WO2005116225A1 - Method for introducing and expressing rna in cells - Google Patents

Abstract

The present invention generally relates to a method for introducing RNA molecules into cells, wherein the RNA molecules are capable of being translated in the eukaryotic cells or is an antisense RNA or a catalytic RNA, or where the RNA is reverse transcribed into double-stranded DNA without integrating into chromosomes, or is an antisense RNA or a catalytic RNA, as well as to such bacteria, compositions comprising such bacteria, and nucleic acids that can be introduced into bacteria for practicing the method of the invention. In particular, the present invention provides for the combined methods of transient and receptor-mediated (targeted) delivery of RNA or protein into a cell wherein the RNA molecules are capable of being translated or reverse transcribed without being able to integrate DNA, in the eukaryotic cells or is an antisense RNA or a catalytic RNA. RNA may also be allowed to be converted into DNA that is prevented from integration into the host genome by inhibition or mutation of retroviral integrase activity.

Description

Method for introducing and expressing RNA in cells

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. 119 to United States provisional applications Ser. No. 60/574,245, filed May 25, 2004; Ser. No. 60/574,514, filed May 26, 2004; and Ser. No. 60/586,579, filed My 9, 2004; the disclosures of which are hereby expressly incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

[0002] The present invention generally relates to a method for introducing RNA molecules into cells, wherein the RNA molecules are capable of being translated in the eukaryotic cells or is an antisense RNA or a catalytic RNA, or where the RNA is reverse transcribed into double-stranded DNA without integrating into chromosomes, as well as to such bacteria, compositions comprising such bacteria, and nucleic acids that can be introduced into bacteria for practicing the method of the invention. In particular, the present invention provides for the combined methods of transient and receptor- mediated (targeted) delivery of RNA or protein into a cell wherein the RNA molecules are capable of being translated or reverse transcribed in the eukaryotic cells or is an antisense RNA, a catalytic RNA, or a regulatory site binding RNA.

BACKGROUND OF THE INVENTION

[0003] All retroviruses have a similar structure. Retroviral particles consist of an RNA genome packaged in a protein capsid surrounded by a lipid envelope. The envelope contains polypeptide chains including receptor-binding proteins, which initiate infection following recognition of the protein by the cell's receptor. In addition to RNA, retrovirus particles also contain reverse transcriptase, which synthesizes a complementary DNA molecule (cDNA) using viral RNA as a template. [0004] Upon infection, the retrovirus introduces its RNA into the cytoplasm of a cell along with the reverse transcriptase enzyme. The RNA template is then reverse transcribed into a linear, double stranded cDNA that contains the virus-derived genetic instructions. Integration of the viral DNA into the host cell genome makes the infection permanent. The retrovirus replication strategy is designed for long-term persisting infection since the virus is spread both vertically (from parent cell to daughter cells via the provirus) as well as horizontally (from cell to cell via virions). With the exception of the lentiviruses, retroviruses do not kill the infected cell. The lentiviruses (e.g., HIV-1) are complex retroviruses that have regulatory and structural elements in addition to the standard (gag-pol-env) elements.

[0005] Gene transfer and expression by a retroviral vector is called transduction to distinguish the process from infection due to a replication competent retrovirus (RCR). Mostly, murine and avian retroviruses and more recently also lentiviruses have been used to produce replication defective retroviral vector systems.

[0006] Typically, retroviral vectors are used for protein expression in transduced cells. The simplest vectors use LTRs as promoters. Modification of the enhancer or promoter region has been shown to alter tissue specificity and/or inducibility. In addition, retroviral vector expression can be subject to suppression particularly in undifferentiated embryonic cells.

[0007] Retroviruses have been widely used as gene delivery tools. Because the retroviral genome inserts into the host cell genome following infection, it can be utilized as a permanent gene delivery vehicle. This key characteristic has been maintained in all the different types of replication incompetent viral vectors that have been designed. It allows the viral genome to be maintained for the life of the cell.

[0008] Retrovirus particles range in size from 80-120 nm in diameter and consist of an outer envelope derived from the host cell lipid bilayer and virus encoded proteins. The protein core of the virus consists of viral replication enzymes and the viral RNA genome. The RNA genome is truly diploid and consists of two copies of linear single-stranded (sense) RNA non-covalently linked by a dimerization domain located in the 5' untranslated region of the RNA.

[0009] Retroviruses are released from cells as membrane-coated particles, which enclose two strands of a messenger RNA as their genome (review of the life cycle in Baum et al, 2002; 2003). The uptake of the genomic retroviral mRNA into the particles occurs in the cytoplasm of infected cells and is mediated by a specific packaging signal (Ψ) of the RNA that interacts with the nucleocapsid domain of the retroviral precursor protein called Gag, resulting in self-assembly of particles. Upon budding through the cytoplasmic membrane, virus-encoded Env glycoproteins are incorporated into the membrane surrounding the viral particle.

[0010] Host cell tropism is directed by an interaction of the Env protein with cellular receptors and can be manipulated using different Env proteins, which can be derived from different viruses or expressed as recombinant proteins (pseudotyping). The type of the Env-receptor interaction also determines whether uptake occurs through fusion at the cell membrane or through endocytosis with subsequent release inside the cytoplasm. "Bald" particles lacking Env infect cells with a greatly reduced efficiency (> 4 orders of magnitude loss of infectivity).

[0011] Following uptake, the membrane surrounding the retroviral particle is lost (uncoating) and the retroviral RNA is reverse transcribed into a double- stranded pro viral DNA. This requires the presence of the viral enzyme reverse transcriptase (RT) and a cellular tRNA, which serves as a primer for reverse transcription by hybridizing with the primer binding site (PBS) located near the 5' end of the retroviral RNA. Mutations or deletions in each of these three components (RT, PBS, tRNA primer) are sufficient to completely block reverse transcription (Lund et al, 1997).

[0012] Following reverse transcription, a viral preintegration complex (PIC) is formed which consists of the double-stranded proviral DNA, various cellular proteins, including DNA binding proteins, and the retroviral enzyme Integrase (IN) which is encoded as part of the pol gene that also encodes RT. The PIC is transported along microtubuli structures towards the nuclear membrane (McDonald et al, 2002). PICs of simple retroviruses such as murine leukemia viruses (MLV) are thought to be unable to cross the nuclear membrane and therefore these simple retroviruses depend on mitosis to allow a contact of the PIC with chromosomal DNA. PICs of more complex lentiviruses such as the human immunodeficiency virus (HIV) can be actively transported through an intact nuclear membrane, thus allowing contact to chromosomal DNA even in non-cycling cells (Allies and Naldini, 2002).

[0013] Once active PICs are in contact with chromosomal DNA, the IN enzyme can target cellular DNA and cleave it at any site that is accessible. IN will then join the proviral DNA with the cellular DNA. Finally, cellular DNA repair processes seal the insertion site. The insertion into chromosomal DNA requires IN and a small recognition motif at the end of the retroviral DNA known as att sites. Disabling mutations or deletions of IN or att are sufficient to block retroviral integration (Leavitt et al, 1993; Jonsson et al, 1996; Masuda et ah, 1998; Brown et al, 1999). Unintegrated retroviral DNA forms a circular structure with terminal fusion of the long terminal repeat (LTR) sequences (2-LTR circle), which is mediated by cellular DNA repair enzymes (Li et at, 2001). Also, recombinations between LTR sequences may result in a structure known as 1-LTR circle that is not dependent on cellular repair enzymes. All forms of integrated and unintegrated retroviral DNA can serve as templates for transcription, once they arrive in the nucleus (Poon and Chen, 2003).

[0014] The proviral RNA packaged into retroviral particles is not thought to act as a template for translation prior to formation of the PIC. Translation of retroviral RNA is therefore thought to be dependent on de novo transcription of RNA in retrovirally infected cells (Poon and Chen, 2003).

[0015] Separating the retroviral genes gag-pol and env on two separate plasmids has generated replication-defective retroviral particles that allow stable gene transfer into a target cell without subsequent retroviral replication. In these constructs, the Ψ domain is deleted such that the expressed RNA cannot be incorporated into retroviral particles. The Ψ domain and all other retroviral regulatory elements required for completion of a single round of stable gene transfer are, however, incorporated into the retroviral transgene vector, whose RNA lacks gag-pol or env genes but encodes (an)other cDNA(s) of interest. Retroviral particles allowing stable gene transfer into target cells can be generated with titers in the range of 10⁵-10⁷/ml unconcentrated cellular supernatant. Depending on the type of Env protein expressed, these particles can be further concentrated to titers approaching 10¹⁰/ml (reviewed in Baum et al, 2002; Ailles and Naldini, 2002). For each infectious particle (as defined by the ability for stable gene transfer) up to a hundred-fold excess of defective particles may be contained in retroviral vector preparations. These defective particles may lack a suitable transgene RNA that can be packaged and reverse transcribed or have insufficient amounts of retroviral proteins involved in any of the many steps of the life cycle between cell uptake and chromosomal insertion (McDonald et al, 2002).

When adding high titer supernatants onto cultured target cells, a high multiplicity of infection (MOI) can be achieved per single exposed cell. Because the number of defective particles is difficult to determine, the MOI is calculated on the basis of the number of infectious particles that lead to stable transgene insertion into chromosomes. When increasing the MOI above 1, it can be observed that exposed cells express for a limited period of time low amounts of the protein that is encoded from the retroviral vector RNA. This protein likely stems from the cytoplasmic pool of proteins in the packaging cell, which are more or less accidentally incorporated into the retroviral particles (subsequently addressed as maternal protein). Alternatively, protein may be transiently expressed de novo from unintegrated retroviral RNA or DNA. Typically after a few days of culture, the transduced protein can no longer be detected unless stable transgene insertion has occurred. This phenomenon is named retroviral pseudotransfer or pseudotransduction: the transient transfer of proteins or RNA but not integrated DNA by retroviral particles (Gallardo et al, 1991,' Haas et al, 2000). Retroviral pseudotransfer has been typically considered a disturbing phenomenon in retroviral vector technology, potentially leading to false predictions of the frequency of retroviral gene transfer events (Gallardo et al, 1997; Haas et al, 2000). The present invention now discloses that the retroviral vector preparations can be manipulated such that only retroviral pseudotransfer occurs, without stable transgene insertion, and that this process can lead to rates of protein or transient nucleic acid transfer that are useful for diagnostic or therapeutic cell manipulation.

SUMMARY OF THE INVENTION [0018] The present invention relates to retroviral pseudotransfer (also referred to as pseudotransduction) as a new tool for diagnostic and therapeutic cell manipulation. Previously, either gene transfer or recombinant proteins or cellular conditioned media are used to exert specific functions in cultured cells. Retroviral pseudotransfer has been described previously as a process that may lead to transduction of proteins into target cells, without the transfer of viral DNA that integrates into the target cell genome. However, this process has not been manipulated previously to exert specific biological functions. The present invention shows that recombinant constructs used to express components of the retroviral particle formation process can be manipulated such that partially defective retroviral particles are produced. These are deficient for transgene insertion into cellular chromosomes but capable of transferring active RNA or proteins for efficient transient cell manipulation. The method allows efficient expression of foreign RNA and proteins in cells. It can also be modified to achieve transient delivery of unintegrated DNA. Moreover, it can be used to introduce genome-modifying enzymes that trigger permanent DNA changes. A large number of variations are possible in the transfer of different types of proteins and unintegrated nucleic acids.

[0019] Preferably, the viral vector is one that is defective in its ability to either reverse transcribe its packaged RNA and/or to integrate into the genomic DNA of the recipient cells. In one embodiment, the vector can be one that has the ability to transduce a variety of cell types. In another embodiment, the vector can be one that has the ability to transduce only a very select number of cell types. Preferably, the vector has the ability to express the transduced gene at high levels. Generally, the virus will carry up to 9 kb of foreign gene sequence packaged in the vector. This is adequate for most applications. It is preferred that the virus have the ability to be manufactured in large quantities to meet very stringent safety specifications.

[0020] In one embodiment, the vector is deficient of short, partially inverted repeats at the ends of the LTR that are required for integration into the host genome. In another embodiment, signals for reverse transcription are deleted or defective including the Primer Binding Site (PBS), which binds the tRNA primer, and polypurine tract (PPT) for initiation of first and second strand DNA synthesis, respectively. Alternatively, the processes of reverse transcription and integration can also be specifically inhibited by introducing mutations into the respective proteins of the retroviral particle or by treating target cells with drugs that block these enzymes or their functions.

[0021] Preferably, the vector contains Poly A tracts. For pseudofransduction, a poly A signal can even be inserted upstream of the 3'LTR,a situation that would not be compatible with the formation of an integrating double-stranded DNA.

[0022] In one embodiment, autologous patient cells or allogeneic donor cells are treated in vitro using retroviral pseudofransduction to transfer/express in a transient and reversible form proteins or RNAs that modify the host cell's genome or regulate cellular growth, proliferation, survival, migration or differentiation. After about 1 to about 72 hours after the last retroviral pseudofransduction exposure, cells are frozen, used in other cell manipulation processes or transplanted or injected into the patient.

[0023] In one embodiment, retroviral pseudofransduction is used to express chemokine receptors or integrins, which are involved in cell homing to distinct tissues. This can be of use in cellular therapy of organ damage, such as myocardial infarction, stroke or acute liver failure. Use of suitable (combinations of) molecules which regulate cellular homing into damaged tissues are known in the art.

[0024] In one embodiment, retroviral pseudofransduction is used to express virus receptors to allow for genetic modification of human cells using viruses that otherwise do not enter human cells.

[0025] In another embodiment, retroviral pseudofransduction is used to express growth regulatory molecules for cell expansion in vitro. Often stem cell numbers are limiting in autologous or allogeneic bone marrow transplantation. The result is insufficient reconstitution of major blood cell lineages and weak immunity, sometimes leading to severe complications such as bleeding, anemia, infections, or even promoting tumor relapse. RNAs are readily available which could be expressed using retroviral pseudofransduction including cellular growth stimulating molecules such as HOXB4 or Notch, cellular oncoproteins such as BCR-ABL or AML-ETO, and viral oncoproteins such as the largeT antigen of SV40 tumor virus or El A and E1B of papilloma virus.

[0026] In another embodiment, retroviral pseudotransduction is used to express differentiation-inducing molecules. Some transcription factors direct cell fate decisions and commitment to differentiation into defined cell types. Examples are MyoD or Myf5, which may induce myogenic differentiation of mesodermal progenitor cells in an appropriate cellular and environmental context. Such molecules could be delivered by retroviral pseudotransduction before transplantation of progenitor/stem cells, to enhance the safety and efficiency of organ reconstitution.

[0027] In another embodiment, retroviral pseudotransduction can be used for in vivo delivery of molecules that stimulate cell repair. Stimulation of angiogenesis in infarcted tissues is an example. The molecules to be expressed by retroviral pseudotransduction may be transcription factors or anti-apoptotic proteins involved in regulation of endothelia survival. In another embodiment the molecules to be expressed by retroviral pseudotransduction may be DNA repair proteins such as those selected from the group consisting of hAPE, APN-1, NTG-1, NTG-2, SCR-1, SCR-2, exoIII, endoIV, endoIII, hMPG, fpg, dS3, .beta.-ρolymerase, DNA ligase, HAAG, OGGl and hMGMT. In another embodiment the molecules to be expressed by retroviral pseudotransduction may be a hormone, an enzyme, a receptor, a post-receptor signal transmitter, a transcription factor, an endonuclease, or a recombinase.

[0028] In another embodiment, retroviral pseudotransduction can be used for inhibition of cell growth in vivo, e.g., by delivering molecules that induce apoptosis.

[0029] In another embodiment, retroviral pseudotransduction can be elaborated as a new form of vaccination. Defined cancer antigens or antigens of known viral, bacterial or parasitic pathogens could be delivered into and expressed in antigen-presenting cells. For this application, antigen-presenting cells will be either cultivated in vitro and reinfused after retroviral pseudotransduction or retroviral pseudotransduction will be directly used in vivo, as with other types of vaccines.

In another embodiment, retroviral pseudotransduction can be adapted to develop new forms of targeted gene delivery. Using retroviral pseudotransduction, a recombinase or integrase can be expressed which directs sequence-specific recombination, as we have shown for Cre. Where a DNA is co-delivered (either using a modification of retroviral pseudotransduction or any other transfection approach) that is designed to allow recognition by the retroviral pseudotransduction-delivered recombinase/integrase, insertion-site specific gene delivery results.

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings incorporated in and forming a part of the specification illustrate several aspects of the present invention, and together with the description serve to explain the principles of the invention, the drawings:

[0032] FIG. 1. Retroviral Cre expression vectors used in this study. SF91 contains all cis-elements required for reverse transcription and integration. Mutant dU5 lacks the att signal required for integration, dPBS lacks the PBS required for reverse transcription, and aPBS contains a defective PBS. Vectors were cloned expressing either EGFP or nlsCRE.

[0033] FIG. 2. Stable retroviral transduction and pseudotransduction. While the intact retroviral vector SF91-EGFP mediates highly efficient stable gene fransfer of EGFP (A), mutants aPBS (B), dPBS (C) and dU5 (D) show a greatly reduced incidence of stable EGFP transduction. NIH3T3 cells were analyzed 5 days after exposure to particles. (E) Pseudotransduction generates detectable levels of EGFP expression between 5h and 13h after exposure of cells to retroviral particles, both with aPBS-EGFP and SF91-EGFP. Subsequently, EGFP expression rises significantly only when using an intact retroviral vector (SF91-EGFP), reflecting de novo synthesis of mRNA after integration of the proviral DNA. In contrast, cells exposed to aPBS-EGFP return to baseline levels of control cells after about 40 hrs (mock treated or transduced with SF91HygR).

[0034] FIG. 3. (A). Cre expression mediated by pseudotransduction depends on the amount of producer cell supernatant; (B). Cre activity mediates a switch from red to green fluorescence in Sc-1 cells containing the Cre reporter allele SFr-2; (C). The percentage of reporter cells modified by Cre-mediated recombination can be clearly defined by flow cytometry. Treatment of reporter cells with supernatants containing either the integrating vector SF91 -nlsCre or the mutants aPBS-nlsCre, dPBS-nlsCre or dU5-nlsCre resulted in highly efficient, dose dependent recombination. [0035] FIG. 4. (A). Cre expression mediated by pseudotransduction is transient and avoids toxic side effects. (B). Permanent expression of Cre by the integrating vector SF91 -nlsCre leads to a competitive growth disadvantage of EGFP+ Cre+ cells during 22 days of culture in three independent experiments. No such effect is seen with mutant aPBS-nlsCre, despite the high initial efficiency of Cre expression. For each vector, three independent experiments were performed.

[0036] FIG. 5. Pseudotransduction is receptor-mediated and allows targeting of distinct cells in a mixed population. Human HT1080 and murine Sc-1 cells containing the Cre-reporter allele SFr-2 were mixed and transduced using either ecotropic (middle panel) or RDl 14 pseudotyped particles (lower panel) containing either the integrating SF91-nlsCre or mutant aPBS-nlsCre vectors. EGFP expression "induced" by Cre activity is strictly dependent on the tropism of the envelope protein. Flow cytometry was performed 4 days after exposure to particles. The mixed cell population was stained with anti human HLA antibody to identify the HT1080 subpopulation. Similar results were achieved when increasing the frequency of human cells (data not shown). Targeting is independent of the type of expression vector used (SF91 -nlsCre, aPBS-nlsCre or dPBS-nlsCre (not shown). The different efficiencies reflect variations in vector preparations.

[0037] Fig. 6. Correction of the Fanconi phenotype of human FANCC deficient fibroblasts by a pseudotransduction FANCC vector. (A-D) Cell cycle analysis of a FANCC deficient fibroblasts line. Exponentially growing cells were treated with an integrating (C) or a pseudotransduction (D) FANCC-encoding retrovirus vector. Four hours later, Melphalan (MEL) was added to a final concentration of 0.2 μg/ml (B-D). After 48 hrs, typically more than 30% of Fanconi deficient cells were arrested in the G2/M phase of the cell cycle (B). As expected, correction of the FANCC deficiency by an integrating FANCC expressing vector resulted in a complete reversal of the arrest (C). Interestingly, also the pseudotransduction vector SF91aPBS-FANCC was almost completely reversing the cell cycle arrest caused by the drug (D), indicating that the transient expression was providing sufficient amounts of FANCC to maintain a normal cell cycle progression. The DNA was stained with propidium iodide for cell cycle analysis using conventional flow cytometry protocols.

In the following description of the illustrated embodiments, references are made to the accompanying drawings, which form a part hereof, and in which is shown by way of illustration various embodiments in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural and functional changes may be made without departing from the scope of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

[0039] Before the present proteins, nucleotide sequences, and methods are described, it is understood that this invention is not limited to the particular methodology, protocols, cell lines, vectors, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention that will be limited only by the appended claims.

[0040] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a host cell" includes a plurality of such host cells.

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All references, publications, patents, patent applications, and commercial materials mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and methodologies which are reported in the publications which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:

[0042] The term "antisense", as used herein, refers to nucleotide sequences that are complementary to a specific DNA or RNA sequence. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense" strand. Antisense molecules may be produced by any method, including synthesis by ligating the gene(s) of interest in a reverse orientation to a viral promoter, which permits the synthesis of a complementary strand. Once introduced into a cell, this transcribed strand combines with natural sequences produced by the cell to form duplexes. These duplexes then block either the further transcription or translation. In this manner, mutant phenotypes may be generated. The designation "negative" is sometimes used in reference to the antisense strand, and "positive" is sometimes used in reference to the sense strand.

[0043] As used herein, an "apoptosis-inducing protein" means a protein which, when expressed in a cell, causes the cell to begin, accelerate, or continue the process of programmed cell death, which is characterized by the fragmentation of the cell into membrane-bound particles that are subsequently eliminated by the process of phagocytosis.

[0044] "Biological activity" or "bioactivity" or "activity" or "biological function", which are used interchangeably, for the purposes herein means a function that is directly or indirectly performed by a polypeptide (whether in its native or denatured conformation), or by any subsequence thereof.

[0045] "Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN, polyethylene glycol (PEG), and PLURONICS.

[0046] "Cells", "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0047] A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a derivative of a primary cell culture that is capable of stable growth in vitro for many generations.

[0048] A "coding sequence" or a "nucleotide sequence encoding" a particular protein, is a sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

[0049] The terms "complementary" or "complementarity", as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing. For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". Complementarity between two single- stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands.

[0050] DNA "control sequences" refer collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, which collectively provide for the transcription and translation of a coding sequence in a host cell.

[0051] "Deoxyribonucleic Acid (DNA)" is the molecular basis of heredity. DNA consists of a polysugar-phosphate backbone from which the purines and pyrimidines project. Bonds between the phosphate molecule and carbon 3 and carbon 5 of adjacent deoxyribose molecules form the backbone. The nitrogenous base extends from carbon 1 of each sugar. According to the Watson-Crick model, DNA forms a double helix that is held together by hydrogen bonds between specific pairs of bases (thymine to adenine and cytosine to guanine). Each strand in the double helix is complementary to its partner strand in terms of its base sequence.

[0052] The term "derivative", as used herein, refers to the chemical modification of a nucleic acid. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative would encode a polypeptide, which retains essential biological characteristics of the natural molecule.

[0053] A "DNA or RNA construct" is a DNA or RNA molecule, or a clone of such a molecule, either single- or double-stranded that has been modified through human intervention to contain segments of DNA or RNA combined and juxtaposed in a manner that as a whole would not otherwise exist in nature. As is well known, genes may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which still code for polypeptides having substantially the same activity.

[0054] An "effective amount" or "therapeutically effective amount" of an active agent disclosed herein is an amount capable of modulating, to some extent, the activity of a target cell and preferably is an amount capable of modulating, to some extent, the growth or activity of a target cell.

[0055] The term "encoding" refers generally to the sequence information being present in a translatable form, usually operably linked to a promoter. A sequence is operably linked to a promoter when the functional promoter enhances transcription or expression of that sequence. An anti-sense strand is considered to also encode the sequence, since the same informational content is present in a readily accessible form, especially when linked to a sequence that promotes expression of the sense strand. The information is convertible using the standard, or a modified, genetic code. See, e.g., Watson et al, (1987) The Molecular Biology of the Gene (4th ed.) vols. 1&2, Benjamin, Menlo Park, Calif.

[0056] As used herein, "expression control sequence" refers to a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed. Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding the desired heterologous protein. The 3' untranslated regions also include transcription termination sites.

[0057] The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as intervening sequences (introns) between individual coding segments (exons).

[0058] The phrases "gene amplification" and "gene duplication" are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as "amplicon." Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed. [0059] A "host cell" is a cell that has been transformed, or is capable of transformation, by an exogenous DNA or RNA sequence.

[0060] The term "hybridization", as used herein, refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.

[0061] The term "hybridization complex", as used herein, refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration.

[0062] By "induction of neovascularization" is meant that angio genesis is either initiated or enhanced. Therefore, for example, when neovascularization is not occurring, the present method provides for initiation of neovascularization. However, if neovascularization is already present, the present method provides a means by which the level of neovascularization is enhanced or heightened. When induction of neovascularization is desired, the angio genesis-modulation factor is an angiogenesis-promoting factor, e.g., a gene product that aids in the formation and/or quality of new blood vessels. Preferably, a greater degree of neovascularization is induced by the present inventive method compared to neovascularization resulting from administration of one of the nucleic acid sequences alone.

[0063] The term "intron" identifies an intervening sequence within a gene for the gene product that does not constitute protein-coding sequences. In eukaryotic cells introns are removed from the primary RNA transcript to produce the mature mRNA.

[0064] An "isolated" nucleic acid is a nucleic acid, e.g. , an RNA, DNA, or a mixed polymer, which is substantially separated from other DNA sequences which naturally accompany a native human sequence, e.g., ribosomes, polymerases, and many other human genome sequences. The term embraces a nucleic acid sequence that has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule includes isolated forms of the molecule. An isolated nucleic acid will generally be a homogenous composition of molecules, but will, in some embodiments, contain minor heterogeneity. This heterogeneity is typically found at the polymer ends or portions not critical to a desired biological function or activity.

[0065] The word "label" when used herein refers to a detectable compound or composition that is conjugated directly or indirectly to the peptide or nucleotide so as to generate a "labeled" entity. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition, which is detectable.

[0066] "Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments. Unless otherwise provided, ligation is accomplished using known buffers and conditions with T4 DNA ligase ("ligase") and approximately equimolar amounts of the DNA fragments to be ligated.

[0067] "Mammal" or "subject" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is human.

[0068] The term "marker" or "marker sequence" or similar phrase means any gene that produces a selectable genotype or preferably a selectable phenotype. It includes such examples as the neo gene, green fluorescent protein (GFP) gene, TK gene, β-galactosidase gene, etc. The marker sequence may be any sequence known to those skilled in the art that serves these purposes, although typically the marker sequence will be a sequence encoding a protein that confers a selectable trait, such as an antibiotic resistance gene, or an enzyme that can be detected and that is not typically found in the cell. The marker sequence may also include regulatory regions such as a promoter or enhancer that regulates the expression of that protein. However, it is also possible to transcribe the marker using endogenous regulatory sequences. In one embodiment of the present invention, the marker facilitates separation of transfected from unfransfected cells by fluorescence activated cell sorting, for example by the use of a fluorescently labeled antibody or the expression of a fluorescent protein such as GFP. Other DNA sequences that facilitate expression of marker genes may also be incorporated into the DNA constructs of the present invention. These sequences include, but are not limited to transcription initiation and termination signals, translation signals, posttranslational modification signals, intron splicing junctions, ribosome binding sites, and polyadenylation signals, to name a few. The marker sequence may also be used to append sequence to the target gene. For example, it may be used to add a stop codon to truncate translation.

[0069] As used herein, "nucleotide sequence", "nucleic acid sequence", "nucleic acid" or "polynucleotide" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally-occurring nucleotides. Nucleic acid sequences can be, e.g., prokaryotic sequences, eukaryotic mRNA sequences, cDNA sequences from eukaryotic mRNA, genomic DNA sequences from eukaryotic DNA (e.g., mammalian DNA), and synthetic DNA or RNA sequences, but are not limited thereto.

[0070] "Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands, which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

[0071] The term "open reading frame" refers to a nucleotide sequence with the potential for encoding a protein. [0072] "Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression.

[0073] The term "polypeptide" refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide. This term also does not exclude modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring.

[0074] A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bound at the 3' terminus by the translation start codon (ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

[0075] The term "protein" is used herein to designate a naturally occurring polypeptide. The term "polypeptide" is used in its broadest sense, i.e., any polymer of amino acids (dipeptide or greater) linked through peptide bonds. Thus, the term "polypeptide" includes proteins, oligopeptides, protein fragments, analogs, muteins, fusion proteins and the like. "Native" proteins or polypeptides refer to proteins or polypeptides recovered from a source occurring in nature. The terms "protein", "polypeptide" and "peptide" are used interchangeably herein when referring to a gene product. "Protein modifications or fragments" are provided by the present invention for polypeptides or fragments thereof which are substantially homologous to primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as 32P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods of labeling polypeptides are well known in the art. Besides substantially full-length polypeptides, the present invention provides for biologically active fragments of the polypeptides or modifications of the polypeptides that could improve efficacy. Significant biological activities include ligand-binding, immunological activity and other biological activities characteristic of polypeptides.

The term "recombinant" refers to a nucleic acid sequence that is not naturally occurring, or is made by the artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a single genetic entity comprising a desired combination of functions not found in the common natural forms. Restriction enzyme recognition sites are often the target of such artificial manipulations, but other site-specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design. A similar concept is intended for a recombinant, e.g., fusion, polypeptide.

[0077] "Regulatory sequences" refers to those sequences normally within 100 kb of the coding region of a locus, but they may also be more distant from the coding region, which affect the expression of the gene (including transcription of the gene, and translation, splicing, stability or the like of the messenger RNA).

[0078] "Retroviruses" are RNA viruses wherein the viral genome is RNA. When a host cell is infected with a retrovirus, the genomic RNA is reverse transcribed into a DNA intermediate that is integrated very efficiently into the chromosomal DNA of infected cells. The integrated DNA intermediate is referred to as a pro virus. The family Retro viridae are enveloped single- stranded RNA viruses that typically infect mammals, such as, for example, bovines, monkeys, sheep, and humans, as well as avian species. Retroviruses are unique among RNA viruses in that their multiplication involves the synthesis of a DNA copy of the RNA that is then integrated into the genome of the infected cell. Retroviruses are defined by the way in which they replicate their genetic material. During replication the RNA is converted into DNA. Following infection of the cell a double-stranded molecule of DNA is generated from the two molecules of RNA that are carried in the viral particle by the molecular process known as reverse transcription. The DNA form becomes covalently integrated in the host cell genome as a provirus, from which viral RNAs are expressed with the aid of cellular and/or viral factors. The expressed viral RNAs are packaged into particles and released as infectious virion.

[0079] As used herein, a "retroviral transfer vector" refers to the expression vector that comprises a nucleotide sequence that encodes a transgene and that further comprises nucleotide sequences necessary for packaging of the vector. Preferably, the retroviral transfer vector also comprises the necessary sequences for expressing the transgene in cells. Expression vectors may contain a selection gene, also termed a selectable marker. A selection gene encodes a protein, sometimes referred to as a secondary protein, necessary for the survival or growth of a host cell transformed with the vector. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line that lacks the ability to grow independent of a supplemented media. Therefore, direct selection of those cells requires cell growth in the absence of supplemental nutrients. The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells that have a novel gene would express a protein conveying drug resistance and would survive the selection.

[0080] The term "signal peptide" refers to any peptide sequence that directs a polypeptide to which it is attached to a target cell and, preferably, directs its transport across the cell membrane. An "importation competent signal peptide sequence" is one that remains competent to translocate the attached peptide sequence across a cellular membrane.

[0081] As used herein, "transgene" refers to a polynucleotide that can be expressed, via recombinant techniques, in a non-native environment or heterologous cell under appropriate conditions. The transgene may be derived from the same type of cell in which it is to be expressed, but introduced from an exogenous source, modified as compared to a corresponding native form and/or expressed from a non-native site, or it may be derived from a heterologous cell. "Transgene" is synonymous with "exogenous gene", "foreign gene" and "heterologous gene".

[0082] As used herein, a "therapeutic" gene refers to a gene that, when expressed, confers a beneficial effect on the cell or tissue in which it is present, or on a mammal in which the gene is expressed. Examples of beneficial effects include amelioration of a sign or symptom of a condition or disease, prevention or inhibition of a condition or disease, or conferral of a desired characteristic. Therapeutic genes include genes that correct a genetic deficiency in a cell or mammal.

[0083] As used herein, a "therapeutically acceptable amount" of a substance refers to a sufficient quantity of the substance that an amelioration of adverse symptoms or protection against adverse symptoms can be detected in a subject treated with the substance.

[0084] "Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably-linked. In preferred embodiments, transcription of one of the genes is under the control of a promoter sequence (or other transcriptional regulatory sequence) that controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences that control transcription of the naturally-occurring forms of a polypeptide.

[0085] "Transfection" refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaPO and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell. However, in the context of the present invention successful transfection refers to stable continuous expression of a desired heterologous protein by a host culture over numerous generations.

[0086] "Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an exfrachromosomal element or by chromosomal integration. Unless otherwise provided, the method used herein for fransformation of the host cells is the method of Graham, F. and van der Eb, A., Virology 52, 456-457 (1973). Host cells may be transformed with the expression vectors of the instant invention and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

[0087] "Transient expression" refers to unamplified expression using the method of the instant invention within about one hour to about four weeks of transfection, preferably from about 2 hours to two weeks, more preferably from 4 hours to 72 hours of transfection. The optimal time for transient expression of a particular desired heterologous protein may vary depending on several factors including, for example, the particular desired heterologous protein, the transacting protein, the translational control effector and the host cell. Transient expression occurs when the particular plasmid that has been transfected functions, i.e., is transcribed and translated to produce the desired protein. During this time, the plasmid DNA that has entered the cell is transferred to the nucleus. The DNA is in a nonintegrated state, free within the nucleus. Transcription of the plasmid taken up by the cell occurs during this period. Vectors, which were identified as capable of producing the desired heterologous protein transiently, may then be used to establish a stable continuous production cell. Transient expression refers to a short period following transfection that is about one day to about two weeks, preferably one day to about seven days and most preferably from about one day to about four days, although this may vary depending on the factors discussed above. Following transfection the plasmid DNA may become degraded or diluted by cell division. Random integration within the cell chromatin occurs. Transient expression in accord with the invention produces transformed cells with stable transfected DNA capable of producing usable amounts of a desired protein.

[0088] The term "treating" as used herein is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease. "Treatment" is an intervention performed with the intention of preventing the development or altering the pathology of a disorder. Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Generally, "treatment" means the alleviation of the symptoms of an airway obstructive disease and/or preservation of lung function and/or the general improvement in the patient's perceived quality of life as regards the disease conditions and symptoms.

[0089] The term "upsfream" identifies sequences proceeding in the opposite direction from expression; for example, the bacterial promoter is upstream from the transcription unit.

[0090] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops that, in their vector form are not bound to the chromosome. The invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.

[0091] As used herein, "vector particle", "retroviral particle", "viral particle", "retroviral vector particle" refers to a replication-defective retrovirus carrying an RNA transcribed from a retroviral vector of the present invention. Preferably, the RNA comprises a transgene sequence (transgene RNA) transcribed from a retroviral transfer vector of the present invention.

[0092] It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The present invention provides a recombinant retrovirus capable of infecting targeted cells. The virus is useful for the in vivo and ex vivo transfer and expression of genes and nucleic acid sequences (e.g., in dividing and non- dividing cells). In particular, the present retroviral vectors are useful in targeting specific cell types including, but not limited to, neoplastic cells or cells having cell-proliferative disorders.

[0093] The present invention has many utilities. For example, the retrovirus and methods of the present invention can be used to provide a therapeutic product to a subject, for providing gene delivery of a non-therapeutic protein or a therapeutic protein to a subject, as well as in in vitro studies to provide a cell with a gene for expression of a gene product. Such in vitro methods are useful, for example, in protein production and the study of regulation and interaction of cis-acting products, and polypeptides.

[0094] The present invention relates to retroviral pseudotransfer as a new tool for diagnostic and therapeutic cell manipulation. Previously, either gene transfer or recombinant proteins or cellular conditioned media are used to exert specific functions in cultured cells. Retroviral pseudotransfer has been described previously as a process that may lead to fransduction of proteins into target cells, without the transfer of viral DNA that integrates into the target cell genome. However, this process has not been manipulated previously to exert specific biological functions. The present invention shows that recombinant constructs used to express components of the retroviral particle formation process can be manipulated such that partially defective retroviral particles are produced. These are deficient for transgene insertion into cellular chromosomes but capable of transferring active RNA or proteins for efficient transient cell manipulation. The method allows efficient expression of foreign RNA or proteins in cells. It can also be used to induce permanent DNA changes. A large number of variations are possible the transfer of different types of proteins and even unintegrated nucleic acids.

[0095] Preferably, the viral vector is one that is defective in its ability to integrate into the genomic DNA of the recipient cells or defective to generate DNA by reverse transcription of RNA. In one embodiment, the vector can be one that has the ability to transduce a variety of cell types. In another embodiment, the vector can be one that has the ability to transduce only a very select number of cell types. Generally, the virus will carry up to 9 kb of foreign gene sequence packaged in the vector. This is adequate for most applications. It is preferred that the viruses have the ability to be manufactured in large quantities to meet very stringent safety specifications.

[0096] To ensure that replication competent viruses are not produced, the essential viral genes gag, pol and env can be supplied in trans through the use of packaging cells; thus minimizing the chance that replication competent virus could be produced. For the purpose of retroviral pseudotransfer, either the entire pol gene or parts thereof (encoding reverse transcriptase or integrase) can be deleted or rendered inactive by mutation. There are various packaging cell lines and packaging plasmids that encode gag, pol or env as non-retroviral expression cassettes, available commercially and through research collaborations, that can be used to generate retroviruses that are suitable for use with a target cell of interest. The choice of packaging cells and packaging plasmids depends on the host range, or tropism, of the desired virus. The host range of retroviruses has been expanded by pseudotyping the vectors with heterologous viral glycoproteins and receptor-specific ligands. This is possible because one species of retrovirus is capable of incorporating the envelope from another species or type of retrovirus. Therefore, the envelope protein can be provided in trans so that the virus produced can infect cells based on the tropism of that envelope protein.

[0097] A retroviral vector will preferably include the 5 ' and 3 ' LTR regions that provide the function of promoter and poly A signal, respectively. It is, however, necessary to include one or more defects in the vector to prevent integration. Therefore, the entire 3 'LTR or parts thereof can be deleted and replaced by other viral or cellular termination and pol A signals. Moreover, the inverted repeats of the U5 region of the 5'LTR and other elements that are required for either reverse transcription (such as PBS or PPT) or integration can be deleted.

[0098] In one embodiment, the vector is deficient of short, partially inverted repeats at the ends of the LTR that are required for integration into the host genome. In another embodiment, signals for reverse transcription are deleted or defective including the Primer Binding Site (PBS), which binds the tRNA primer, and polypurine tract (PPT) for initiation of first and second strand DNA synthesis, respectively.

[0099] There are limitations on the insert size that can be used successfully with currently available retroviral vectors, but most cDNA sequences are accommodated by those limits. Preferably, the size of the insert will remain at or below the size of the wild-type virus (about 10 kb, LTR to LTR). However, it is well possible that pseudotransfer allows the use of even larger RNA molecules.

[00100] In a preferred embodiment, the vector will contain a double mutant. That is, the vector will be defective in two ways to prevent a back mutation in the vector.

[00101] The double mutation will preferably contain (1) a mutation selected from a deleted or defective integrase or reverse transcriptase gene and (2) a defect in the sequence itself, either at the primer binding site (PBS) or the cell core attachment signal, since these required for reverse transcription to start.

[00102] A third level of protection can be added by blocking the activity of the enzymes in the target cells by chemical means through the use of integrase or reverse franscriptase inhibitors used in cell culture or in systemic drug therapy to the target cells in order to add a further layer of protection to the viral therapy.

[00103] The present invention provides for retroviral pseudotransfer methods for transient delivery of biologically active proteins into target cells. The production process for retroviral vectors can be manipulated to exclusively generate integration-defective particles.

[00104] The present invention also provides for the use of retroviral pseudofransfer for transient and reversible delivery of biologically active proteins into target cells; the use of this technology for diagnostic or therapeutic cell manipulation, using either a recombinase or related endonuclease, or any other type of nuclear localizing protein (such as transcription factors), or any type of cytoplasmic protein or any type of transmembrane protein; the introduction of mutations into retroviral vector plasmids or into expression vectors for retroviral proteins to generate exclusively integration-defective particles; the application of this method with any type of retroviral vector (including lentiviral vectors); the development of novel gene transfer methods, using other types of endonucleases or recombinases; and the use of retroviral pseudotransfer for in vivo cell manipulation.

[00105] Transient gene expression, according to the present invention, is by gene transfer to introduce DNA sequences into the nucleus in an unintegrated form. The transient, nonintegrated expression is limited by the stability of the nonintegrated DNA molecule(s) and may persist for extended periods of time, but rarely persists for periods longer than about one to three weeks. Preferably, expression is from about 1 to about 72 hours.

[00106] Transient transfection is measured 1 to approximately 72 hours after transfection by assays that measure gene expression of the transfected gene(s). Commonly used assays monitor enzyme activities of chloramphenicol acetyltransferase (CAT), LAC-Z, enhanced green fluorescent protein (EGFP), beta-galactosidase, luciferase, or human growth hormone that can be contained in the constructs.

[00107] According to the present invention, conditions are established for achieving recombinant gene expression in a majority of the cells cultured in vitro or of the target organ to be modified in vivo.

[00108] • Transient expression of genes administered in vivo is viewed in the art as a major technical limitation to gene therapy. In contrast, according to the present invention transient expression of the genes is highly desirable because expression is needed only for a limited period of therapy; thereafter, rapid clearance of the gene product is desirable. Transient expression is desirable to avoid toxic side effects of constitutive over-expression, and to allow cells to express their original phenotype after the effects of the transferred nucleic acids and/or proteins are no longer needed. E.g., transient expression is of interest to modify cell migration, to induce differentiation, to introduce a reversible growth advantage, or to modify the genome of target cells using integrases or recombinases.

[00109] Also, clearing of the transgene and its vector may be clinically desirable after delivery of cells back into the organism, to avoid potential short-term and long-term side effects of transgene insertion and/or expression.

[00110] The methods of the present invention are designed to result in transient, nonintegrated expression of an exogenous gene in vivo. Transient expression can be achieved by directed introduction of the genetic material encoding the desired proteins into cells or by use of a heterologous virus genome as a vector. Methods for delivering genes into mammalian cells to provide transient expression that can be utilized for gene therapy include: papovaviruses, adenovirus, vaccinia virus, herpesviruses, poxviruses, polio virus, sindbis and other RNA viruses, ligand-DNA conjugates, adenovirus- ligand-DNA conjugates, naked DNA, lipofection and receptor-mediated gene transfer. See, e.g., Mulligan, supra. Coen in VIROLOGY, Fields et al. (eds.) Raven Press, Ltd., (New York, 1990); Ferkol et a , FASEB 7: 1081 (1993). Animal model studies have efficiently transferred genes using retroviruses (Friedmann, Science 244: 1275 (1989)), adenovimses (Rosenfeld et al, Science 252: 431 (1991); Rosenfeld et al, Cell 68: 143 (1992)) and liposomes (Feigner et al, Nature 349: 351 (1991). Preferably, transfer retroviruses are utilized in the present invention. More preferably, other viruses could be chosen that utilize plus stranded RNA genomes, e.g., picornaviridae, flaviviridae, togaviridae, coronaviridae, artiviridae, caliciviridae and hepatitis- E-viridae.

[00111] Retroviruses belong to the family of viruses called Retroviridae. The Retroviridae family includes various species, such as Alpharetrovirus, Avian type C retroviruses, Betarefrovirus, Deltaretrovirus, Epsilonretrovirus, Gammaretrovirus, Intracisternal A-particles, Lentivirus, Mammalian type C retroviruses, Spumavirus, Type D retroviruses, and unclassified Retroviridae. [00112] Retroviruses are defined by the way in which they replicate their genetic material. During replication the RNA is converted into DNA. Following infection of the cell a double-stranded molecule of DNA is generated from the two molecules of RNA that are carried in the viral particle by the molecular process known as reverse transcription. Through the action of the retroviral Integrase, the DNA form becomes covalently integrated in the host cell genome as a provirus, from which viral RNAs are expressed with the aid of cellular and/or viral factors. The expressed viral RNAs are packaged into particles and released as infectious virion. After reverse transcription and nuclear transport of the retroviral DNA and before integration, the retroviral genome can be detected in target cells as unintegrated DNA. Gene expression may already occur from these unintegrated fonns.

[00113] The retrovirus particle is composed of two identical RNA molecules. Each wild-type genome has a positive sense, single-stranded RNA molecule, which is capped at the 5' end and polyadenylated at the 3' tail. The diploid virus particle contains the two RNA strands complexed with gag proteins, viral enzymes (pol gene products) and host tRNA molecules within a core^Λ structure of gag proteins. Surrounding and protecting this capsid is a lipid bilayer, derived from host cell membranes and containing viral envelope (env) proteins. The env proteins bind to a cellular receptor for the virus and the particle typically enters the host cell via receptor-mediated endocytosis and/or membrane fusion.

[00114] Viral RNA is copied into DNA by reverse transcription. This is catalyzed by the reverse transcriptase enzyme encoded by the pol region and uses the host cell tRNA packaged into the virion as a primer for DNA synthesis. In this way the RNA genome is converted into a hybrid RNA/DNA molecule (first strand DNA synthesis). Second strand synthesis requires priming of reverse transcription at the poly purine tract (PPT) which is located 5' of the 3 'LTR. Lentiviruses contain a second PPT in their pol gene region. This so-called central PPT can also be introduced infro retroviral vectors to promote reverse transcription. [00115] The double-stranded linear DNA produced by reverse transcription may, or may not, have to be circularized in the nucleus. The provirus now has two identical repeats at either end, known as the long terminal repeats (LTR). The termini of the two LTR sequences produces the site recognized by a pol product—the integrase protein— which catalyzes integration, such that the provirus is always joined to host DNA two base pairs (bp) from the ends of the LTRs. A duplication of cellular sequences is seen at the ends of both LTRs, reminiscent of the integration pattern of transposable genetic elements. Integration is thought to occur essentially at random within the target cell genome. However, by modifying the long-terminal repeats it is possible to control the integration of a retroviral genome.

[00116] Transcription, RNA splicing and translation of the integrated viral DNA is mediated by host cell proteins. Variously spliced transcripts are generated. In the case of the human retroviruses HIV- 1/2 and HTLV-I/II viral proteins are also used to regulate gene expression. The interplay between cellular and viral factors is important in the control of virus latency and the temporal sequence in which viral genes are expressed.

[00117] An LTR is composed of three elements made up of U3, R and U5 regions. U3 includes most of the transcriptional control elements and carries the promoter/enhancer sequence. R region is usually a short (18-250 nucleotide) sequence that provides the sequence homology for strand transfer during reverse transcription of the RNA genome. Both U3 and U5 regions contain the Att sites required for integration.

[00118] The retroviral genome includes - a "Leader": A relatively long (90-500 nucleotides) non-translated region downstream of the transcription start site present at the 5' end of all virus mRNAs.

[00119] Gag (Group specific Antigens) is the precursor to the internal structure of the retrovirus also known as the "core." It gives rise to four different polypeptides. The three common to all retroviruses are - CA (capsid) is the largest protein composed of 200-270 amino acids. It contains the major Homology Region (MHR) that is a 20 amino acid segment that is highly conserved between different retroviruses. 11. MA (matrix), derived from the amino terminus of the Gag gene, is a membrane associated protein. HI. NC (Nucleocapsid) is a 60-90 amino acid protein that binds the viral RNA.

[00120] Pol gives rise to three polypeptides: the protease, the reverse transcriptase (with RNase H activity) and integrase. Env gives rise to two polypeptides: the transmembrane 'spike' protein (gp41 in HIV) and the knob-like surface protein gpl20. These proteins are initially inserted into the host cell membrane and are acquired by the virus particle at a later stage during budding.

[00121] There are various packaging cell lines or plasmids encoding retroviral proteins available that can be used to generate retroviruses that are suitable for a target cell of interest. The choice of packaging cells depends on the desired host range, or tropism, of the virus. Tropism refers to the host range of a particular virus. For infection, retroviruses require specific cell surface molecules to interact with a protein on the surface of the viral particle. This interaction is highly specific, and determines both the host range, tissue specificity and the pathogenicity of the virus.

[00122] The key factor in using a retrovirus as a gene delivery vehicle is biosafety. The main goal of the vector design is to ensure that a replication incompetent virus is generated. Separation of the packaging function from the genetic material to be transferred makes this possible. Traditionally, a basic retroviral vector contains the cw-acting elements required for a single replication as a virus, but lacks some or all of the viral genes, which are replaced by foreign coding sequences. For a retroviral vector to replicate as a virus, it is necessary to provide the missing viral gene(s) in trans. The refroviral genes can be expressed from recombinant, stably integrated or transiently transfected expression cassettes. [00123] Historically, replication-competent helper virus was used to package both vector virus and helper virus. In a more refined approach, used currently, specially-engineered cell lines that express the viral genes from heterologous promoters are used to produce vector virus. These genetically-engineered cell lines are called packaging or helper cell lines, irrespective of the transient or stable presence of the expression cassettes that encode the retroviral proteins.

[00124] The techniques used to construct vectors, and transfect and infect cells, are widely practiced in the art, and most practitioners are familiar with the standard resource materials that describe specific conditions and procedures. However, for convenience, the following paragraphs may serve as a guideline.

[00125] Construction of the vectors of the invention employs standard ligation and restriction techniques that are well understood in the art (see Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1982)). Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired.

[00126] Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions that are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. (See, e.g. New England Biolabs, Product Catalog.) In general, about lμg of plasmid or DNA sequences is cleaved by one unit of enzyme in about 20 μl of buffer solution. Typically, an excess of restriction enzyme is used to insure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37°C are workable, although variations can be tolerated. After each incubation, protein is removed by extraction with phenol/chloroform, and may be followed by ether extraction, and the nucleic acid recovered from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods of Enzymology 65:499-560 (1980). [00127] Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20°C in 50 mM Tris (pH 7.6) 50 mM NaCl, 6 mM MgCl₂, 6 mM DTT and 5-10 μM dNTPs. The Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTPs are present. If desired, selective repair can be performed by supplying only one of the dNTPs, or with selected dNTPs, within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture is extracted with phenol/chloroform and ethanol precipitated. Treatment under appropriate conditions with SI nuclease or Bal-31 results in hydrolysis of any single-stranded portion.

[00128] Ligations may be performed in 15-50 μl volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl₂, 10 mM DTT, 33 mg/ml BSA, 10 mM-50 mM NaCl, and either 40 μM ATP, 0.01-0.02 (Weiss) unites T4 DNA ligase at 0°C (for "sticky end" ligation) or 1 mM ATP, 0.3-0.6 (Weiss) unites T4 DNA ligase at 14°C (for "blunt end" ligation). Intermolecular "sticky end" ligations are usually performed at 33-100 μg/ml total DNA concentrations (5-100 mM total end concentration). Intermolecular blunt end ligations (usually employing a 10-30 fold molar excess of linkers) are performed at 1 μM total ends concentration. Pseudotyping in Stem Cells

[00129] The present invention also provides for a method for increasing the number of hematopoietic stem cells ex vivo, the method comprising the steps of: a. isolating hematopoietic stem cells from a donor; b. incubating the stem cells in a cell culture medium comprising an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells ex vivo. [00130] Preferably, the gene of interest transiently expresses a hematopoietically effective amount of stem cell factor polypeptide. More preferably the hematopoietic growth factor selected from the group consisting of: GM-CSF, CSF-1, G-CSF, G-CSF Serl7, c-mpl ligand (TPO), MGDF, M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL- 11, IL-12, IL-13, IL-15, IL-16, LIF, flt3 ligand, human growth hormone, B- cell growth factor, B-cell differentiation factor, eosinophil differentiation factor and stem cell factor (SCF).

[00131] In one embodiment, the method further comprises the step of separating the stem cells from a mixed population of cells prior to culturing the stem cells. In an alternate embodiment, the stem cells are separated from a mixed population of cells based on the stem cells having CD34 surface antigen. In an alternate embodiment, the stem cells are separated from a mixed population of cells based cells characterized by an absence, or substantially diminished expression of cell surface antigens CD38, CD3, CD61, CD33, CD 14, CD 15 or CD4.

[00132] A method for increasing the number of hematopoietic progenitor cells in the peripheral blood of a subject, the method comprising the step of administering to a subject a hematopoietically effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells in vivo, thereby increasing the number of peripheral blood hematopoietic progenitor cells.

[00133] A method for providing a population of early hematopoietic progenitor cells to a human in need thereof, the method comprising the steps of: (a) administering to a subject a hematopoietically effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells in vivo, thereby increasing the number of peripheral blood hematopoietic progenitor cells; (b) harvesting from the peripheral blood of the subject the hematopoietic progenitor cells produced in step a); and (c) administering to the subject the hematopoietic progenitor cells obtained in step (b).

[00134] Additionally, the present invention encompasses methods of ex- vivo expansion of stem cells comprising the steps of (a) separating stem cells from a mixed population of cells; (b) culturing said separated stem cells with a growth medium comprising a hematopoietically effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells ex vivo, thereby increasing the number of peripheral blood hematopoietic progenitor cells; and (c) harvesting said cultured cells.

[00135] The present invention includes methods for treatment of a patient having a hematopoietic disorder, comprising the steps of; (a) removing stem cells from said patient or a blood donor; (b) culturing said separated stem cells with a growth medium comprising a hematopoietically effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells ex vivo, thereby increasing the number of peripheral blood hematopoietic progenitor cells; and (d) transplanting said cultured cells into said patient.

[00136] The present invention also includes methods for treatment of a patient having a hematopoietic disorder, comprising the steps of; (a) removing stem cells from said patient or a blood donor; (b) separating stem cells from a mixed population of cells; (c) culturing said separated stem cells with a growth medium comprising a hematopoietically effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome, whereby the gene of interest is expressed within the stem cells and is capable of increasing the expansion of hematopoietic stem cells ex vivo, thereby increasing the number of peripheral blood hematopoietic progenitor cells; (d) harvesting said cultured cells; and (e) transplanting said cultured cells into said patient.

[00137] It is also envisioned that a patient could be given a hematopoietic growth factor, preferably a early acting factor, prior to removing stem cells for ex- vivo expansion to increase the number of early progenitors. It is also envisioned that a portion of the stem cells removed from a patient could be frozen and transplanted with the expanded stem cells to provide more early progenitors.

[00138] It is envisioned that the present invention includes methods of human gene therapy, comprising the steps of; (a) removing stem cells from a patient or blood donor; (b) culturing said separated stem cells with a growth medium comprising an effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome; (c) introducing the construct into said cultured cells; (d) harvesting said transduced cells; and (e) transplanting said transduced cells into said patient.

[00139] It is also envisioned that the present invention includes methods of human gene therapy, comprising the steps of; (a) removing stem cells from a patient or blood donor; (b) separating said stem cells from a mixed population of cells; (c) culturing said separated stem cells with a growth medium comprising an effective amount of an RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome; (d) introducing the construct into said cultured cells; (e) harvesting said transduced cells; and (f) transplanting said transduced cells into said patient.

[00140] It is also intended that the present invention includes methods of ex vivo expansion of hematopoietic cells, methods of expanding hematopoietic cells for gene therapy and methods of treating a patient using the expanded cells using the RNA constructs of the present invention along with other hematopoietic growth factors. A non-exclusive list of other appropriate hematopoietic growth factors, colony stimulating factors, cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or serial co-administration with the polypeptides of the present invention includes GM-CSF, CSF-1, G-CSF, G-CSF Serl7, c-mpl ligand (MGDF or TPO), c-mpl receptor agonists disclosed in PCT/US96/15938, M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL- 11, IL-12, IL-13, IL-15, IL-16, LIF, flt3 ligand, B-cell growth factor, B-cell differentiation factor and eosinophil differentiation factor, stem cell factor (SCF) also known as steel factor or c-kit ligand, multi-functional hematopoietic receptor agonists disclosed in PCT7US96/15774, or combinations thereof.

[00141] Hematopoietic cells that have been expanded ex- vivo using the RNA constructs of the present invention may be useful in the treatment of diseases characterized by a decreased levels of either myeloid, erythroid, lymphoid, or megakaryocyte cells of the hematopoietic system or combinations thereof. In addition, they may be used to activate mature myeloid and/or lymphoid cells. Among conditions susceptible to treatment with hematopoietic cells that have been expanded ex- vivo using the chimera proteins of the present invention is leukopenia, a reduction in the number of circulating leukocytes (white cells) in the peripheral blood. Leukopenia may be induced by exposure to certain viruses or to radiation. It is often a side effect of various forms of cancer therapy, e.g., exposure to chemotherapeutic drugs, radiation and of infection or hemorrhage. Therapeutic treatment of leukopenia with these RNA constructs of the present invention may avoid undesirable side effects caused by treatment with presently available drugs. [00142] Hematopoietic cells that have been expanded ex-vivo using the RNA constructs of the present invention may be useful in the treatment of neutropenia and, for example, in the treatment of such conditions as aplastic anemia, cyclic neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus (SLE), leukemia, myelodysplastic syndrome and myelofibrosis.

[00143] Hematopoietic cells that have been expanded ex-vivo using the chimera molecule of the present invention may be useful in the treatment or prevention of thrombocytopenia. Currently the only therapy for thrombocytopenia is platelet transfusions which are costly and carry the significant risks of infection (HIV, HBV) and alloimunization. Treatment involving the transplantation of the hematopoietic cells that have been expanded ex-vivo using chimera proteins of the present invention into a patient, may alleviate or diminish the need for platelet transfusions. Severe thrombocytopenia may result from genetic defects such as Fanconi's Anemia, Wiscott-Aldrich, or May-Hegglin syndromes. Acquired thrombocytopenia may result from auto- or allo-antibodies as in Immune Thrombocytopenia Purpura, Systemic Lupus Erythromatosis, hemolytic anemia, or fetal maternal incompatibility. In addition, splenomegaly, disseminated intravascular coagulation, thrombotic thrombocytopenic purpura, infection or prosthetic heart valves may result in thrombocytopenia. Severe thrombocytopenia may also result from chemotherapy and/or radiation therapy or cancer. Thrombocytopenia may also result from marrow invasion by carcinoma, lymphoma, leukemia or fibrosis.

[00144] One aspect of the present invention provides a novel hematopoietic factors for selective ex-vivo expansion of stem cells. The term "stem cell" refers to the totipiotent hematopoietic stem cells as well as early precursors and progenitor cells that can be isolated from bone marrow, spleen or peripheral blood. The term "expanding" refers to the differentiation and proliferation of the cells. The present invention provides a method for selective ex-vivo expansion of stem cells, comprising the steps of; (a) separating stem cells from a mixed population of cells, (b) culturing said separated stem cells with a selected media which contains a chimera protein(s) and (c) harvesting said cultured stems cells.

[00145] Stem cells as well as committed progenitor cells destined to become neufrophils, erythrocytes, platelets, etc., may be distinguished from most other cells by the presence or absence of particular progenitor marker antigens, such as CD34, that are present on the surface of these cells and/or by morphological characteristics. The phenotype for a highly enriched human stem cell fraction is reported as CD34+, Thy-1+ and lin-, but it is to be understood that the present invention is not limited to the expansion of this stem cell population. The CD34+ enriched human stem cell fraction can be separated by a number of reported methods, including affinity columns or beads, magnetic beads or flow cytometry using antibodies directed to surface antigens such as the CD34+. Further, physical separation methods such as counterflow elutriation maybe used to enrich hematopoietic progenitors. The CD34+ progenitors are heterogeneous, and may be divided into several subpopulations characterized by the presence or absence of coexpression of different lineage associated cell surface associated molecules. The most immature progenitor cells do not express any known lineage-associated markers, such as HLA-DR or CD38, but they may express CD90 (thy-1). Other surface antigens such as CD33, CD38, CD41, CD71, HLA-DR or c-kit can also be used to selectively isolate hematopoietic progenitors. The separated cells can be incubated in selected medium in a culture flask, sterile bag or in hollow fibers. Various hematopoietic growth factors may be utilized in order to selectively expand cells. Representative factors that have been utilized for ex-vivo expansion of bone marrow include, c-kit ligand, IL-3, G-CSF, GM-CSF, IL-1, IL-6, IL-11, flt-3 ligand or combinations thereof. The proliferation of the stem cells can be monitored by enumerating the number of stem cells and other cells, by standard techniques (e.g., hemacytometer, CFU, LTCIC) or by flow cytometry prior and subsequent to incubation.

[00146] Another projected clinical use of RNA constructs is in the in vitro activation of hematopoietic progenitors and stem cells for gene therapy. Due to the long life-span of hematopoietic progenitor cells and the distribution of their daughter cells throughout the entire body, hematopoietic progenitor cells are good candidates for ex vivo gene transfection. Hematopoietic stem cells cycle at a very low frequency that means that growth factors may be useful to promote gene transduction and thereby enhance the clinical prospects for gene therapy. Potential applications of gene therapy (review Crystal, Science 270:404-410 (1995) include; 1) the treatment of many congenital metabolic disorders and immunodifϊencies (Kay and Woo, Trends Genet. 10:253-257 (1994), 2) neurological disorders (Freedmann, Trends Genet. 10:210-214 (1994), 3) cancer (Culver and Blaese, Trends Genet. 10:174-178 (1994) and 4) infectious diseases (Gilboa and Smith, Trends Genet. 10:139-144 (1994). Due to the long life-span of hematopoietic progenitor cells and the distribution of their daughter cells throughout the entire body, hematopoietic progenitor cells are good candidates for ex vivo gene transfection include the treatment of many congenital metabolic disorders and immunodifiencies (Kay and Woo, Trends Genet. 10:253-257 (1994) neurological disorders (Freedmann, Trends Genet. 10:210-214 (1994), cancer (Culver and Blaese, Trends Genet. 10:174- 178 (1994) and infectious diseases (Gilboa and Smith, Trends Genet. 10:139- 144 (1994).

[00147] The present invention provides an improvement to the existing methods of expanding hematopoietic cells, into which new genetic material has been introduced, in that it provides methods utilizing transient expression of proteins that have improved biological activity, including an activity not seen by any previous method.

[00148] Many drugs may cause bone marrow suppression or hematopoietic deficiencies. Examples of such drugs are AZT, DDI, alkylating agents and anti-metabolites used in chemotherapy, antibiotics such as chloramphenicol, penicillin, gancyclovir, daunomycin and sulfa drugs, phenothiazones, tranquilizers such as meprobamate, analgesics such as aminopyrine and dipyrone, anti convulsants such as phenytoin or carbamazepine, antithyroids such as propylthiouracil and methimazole and diuretics. Hematopoietic cells that have been expanded ex-vivo using the RNA constructs of the present invention may be useful in preventing or treating the bone marrow suppression or hematopoietic deficiencies which often occur in patients treated with these drugs.

[00149] Hematopoietic deficiencies may also occur as a result of viral, microbial or parasitic infections and as a result of treatment for renal disease or renal failure, e.g., dialysis. Hematopoietic cells that have been expanded ex-vivo using the RNA constructs of the present invention may be useful in treating such hematopoietic deficiency.

[00150] Various immunodeficiencies e.g., in T and/or B lymphocytes, or immune disorders, e.g., rheumatoid arthritis, may also be beneficially affected by treatment with hematopoietic cells that have been expanded ex-vivo using the RNA constructs of the present invention. Immunodeficiencies may be the result of viral infections e.g. HTLVI, HTLVII, HTLVIII, severe exposure to radiation, cancer therapy or the result of other medical treatment. The RNA constructs of the present invention may also be employed, alone or in combination with other hematopoietic growth factors, in the treatment of other blood cell deficiencies, including thrombocytopenia (platelet deficiency), or anemia. Other uses for these novel polypeptides are in the treatment of patients recovering from bone marrow transplants.

[00151] As indicated above, the therapeutic method may also include co- administration with other human factors, including but not limited to, other appropriate hematopoietic growth factors, colony stimulating factors, cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or serial co-administration with the polypeptides of the present invention includes GM-CSF, CSF-1, G-CSF, G-CSF Ser7, c-mpl ligand (MGDF or TPO), c-mpl receptor agonists disclosed in PCT/US96/15938, M- CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL- 10, IL-11, IL-12, IL-13, IL-15, IL-16, LIF, flt3 ligand, B-cell growth factor, B-cell differentiation factor and eosinophil differentiation factor, stem cell factor (SCF) also known as steel factor or c-kit ligand, multi-functional hematopoietic receptor agonists disclosed in PCT7US96/15774, or combinations thereof. [00152] The treatment of hematopoietic deficiency .may include removing hematopoietic cell from a patient, culturing the cell in a medium containing the RNA constructs to differentiate and proliferate the cells and returning the cultured cells to the patient following a medical treatment. In addition, hematopoietic cell can be removed from a blood donor, cultured and given to a patient suffering from a hematopoietic disorder.

[00153] The methods could be used to treat stem cell disorders that are characterized by a reduction in functional marrow mass due to toxic, radiant, or immunologic injury. Aplastic anemia is a stem cell disorder in which there is a fatty replacement of hematopoietic tissue and pancytopenia. Paroxysmal nocturnal hemoglobinuria (PNH) is a stem cell disorder characterized by formation of defective platelets and granulocytes as well as abnormal erythrocytes. Other diseases include the following: myelofibrosis, myelosclerosis, osteopetrosis, metastatic carcinoma, acute leukemia, multiple myeloma, Hodgkin's disease, lymphoma, Gaucher's disease, Niemann-Pick disease, Letterer-Siwe disease, refractory erythroblastic anemia, Di Guglielmo syndrome, congestive splenomegaly, Hodgkin's disease, Kala azar, sarcoidosis, primary splenic pancytopenia, miliary tuberculosis, disseminated fungus disease, Fulminating septicemia, malaria, vitamin B12 and folic acid deficiency, pyridoxine deficiency, Diamond Blackfan anemia, hypopigmentation disorders such as piebaldism and vitiligo.

[00154] Enhancement of growth in non-hematopoietic stem cells such as primordial germ cells, neural crest derived melanocytes, commissural axons originating from the dorsal spinal cord, crypt cells of the gut, mesonephric and metanephric kidney tubules, and olfactory bulbs is of benefit in states where specific tissue damage has occurred to these sites. The present method is useful for treating neurological damage and is a growth factor for nerve cells and is useful during in vitro fertilization procedures or in treatment of infertility states. In addition, it is useful for treating intestinal damage resulting from irradiation or chemotherapy. There are stem cell myeloproliferative disorders such as polycythemia vera, chronic myelogenous leukemia, myeloid mataplasia, primary thrombocythemia, and acute leukemias which are treatable with the present methods.

[00155] The present methods are useful for expanding early hematopoietic progenitors in syngeneic, allogeneic, or autologous bone marrow transplantation. For bone marrow transplantation, the following three scenarios are used alone or in combination: a donor is treated with SCF alone or in combination with other hematopoietic factors prior to bone marrow aspiration or peripheral blood leucophoresis to increase the number of cells available for transplantation; the bone marrow is treated in vitro to activate or expand the cell number prior to transplantation; finally, the recipient is treated to enhance engraftment of the donor marrow.

[00156] The present methods are useful useful for treatment of acquired immune deficiency (AIDS) or severe combined immunodeficiency states (SCID) alone or in combination with other factors such as IL-7. The present methods are also useful for enhancing hematopoietic recovery after acute blood loss.

[00157] The present methods can be used to express chemokine receptors or integrins which are involved in cell homing to distinct tissues. Use in cellular therapy of organ damage, such as myocardial infarction, stroke or acute liver failure. Prerequisite is the identification of suitable (combinations of) molecules which regulate cellular homing into damaged tissues.

[00158] The present methods can be used to express growth regulatory molecules for cell expansion in vitro. Often stem cell numbers are limiting in autologous or allogeneic bone marrow transplantation. The result is insufficient reconstitution of major blood cell lineages and weak immunity, sometimes leading to severe complications such as bleeding, anemia, infections, or even promoting tumor relapse. Preferred RNAs are those that can express cellular growth stimulating molecules such as HOXB4 or Notch, cellular oncoproteins such as BCR-ABL or AML-ETO, and viral oncoproteins such as the largeT antigen of SV40 tumor virus or El A and E1B of papilloma virus. All these molecules need to be expressed in a transient and dose-controlled form to become clinically useful. [00159] In one aspect, the present invention provides a nucleic acid sequence comprising an enhancer operably linked to a promoter and a transgene. The promoter may be selected from the group of promoters consisting of: ApoA-I, ApoA-II, ApoA-IIL ApoA-IV, AρoB-48, AρoB-100, ApoC-I, ApoC-II, ApoC-III, ApoE, albumin, alpha feto protein, PEPCK, transthyretin, SV40, murine leukemia viruses, CMV, and TK. The transgene may be selected from the group consisting of: interleukin 1, interleukin 2, interleukin 3, interleukin 4, interleukin 5, interleukin 6, interleukin 7, interleukin 8, interleukin 9, interleukin 10, interleukin 11, interleukin 12, ENA-78, interferon-.alpha., interferon-.beta., interferon-.gamma., granulocyte-colony stimulating factor, granulocyte-macrophage colony simulating factor, macrophage colony stimulating factor, stem cell factor, keratinocyte growth factor, MCPI, AFM, and TNF, and fragments thereof.

[00160] The present methods can be used to express differentiation-inducing molecules. Some transcription factors direct cell fate decisions and commitment to differentiation into defined cell types. Examples are MyoD or Myf5 that may induce myo genie differentiation of mesodermal progenitor cells in an appropriate cellular and environmental context. Such molecules could be delivered by RP before transplantation of progenitor/stem cells, to enhance the safety and efficiency of organ reconstitution. Transgene Sequences

[00161] The retroviral transfer vector sequences of the present invention can encode one or more transgene sequences (i.e., a gene or gene fragment, or more than one gene or gene fragment or other sequence encoding a protein). Any of the polynucleotide sequences described herein may be used to identify fragments or full-length coding sequences of the genes to which they are associated and may be suitable for use in the compositions and methods of the present invention. Methods of isolating fragments or full-length sequences of genes are well known in the art.

[00162] Such genes and/or gene fragments can comprise any sequence useful in gene therapy or for any other purpose (e.g., cloning or product production). Preferably, the transgene sequence encodes a protein, e.g., a hormone, cytokine, enzyme, receptor, post-receptor signaling molecule, transcription factor, or other recombinant sequences useful in gene and cell therapy.

[00163] The transgene sequence can be any nucleic acid sequence of interest that can be transcribed. Often, the transgene sequence encodes a polypeptide. Preferably, the polypeptide has some therapeutic benefit. For example, the polypeptide may supplement deficient or nonexistent expression of an endogenous protein in a host cell. The polypeptide can confer new properties on the host cell, such as a chimeric signaling receptor, see e.g., U.S. Pat. No. 5,359,046. The artisan can determine the appropriateness of a transgene sequence practicing techniques taught herein and known in the art. For example, the artisan would know whether a transgene sequence is of a suitable size for encapsidation and whether the transgene sequence product is expressed properly.

[00164] A transgene sequence encoded by a retroviral vector sequence of the present invention can be operably linked to a promoter that is internal to the transcription regulatory sequences of the retroviral vector sequence. "Operably linked" as used herein with reference to a transgene sequence refers to a functional linkage between a regulatory sequence and a transgene nucleic acid sequence resulting in expression of a transgene sequence from unintegrated DNA in cells.

[00165] If pseudotransfer is used to introduce an RNA for immediate translation in target cells without the need for de novo transcription, the coding sequences will be inserted either in the cap-proximal position of the RNA or behind an internal ribosome entry site that can be derived from viral (such as picornaviral) or cellular genes.

[00166] It may be desirable to modulate the expression of a gene regulating molecule in a cell by the introduction of a molecule using the compositions and methods of the invention. The term "modulate" envisions the suppression of expression of a gene when it is over-expressed or augmentation of expression when it is under-expressed. Where a cell proliferative disorder is associated with the expression of a gene, nucleic acid sequences that interfere with the expression of a gene at the translational level can be used. The approach can utilize, for example, antisense nucleic acid, ribozymes or triplex agents to block transcription or translation of a specific mRNA, either by masking that RNA with an antisense nucleic acid or triplex agent, or by cleaving same with a ribozyme, or by expressing a small-interfering RNA (siRNA) that triggers degradation of the target RNA.

[00167] Antisense nucleic acids are DNA or RNA molecules, which are complementary to at least a portion of a specific mRNA molecule (Weintraub, Sci. Am. (1990) 262:40). In the cell, the antisense nucleic acids hybridize to the corresponding mRNA forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA since the cell will not translate a mRNA that is double-stranded. Antisense oligomers of about 15 nucleotides or more are preferred since such are synthesized easily and are less likely to cause problems than larger molecules when introduced into the target cell. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (see e.g., Marcus-Sakura, Anal. Biochem. (1988) 172:289).

[00168] Useful antisense nucleic acids also include small-interfering RNA (siRNA) molecules. Methods of using siRNA to inhibit gene expression are well known in the art (see e.g., U.S. Pat. No. 6,506,559).

[00169] The antisense nucleic acid can be used to block expression of a mutant protein or a dominantly active gene product, such as amyloid precursor protein that accumulates in Alzheimer's disease. Such methods are also useful for the treatment of Huntington's disease, hereditary Parkinson's and other diseases. Antisense nucleic acids are also useful for the inhibition of expression of proteins associated with toxicity.

[00170] Use of an oligonucleotide to stall transcription can be by the mechanism known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, the triplex compounds can be designed to recognize a unique site on a chosen gene (see e.g., Maher et al, Antisense Res. and Dev. (1991)1(3):227; Helene, Anticancer Drug Dis. (1991) 6(6):569).

[00171] Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode those RNA's, it is possible to engineer molecules that recognize and cleave specific nucleotide sequences in an RNA molecule (see e.g., Cech, J. Amer. Med Assn. (1988) 260:3030). A major advantage of that approach is only n RNA's with particular sequences are inactivated.

[00172] The desired transgene sequence or sequences are preferably non-retroviral sequences that are inserted into a retroviral transfer vector sequence of the present invention. However, in some cases a desired therapeutic gene may be a retroviral gene, e.g., a sequence encoding an HIV structural protein capable of inducing an anti-HIV immune response. Such therapeutic retroviral sequences are preferably recombinant or heterologous with respect to the retroviral vector sequence (e.g., an HIV-1 therapeutic gene sequence is inserted into a murine leukemia virus vector sequence of the present invention).

[00173] The nucleic acid sequence inserted into the retroviral vector can be, e.g. , a viral structural gene that is capable of inducing an immune response against a viral infection in a subject. Additionally, the nucleic acid sequence inserted into the retroviral vector can be, e.g., any other gene useful for vaccination or immunization of a subject (e.g., a bacteria or protozoa, particularly a pathogen, or a gene encoding a tumor antigen). In the particular case of disease caused by HIV infection, where immunostimulation is desired, the antigen generated from a recombinant retrovirus may be in a form which will elicit either or both an HLA class I- or class Il-restricted immune response. In the case of HIV envelope antigen, for example, the antigen is preferably selected from gp 160, gp 120, and gp 41, which have been modified to reduce their pathogenicity. In particular, the selected antigen is modified to reduce the possibility of syncytia, to avoid expression of epitopes leading to a disease enhancing immune response, to remove immunodominant, but haplotype-specific epitopes or to present several haplotype-specific epitopes, and allow a response capable of eliminating cells infected with most or all strains of HIV.

[00174] The haplotype-specific epitopes can be further selected to promote the stimulation of an immune response within an animal that is cross-reactive against other strains of HIV. Antigens from other HIV genes or combinations of genes, such as gag, pol, rev, vif, nef, prot, gag/pol, gag prot, etc., may also provide protection in particular cases. HIV is only one example. This approach should be effective against many virally linked diseases or cancers where a characteristic antigen (which does not need to be a membrane protein) is expressed, such as in HP V and cervical carcinoma, HTLV-I-induced leukemias, prostate-specific antigen (PSA) and prostate cancer, mutated p53 and colon carcinoma and melanoma, melanoma specific antigens (MAGEs), and melanoma, mucin and breast cancer.

[00175] A variety of cytokine or immunomodulatory genes may be inserted into the retroviral vectors of the invention. Representative examples of immunomodulatory factors include cytokines, such as IL-1, IL-2 (see e.g., Karupiah et al, J. Immunology 144:290-298, 1990; Weber et al, J. Exp. Med. 166:1716-1733,1987; Gansbacher et a., J. Exp. Med. 172:1217-1224, 1990; U.S. Pat. No. 4,738,927), IL-3, IL-4 (see e.g., Tepper et al, Cell 57:503-512, 1989; Golumbek et al, Science 254:713-716, 1991; U.S. Pat. No. 5,017,691), IL-5, IL-6 (see e.g., Brakenhof et al, J. Immunol. 139:4116-4121, 1987; WO 90/06370), IL-7 (see e.g., U.S. Pat. No. 4,965,195), IL-8, IL-9, IL-10, IL- 11, IL-12, IL-13 (see e.g., Cytokine Bulletin, Summer 1994), IL-14 and IL-15, particularly IL-2, IL-4, IL-6, IL-12, and IL-13, alpha interferon (see e.g., Finter et al, Drugs 42(5):749-765, 1991; U.S. Pat. No. 4,892,743; U.S. Pat. No. 4,966,843; WO 85/02862; Nagata et al, Nature 284:316-320, 1980; Familletti et al, Methods in Enz. 78:387-394,1981; Twu et al, Proc. Natl. Acad. Sci. USA 86:2046-2050,1989; Faktor et a., Oncogene 5:867-872, 1990), beta interferon (see e.g., Seif et al, J. Virol. 65:664-671, 1991), gamma interferons (see e.g., Radford et al, The American Society of Hepatology 2008-2015, 1991; Watanabe et al, PNAS 86:9456-9460, 1989; Gansbacher et a., Cancer Research 50:7820-7825, 1990; Maio et al, Can. Immunol. rmmunother. 30:34-42, 1989; U.S. Pat. No. 4,762,791; U.S. Pat. No. 4,727,138), G-CSF (see e.g., U.S. Pat. Nos. 4,999,291 and 4,810,643), GM- CSF (WO 85/04188), tumor necrosis factors (TNFs) (see e.g., Jayaraman et al, J. Immunology 144:942-951, 1990), CD3 (see e.g., Krissanen et al, Immunogenetics 26:258-266, 1987), ICAM-1 (see e.g., Altman et a., Nature 338:512-514, 1989; Simmons et al, Nature 331:624-627, 1988), ICAM-2, LFA-1, LFA-3 (see e.g., Wallner et al, J. Exp. Med. 166(4):923-932, 1987), MHC class I molecules, MHC class II molecules, B7 0.1-0.3, b2 - microglobulin (see e.g., Parnes et al, PNAS 78:2253-2257, 1981), chaperones such as calnexin, MHC linked transporter proteins or analogs thereof (see e.g., Powis et al, Nature 354:528-531,1991). Immunomodulatory factors may also be agonists, antagonists, or ligands for these molecules. For example soluble forms of receptors can often behave as antagonists for these types of factors, as can mutated forms of the factors themselves. Within one embodiment, the gene encodes gamma-interferon.

Immuiiomodulatory factors may also be agonists, antagonists, or ligands for these molecules. For example soluble forms of receptors can often behave as antagonists for these types of factors, as can mutated forms of the factors themselves. Genes encoding any of the cytokine and immunomodulatory proteins described herein can be expressed in a retroviral vector to achieve long term in vivo expression. Other forms of these cytokines which are know to those of skill in the art can also be used. For instance, nucleic acid sequences encoding native IL-2 and gamma-interferon can be obtained as described in U.S. Pat. Nos. 4,738,927 and 5,326,859, respectively, while useful muteins of these proteins can be obtained as described in U.S. Pat. No. 4,853,332. As an additional example, nucleic acid sequences encoding the short and long forms of mCSF can be obtained as described in U.S. Pat. Nos. 4,847,201 and 4,879,227, respectively. Retroviral vectors expressing cytokine or immunomodulatory genes can be produced as described herein and in PCT publication number U.S. Ser. No. 94/02951 entitled "Compositions and Methods for Cancer Immunotherapy". [00177] Within the recombinant retroviral vectors of the invention, the desired sequences, genes and/or gene fragments can be inserted at several sites (e.g., at a restriction enzyme site or polylinker) and operably linked to different regulatory sequences. For example, a site for insertion can be the viral enhancer/promoter proximal site (i.e., 5'LTR-driven gene locus). Alternatively, the desired sequences can be inserted into the viral promoter distal site, where the expression of the desired sequence or sequences is through splicing of the promoter proximal cistron, an internal heterologous promoter as SV40 or CMV, or an internal ribosome entry site (IRES).

[00178] Nucleic acid molecules that encode the above-described substances, as well as other nucleic acid molecules that are advantageous for use within the present invention, may be readily obtained from a variety of sources, including for example depositories such as the American Type Culture Collection (ATCC, Rockville, Md.), or from commercial sources such as British Bio-Technology Limited (Cowley, Oxford England). Representative examples include BBG 12 (containing the GM-CSF gene coding for the mature protein of 127 amino acids), BBG 6 (which contains sequences encoding gamma interferon), ATCC No. 39656 (which contains sequences encoding TNF), ATCC No. 20663 (which contains sequences encoding alpha interferon), ATCC Nos. 31902, 31902 and 39517 (which contains sequences encoding beta interferon), ATCC No. 67024 (which contains a sequence which encodes Interleukin-lb), ATCC Nos. 39405, 39452, 39516, 39626 and 39673 (which contains sequences encoding Interleukin-2), ATCC Nos. 59399, 59398, and 67326 (which contain sequences encoding Interleukin-3), ATCC No. 57592 (which contains sequences encoding Interleukin-4), ATCC Nos. 59394 and 59395 (which contain sequences encoding Interleukin-5), and ATCC No. 67153 (which contains sequences encoding Interleukin-6).

[00179] Alternatively, cDNA sequences for use with the present invention may be obtained from cells that express or contain the sequences. Briefly, within one embodiment mRNA from a cell which expresses the gene of interest is reverse transcribed with reverse transcriptase using oligo dT or random primers. The single stranded cDNA may then be amplified by PCR (see e.g., U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159; PCR Technology: Principles and Applications for DNA Amplification, Erlich (ed.), Stockton Press, 1989)) utilizing oligonucleotide primers complementary to sequences on either side of desired sequences. In particular, a double stranded DNA is denatured by heating in the presence of heat stable Taq polymerase, sequence specific DNA primers, ATP, CTP, GTP and TTP. Double-stranded DNA is produced when synthesis is complete. T his cycle may be repeated many times, resulting in a factorial amplification of the desired DNA. Nucleic acid molecules that are carried and/or expressed by the recombinant retroviruses described herein may also be synthesized, for example, on an Applied Biosystems hie. DNA synthesizer (e.g., APB DNA synthesizer model 392 (Foster City, Calif.).

[00180] Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription, which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding the desired heterologous protein. The 3' untranslated regions also include transcription termination sites.

[00181] Another aspect of the present invention relates to a kit to be used for carrying out retro virus-mediated gene transfer into target cells and the kit comprises: (a) an effective amount of a functional material to generate an RNA polynucleotide construct, wherein the RNA construct is capable of expressing the gene of interest and wherein the RNA construct is incapable of integrating into the host cell genome; (b) an artificial substrate for incubating target cells and a retrovirus; and (c) a target cell growth factor for pre-stimulating the target cells, although this is not required when pseudotransfer is used. By using the reagent kit, the methods of the present invention can be carried out conveniently to transfer RNA into cells.

[00182] In this embodiment, the functional material may be used without immobilization or may be immobilized, though immobilization is preferred in case that target cells are adherent cells. Examples Example 1.

[00183] To demonstrate the significance of pseudofransfer, retroviral expression vectors for the Cre recombinase were manipulated. Cre is derived from a bacteriophage and represents an endonuclease that acts on a specific target sequence of double-stranded DNA, known as loxP site. DNA flanked by loxP sites is excised from the genome in the presence of Cre, and the open ends of DNA are religated. Thus, Cre can be used to reverse a transgene insertion into the genome. Under specific conditions, the Cre enzyme also allows site- specific insertion of a transgene into a single loxP site of the genome. Thus, it represents an example for a larger family of site-specific endonucleases that are of interest for therapeutic cell manipulation (Will et al, 2002; Gorman and Bullock, 2000; Ghosh and Van Duyne, 2002).

[00184] According to the state of the art, Cre has to be expressed in target cells from a transiently or stably transfected DNA expression vector, or by fransfer of the recombinant protein. As prolonged expression of Cre at high levels is genotoxic for target cells (Loonsfra et al, 2001), transient dose-controlled expression is the preferred mode of delivery. Protein transduction of Cre, as described by us and others, has important limitations in that the generation of large amounts of Cre protein is cumbersome and that the efficiency of this technology is extremely cell-type dependent (Will et al, 2002). Certain adherent cells (fibroblasts) can be treated with high efficiency by transfer of purified Cre protein, while the efficiency in suspension cells (including the important population of hematopoietic stem cells) is less than 20% (own unpublished data). Therefore, alternative modes of delivery are required.

[00185] Delivering Cre by retroviral pseudotransfer offers the following conceptual advantages (i) the method circumvents safety-limitations associated with random transgene insertion mediated by retroviral vectors (the latter being reviewed by Baum et al, 2003); (ii) the method should work well in any cell type that can be efficiently transduced with retroviral vectors; (iii) depending on the type of Env protein used, targeting of specific cell types within mixed populations of cells is possible; and (iv) because the endonuclease is delivered with a retroviral particle, it may also be combined with a specific transgene for the purpose of targeted gene insertion.

[00186] To investigate the potential of retroviral pseudotransduction to express Cre, we inserted a nuclear localizing variant of Cre (nlsCre) into mouse leukemia virus (MLV) based retroviral vectors that mediated stable integration into the target cell genome (SF91 -nlsCre, FIG. 1). To inhibit stable gene fransfer, we designed several mutants. Vector dPBS lacks the retroviral primer binding site (PBS) to disable reverse transcription into proviral DNA. Vector aPBS contains an artificial PBS that cannot prime reverse transcription unless being complemented by a recombinant tRNA (Lund et al., 1997). Vector dU5 contains all elements required for reverse transcription into double-stranded DNA but lacks the att recognition motif of the retroviral integrase (Basu and Varmus, 1990), along with flanking sequences of the U5 region (FIG. 1).

[00187] Phoenix-gp packaging cells are based on human 293T cells and stably express a transgene for gag-pol lacking Ψ. Using the calcium phosphate transfection method, Phoenix-gp can be co-fransfected with plasmids pSF91EGFP and another plasmid encoding a retroviral Env protein message lacking Ψ, such as pEcoEnv (Morita et al, 2000) encoding the ecofropic Env, or pRDF encoding the RDl 14 Env which allows the production of refroviral particles that are capable of infecting human cells (Cosset et al, 1995). 24-96 hours following transfection, cellular supernatants will contain replication-defective particles that allow stable gene transfer of EGFP into murine target cells expressing the ecofropic receptor (as described in Li et al, 2003). EGFP expression will persist for several cell generations, as a result of stable gene transfer. This can be demonstrated with murine SCI fibroblasts as target cells (data not shown).

[00188] Treatment of murine fibroblasts with supernatants harvested after co- fransfection of Phoenix-gp cells with pEcoEnv plus pSF91dPBS-EGFP or pSF91dU5-EGFP results in low but unstable levels of EGFP expression in target cells. In cells showing low levels of EGFP expression, a decline to undetectable levels is observed in the vast majority of treated cells after 36 hours, equivalent to a few cell divisions. This is consistent with pseudotransfer of EGFP protein (FIG.2e). When compared to SF91-EGFP, the reduction of cells with permanent expression of EGFP is at least three orders of magnitude (FIG. 2a-d).

[00189] To demonstrate the potential of pseudotransfer for delivery of a biologically meaningful protein, supernatants of Phoenix-gp cells were harvested after co- transfection of pEcoEnv with either ρSF91-nlsCre (SEQ ID NO:l), pSF91aPBS-nlsCRE, pSF91dPBS-nlsCre (SEQ ID NO:2) or pSF91dU5- nlsCre (SEQ ID NO:3). Unconcenfrated supernatants were added to SCI cells that contained a single copy of a fransgene where the coding region for the red fluorescent protein (RFP) is flanked by loxP sites. We (Will et al. 2002, and FIG. 3) previously described these SCl-SFr cells. Cre-dependent excision of the RFP cDNA results in a new fransgene configuration that relocates a downstream located EGFP cDNA as the first open reading frame available for translation. Therefore, these cells lose RFP expression and instead gain EGFP expression after Cre-mediated excision. The fluorescence shift can be detected and the frequency of events can be quantified by flow cytometry (Will et al. , 2002, and FIG.3a-c). As shown in FIG. 3, successful Cre-mediated conversion was achieved in a dose-dependent manner with Phoenix-gp supernatants derived from transfection of with either pSF91-nlsCre, pSF91aPBS-nlsCRE, pSF91dPBS-nlsCre or ρSF91dU5-nlsCre. Thus, the efficiency of nlsCre expression by the mutants pSF91aPBS-nlsCRE, ρSF91dPBS-nlsCre or pSF91dU5-nlsCre was similar to the wild-type vector pSF91 -nlsCre, despite the strong reduction in stable gene transfer potency. The apparent discrepancy of poor stable gene fransfer rates and highly efficient delivery of Cre activity by the mutants SF91aPBS-nlsCre, SF91dPBS-nlsCre and SF91dU5-nlsCre can be explained by the fact that transient expression of Cre is sufficient to trigger recombination of loxP sites.

[00190] If Cre is expressed for prolonged periods of time, genotoxicity may results due to the aberrant recognition of cellular target sequences (Silver and Livingston, 2001). Using the most potent preparations of mutant SF91aPBS-nlsCre, almost complete conversion of the target cell population could be achieved with a single treatment, even with unconcenfrated supernatants (FIG. 4). Importantly, this efficient delivery of Cre occurred without evidence of target cell toxicity, in contrast to the use of the integrating vector SF91 -nlsCre (FIG. 4). To demonstrate this important advantage of retroviral pseudotransduction, we started with populations of target cells where EGFP expression was achieved with 80% to 96% efficiency using the integrating refroviral vector SF91 -nlsCre. The frequency of EGFP+ cells decreased by 45% within 22 days after refroviral transduction (FIG. 4A). When using aPBS-nlsCre, the frequency of EGFP+ cells remained constant for the entire observation period, independent of the initial conversion rate (FIG. 4B).

[00191] Western blot analysis performed with cell extracts harvested 9 days after particle exposure revealed persisting Cre expression after use of the integrating vector SF91 -nlsCre, very weak residual Cre expression after use of the SF91dU5 mutant, and undetectable Cre activity after use of mutants SF91aPBS or SF91dPBS (data not shown). Interestingly, Western blot analysis performed with cell extracts harvested 22 days after particle exposure showed absence of Cre expression in the population transduced with SF91- nlsCre (data not shown), in striking contrast to full persistence of EGFP expression after transduction with SF91-EGFP. In line with the above data and the reported toxicity of constitutive Cre expression, PCR detecting Cre sequences in genomic DNA of exposed cells revealed persisting signals after the use of SF91 -nlsCre, SF91dPBS-nlsCre and SF91dU5-nlsCre. Weak PCR signals of Cre sequences were also detected in cell populations treated with SF91aPBS after 9 (data not shown). This is in line with the residual leakiness of these mutants which may still integrate proviral DNA, although with >1000-fold reduced potency (FIG. 2).

[00192] Controls addressed which retroviral components were required for transfer of Cre activity by constructs SF91aPBS-nlsCre and SF91dPBS-nlsCre. No EGFP conversion was observed in SFr-2 reporter cells when omitting either of the three key components of the refroviral packaging process transfected into 293T cells (Gorelick et al, 1988): the gag-pol expression plasmid, the env expression plasmid, or the retroviral packaging signal (Ψ) of the nlsCre plasmid. The latter construct encoded large amounts of nlsCre mRNA and protein in transfected 293T cells (data not shown). However, uptake of a cellular mRNA lacking Ψ into retroviral particles is expected to be very inefficient (Gorelick et al., 1988). The latter control also excluded passive protein transfer and contamination of retroviral particles by transfected plasmid DNA as the underlying mechanisms of nlsCre transfer by SF91dPBS or SF91aPBS (Chen et al, 2001; Will et al, 2002). Thus, retroviral pseudotransduction requires refroviral particle formation with incorporation of Ψ+ mRNA in the producer cells and an active refroviral infection process triggered by the env protein. Thus, the retroviral mRNA must be able to serve as an immediate translation template if not undergoing reverse transcription. In line with this, pseudotransduction with mutant SF91dPBS was impossible when expressing nlsCre from an internal promoter located 3' of Ψ on the retroviral mRNA (data not shown). In this case, cap-dependent ribosomal scanning could only occur after de novo synthesis of mRNA in transduced cells.

[00193] To address whether transfer of Cre activity by SF91 aPBS-nlsCre was receptor- mediated, we mixed human HT1080 and murine Sc-1 fibroblasts carrying the same indicator allele SFr-2. EGFP conversion was restricted to murine cells when using the ecofropic Env for supernatant production. In contrast, when using the RD114 Env, EGFP preferentially occurred in human cells (FIG. 5). Even when human cells represented a minority of the cell mix (<5%), specific targeting with RD114 enveloped particles containing SF91aPBS-nlsCre was possible (data not shown). The data are consistent with the known species restriction of these pseudotypes (RD114 may confer residual infectivity in mouse cells; personal communication, Francois-Loϊc Cosset, January 2004) (Hanawa et al, 2002). As expected, the tropism was independent of the type of expression vector used (SF91,SF91aPBS or SF91dPBS).

[00194] Receptor-mediated, dose-controlled and transient delivery of nucleic acids or proteins is of great interest for numerous approaches in cell biology and cell therapy. By expressing the bacteriophage site-specific recombinase Cre, we have demonstrated that integration-defective mutants of retroviral expression vectors represent a promising strategy to achieve this goal. Retroviral producer cell supernatants obtained with a construct that fails to initiate reverse transcription of the proviral mRNA mediated Cre activity in >95% of targeted cells, and allowed specific delivery of Cre without target cell toxicity depending on the tropism of the refroviral envelope protein. Our data suggest particle-mediated transfer of refroviral mRNA as the crucial mechanism. Multiple modifications of this refroviral pseudotransduction approach can be envisaged for targeted and transient cell manipulation.

[00195] Experimental procedures

[00196] Phoenix-gp packaging cells, NIH3T3 and both red fluorescent mouse SC-1 and human HT1080 reporter cells were grown in Dulbecco's modified Eagle medium supplemented with 10% FCS. Stable clones of SCI cells and HT1090 cells containing a Cre-reporter allele were generated by transducing SCI (ATCC no. CRL-1404) and HT1080 (ATCC no. CCL-121) with the retroviral vector SFr-2, containing loxP sites surrounding a DsRed2 cDNA. Clones expressing DsRed2 were obtained by single cell sorting.

[00197] SFr-2 is a derivative of SFr (Will et al, 2002) encoding DsRed2 instead of DsRedl, thereby allowing an improved expression of red fluorescence. SFr-2 was generated as follows: SF91-loxPl-RFP-loxP2-EGFP (Will et al, 2002) was cleaved with Ncol and Sail restriction enzymes, treated with T4 DNA polymerase and the vector fragment was isolated. The BamHI/Notl fragment containing the DsRed2 cDNA from pDsRed2 (Clontech) gene was isolated, treated with T4 DNA polymerase and inserted into the vector fragment. To enhance protein expression, the Hind III fragment containing the woodchuck hepatitis B virus post-franscriptional regulatory element (wPRE) (Schambach et ab, 2000; Zufferey et al, 1999) was inserted into the Hindlll site of SF91- loxPl-DsRed2-loxP2-EGFP. The resulting reporter vector SF91-loxPl- DsRed2-loxP2-EGFP-wPRE was termed SFr-2.

[00198] Refroviral vector SF91-nlsCre was derived from SF91-EGFP (Schambach et al, 2000) by replacing a Ncol-Nhel fragment containing the EGFP cDNA with a Ncol-Nhel fragment of pGEX-nlsCre (Will et al, 2002). Mutant vectors lacking the U5 region of the 5 'LTR located 70-145 bp downstream of the CAP site (SF91dU5-EGFP) or lacking the PBS located 146-163 bp downstream of the CAP site (SF91dPBS-EGFP) were derived from SF91- EGFP by overlapping PCR, resulting in precise deletions. Corresponding vectors SF91dU5-nlsCre and SF91dPBS-nlsCre were obtained by replacing the Ncol-Nhel fragment containing the EGFP cDNA with a Ncol-Nhel fragment of pGEX-nlsCre (Will et al, 2002).

[00199] In SF91aPBS-EGFP containing an artificial PBS, sequences 149-160 bp downsfream of the CAP site were replaced by "TCAGCTGCAGGG" (SEQ ID NO:4) using site-directed mutagenesis, according to Lund et al. (1997). Correct deletions or nucleotide replacements were confirmed by sequencing.

[00200] The eukaryotic Cre expression plasmid pCMVnlsCre lacking ψ was generated by Agel/EcoRI restriction cleavage of the expression vector pEGFP-Cl (Clontech) and blunt end insertion of a EcoRI-Nhel fragment of pGEX-nlsCre (Will et al, 2002), thereby replacing EGFP with the nlsCre cDNA. Western blotting (data not shown) confirmed high Cre expression in packaging cells transfected with pCMVnlsCre.

[00201] Packaging of SFr-2, SF91-nlsCre, SF91dU5-nlsCre, SF91dPBS-nlsCre and SF91aPBS -nlsCre in retroviral particles was performed by co-fransfection of the refroviral plasmid DNA with a MLV gag-pol expression plasmid as well as with expression plasmids encoding either ecofropic (Morita et al, 2000) or RD114 envelope (Cosset et al, 1995) into Phoenix GP (G. Nolan, Stanford University, Palo Alto, CA) or 293T packaging cells. Transfection, harvest and concentration of virus-containing supernatants was performed as described previously (Beyer et al, 2002).

[00202] The day before (pseudo)fransduction, 5 x 10⁴ SCI reporter cells were plated per well in a 24-well-plate. Either 1 ml undiluted or serial dilutions of retroviral supernatants were applied to the cells. (Pseudo)transduction was assisted by adding 4 μg/ml protamine sulfate and centrifugation for 60 min at 400g and 25-32°C. After 2 days the percentage of eGFP⁺ cells was analyzed by flow cytometry. For specific detection of human cells, mixed populations were stained with anti human HLA (A,B,C)-APC conjugate (BD Pharmingen) according to manufacturers instructions.

[00203] For Western Blot analysis, 6.5 x 10⁵ (pseudo)fransduced SC-1 reporter cells were harvested at different time points. Lysates were obtained after 15 min incubation with 50μl RJPA buffer containing proteinase inhibitors (Complete, Roche). Samples were separated by SDS / PAGE (12.5%), transferred to nitrocellulose membranes (Bio-Rad), and probed with anti-Cre (Novagen) 1:7,000 or anti-GFP (Santa-Cruz) antiserum 1:500 in TBST/3% dry milk. The secondary antibody anti-rabbit-HRP (Santa Cruz) was used at a 1 : 10,000 dilution in TBST/3% dry milk. Detection was carried out using chemiluminescence (ECL, Pierce).

[00204] For semiquantitative PCR, genomic DNA was isolated from SCI reporter cells 9 or 22 days post transduction with QIAamp DNA Blood Mini Kit (Qiagen) after the manufacturer's protocol. 500 ng of DNA was used for PCR amplification of Cre DNA sequence using oligonucleotides GGTGAACGTGCAAAACAGGCTCTA (SEQ ID NO:5) (sense) and GCTTGCATGATCTCCGGTATTGAAA (SEQ ID NO:6) (antisense). PCR was performed using Taq polymerase (New England Biolabs), 2 min 94°C, followed by 41 cycles of 30 s 94°C, 30 s 57°C and 40 s 72°C following manufacturer's instructions. For the control amplification of EGFP-wPRE in the reporter allele oligonucleotides ACGAGAAGCGCGATCACATGGTCCTG (SEQ ID NO:7) (sense) and CCAAATCAAGAAAAACAGAACAAATA (SEQ ID NO:8) (antisense) were used under identical conditions.

Example 2.

[00205] Retroviral pseudotransduction of a functional cell-surface receptor into human cells, demonstrated with the receptor for murine ecofropic retroviruses.

[00206] The host range of retroviruses is strongly dependent on the envelope protein presented on the surface of the particles. Murine ecofropic retroviruses can only infect certain rodent cells. Infection of human cells is blocked due to a mutation in the cognate receptor that encodes a transporter for cationic amino acids (Fig.l). We obtained a cDNA encoding the murine form of this transporter (mCAT-1) fused to enhanced green fluorescent protein (EGFP). Previous studies have shown that this mCAT-EGFP fusion protein functions as a receptor for ecofropic retroviruses (Ou, W. and J. Silver. (2003). Role of a conserved amino-terminal sequence in the ecofropic MLV receptor mCATl. Virology. 308: 101-13). We placed this cDNA into intact refroviral vectors that were able to undergo reverse transcription and integration (SF91) and a corresponding mutant vector that is deficient in reverse transcription (SF91aPBS). We generated particles pseudotyped with the envelope protein of vesicular stomatitis virus glycoprotein (VS Vg) by transient transfection of human 293T cells as described previously (RNA-form schematically shown in Fig.2) (Galla, M., E. Will, J. Kraunus, L. Chen, and C. Baum. (2004). Retroviral pseudotransduction for targeted cell manipulation. Molecular Cell. 16: 309-315).

[00207] Next, we tested whether human Jurkat cells, representing an established T lymphoblast cell line, could be retrovirally transduced with ecofropic lentiviral particles encoding the dsRed fluorescent protein. As expected, the cells could not be transduced, while murine SCI fibroblasts were transduced at high levels using samples of the same ecofropic lentiviral vector preparation (>50%). In contrast, the lentiviral vector expressing dsRed transduced Jurkat cells at a high frequency when being pseudotyped with VSVg (Fig.3), demonstrating that the block to infection by ecofropic lentiviral vectors is related to the lack of an appropriate receptor on human cells.

[00208] Next, we introduced mCAT-EGFP using the intact refroviral vector SF91 - mCAT-EGFP or the mutant SF91aPBS-mCAT-EGFP. As shown in Fig. 4, subsequent infection of ecofropic lentiviral vector expressing dsRed generated a high frequency of Jurkat cells expressing dsRed, as determined 2 days after exposure. Reproducibly, >80% of Jurkat cells could be rendered susceptible to ecofropic lentiviral gene fransfer following pseudotransduction of mCAT- EGFP. Ecofropic infectivity was preserved up to 5 days following pseudotransduction of mCAT-EGFP, indicating a rather long half-life of the receptor in the cellular membrane. After 5 days, infectivity by lentiviral particles declined below the sensitivity of flow cytometry. In contrast, infectivity remained high following stable gene transfer mediated by SF91- mCAT-EGFP. This reveals that retroviral pseudofransduction allows the efficient and reversible introduction of functional receptor molecules into human cells.

[00209] Methods:

[00210] Ecofropic pseudotyped lentiviral particles were generated using the DsRed Express (Clontech, Heidelberg, Germany) expressing SIN vector RRL.PPT.SF.DsRedexp.pre (kindly provided by A. Schambach, Hannover Medical School, Hannover, Germany). The lentiviral fransfer vector was co- fransfected with lentiviral gag/pol plasmid (pcDNA3 g/p 4xCTE), Rev plasmid (pRSV-Rev, kindly provided by T. Hope, Chicago) and the ecofropic envelope plasmid pEcoEnv (Morita, S., T. Kojima, and T. Kitamura. (2000). Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7: 1063-1070) using the calcium phosphate method.

[00211] For (pseudo)fransduction of the mCAT-EGFP receptor, refroviral supernatants of either SF91-mCAT-EGFP or SF91aPBS-mCAT-EGFP were applied to 3xl0⁵ Jurkat cells. After cells were incubated at 37°C and 5% CO₂ for 12 hours a second infection by using ecofropic pseudotyped lentiviral particles was performed. Both fransductions were assisted by adding 4 μg/ml protamine sulfate and centrifugation for 60 min at 400g at 32°C. Two days post second infection the percentage of DsRed^4* or EGFP⁺/DsRed⁺ was determined by flow cytometry.

[00212] Plasmids encoding retroviral vectors SF91-mCAT-EGFP and SF91aPBS- mCAT-EGFP were generated as follows: The EGFP cDNA from SF91-EGFP (Schambach, A., H. Wodrich, M. Hildinger, J. Bohne, H.G. Krausslich, and C. Baum. (2000). Context dependence of different modules for postfranscriptional enhancement of gene expression from refroviral vectors. Molecular Therapy. 2: 435-45) was excised with Ncol and EcoRI restriction enzymes. The resulting overhangs of the generated vector backbone were treated with Klenow fragment. The insert was prepared by cutting the expression plasmid pECAT-GFP (murine CAT receptor) (Ou, W. and J. Silver. (2003). Role of a conserved amino-terminal sequence in the ecofropic MLV receptor mCATl. Virology. 308: 101-13) withXbal mdApal, followed by blunting the overhangs with Klenow fragment and T4 polymerase. Finally, the fragment was inserted either into the SF91 or SF91aPBS backbone.

[00213] Example 3. Refroviral pseudotransduction of a functional DNA repair protein into human cells, as demonstrated with the Fanconi complementation group C protein.

[00214] Fanconi anemia is a fatal genetic disorder caused by loss-of-function mutations in the genes encoding proteins that are involved in the Fanconi DNA repair complex, which consists of at least 9 different proteins (Thompson, L.H., J.M. Hinz, N.A. Yamada, and N.J. Jones. (2005). How Fanconi anemia proteins promote the four Rs: replication, recombination, repair, and recovery. Environ Mol Mutagen. 45: 128-42). Homozygous loss- of-function mutation in one of these proteins is sufficient to render cells highly susceptible to DNA damaging agents. Upon exposure to agents such as Melphalan, Fanconi (FANC) cells respond with increased arrest in the G2/M phases of the cell cycle, and survive with accumulating mutations unless undergoing p53 -dependent apoptosis. Introduction of an intact copy of the defective FANC gene may restore the wild-type response to DNA damaging agents, thus preventing accumulation of mutations. The restoration of the wild-type phenotype by gene transfer of the correct missing protein is referred to as FANC "complementation". FANC complementation is an established diagnostic tool, e.g. using appropriate retroviral vectors (Hanenberg, H., et al. (2002). Phenotypic correction of primary Fanconi anemia T cells with retroviral vectors as a diagnostic tool. Exp Hematol. 30: 410-20).

[00215] Transfer of intact FANC genes into hematopoietic cells is of great interest for gene therapy of Fanconi anemia. Current gene fransfer methods require prolonged manipulations of cells in vitro before corrective levels of FANC proteins will be expressed from the newly introduced transgenes. This may aggravate DNA lesions in cells that are to be transplanted into Fanconi patients, as demonstrated in mouse models (Li, X., et al. (2005). Ex vivo culture ofFancc-/- stem/progenitor cells predisposes cells to undergo apoptosis, and surviving stem/progenitor cells display cytogenetic abnormalities and an increased risk of malignancy. Blood. 105: 3465-71). We reasoned that retroviral pseudofransduction of RNA encoding FANC proteins may allow for a potent and rapid reversal of the DNA repair defect. From an intact retroviral vector encoding the FANCC gene (SF11 -FANCC), we excised the FANCC cDNA to insert it into the pseudotransduction vector SF91aPBS, resulting in the construct aPBS-FANCC. The RNA-forms of the vectors are shown in Fig. 5. Vector particles were generated as described, pseudotyped with the RDl 14 envelope protein (Galla, M., E. Will, J. Kraunus, L. Chen, and C. Baum. (2004). Retroviral pseudotransduction for targeted cell manipulation. Molecular Cell. 16: 309-315). Human fibroblasts defective for FANCC gene (FANCC-/- cells) were obtained from David A. Williams, Division of Experimental Hematology, Cincinnati Children's Hospital Medical Center, and were left untreated or treated in vitro with SF11 -FANCC (integrating retroviral vector) or with aPBS-FANCC (pseudotransduction vector). Four hours later, cells were treated with Melphalan, a DNA damaging agent. Pseudofransduction vector was added after 24 hrs and Melphalan was added to keep its final concentration at 0.2 μg/ml. Cell cycle determination after 48 hours revealed that pseudotransduction completely reverted the cell cycle arrest of FANCC-/- cells (Fig. 6). We conclude that retroviral pseudotransduction allows diagnostic FANC complementation assays, and prevention of DNA damage in cultured Fanconi cells.

References

Ailles LE, Naldini L. HIV- 1 -derived lentiviral vectors. Curr Top Microbiol Immunol. 2002; 261:31-52.

Basu, S., and Varmus, H. E. (1990). Moloney murine leukemia virus integration protein produced in yeast binds specifically to viral att sites. J. Virol. 64, 5617-5625. Baum C, Dϋllmann J, Li Z, Fehse B, Meyer J, Williams DA, von Kalle C: Side effects of retroviral gene transfer into hematopoietic stem cells. Blood. 2003; 101:2099-2114.

Baum C, Ostertag W, Stocking C, von Laer D. Retroviral vector design for cancer therapy. In: Gene Therapy of Cancer, 2^nd edition, ed. By Lattime E and Gerson S. Academic Press, San Diego, pp. 3-29.

Beyer, W. R., Westphal, M., Ostertag, W., and von Laer, D. (2002). Oncorefrovirus and lentivirus vectors pseudotyped with lymphocytic choriomeningitis virus glycoprotein: generation, concentration, and broad host range. J. Virol. 76, 1488-1495.

Brown HE, Chen H, Engelman A. Structure-based mutagenesis of the human immunodeficiency virus type 1 DNA attachment site: effects on integration and cDNA synthesis. J Virol. 1999; 73:9011-9020.

Chen, J., Reeves, L., Sanburn, N., Croop, J., Williams, D. A., and Cornetta, K. (2001). Packaging cell line DNA contamination of vector supernatants: implication for laboratory and clinical research. Virology. 282, 186- 197.

Cosset, F. L., Takeuchi, Y., Battini, J. L., Weiss, R. A., and Collins, M. K. (1995). High-titer packaging cells producing recombinant retroviruses resistant to human serum. J. Virol. 69, 7430-7436.

Gallardo HF, Tan C, Ory D, Sadelain M. Recombinant retroviruses pseudotyped with the vesicular stomatitis virus G glycoprotein mediate both stable gene transfer and pseudotransduction in human peripheral blood lymphocytes. Blood. 1997; 90:952-957.

Ghosh K, Van Duyne GD. Cre-loxP biochemistry. Methods. 2002; 28:374- 383.

Gorelick, R. J., Henderson, L. E., Hanser, J. P., and Rein, A. (1988). Point mutants of Moloney murine leukemia virus that fail to package viral RNA: evidence for specific RNA recognition by a "zinc finger-like" protein sequence. Proc. Natl. Acad. Sci. USA. 85, 8420-8424. Gorman C, Bullock C. Site-specific gene targeting for gene expression in eukaryotes. Curr Opin Biotechnol. 2000; 11 :455-460.

Haas DL, Case SS, Crooks GM, Kohn DB. Critical factors influencing stable transduction of human CD34(+) cells with HIV- 1 -derived lentiviral vectors. Mol Ther. 2000; 2: 71-80.

Hanawa, H., Kelly, P. F., Nathwani, A. C, Persons, D. A., Vandergriff, J. A., Hargrove, P., Vanin, E. F., and Nienhuis, A. W. (2002). Comparison of various envelope proteins for their ability to pseudotype lentiviral vectors and transduce primitive hematopoietic cells from human blood. Mol. Ther. 5, 242-251.

Jonsson CB, Donzella GA, Gaucan E, Smith CM, Roth MJ. Functional domains of Moloney murine leukemia virus integrase defined by mutation and complementation analysis. J Virol. 1996; 70:4585-4597.

Leavitt AD, Shiue L, Varmus HE. Site-directed mutagenesis of HIV- 1 integrase demonstrates differential effects on integrase functions in vitro. J Biol Chem. 1993; 268:2113-2119.

Li L, Olvera M, Yoder KE, Mitchell RS, Butler SL, Lieber M, Martin SL, Bushman FD: Role of non-homologous DNA end joining pathway in the early steps of refroviral infection. Embo J. 2001; 12:3272-3281.

Li Z, Schwieger M, Lange C, Kraunus J, Sun H, van den Akker E, Modlich U, Serinsoz E, Will E, von Laer D, Stocking C, Fehse B, Schiedlmeier B, Baum C. Predictable and efficient refroviral gene fransfer into murine bone marrow repopulating cells using a defined vector dose. Exp Hematol. 2003; in press

Loonstra A, Vooijs M, Beverloo HB, Allak BA, van Drunen E, Kanaar R, Berns A, Jonkers J. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc Natl Acad Sci USA. 2001; 98:9209-9214.

Lund AH, Duch M, Lovmand J, Jorgensen P, Pedersen FS. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer. J Virol. 1997; 71:1191-1195.

Masuda T, Kuroda MJ, Harada S. Specific and independent recognition of U3 and U5 att sites by human immunodeficiency virus type 1 integrase in vivo. J Virol. 1998; 72:8396-8402.

McDonald D, Vodicka MA, Lucero G, Svitkina TM, Borisy GG, Emennan M, Hope TJ. Visualization of the intracellular behavior of HIV in living cells. J Cell Biol. 2002; 159:441-452.

Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063- 1070.

Poon B, Chen IS. Human immunodeficiency virus type 1 (HIV-1) Vpr enhances expression from unintegrated HIV-1 DNA. J Virol. 2003; 77:3962-3972.

Schambach, A., Wodrich, H., Hildinger, M., Bohne, J., Krausslich, H. G., and Baum, C. (2000). Context dependence of different modules for posttranscriptional enhancement of gene expression from retroviral vectors. Mol. Ther. 2, 435-445.

Silver, D. P., and Livingston, D. M. (2001). Self-excising retroviral vectors encoding the Cre recombinase overcome Cre-mediated cellular toxicity. Mol. Cell. 8, 233-243.

Thomas CE, Ehrhardt A, Kay MA: Progress and problems with the use of viral vectors for gene therapy. Nature Rev Genet. 2003; 4:346-358.

Zufferey, R., Donello, J. E., Trono, D., and Hope, Z. J. (1999). Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J. Virol. 73, 2886-2892.

Claims

CLAIMSWe claim:

1. A method for transient expression of a gene transcribed within a host cell comprising an RNA polynucleotide construct, wherein the RNA construct is capable of expressing the gene of interest or conversion into double-stranded DNA by reverse transcription, and wherein the resulting DNA construct is incapable of being converted into DNA for subsequent integration into the host cell genome.

2. The method of claim 1, wherein the RNA element is contained in a recombinant expression vector.

3. The method of claim 2, wherein the vector is a viral vector.

4. The method of claim 3, wherein the viral vector is an RNA virus.

5. The method of claim 3, wherein the viral vector is a retrovirus.

6. The method of claim 2, wherein the host cell is a mammalian cell.

7. The method of claim 2, wherein the vector is a replication-deficient virus.

8. The method of claim 2, wherein the gene of interest is selected from the group consisting of genes capable of encoding for a hormone, an enzyme, a receptor, a post-receptor signal transmitter, a transcription factor, an endonuclease, a recombinase, a DNA repair protein and a drug of interest.

9. The method of claim 2, wherein the vector is a genetically engineered, non- infectious and non-replicating virus-like particle comprising a positive strand mRNA.

10. The method of claim 2, wherein the vector is deficient in integrase or reverse transcriptase wherein the deficiency is by a method selected from the group consisting of mutation of the fransfereed RNA, mutation of refroviral proteins, by drug treatment and combinations thereof.

11. The method of claim 2, wherein all or part of the vector is deleted or rendered non-functional in a region coding for a primer binding site (PBS) or a poly purine tract (PPT) or both.

12. The method of claim 1, wherein the vector is deficient in short, partially-inverted repeats at the ends of the LTR.

13. The method of claim 1, wherein all or part of at least one gene for the signals for reverse transcription is deleted or rendered non-functional.

14. The method of claim 1, wherein all or part of the vector is deleted or rendered non-functional in a region coding for a primer binding site (PBS).

15. The method of claim 1, wherein all or part of the vector is deleted or rendered non-functional in a region coding for a polypurine tract (PPT).

16. The method of claim 1, wherein the vector has two deficiencies comprising (a) a deficiency in at least one of integrase or reverse transcriptase and (b) a deficiency in at least one of the primer binding site (PBS), the polypurine tract, and the partially inverted repeats at the ends of the LTR.

17. The method of claim 1, wherein the vector further includes a packaging signal for packaging the vector in an infectious viral particle.

18. The method of claim 1, wherein the vector further comprises a gene encoding a recombinase such as Cre or an integrase, the transient expression of which provides a permanent alteration of the host cell genome.

19. The method of claim 1, wherein the vector further comprises a mammalian marker gene, the expression of which provides a detectable phenotype in a host cell.

20. The method of claim 1, wherein the vector further comprises a gene regulating proliferation, differentiation, migration or cell death, the transient expression of which provides a detectable phenotype in a host cell.

21. The method of claim 19, wherein the mammalian marker gene encodes a fluorescent protein or an enzyme, which can alter the fluorescence of the host cell.

22. The method of claim 21, wherein the mammalian marker gene encodes a green fluorescent protein.

23. The method of claim 1, wherein the vector further comprises a constitutive transcriptional regulatory sequence for regulating transcription of the heterologous nucleic acid in the host cell.

24. The method of claim 1, wherein the retroviral vector is derived from a replication- deficient retrovirus lacking all or a portion of the refroviral gag, pol and/or env genes.

25. An RNA polynucleotide construct comprising a gene of interest, wherein the RNA construct is capable of expressing the gene within a host cell and wherein the RNA construct is incapable of integrating into the host cell genome.

26. The construct of claim 25, wherein the RNA element is contained in a recombinant expression vector.

27. The construct of claim 26, wherein the vector is a viral vector.

28. The construct of claim 27, wherein the virus is selected from the group consisting of a retrovirus and an RNA virus with a plus-stranded genome.

29. The construct of claim 28, wherein the virus is a replication-deficient virus.

30. The construct of claim 29, wherein the gene of interest is selected from the group consisting of genes capable of encoding for a hormone, an enzyme, a receptor, a post-receptor signal transmitter, a transcription factor, an endonuclease, a recombinase, a DNA repair protein and a drug of interest.

31. The construct of claim 25, wherein the vector is a genetically engineered, non- infectious and non-replicating virus-like particle comprising a positive strand mRNA.

32. The construct of claim 31 , wherein the vector is deficient in integrase or reverse transcriptase wherein the deficiency is by a method selected from the group consisting of mutation of the transfened RNA, mutation of refroviral proteins, by drug treatment and combinations thereof.

33. The construct of claim 25, which is deficient in (1) integrase or reverse transcriptase and (2) deficient in the primer binding site (PBS) or the partially inverted repeats at the ends of the LTR.

34. The construct of claim 25, which is deficient in one or more regions selected from the group consisting of a primer binding site, partially inverted repeats at the ends of the LTR, one or more signals for reverse transcription, a Primer Binding Site (PBS), and a polypurine tract (PPT).

35. An isolated host cell comprising the construct of claim 25.

36. A composition comprising the cells of claim 35 and a carrier.

37. A composition comprising the retroviral vector particle of claim 31 and a carrier.

38. The retroviral vector particle according to claim 37, wherein the gene of interest encodes a therapeutic protein.

39. A recombinant retroviral vector system which is capable of producing a refroviral particle, comprising a retroviral vector according to claim 25.

40. An isolated refroviral particle produced by the retroviral vector system of claim 39.

41. A recombinant but non-integratingretro viral provirus produced by infecting a target cell with the refroviral particle of claim 31.

42. A method for expressing a gene product comprising introducing a gene of interest into a cell by contacting said cell with the retroviral vector particle according to claim 31.

43. The refroviral production system of claim39 wherein the genome includes an operable promoter.

44. The refroviral production system of claim 43 wherein the promoter is a non- retroviral promoter.

45. A method for expressing a gene of interest or replicating a nucleic acid molecule therefor comprising contacting a cell with the refroviral vector particle of claim 39.

46. A retroviral vector production system for producing the infection and transduction competent, retrovirus-based vector particle according to claim 1, which system comprises RNA sequence(s) encoding one or more genes of interest, wherein the RNA construct is capable of expressing the gene of interest and wherein the RNA construct is incapable of integrating into the host cell genome.

47. The retroviral vector production system according to claim 46, wherein the gene of interest encodes a therapeutic protein.

48. A method for expressing a gene product comprising introducing a gene of interest into a cell by contacting said cell with the retroviral vector particle according to claim 47.