preferably oligonucleotides having the base sequence of SEQ ID NO: 6. Most preferred probes include those consisting of oligonucleotides shown in (C) or (D) below:

(C) Probe: gtgctaatgccggataatacacggg (Rooster No. 5)

(D) Probe: acttgtgttgaaagatgcaac (SEQ ID NO: 6).

[0028] These probes may be labeled with an appropriate labeling agent. As the labeling agent, digoxigenin (DIG), biotin, avidin, streptavidin, enzymes (horseradish peroxidase (HRP), alkaline phosphatase (AP), etc.), radioisotopes (AP), etc. ^{^{^{32 P, 131 1, 3 ¾}}} , 45 Ca, 3 H, W C , etc.), fluorescent dyes (e.g., CyDye, Furuorese in isothiocyanate Xia sulfonate (FITC), tetra methylol Honoré rhodamine isothiocyanate Xia sulfonate (TRITC), etc.) And other labeling agents commonly used in the art.

[0029] The probe is preferably used in a specific combination with the aforementioned primer set. In the method for specifically detecting Alicyclobacillus bacteria from bacteria belonging to other genera, any of the above probes may be any of the above-mentioned primer sets, most preferably the above-mentioned (A) or (B) primer set. And can be suitably used for hybridization with a PCR product obtained in a PCR step using

Here, bacteria other than the genus Alicyclobacillus include Escherichia coli, Bacillus subtilis, Staphylococcus aureus, Salmonella and the like. As the genus Alicyclobacillus, preferably A1 icyclobacillus acidoterrestris (A. acidoterrestris) can be named S. A. acido terrestris has a property of assimilating vanillin and has a tendency to favor acidity under high temperature conditions. Are bacteria. A. acidoterrestris is a fungus that can generate odors based on its ability to utilize vanillin, so it is important to use fragrances such as cosmetics, hair care products, dental care products, and fragrances that are not limited to food and drink. Contamination of the A. acidoterrestris is also a problem in products.

In order to specifically detect A. acidoterrestris among bacteria of the genus Alicyclobacillus, an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and an oligonucleotide having SEQ ID NO: 2 A primer set comprising an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, more preferably having an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 2 A nucleotide sequence exhibiting at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 6 with respect to a PCR product obtained in a PCR step using a primer set having oligonucleotide power, most preferably a primer set described in (A) above. A probe consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 6 is more preferable. It is preferable to use a probe consisting of a peptide, most preferably a probe of the above (D), and an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3. A primer set having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4; more preferably, an oligonucleotide having a nucleotide sequence shown in SEQ ID NO: 3 and a nucleotide sequence shown in SEQ ID NO: 4 With respect to the PCR product obtained in the PCR step using the primer set comprising an oligonucleotide having the above-mentioned (B), at least 90% of the nucleotide sequence represented by SEQ ID NO: 5 or 6 A probe having the same nucleotide sequence as an oligonucleotide, and more preferably a nucleotide sequence represented by SEQ ID NO: 5 or 6; Oligonucleotide force becomes probe having, most preferably it is preferable to use a probe of the (C) or (D).

[0032] In addition, among bacteria belonging to the genus Alicyclobacillus, they have vanillin assimilation and may cause odor.

acidoterrestris, A. hesperidum and A. hespendensis An oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence having a nucleotide sequence showing at least 90% identity to specifically detect the bacteria and Alicyclobadllus genus bacteria that do not utilize vanillin A primer set comprising an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2, more preferably having an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 2 It shows at least 90% identity with the base sequence shown in SEQ ID NO: 5 to a PCR product obtained in a PCR step using a primer set that also has the ability to generate oligonucleotides, most preferably the primer set described in (A) above. A probe consisting of an oligonucleotide having a base sequence, more preferably an oligonucleotide having a base sequence shown in SEQ ID NO: 5 Probe consisting Reochido, and most preferably it is preferable to use a probe of the (C).

(3) Detection process

The detection step is a step of detecting a hybridized product (PCR product-probe) obtained by the above hybridization step. For example, when the labeled PCR product is obtained by using a primer labeled at the 5 ′ end or a dNTP mixture containing a labeled nucleic acid in the (l) PCR step, the detection is performed using the PCR product (labeled PCR). A labeled hybridized product (PCR product-labeled probe) is obtained by using the label of the product (probe) as an index and (2) using a labeled probe as a hybridization probe in the hybridization step. In this case, the label of the probe can be used as an index. As the labeling agents used for the detection, Jigokishi genin (DIG), radioactive isotopes ^{^{^{(32 P, 131 I, 35}}} S, 45 Ca, 3 H, 14 C , etc.), fluorescent dyes (e.g., Cy Dye It is preferable to use fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), or the like. The detection of a strong labeling agent can be performed by a conventional method depending on the labeling agent to be used. For example, when the hybridized product is labeled with digoxigenin (DIG), an anti-digoxigenin antibody obtained by labeling the labeled hybridized product with an enzyme such as alkaline phosphatase (AP) or peroxidase (POD) is used. And then react with the substrate of the enzyme (Nitroblue tetrazolium chloride and 5-blomo-4-chloro-3-indolyl phosphate in the case of AP: TMB or 2,2'-azinobis (3-E in the case of POD). Reaction with butylbenzothiazoline-6-sulfonic acid (ABTS) A method for detecting; a method for detecting the fluorescence intensity of the hybridized product when the hybridized product is labeled with a fluorescent dye; a method for detecting the fluorescence intensity of the hybridized product; and a method for detecting the fluorescent intensity when the hybridized product is labeled with a radioisotope. A method for detecting the presence or absence of radioactivity of the product using autoradiography can be mentioned.

(4) Immobilization step

In the method of the present invention, prior to the hybridization step (2), the immobilization step of immobilizing the probe on an arbitrary solid phase, or (3) prior to the detection step, It may also have a fixing step of fixing the hybridization product obtained in the hybridization step to an arbitrary solid phase.

[0035] The immobilization of the probe or the hybridized product on the solid phase is not limited, but is preferable. Specifically, the probe was prepared using a probe labeled with biotin, a hybridization product prepared using a PCR product labeled with biotin (biotin-labeled PCR product-probe), or a probe labeled with biotin. (B) The reaction of an ibridiz product (PCR product-biotin-labeled probe) with a solid phase to which avidin (or streptavidin) has been previously bound to allow the binding of biotin to avidin (or streptavidin). Can be immobilized on a solid phase. When the probe is immobilized, the PCR product to be hybridized to the probe is preferably labeled with a labeling agent suitably used for the above-described detection. When the hybridized product is immobilized, the side of the hybridized product that is not labeled with biotin (ie, the PCR product is labeled with biotin, the probe is labeled with biotin, or the probe is labeled with biotin! R product) is preferably labeled with a labeling agent suitably used for the aforementioned detection. Thus, it is possible to specifically detect a specific hybridization product immobilized on the solid phase.

That is, the method for specifically detecting Alicyclobacillus genus bacteria, particularly A. acidoterrestris of the present invention, can be preferably performed using the principle of PCR ELISA. PCR ELISA is a method for detecting the presence or absence of a product amplified by PCR by ELISA. In PCR ELISA, the PCR product and the probe are labeled in advance with different labeling agents. Then Then, the probe and the PCR product are hybridized to form a hybridized product, and the hybridized product is immobilized on a solid phase via a labeling agent of either the PCR product or the probe. After that, the immobilized substances immobilized on the solid phase are removed, and then the labeling agent of the hybridization product (another labeling agent not used for immobilization) is detected with an arbitrary detection substance (for example, an antibody). . Note that the description is merely a simple explanation for easier understanding of the principle of the PCR ELISA method used as one embodiment of the present invention, and the present invention is not limited to this method. For detailed instructions on PCR ELISA method, reference may be made to the Roche Mole cular Biochemicals PCR Applications Manual 2 nd edition , and the like.

[0037] The solid phase used in the immobilization method is not particularly limited, and petri dishes, plates (including microplates), strips, beads, and the like used in the art can be widely used! Can be

[0038] The present invention also provides a primer (primer set) and a probe used in a method for specifically detecting the bacterium belonging to the genus Alicyclobacillus, particularly A. acidoterrestris. These primers (primer sets) and probes are as described above.

[0039] The present invention provides a reagent kit suitably used for easily carrying out a method for specifically detecting Alicyclobacillus bacteria, particularly A. acidoterrestris, of the present invention. The reagent kit includes at least the above primer (primer set) and a probe as constituent components of the kit.

DNTP mixture which may contain NA polymerase, DIG-11-dUTP or Biotin-16-dUTP, sterile water, solid phase (microplate etc.), etc. may contain one kind or a combination of two or more kinds. .

BEST MODE FOR CARRYING OUT THE INVENTION

[0040] Examples of the present invention will be shown below, but these examples are merely exemplifications for easier understanding of the present invention, and are not intended to limit the present invention.

Example 1

1. Preparation of DNA solution from microorganism

7 isolated Alicyclobacillus acidoterrestris, Otsuki easy tooth, Escherichia coli), hay! ¾ (Bacill us subtilis), Staphylococcus aureus (Stapnylococcus aureus) and Salmonef (Salmonella enteritidis) was picked with a platinum loop and suspended in 200 μL of PrepMan Ultra (Applied Biosystems). The suspension was heated at 100 ° C. for 10 minutes to lyse the cells. After centrifugation at 3000 rpm for 5 minutes, the supernatant was recovered and used as a DNA solution.

2. PCR ELISA method

For the PCR ELISA method, the combinations of the forward primer, reverse primer and probe shown in Table 1 below were used. This probe was used with its 3 'end labeled with biotin. 3. Labeling of biotin at the terminal was carried out using a commercially available kit, Biotin-16-2 ', 3, dideoxy-uridine-5, and tripho sphate (Roche). For the labeling method, see Schmitz, G.G. et al. (1990) Anal. Biochem. 192, 222. In addition, F and R in the primer name mean forward and reverse, respectively. Further, P in the probe name means probe.

[Table 1]

[0043] 2-1. PCR

First, PCR was performed using a set of forward primer and reverse primer of No. 1 to No. 4 shown in Table 1 above. For digoxigenin (DIG) labeling, a commercially available kit PCR ELISA (DIG-Labeling) (Roche) equipped with a reagent containing dATP, dCTP, dGTP, dTTP and DIG-11-dUTP was used. By performing PCR using this PCR ELISA (DIG-Labeling), DIG-11-dUTP is incorporated into the amplification product, and a DIG-labeled amplification product is obtained.

[0044] A reaction solution for PCR was prepared to have the following composition. DNA solution 2.5 μ 1

10 X PCR buffer (TaKaRa) 2.5 μ 1

PCR DIG labeling mix (Roche) 2.5 μ I

forward primer (50 pM) 0.2 5 μ 1

reverse primer (50 pM) 0.25 μI

Taq polymerase (5 Units) (TaKaRa) 0.05 μI

Water, —sterile, PCR grade (Roche) 6. 9 5 ji 1

Total 25 μI

PCR reaction conditions are as shown in Table 2 below.

[Table 2]

94 ° C X Γ) m i n.

i

35 cyc l es

i

72 ° C X 10 min.

1

4 f or ever

[0046] 2—2. ELISA (DIG detection)

The following operation was performed using a commercially available kit PCR ELISA (DIG Detection) (Roche) to detect the DIG-labeled PCR product.

[0047] First, the DIG-labeled PCR product was denatured into a single strand, mixed with a probe whose 3 'end was labeled with biotin, and shaken at 50 ° C for 90 minutes. The reaction solution was caloried onto a streptavidin solid-phased microplate (Roche) and shaken at 50 ° C for 90 minutes. Washing was performed 5 times with the washing solution included in the kit. Next, an anti-DIG antibody (Roche) labeled with peroxidase (POD) (Roche) was added, followed by shaking at 37 ° C for 30 minutes. After that, washing was performed 5 times with the washing solution included in the kit. Add the POD substrate 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS ™). (In this example, dissolve one ABTS ™ tablet supplied with the kit in 5 ml of substrate buffer.) The sample was shaken for 30 minutes at 37 ° C. The absorbance of the obtained sample was measured at a main wavelength of 492 nm and a sub wavelength of 620 nm. ++, 1.0 to 0.2 if +, 0.2 In the following cases, the judgment was made as one.

3. Results of PCR ELISA

The results are shown in Table 3 below.

[Table 3]

[0049] As shown in Table 3, A. acidoterres tris was detected in all combinations of No. 1 to No. 4, but Escherichia coli, Bacillus subtilis, Staphylococcus aureus and Salmonella were not detected.

Four.

In all combinations of No. 1 to No. 4, A. acidoterrestris could be detected specifically and distinguished from bacteria of other genera. Among them, the combination of No. 1 and No. 2 primers and probes is very specific. You can see that you can. Example 2

[0050] 1. Preparation of DNA solution

A DNA solution was prepared according to the same procedure as in Example 1 using four types of Itoda bacteria belonging to Alicyclobacillus Jill, A. acidoterrestris, A. acidocaldarius, A. hesperidensis and A. hesperidum.

2. PCR ELISA method

PCR ELISA was performed in the same manner as in Example 1. As for the primer and the probe, the forward primer, reverse primer and probe shown in No. 1 to No. 4 in Table 1 were used.

[0051] 3. PCR ELISA The results are shown in Table 4 below.

[Table 4]

[0053] As shown in Table 4, in the binding of the primer and the probe of No. 24, only A. acidoterrestris was detected, and no other bacteria of the genus Alicyclobacillus were detected. In No. 1 yarn knotting, in addition to A. acidoterrestris, A. hesperidum and A. hesperidensis were detected, but A. acidocaldarius was not detected.

4.Discussion

In all combinations of No. l No. 4, a large number of vanillin-utilizing and contaminating causative bacteria were reported, and A. acidoterrestris was detected. A. acidocaldarius was not detected!

In particular, in the binding of No. 24 primer and probe, A. acidoterrestris was detected specifically and distinguished from all other Alicyclobacillus bacteria. Therefore, the combination of No. 24 is useful as a combination for specifically detecting only A. acidoterrestris.

[0055] On the other hand, the yarn binding of No. 1 primer and probe is a low level of A. hesperidum and A. hesperidum, which have the ability to assimilate vanillin at a lower level as compared with A. acidoterrestris and can cause contamination. A. hesperidensis, a closely related species of A., is also detected. Therefore, the combination of No. 1 is useful for comprehensively detecting a kind of Alicyclobacillus bacterium which has vanillin assimilation properties and can cause off-flavor.

Industrial applicability

The present invention provides a rapid, simple, and low-cost method for specific detection of Alicyclobacillus bacteria. provide.

In the present invention, since a primer for amplifying a DNA sequence specific to a bacterium of the genus Alicyclobacillus and a probe for specifically labeling the DNA sequence are used, a primer based on a DNA sequence specific to a bacterium of the genus Alicyclobacillus is used. In addition, the bacterium can be specifically detected separately from bacteria of other genera. Therefore, according to the present invention, bacteria of the genus Alicyclobacillus can be detected without being affected by the activity of the bacteria.

[0058] Since the method of the present invention is a method utilizing PCR, even if the amount of Alicyclobacillus bacteria in the test sample is small, it can be detected, and the detection sensitivity is high.

[0059] Further, depending on the combination of the primer and the probe of the present invention, bacteria of the genus Alicyclobacillus having vanillin assimilation may be comprehensively detected, or only Alicyclobacillus acidoterrestris may be specifically (or selectively) detected. can do.

[0060] The method of the present invention does not require time-consuming operations such as cultivation of bacteria or DNA sequencing, so that Alicyclobacillus bacteria can be detected quickly. In addition, the method of the present invention does not require expensive reagents or equipment for sequencing, and can be performed at low cost.

Claims

The scope of the claims

[1] (1) For the test sample, an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A primer set that also has an oligonucleotide having the nucleotide sequence shown in the above, or an oligonucleotide having a nucleotide sequence showing at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 3 and at least 90% of the nucleotide sequence shown in SEQ ID NO: 4 Performing PCR using a primer set consisting of an oligonucleotide having a nucleotide sequence showing identity,

(3) Step of detecting the hybridized product obtained above

A method for specifically detecting Alicyclobadllus bacteria.

[2] (1) For a test sample, a primer set comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 2, or a primer set shown in SEQ ID NO: 3 PCR using an oligonucleotide having a base sequence and an oligonucleotide having a base sequence shown in SEQ ID NO: 4 as a primer set,

(3) Step of detecting the hybridized product obtained above

The method for specifically detecting Alicyclobadllus bacteria according to claim 1, which comprises:

[3] The method for detecting a genus Alicyclobadllus according to claim 1, wherein the probe is immobilized on a solid phase.

[4] Step (3) of immobilizing the Ibridium product on a solid phase prior to the detection step (3)

[5] The method according to claim 1, wherein the bacterium belonging to the genus Alicyclobadllus has vanillin assimilation properties.

[Ri] Alicyclobadllus J¾ Itoda bacterium Alicyclobacillus acidoterrestris Method.

[7] (1 ′) For the test sample, an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 Performing a PCR using a primer set that also has oligonucleotide power having a base sequence showing

(3 ') a step of detecting the above-obtained and hybridized products

Has or

(1 ") For the test sample, an oligonucleotide having a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3 and a nucleotide having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 4 A step of performing PCR using a primer set that also has the ability of an oligonucleotide having a sequence,

(3 ") Step of detecting the hybridized product obtained above

[8] (1 ′) a step of performing PCR on a test sample using a primer set consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 2,

(3 ') a step of detecting the above-obtained and hybridized products

Has or

(1 ") For the test sample, a primer set consisting of an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 4 was prepared. Performing PCR using

(3 ") Step of detecting the hybridized product obtained above

The method for specifically detecting Alicyclobacillus acidoterrestris according to claim 7, wherein the method comprises:

[9] The method for detecting Alicyclobacillus acidote rrestris according to claim 7, wherein the probe is immobilized on a solid phase.

[10] The method for specific detection of Alicyclobacillus acidoterrestris according to claim 7, wherein the method further comprises a step of immobilizing the ribonucleic acid product on a solid phase before the detection step (3 ') or (3 "). .

[11] The method for specific detection of Alicyclobacillus acidoterrestris according to claim 7, wherein the test sample is a food or drink, a cosmetic, a hair care cosmetic, a dental care product, or a raw material thereof.

[12] (1 "') For the test sample, an oligonucleotide having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 Performing a PCR using a primer set that also has oligonucleotide power having a nucleotide sequence showing

(3 "') Step of detecting the hybridized product obtained above

[13] (1 '' ′) a step of performing PCR on a test sample using a primer set consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2,

(3 "') Step of detecting the hybridized product obtained above

13. The method for specifically detecting a bacterium belonging to the genus Alicyclobacillus capable of assimilating vanillin according to claim 12, which comprises:

14. The method for specific detection of a bacterium belonging to the genus Alicyclobadllus assimilating vanillin according to claim 12, wherein the probe is immobilized on a solid phase.

[15] The method of claim 12, further comprising a step of immobilizing the hybridized product on a solid phase prior to the detection step (3 "'). Detection method.

[16] The method for specifically detecting a bacterium belonging to the genus Alicyclobadllus assimilating vanillin according to claim 12, wherein the test sample is a food or drink, a cosmetic, a hair care cosmetic, a dental care product, or a raw material thereof.

[17] An oligonucleotide having a base sequence showing at least 90% identity to the base sequence shown in SEQ ID NO: 1, and an oligonucleotide having a base sequence showing at least 90% identity to the base sequence shown in SEQ ID NO: 2 An oligonucleotide having a nucleotide sequence showing at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 3 and an oligonucleotide having a nucleotide sequence showing at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4 A primer for amplifying a DNA sequence specific to a bacterium of the genus Alicyclobacillus, comprising at least one oligonucleotide selected from the group consisting of:

[18] an oligonucleotide having the base sequence of SEQ ID NO: 1, an oligonucleotide having the base sequence of SEQ ID NO: 2, an oligonucleotide having the base sequence of SEQ ID NO: 3, and an oligonucleotide having the base sequence of SEQ ID NO: 4 18. The primer for amplifying a DNA sequence specific to a bacterium belonging to the genus Alic yclobacillus according to claim 17, wherein the primer comprises at least one oligonucleotide selected from the group consisting of oligonucleotides having a base sequence.

[19] Primer set for amplifying a DNA sequence specific to Alicyclobacillus bacteria of the following (a ') or (b'):

(a ′) an oligonucleotide forward primer having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 2 A primer set having a reverse primer consisting of an oligonucleotide having a base sequence of

(b ′) an oligonucleotide forward primer having a nucleotide sequence showing at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence shown in SEQ ID NO: 4 A primer set having a reverse primer consisting of an oligonucleotide having a nucleotide sequence showing at least 90% identity to a sequence.

[20] A primer set for amplifying a DNA sequence specific to the genus Alicyclobacillus according to claim 19, which is either (a) or (b) below:

[21] A probe for marking a DNA sequence specific to Alicyclobacillus bacteria of the following (c ') or (d'):

[22] A probe for labeling a DNA sequence specific to a bacterium belonging to the genus Alicyclobacillus according to claim 21, which is any of the following (c) or (d):

(d) a probe comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 6.

[23] At least one primer set selected from the group consisting of (a) and (b) described in claim 17 and (a ') and (b') described in claim 18; A reagent for specifically detecting Alicyclobacillus bacteria, comprising at least one probe selected from the group consisting of (c) and (d) described in (1) and (2) and (d ′) described in (2). Kit

[24] an oligonucleotide having the base sequence of SEQ ID NO: 1, an oligonucleotide having the base sequence of SEQ ID NO: 2, an oligonucleotide having the base sequence of SEQ ID NO: 3, and an oligonucleotide having the base sequence of SEQ ID NO: 4 Consists of an oligonucleotide having a base sequence Use of at least one oligonucleotide selected from the group as a primer in PCR for amplifying a DNA sequence specific to Alicyclobacillus bacteria.

[25] Use of the following primer sets (a) or (b) in PCR to amplify DNA sequences specific to Alicyclobacillus bacteria:

[26] Use of the following probes (c) or (d) for labeling a DNA sequence specific to bacteria of the genus Alicyclobacillus:

[27] a primer set having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 1 and a reverse primer having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 2, and SEQ ID NO: 6 Oligonucleotide probe having a base sequence of

A primer set having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 1 and a reverse primer having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 2, and SEQ ID NO: 5 or 6 A probe which is also an oligonucleotide having a base sequence,

For the specific detection of Alicyclobacillus acidoterrestris.

[28] A primer set having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 1 and a reverse primer having an oligonucleotide primer having the nucleotide sequence shown in SEQ ID NO: 2, and SEQ ID NO: 6 Use of a probe consisting of an oligonucleotide having a base sequence to be used for specific detection of Alicyclobacillus bacteria having vanillin assimilation properties.