JP2001510053A - Lentivirus vector - Google Patents

Abstract

(57) Abstract: A 5 ′ lentivirus LTR, a tRNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, an origin of second strand DNA synthesis, and a 3 ′ lentivirus LTR A lentiviral vector is provided, wherein the lentiviral vector contains a nuclear translocation element that is not an RRE. Expression cassettes and packaging cell lines for producing lentiviral vector particles are also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

TECHNICAL FIELD The present invention relates generally to pharmaceutical compositions and methods, and more specifically to lentiviral vectors suitable for a wide variety of gene therapy applications.

BACKGROUND OF THE INVENTION Since the discovery of nucleic acids in the 1940's, and continually throughout the most recent age of biotechnology, it can affect the course of disease through the interaction of living organisms with nucleic acids. Substantial research has been done to realize this possibility. Most recently, a wide variety of methods have been described for altering or affecting genes, including viral vectors derived from retroviruses, adenoviruses, vaccinia viruses, herpes viruses, and adeno-associated viruses. (Jolly, Cancer Gene Therapy 1
(1): 51-64, 1994).

[0002] Of these technologies, the recombinant retroviral gene delivery method is the most widely used. It is partly due to the following reasons: (1) efficient entry of genetic material (vector genome) into cells; (2) an active and efficient process of entry into target cell nuclei; (3) relatively high Level of gene expression; (4) the ability to target specific cell subtypes via control of vector-target cell binding and tissue-specific control of gene expression; (5) general lack of existing host immunity. And (6) substantial knowledge and clinical experience gained with such vectors.

[0003] Briefly, retroviruses replicate via integrated DNA intermediates.
It is a diploid positive strand RNA virus. In particular, upon infection by an RNA virus, the retroviral genome is reverse transcribed into DNA by a reverse transcriptase encoded by the virus carried as a protein in each retrovirus. Then
Viral DNA is pseudo-randomly integrated into the infected cell's host genome to form a "provirus" that is inherited by daughter cells.

One type of retrovirus, murine leukemia virus or “MLV”
It is widely used in gene therapy applications (see generally Mann et al. (Cell 3).
3: 153, 1983), Cane and Mulligan (Proc. Nat.
'l. Acad. Sci. USA 81: 6349, 1984), and Mi.
ller et al., Human Gene Therapy 1: 5-14, 1990.
checking). However, one major disadvantage of MLV-based vectors is that they have a limited host range (ie, cells infected with the vector), and the frequency of transduction of non-replicating cells is generally low.

[0005] To improve lentivirus-based gene therapy vectors for particular applications, the present invention provides improved lentivirus-based vectors and packaging cell lines. The present invention also provides other related advantages.

SUMMARY OF THE INVENTION Briefly, in one aspect of the invention, the 5 ′ lentiviral LTR, t
Lentiviral vectors are provided that include an RNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, an origin of second strand DNA synthesis, and a 3 ′ lentiviral LTR. Here, the lentiviral vector contains a nuclear localization element. The nuclear translocation element can be located either upstream (5 ') or downstream (3') of the gene of interest. In certain embodiments, the nuclear localization element is not an RRE. In one embodiment, the packaging signal is an extended packaging signal. In other embodiments, the promoter is a tissue-specific promoter or a promoter such as CMV. In a further embodiment, the lentiviral vector further comprises an internal ribosome entry site.

[0007] In various embodiments, the lentiviral vector expresses the gene of interest (eg, a heterologous sequence; however, in certain embodiments, a lentivirus such as HIV env may also be expressed). Representative examples of suitable genes of interest include cytokines, insulin, β-gal, alkaline phosphatase (eg, placental alkaline phosphatase), green fluorescent protein, factor VIII,
Includes Factor IX, LDL receptor, human growth hormone, EPO, TPO, prodrug activating enzyme, trans-dominant negative viral or cancer-associated protein, and tyrosine hydroxylase.

[0008] A wide variety of lentiviruses may be utilized within the context of the present invention, including, for example, lentiviruses selected from the group consisting of HIV, HIV-1, HIV-2, and SIV.

In another aspect of the present invention, an expression cassette is provided. In one embodiment, the promoter and the sequence encoding gag / pol, and vpr,
A gag / pol expression cassette is provided, comprising a sequence encoding at least one of vpu, nef, or vif, wherein the promoter comprises gag
/ Pol and operably linked to vpr, vpu, nef, or vif. In another embodiment, a promoter and a tat expression cassette comprising a sequence encoding tat and a sequence encoding at least one of vpr, vpu, nef, or vif are provided, wherein the promoter comprises tat, and Operably connected to vpr, vpu, nef, or vif. In a further embodiment, a promoter, and a sequence encoding rev, and at least one of vpr, vpu, nef, or vif.
A rev expression cassette is provided, comprising a coding sequence for one of the two, wherein the promoter is operably linked to rev and vpr, vpu, nef, or vif. In still other embodiments, the promoter, and the VSV-
A VSV-G expression cassette is provided comprising a sequence encoding G and a sequence encoding at least one of vpr, vpu, nef, or vif, wherein the promoter is VSV-G, and vpr, Operably connected to vpu, nef, or vif.

[0010] In yet another aspect of the invention, a host cell (eg, a packaging cell line)
Is provided, which contains any of the expression cassettes described herein. For example, in one aspect, there is provided a packaging cell line comprising a sequence encoding gag / pol and an expression cassette comprising a nuclear translocation element,
Here, the promoter is operably linked to a sequence encoding gag / pol. In one aspect, a packaging cell line is provided that includes a promoter and a sequence encoding a tat, rev, or envelope (eg, VSV-G), wherein the promoter encodes a tat, rev, or envelope. Operably linked to the array. In a further embodiment, the packaging cell line may further comprise a sequence encoding any one or more of nef, vif, vpu, or vpr. In another embodiment, the expression cassette is stably integrated. In yet another embodiment, the packaging cell line, upon introduction of a lentiviral vector, to produce particles in a concentration not greater than 10 ⁵ cfu / ml. In a further embodiment, the promoter is inducible. In certain preferred embodiments of the present invention, the packaging cell line comprises
Upon induction of the lentiviral vector, it produces particles free of replication competent virus.

In yet another aspect of the invention, an expression cassette that directs the expression of the gag / pol gene, an expression cassette that directs the expression of the env gene (eg, VSV-G or amphipathic envelope), and a Tat expression An indicating expression cassette, and R
A packaging cell line is provided that contains an expression cassette that directs ev expression. In a further aspect, a lentiviral vector is introduced into a packaging cell line to produce a vector-producing cell line.

[0012] In a further aspect, there is provided a method for enhancing the production of an infectious virus, comprising infecting a packaging cell line with a viral vector, wherein butyrate (eg, butyric acid) is provided. Sodium or potassium butyrate) is added following or after infection of the packaging cell line. In certain embodiments, butyrate is added prior to the step of recovering the infectious virus.

[0013] These and other aspects of the invention will become apparent with reference to the following detailed description and accompanying drawings. In addition, various references are set forth below in more detail describing particular procedures or compositions (e.g., plasmids, etc.), and are therefore noted in their entirety, each of which is individually incorporated. Used as a reference as if

DETAILED DESCRIPTION OF THE INVENTION Before presenting the present invention, it will be helpful for an understanding of the present invention to provide definitions of certain terms used hereinafter.

“Vector constructs”, “lentiviral vectors”, and “recombinant lentiviral vectors” are nucleic acid constructs that carry a nucleic acid molecule of interest and, in certain embodiments, can direct the expression of the nucleic acid molecule of interest. Say. Lentiviral vectors provide for gene expression by at least one transcription promoter / enhancer or locus-defining element, or by other means (eg, alternative splicing, nuclear RNA export, messenger post-translational modification, or protein post-translational modification). Must include other elements to control. Such a vector construct may also include a packaging signal, a long terminal repeat (LTR) or a portion thereof,
As well as positive and negative strand primer binding sites that are appropriate for the retrovirus used (if they are not already present in the retrovirus). Optionally, the recombinant lentiviral vector also contains a signal that directs polyadenylation, a selectable marker (eg, Neo, T
K, hygromycin, phleomycin, histidinol, or DHFR), and one or more restriction sites and translation termination sequences. By way of example, such vectors are typically 5 'LTR, tR
NA binding site, packaging signal, origin of second strand DNA synthesis, and 3 '
Includes LTR or portions thereof.

“Lentiviral vector particles” used in the present invention include at least one
Lentivirus that carries two genes of interest. Retroviruses can also contain a selectable marker. Recombinant lentivirus can reverse transcribe the genetic material into DNA and integrate the genetic material into host cell DNA upon infection. Lentiviral vector particles can have a lentiviral envelope, a non-lentiviral envelope (eg, an ampho or VSV-G envelope), or a chimeric envelope.

“Nucleic acid expression vector” or “expression cassette” refers to an assembly that can direct the expression of a sequence or gene of interest. The nucleic acid expression vector must include a promoter that, when transcribed, is operably linked to the sequence or gene of interest, as well as polyadenylation sequences. In certain embodiments of the invention, the nucleic acid expression vectors described herein can be included in a plasmid construct. In addition to the components of the nucleic acid expression vector, the plasmid construct also provides a bacterial origin of replication,
One or more selectable markers, a signal that allows the plasmid construct to be present as single-stranded DNA (eg, the M13 origin of replication), multiple cloning sites, and a “mammalian” origin of replication (eg, SV40 or adenovirus replication) Origin)
May be included.

“Packaging cell” is deficient in a recombinant retroviral vector,
A cell that contains the elements necessary for the production of an infectious recombinant retrovirus. Typically, such packaging cells contain one or more expression cassettes capable of expressing the proteins encoding the gag, pol, and env proteins.

“Producer cell” or “vector producing cell” refers to a cell that contains all the elements required for the production of recombinant retroviral particles.

(Construction and Preparation of Lentiviral Vector) As described above, the present invention provides a lentiviral vector designed to carry or express a selected gene or sequence of interest. Lentiviral vectors can be readily constructed from a wide variety of lentiviruses (RNA Tu
mor Viruses, Second Edition, Cold Spri
ng Harbor Laboratory, 1985). Representative examples of lentiviruses include HIV, HIV-1, HIV-2, and SIV.
Such lentiviruses may be obtained from patient isolates or, more preferably, from the American Type Culture Collection (ATCC, Rockville, MD).
Can be obtained from a depository or collection such as, or isolated from known sources using commonly available techniques.

[0021] Any of the above lentiviruses may be prepared using the disclosure and standard recombinant techniques provided herein (eg, Sambrook et al., Molecular Clon).
ing: A Laboratory Manual, 2nd edition, Cold Sp
ring Harbor Laboratory Press, 1989; K
Uncle, PNAS 82: 488, 1985), and can be readily utilized to assemble or construct a lentiviral gene delivery vehicle. Further, in certain embodiments of the invention, the portions of the lentiviral gene delivery vehicle may be from different viruses. For example, in one embodiment of the invention, the recombinant lentiviral vector LTR may be from HIV, the packaging signal may be from SIV, and the origin of second strand synthesis may be from HIV-2.

In one aspect of the invention, a lentiviral vector construct comprising a 5 ′ lentiviral LTR, a tRNA binding site, a packaging signal, one or more heterologous sequences, a second strand DNA synthesis origin, and a 3 ′ LTR Wherein the lentiviral vector contains a nuclear translocation element that is not an RRE. Briefly, the long terminal repeat ("LTR") is subdivided into three elements called U5, R, and U3. These elements include various signals responsible for the biological activity of the retrovirus, such as promoter and enhancer elements located in U3. LTRs can be easily identified in proviruses (integrated DNA form) due to their precise replication at either end of the genome. As used herein, it is understood that the 5 'LTR contains a 5' promoter element, and often sufficient LTR sequences to allow reverse transcription and integration of the DNA form of the vector. Should. It should be understood that the 3 'LTR contains a polyadenylation signal, as well as enough LTR sequences to allow reverse transcription and integration of the DNA form of the vector.

[0023] The tRNA binding site and origin of second strand DNA synthesis are also important for the retrovirus to be biologically active and can be readily identified by those skilled in the art. For example, a retroviral tRNA binds to the tRNA binding site by Watson-Crick base pairing and is carried along with the retroviral genome into a viral particle. The tRNA is then used as a primer for DNA synthesis by reverse transcriptase. The tRNA binding site can be easily identified based on its position immediately downstream of the 5 'LTR. Similarly, the origin of second strand DNA synthesis, as the name implies, is important for retrovirus second strand DNA synthesis. This region, also referred to as a poly-purine region, is located just upstream of the 3 'LTR.

[0024] In addition to the 5 'and 3' LTRs, the tRNA binding site, and the origin of second strand DNA synthesis, certain preferred recombinant retroviral vector constructs provided herein also include a packaging signal, As well as one or more genes of interest, each of which is discussed in more detail below. In addition, lentiviral vectors have a nuclear localization element, which in a preferred embodiment is RR
Not E. Representative examples of suitable nuclear translocation elements include elements in the Rous sarcoma virus (Ogert et al., J. Virol. 70, 3834-384).
3, 1996), an element in Rous sarcoma virus (Liu & Mert).
z, Genes & Dev. , 9, 1766-1789, 1995), and elements in the genome of the simian retrovirus type I (Zolotukhin et al., J. Virol. 68, 7944-7952, 1994). Other potential elements include histone genes (Kedes, Annu. Rev. Bioc).
hem. 48, 837-870, 1970), the alpha interferon gene (Na
Gata et al., Nature 287, 401-408, 1980), β-adrenergic receptor gene (Koilka et al., Nature 329, 75-).
79, 1987), and the c-Jun gene (Hattori et al., Proc.
Natl. Acad. Sci. USA 85, 9148-9152, 1988)
The element in is included.

In one aspect of the invention, there is provided a recombinant lentiviral vector construct that deletes both the gag / pol coding sequence and the env coding sequence. As used herein, the phrase "deleting the gag / pol or env coding sequence" refers to the fact that the recombinant lentiviral vector is used in the gag / pol or env gene, particularly as described below and in the Examples. 1, at least 20, preferably at least 15, more preferably at least 20 found in the gag / pol or env expression cassette used to construct the packaging cell line for the recombinant retroviral vector construct shown in more detail. Should be understood to mean not containing at least 10, and most preferably at least 8, consecutive nucleotides.

As one illustration, in one embodiment of the present invention, the construction of a recombinant lentiviral vector construct lacking gag / pol or env sequences comprises a vector construct lacking an extended packaging signal. Can be achieved by preparing As used herein, the phrase "extended packaging signal" refers to a sequence of nucleotides that exceeds the minimum core sequence required for packaging, which is increased by enhanced packaging. Allows virus titers.

In certain embodiments of the present invention, there is provided a lentiviral vector, wherein a tissue-specific promoter is used to drive expression of one or more genes of interest. For example, lentiviral vector particles of the present invention can include a liver-specific promoter that maximizes the ability for liver-specific expression of foreign DNA sequences contained in the vector. Preferred liver-specific promoters include the Hepatitis B X gene promoter and the Hepatitis B core protein promoter. These liver-specific promoters are preferably utilized with their respective enhancers. Enhancer elements are 5 'or 3' of the nucleic acid encoding the therapeutic molecule.
'Can be linked to either end. The hepatitis B X gene promoter and its enhancer are described in Twu, 1987, j. Virol. 61: 3448-3453
Utilizing the method described in, the DNA fragment can be obtained from the viral genome as a 332 base pair EcoRV-NcoI DNA fragment. The hepatitis B core protein promoter can be obtained from the viral genome as a 584 base pair BamHI-BglII DNA fragment using the method described in Gerlach, 1992, Virol 189: 59-66. Before inserting the BamHI-BglII fragment, it may be necessary to remove the negative regulatory sequences of the BamHI-BglII fragment. Other liver-specific promoters include AFP
(Α fetal protein) gene promoter and albumin gene promoter (disclosed in EP Patent Application No. 0415731), -1 antitrypsin gene promoter (Rettenger, 1994, Proc. Natl. Acad. Sc).
i. 91: 1460-1464), a fibrinogen gene promoter, an APO-A1 (apolipoprotein A1) gene promoter, and a promoter gene for liver transferase (eg, SGOT, SGPT, and glutamyltransferase). For a description of the use of liver-specific promoters in lentiviral vector particles, see PCT Patent Publication WO 90 /
See 07936 and WO 91/02805.

[0028] In certain embodiments of the invention, the lentiviral vector constructs provided herein can be generated such that one or more genes of interest are expressed. This means that di- or oligo-cistronic cassettes (for example, if the coding region is 80
Separated by no more than nucleotides. In general, Levin et al., Gene 108:
167-174, 1991) or through the use of an internal ribosome entry site ("IRES").

Packaging / Producer Cell Line Packaging cell lines for use with the above-described recombinant retroviral vector constructs can be readily prepared given the disclosure herein. Briefly,
The parent cell line from which the packaging cell line is derived can be selected from a wide variety of mammalian cell lines including, for example, human cells, monkey cells, dog cells, mouse cells, and the like.

In one embodiment of the invention, potential packaging cell line candidates are screened by isolating the human placental alkaline phosphatase (PLAP) gene from pBAAP and inserting that gene into pNL4-3. You.
To produce infectious virus, the construct is co-transfected with pCMV-G into 293 cells, and the virus is recovered 48 hours after transfection. The resulting virus is a candidate host cell (eg, He
La, HY1080, 293, human cells such as Jurkats, supT1, and CEM), which can subsequently be used to infect PLAP
Is screened using an antibody specific for Production of p24 and reverse transcriptase can also be analyzed in the evaluation of appropriate packaging cell lines.

After selection of an appropriate host cell for the generation of a packaging cell line, one or more expression cassettes are introduced into the cell line to supplement or supply the trans component of the vector that has been deleted. (See generally, US application Ser. No. 08 / 240,030 filed May 9, 1994; also, US application Ser. No. 07 / 800,921 filed Nov. 27, 1991.) See also).

[0032] Representative examples of suitable expression cassettes include promoters, as well as gag / po
1 and a gag / pol expression cassette comprising a sequence encoding at least one of vpr, vpu, nef, or vif. Here, the promoter is operably linked to gag / pol and vpr, vpu, nef, or vif. In another embodiment, the promoter, and the sequence encoding tat, and vpr, vpu, nef, or vif
There is provided a tat expression cassette comprising a sequence encoding at least one of the following. Here, the promoter is operably linked to tat and vpr, vpu, nef, or vif. In a further embodiment, there is provided a rev expression cassette comprising a promoter, and a sequence encoding rev, and a sequence encoding at least one of vpr, vpu, nef, or vif. Here, the promoter is rev, and vpr, vpu,
operatively connected to nef or vif. In still other embodiments, the promoter and the sequence encoding VSV-G, and vpr, vpu
Comprising a sequence encoding at least one of, nef, or vif
A VG expression cassette is provided. Here, the promoter is VSV-G,
And operably connected to vpr, vpu, nef, or vif.

Using the above expression cassettes, a wide variety of packaging cell lines can be generated. For example, in one aspect, there is provided a packaging cell line comprising a sequence encoding gag / pol and an expression cassette comprising a nuclear translocation element, wherein the promoter is operable with the sequence encoding gag / pol. It is connected to. In another aspect, there is provided a packaging cell line comprising a promoter and a sequence encoding tat, rev, or envelope (eg, VSV-G), wherein the promoter encodes tat, rev, or envelope. Operably linked to the array. In a further embodiment, the packaging cell line may further comprise a sequence encoding any one or more of nef, vif, vpu, or vpr. For example, the packaging cell line may include nef, vif, vpu, or vpr alone, nef and vif, n
ef and vpu, nef and vpr, vif and vpu, vif and v
all four of pr, vpu and vpr, nef vif and vpu, nef vif and vpr, nef vpu and vpr, vvir vpu and vpr, or nef vif vpu and vpr.

[0034] In another embodiment, the expression cassette is stably integrated. In yet another embodiment, the packaging cell line is one of the following when the lentiviral vector is introduced.
It produces particles with a concentration higher than 0 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , or 10 ⁹ cfu / ml. In a further embodiment, the promoter is inducible. In certain preferred embodiments of the invention, the packaging cell line produces particles free of replication competent virus upon introduction of the lentiviral vector.

Genes of Interest / Heterologous Nucleic Acid Molecules A wide variety of nucleic acid molecules can be carried and / or expressed by the lentiviral vector particles of the present invention. As used herein, "pathogenic agent"
Refers to cells that are responsible for the disease state. Representative examples of virulence factors include tumor cells, auto-responsive immune cells, hormone-secreting cells, cells that lack normal functions, cells with additional inappropriate gene expression that does not normally occur in that cell type, and Includes cells infected by bacteria, viruses, or endoparasites. In addition, "pathogenic agent" as used herein also refers to cells that have become tumorigenic by improper insertion of a nucleic acid molecule contained in a lentiviral vector into the genome of the host cell.

Examples of nucleic acid molecules that can be carried and / or expressed by the lentiviral vector particles of the present invention include genes encoding substances and other nucleic acid molecules, as well as incorporation into and inactivation of a particular nucleic acid molecule. Biologically active nucleic acid molecules such as inactivating sequences. A nucleic acid molecule is considered biologically active if the molecule itself provides the desired benefit. For example, a biologically active nucleic acid molecule can be an inactivating sequence that integrates into and inactivates a particular intracellular nucleic acid molecule, or the molecule can be a tRNA having a configuration that provides binding ability.
, RRNA, or mRNA.

Substances that can be encoded by the nucleic acid molecules described herein include proteins (eg, antibodies, including single-chain molecules), immunostimulatory molecules (eg, antigens), immunosuppressive molecules, blocking agents, palliatives Agents (eg, toxins, antisense ribonucleic acids, ribozymes, enzymes, and other materials that can inhibit the function of virulence factors), cytokines,
Various polypeptides or peptide hormones, if these hormones can be derived from tissues such as the pituitary, hypothalamus, kidney, endothelial cells, liver, pancreas, bone, hematopoietic bone marrow, and adrenal glands Agonists or antagonists are included. Such polypeptides can be used to induce tissue growth and regression, immune responses, apoptosis, suppression of gene expression, receptor-ligand interactions, blocking of immune responses, and in certain anemias, diabetes, infection High blood pressure, abnormal blood chemistry (eg, elevated blood cholesterol, deficiency of blood coagulation factors, elevated LD
L and reduced HDL), levels of Alzheimer's disease-associated amyloid alone, bone eosin / calcification, and the control of various metabolites (eg, steroid hormones, purines, and pyrimidines).

For a moderating agent, “capable of inhibiting function” when used in the context of the present invention means that the moderating agent directly inhibits the function or causes, for example, a factor present in the cell to be pathogenic. It should be understood that the function of the sex factor is indirectly either by converting from a factor that does not normally inhibit to a factor that does. Examples of such functions for viral diseases include adsorption, replication, gene expression, assembly, and export of virus from infected cells. Examples of such functions for cancerous diseases include cell replication, susceptibility to external stimuli (eg, contact inhibition), and lack of production of anti-oncogene proteins.
Examples of such functions for cardiovascular diseases include inappropriate growth or accumulation of substances in the blood vessels, high blood pressure, unwanted blood levels of factors such as cholesterol predisposing to the disease, or low density lipoproteins. , Localized hypoxia, and inappropriately high levels of free radicals and tissue damage. Examples of such functions for neurological conditions include pain, lack of dopamine production, inability to replace damaged cells, impaired motor control of physical activity, neurological tissue (eg, pituitary or These include inappropriately low levels of various peptide hormones from the hypothalamus, accumulation of Alzheimer's disease-related amyloid plaque protein, and the inability to regenerate damaged nerve binding sites. Examples of such functions for autoimmune or inflammatory diseases include inappropriate production of cytokines and lymphokines, inappropriate production and presence of autoimmune antibodies and cellular immune responses,
Inappropriate destruction of tissue by proteases and collagenases, lack of production of factors normally supplied by the disrupted cells, and excessive or abnormal regrowth of tissue under autoimmune attacks.

In one aspect of the invention, a method is provided for administration of a recombinant lentivirus that directs the expression of a palliative. Representative examples of palliatives that act directly to inhibit cell growth include toxins such as ricin (Lamb et al., Eur. J. Bio.
chem. 148: 265-270, 1985), Abrin (Wood et al., Eu).
r. J. Biochem. 198: 723-732, 1991; Evensen.
J. et al. ofBiol. Chem. 266: 6848-6852,991; Co
llins et al. ofBiol. Chem. 265: 8665-8669, 1
990; Chen et al., Fed. ofEur. Biochem Soc. 309:
115-118, 1992), diphtheria toxin (Tweten et al., J. Biol).
. Chem. 260: 10392-10394, 1985), cholera toxin (Me
kalanos et al., Nature 306: 551-557, 1983; San.
chez & Holmgren, PNAS 86: 481-485, 1989),
Gelonin (Stirpe et al., J. Biol. Chem. 255: 6947-69).
53, 1980), pokeweed (Irvin, Pharmac. Ther. 21)
: 371-387, 1983), antiviral proteins (Barbieri et al.,
Biochem. J. 203: 55-59, 1982; Irvin et al., Arch.
. Biochem. & Biophys. 200: 418-425, 1980;
rvin, Arch. Biochem. & Biophys. 169: 522-5
28, 1975), tritin, Shigella toxin (Calderwo)
od et al., PNAS 84: 4364-4368, 1987; Jackson et al.
Microb. Path. 2: 147-153, 1987), and Pseudomonas exotoxin A (Carroll and Collier, J. Biol. Chem).
. 262: 8707-8711, 1987). A detailed description of a recombinant retrovirus expressing Russell's viper snake venom is provided in US application Ser. No. 08 / 368,574, filed Dec. 30, 1994.

In another aspect of the invention, the lentiviral vector is not toxic per se, but is a toxic form when processed or modified by a protein such as a protease specific for the virus or other pathogen. Carries a gene that identifies the product that is converted to For example, a recombinant retrovirus may carry a gene encoding a proprotein chain that becomes toxic when processed by HIV protease. More particularly, a synthetic inactive proprotein form of the toxic lysine or diphtheria A chain is cleaved and activated by arranging it to recognize and cleave the appropriate "pro" element for the protease encoded by the HIV virus. It can be in any form.

In a related aspect of the invention, there is provided a lentiviral vector that directs the expression of a gene product that activates a compound having little or no cytotoxicity to a toxic product. Briefly, a wide variety of gene products that activate compounds having little or no cytotoxicity, either directly or indirectly, to toxic products can be utilized within the context of the present invention. . Representative examples of such gene products include:
HSVT to selectively monophosphorylate certain purine arabinoside and substituted pyrimidine compounds and convert them to cytotoxic or cytostatic metabolites
K and VZVTK. More specifically, the HSV of the drug ganglioside, acyclovir, or any analog thereof (eg, FIAC, DHPG)
Exposure to TK phosphorylates the drug to its corresponding active nucleotide triphosphate form.

For example, in one embodiment of the present invention, the lentiviral vector is HI
V promoter, which is known to be transcriptionally silent except when activated by the HIVtat protein, and is under its transcriptional control, herpes simplex virus thymidine kinase ("HSVTK") Directs gene expression. Briefly, tat gene expression in human cells infected with HIV and carrying the recombinant retrovirus results in increased production of HSVTK. The cell (either in vitro or in vivo) is then
Exposure to drugs such as ganciclovir, acyclovir, or analogs thereof (FIAC, DHPG). As noted above, these drugs are known to be phosphorylated by HSVTK (but not by cellular thymidine kinase) to its corresponding active nucleotide triphosphate form. Acyclovir triphosphate generally inhibits cellular polymerases, leading to a specific destruction of cells expressing HSVTK in transgenic mice (Borrelli et al.,
Proc. Natl. Acad. Sci. ScL USA 85: 7572, 1988). Cells containing the recombinant retrovirus and expressing the HIV tat protein are selectively killed by the presence of certain doses of these drugs.

In a similar manner to the above embodiments, lentiviral vectors carrying genes for phosphorylation, phosphoribosylation, ribosylation, or other metabolism of purine- or pyrimidine-based drugs can be generated. Such genes may have no equivalent in mammalian cells and may be derived from organisms such as viruses, bacteria, fungi, protozoa. Representative examples include: coli guanine phosphoribosyltransferase ("gpt") gene product, which converts thioxanthine to thioxanthine monophosphate (Besnard et al., M.
ol. Cell. Biol. 7: 4139-4141, 1987).
Alkaline phosphatase, which converts inactive phosphorylated compounds such as mitomycin phosphate and doxorubicin phosphate to toxic diphosphorylated compounds); converts 5-fluorocytosine to the toxic compound 5-fluorouracil Fungi (eg, Fusarium oxysporum) or bacterial cytosine deaminase (Mullen, PNAS 89:33, 19)
92); carboxypeptidase G2, which cleaves glutamic acid from para-N-bis (2-chloroethyl) aminobenzoylglutamic acid, thereby producing toxic benzoic mustard; Acetoavid (phenoxyacet)
abide) converts the derivative to a toxic compound). Gene products of this type, which are lethal by conditions, are used in many currently known purine-based or pyrimidine-based anticancer agents, which are often intracellular ribosylation or phosphorylation in order to be effective cytotoxic agents. Need). Conditionally lethal gene products can also metabolize non-toxic drugs that are neither purine nor pyrimidine analogs to cytotoxic forms (Searle et al., Brit. JC).
anther 53: 377-384, 1986).

In addition, if the target pathogen is a mammalian virus, the lentiviral vector is a vector in which the mammalian virus is generally required for the “immediate early” gene, which is required for subsequent transcriptional activation of other viral promoter elements. ) Can be constructed to take advantage of the fact that they tend to have Gene products with this property are:
It is a good candidate for an internal signal (or "identifier") of a viral infection. Thus, a gene that is lethal by conditions transcribed from a transcriptional promoter element that is responsive to such a viral "immediate early" gene product,
It can specifically kill cells infected with any particular virus. In addition, since human and interferon promoter elements are transcriptionally activated in response to infection by a wide variety of unrelated viruses, for example, these viral responsive elements (VRE) can be activated by conditions such as HSVTK. Introduction of a vector expressing a lethal gene product can result in the destruction of cells infected with a variety of different viruses.

In another embodiment of the present invention, producing a substance such as an inhibitor moderating agent,
Lentiviral vectors that inhibit viral assembly are provided. In this context, the recombinant retrovirus encodes a defective gag, pol, env, or other virion protein or peptide that inhibits the assembly of the virion in a predominant manner. Such inhibition occurs because the interaction of the normal subunit of the virion is disrupted by interaction with the defective subunit.

One way to increase the efficacy of an inhibitory alleviator is to express an inhibitory gene, such as a viral inhibitory gene, in combination with expression of a gene that increases the probability of infection of resistant cells by the virus in question. That is. The result is a non-productive "dead-end" event that competes with the productive infection event. HIV
In certain cases, HIV replication is inhibited (as described above, antisense ta
t, etc.), and also recombinant retroviruses that overexpress proteins required for infection, such as CD4. In this way, a relatively small number of vector-infected HIV-resistant cells may have a "sink" for multiple non-productive fusion events in free virus or virus-infected cells.
) "Or" magnet ".

In another embodiment of the present invention, there is provided a lentiviral vector for an expression material, such as an inhibitory peptide or inhibitory protein specific for a viral protease. Viral proteases cleave viral gag and gag / pol proteins into a number of smaller peptides. This failure to cleave in all cases results in complete inhibition of the production of infectious retroviral particles. HIV proteases are known to be aspartyl proteases, and they are known to be inhibited by peptides generated from amino acids derived from proteins or analogs. Lentiviral vectors that inhibit HIV express one or more fused copies of such a peptide inhibitor.

[0048] Administration of the lentiviral vectors discussed above should be effective against many virus-related diseases, cancers, or other virulence factors.

In yet another aspect, a therapeutic effect is obtained by encoding one or more ribozymes (RNA enzymes), which cleave the RNA molecule corresponding to the pathogenic function and therefore inactivate it. Is provided (Has
eloff and Gerlach, Nature 334: 585, 1989.
). Ribozymes function by recognizing a particular sequence in a target RNA, and since this sequence is usually 12-17 bp, this translates into specific RNA sequences (eg, HIV tat) that correspond to a pathogenic state. It allows specific recognition and toxicity is specific for such pathogenic states. Representative examples of suitable ribozymes include hammerhead ribozymes (Rossi et al., Pharmac.
. Ther 50: 245-254, 1991) and hairpin ribozymes (Hampel et al., Nucl. Acids Res. 18: 299-).
304, 1990; U.S. Patent No. 5,254,678) and Tetrahym.
ena-based ribozymes (US Pat. No. 4,987,071).
Further specificity may be achieved in some cases by making this a conditional moderator, as discussed above.

[0050] In yet another aspect, there is provided a lentiviral vector comprising a biologically active nucleic acid molecule that is an antisense sequence (the antisense sequence may also be encoded by the nucleic acid sequence, and then And can be produced in host cells)
. Briefly, antisense sequences are designed to bind RNA transcripts, thereby preventing cellular synthesis of a particular protein or preventing use of this RNA sequence by cells. Representative examples of such sequences include antisense thymidine kinase, antisense dihydrofolate reductase (Maher
And Dolnick, Arch. Biochem. & Biophys. 25
3: 214-220, 1987; Bzik et al., PNAS 84: 8360-836.
4, 1987), antisense HER2 (Coussens et al., Science).
230: 1132-1139, 1985), antisense ABL (Fains).
tein et al., Oncogene 4: 1477-1481, 1989), antisense Myc (Stanton et al., Nature 310: 423-425,1).
984), and antisense ras, as well as antisense sequences that block any enzyme in the nucleotide biosynthetic pathway. In another embodiment, the antisense sequence comprises an influenza virus, HIV, HSV, HPV.
, CMV, and HBV. The antisense sequence can also be an antisense RNA complementary to an RNA sequence required for virulence. Alternatively, the biologically active nucleic acid molecule can be a sense RNA (or DNA) that is complementary to an RNA sequence required for virulence.

[0051] In a further embodiment of the invention, the antisense RNA comprises a potent class I
It can be utilized as an anti-tumor agent to induce a restricted response. Briefly, R
In addition to binding to NA and thereby preventing translation of certain mRNAs, high levels of certain antisense sequences cause interferon (including gamma interferon) due to the formation of large amounts of double-stranded RNA. ) Is thought to induce increased expression. Increased expression of gamma interferon is then followed by MHC class I
Promotes antigen expression. Preferred antisense sequences for use in this regard include:
Actin RNA, myosin RNA, and histone RNA. Antisense RNA that forms a mismatch with actin RNA is particularly preferred.

[0052] In another embodiment, the lentiviral vectors of the invention express surface proteins that are themselves therapeutically beneficial. For example, in the specific case of HIV, expression of the human CD4 protein, particularly in HIV-infected cells, can be beneficial in two ways: Intracellular binding of CD4 to HIV env can inhibit the formation of viable viral particles, similar to what soluble CD4 has shown to inhibit for free virus, but with systematic clearance and possible immunogenicity Without the problem of This is because the protein remains membrane-bound and is structurally identical to endogenous CD4 (in contrast to which the patient should be immunologically tolerated).

[0053] 2. Since this CD4 / HIV env complex has been suggested to be responsible for cell death, additional expression of CD4 (excessive HIV-
(in the presence of env) leads to faster cell death and thus inhibits the spread of the virus. This is especially true for storage for virus production as a result of their relative refraction to HIV-induced cytotoxicity, which in turn seems to be due to the relative lack of CD4 on their cell surface. May be applicable to monocytes and macrophages, acting as sites.

[0054] Yet a further aspect of the invention relates to lentiviral vectors capable of immunostimulation. Briefly, the ability to recognize and protect against foreign pathogens is essential for the functioning of the immune system. In particular, the immune system shifts from “foreign” (ie, foreign) to “self”
Must be able to differentiate, so that the host defense mechanism goes directly to the invasion situation instead of against the host tissue. Cytolytic T lymphocytes (CTLs) are typically expressed by presenting cell surface recognition structures (eg, processed pathogen-specific peptides) in combination with MHC class I or class II cell surface proteins. Induced or stimulated.

[0055] Diseases suitable for treatment include influenza virus, respiratory syncytial virus, HPV
Viral infections such as HBV, HCV, EBV, HIV, HSV, FeLV, FIV, Hantavirus, HTLV I, HTLV II and CMV, cancers such as melanoma, kidney cancer, breast cancer, ovarian cancer and other cancers. , As well as heart disease.

In one embodiment, the present invention provides for viral transmission by using a lentiviral vector that stimulates a particular immune response and / or directs expression of an antigen or an altered form thereof in susceptible target cells. Wherein the antigen comprises: (1) mounting an immune response against the viral antigen;
Or (2) Prevent transmission of this virus by occupying cell receptors required for virus interaction. Expression of this protein may be transient or stable over time. If the immune response is to be stimulated against a pathogenic antigen, the lentiviral vector preferably stimulates the immune response and expresses a modified form of the antigen with reduced pathogenicity as compared to the native antigen Designed to be. This immune response indicates that the cells are in a precise manner (ie, in the context of MHC class I and / or II molecules with auxiliary molecules such as CD3, ICAM-1, ICAM-2, LFA-1, or analogs thereof). ) When presenting antigen (e.g. Altmann et al., Na
cure 338: 512, 1989).

The immune response can also be achieved by appropriate immune cells (eg, T lymphocytes) having (a) the gene for a particular T cell receptor that recognizes the antigen of interest (if necessary, the appropriate M
By transferring (b) the gene for an immunoglobulin that recognizes the antigen of interest, or (c) the gene for two hybrids that provide a CTL response in the absence of the NHC context). Can be achieved. Thus, recombinant retroviruses can also be used as immunostimulants, immunomodulators, vaccines and the like.

In the specific case of diseases caused by HIV infection, if immunostimulation is desired, antigens generated from the recombinant retrovirus elicit either or both HLA class I or class II restricted immune responses It can be in the form. H
In the case of an IV envelope antigen, for example, the antigen is preferably selected from gp160, gp120, and gp41, which have been modified to reduce their pathogenicity. In particular, the selected antigen removes epitopes that are immunodominant but haplotype specific, such as to reduce the likelihood of syncytia, to avoid expression of epitopes that lead to diseases that enhance the immune response Or some haplotype-specific epitopes are modified to allow for a response that can eliminate cells infected with most or all strains of HIV. The haplotype-specific epitope is further selected to promote stimulation of an immune response in animals that are cross-reactive with other strains of HIV. Other HIV genes or gag, pol, rev, vif, nef, prot, gag / pol,
Antigens from a combination of genes, such as gag prot and the like, may also provide protection in certain cases.

HIV is only one example. This approach can be utilized for many virus-related diseases or cancers in which characteristic antigens, which need not be membrane proteins, are expressed. Representative examples of such “disease-associated” antigens include all or a portion of various eukaryotic pathogens (eg, including parasites), prokaryotic pathogens (eg, bacteria), or viral pathogens. Can be Representative examples of viral pathogens include the following: Hepatitis B virus ("HBV") and Hepatitis C virus ("HCV"; see US patent application Ser. No. 08/102/132).
, Human papilloma virus ("HPV"; WO 92/05248; WO 90
EPO 133,123), Epstein Barr virus ("EBV"; EPO 173,254; JP 1,128,788; and U.S. Pat. Nos. 4,939,088 and 5,173). 414), feline leukemia virus ("FeLV"; US application Ser. No. 07 / 948,358).
No .; EPO 377,842; WO 90/08832; WO 93/0923
8), feline immunodeficiency virus ("FIV"; US Pat. No. 5,037).
No. 753; WO 92/15684; WO 90/13573; and JP
4,126,085), HTLV I and II, and human immunodeficiency virus ("HIV"; see U.S. Application No. 07 / 965,084).

In accordance with the immunostimulatory aspects of the present invention, the substances carried and / or expressed by the lentiviral vectors of the present invention may also include “immunomodulators,” many of which include
Explained above. An immunomodulatory factor is one that is produced by, or added exogenously to, one or more cells involved in the immune response, is of a quality or quality that will occur in the absence of the factor. Refers to factors that trigger a different immune response in potency. The factor can also be expressed from a gene from a non-recombinant virus, but this expression is driven or controlled by the recombinant retrovirus. The quality or potential of a response can be measured by various assays known to those of skill in the art, including, for example, in vitro assays that measure cell proliferation (eg, ³ H thymidine incorporation), and in vitro cytotoxicity assays ( For example, it measures ⁵¹ Cr release) (Warner et al., AIDS Res. And Human Re.
troubles 7: 645-655, 1991). Immunomodulators can be activated both in vivo and ex vivo.

Representative examples of such factors include the following cytokines: IL-1, L-2 (Karupiah et al., J. Immunology 144: 290-298, 1990; Weber et al., J. Exp. Med, 1
66: 1716-1733, 1987; Gansbacher et al. Exp.
Med. 172: 1217-1224, 1990; U.S. Pat. No. 4,738,9.
No. 27), IL-3, IL-4 (Tepper et al., Cell 57: 503-5).
12, 1989; Golumbek et al., Science 254: 713-71.
U.S. Pat. No. 5,017,691), IL-5, IL-6 (Br
akenhof et al. Immunol. 139: 4116-4121,19
87; WO 90/06370), IL-7 (U.S. Pat. No. 4,965,195), IL-8, IL-9, IL-10, IL-11, IL-12, IL-13 (
Cytokine Bulletin, Summer 1994), IL-1
4 and IL-15, especially IL-2, IL-4, IL-6, IL-12, and IL-13, alpha interferon (Finter et al., Drugs 42 (5):
749-765, 1991; U.S. Pat. No. 4,892,743; U.S. Pat.
No. 966,843; WO 85/02862; Nagata et al., Nature.
284: 316-320, 1980; Familletti et al., Methods.
in Enz. 78: 387-394, 1981; Twu et al., Proc. N
atl. Acad. Sci. USA 86: 2046-2050, 1989; F.
Aktor et al., Oncogene 5: 867-872, 1990), β-interferon (Seif et al., J. Virol. 65: 664-671, 1991).
), Gamma interferon (Radford et al., The American So
city of Hepatology 2008-2015, 1991; W
atanabe et al., PNAS 86: 9456-9460, 1989; Gans.
Bacher et al., Cancer Research 50: 7820-7825.
Maio et al., Can. Immunol. Immunother.
30: 34-42, 1989; U.S. Pat. No. 4,762,791; U.S. Pat. No. 4,727,138), G-CSF (U.S. Pat. Nos. 4,999,291 and 4,810,643). No.), GM-CSF (WO 85/04188), tumor necrosis factor (TNF) (Jayaramaman et al., J. Immunology 1).
44: 942-951, 1990), CD3 (Krissanen et al., Immu).
nogenetics 26: 258-266, 1987), ICAM-1 (A
Itman et al., Nature 338: 512-514, 1989; Simmo.
ns et al., Nature 331: 624-627, 1988), ICAM-2,
LFA-1, LFA-3 (Wallner et al., J. Exp. Med. 166 (
4): 923-932, 1987), MHC class I molecules, MHC class II molecules, B7.1-. 3, β ₂ -microglobulin (Parnes et al., PNAS 78: 2253-2257, 198l), chaperones such as calnexin, MH
C-linked transport proteins or analogs thereof (Powis et al., Nature 3
54: 528-531, 1991). Immunomodulators can also be agonists, antagonists or ligands of these molecules. For example, soluble forms of the receptor can often behave as antagonists for these types of factors, just as mutant forms of the factor itself can behave.

[0062] The choice of which immunomodulator to include in the lentiviral vector can be based on the known therapeutic effect of the agent or can be determined experimentally. For example, a known therapeutic effector in chronic hepatitis B infection is alpha interferon. This has been found to be effective in compensating the patient's immunological deficiency and thereby assisting in recovery from the disease. Alternatively, appropriate immunomodulators can be determined experimentally. Briefly, a blood sample is first obtained from a patient with liver disease. Peripheral blood lymphocytes (PBLs) are autologous cells or HLA-compatible cells (eg, EBV-transformed cells) transduced with a recombinant retrovirus that directs the expression of immunogenic portions of hepatitis antigens and immunomodulators. Restimulated in vitro. These stimulated PBLs were then targeted to H
Used as an effector in a CTL assay using LA-adapted transduced cells. An increase in the CTL response over that found in the same assay performed with HLA-matched stimulators and target cells transduced with the vector encoding the antigen alone indicates a useful immunomodulator. In one embodiment of the invention, the immunomodulator gamma interferon is particularly preferred.

The invention also includes a lentiviral vector encoding an immunogenic portion of a desired antigen, including, for example, a viral, bacterial, or parasite antigen. For example, at least one immunogenic portion of a hepatitis B antigen can be incorporated into a lentiviral vector. The immunogenic portion (s) incorporated into the lentiviral vector can be of various lengths, but generally it is preferably at least 9 amino acids in length and can include the entire antigen . While the immunogenicity of a particular sequence is often difficult to predict, T cell epitopes have been described by Falk et al.
HLA A2.1 as described by H.A. 351: 290, 1991).
Can be predicted by utilizing motifs. From this analysis, the peptides can be synthesized and used as targets in in vitro cytotoxicity assays. However, other assays may also be utilized, including, for example, ELISAs that detect the presence of antibodies to the newly introduced vector, as well as assays that test for T helper cells (eg, gamma interferon assay, IL-2
Production assays, and proliferation assays).

In one embodiment of the invention, at least one immunogenic portion of a hepatitis C antigen may be incorporated into a lentiviral vector. Preferred immunogenic portions of hepatitis C can be found in the C and NS3-NS4 regions. Because these regions are the most conserved among the various types of hepatitis C virus (Ho
Ughton et al., Hepatology 14: 381-388, 1991).
Particularly preferred immunogenic moieties can be determined by various methods. For example, as described above for hepatitis B virus, the identification of the immunogenic portion of the polypeptide
Predictions can be made based on the amino acid sequence. Briefly, various computer programs known to those of skill in the art can be utilized to predict CTL epitopes. For example, the CTL epitope for the HLA A2.1 haplotype is:
H described by Falk et al. (Nature 351: 290, 1991).
It can be predicted using the LA A2.1 motif. From this analysis, peptides are synthesized and used as targets in in vitro cytotoxicity assays.

Other disease-associated antigens that can be carried by the gene delivery constructs of the present invention include:
For example, immunogenic, non-tumorigenic forms of altered cellular components normally associated with tumor cells (see US Application No. 08 / 104,424). Representative examples of altered cellular components normally associated with tumor cells include: ras ^* (where " ^* " refers to an antigen that has been altered to be non-tumorigenic. P53 ^* , Rb ^* , altered proteins encoded by the Wilms oncogene, ubiquitin ^* , proteins encoded by mucin, DCC, APC and MCC genes, and neu, thyroid hormone receptor, platelets Derived growth factor ("PDGF") receptor, insulin receptor, epidermal growth factor ("EGF") receptor, and colony stimulating factor ("
CSF ") a receptor such as a receptor or a receptor-like structure.

[0066] The immunogenic portion of the disease associated antigens described herein can be selected by a variety of methods. For example, HLA A2.1 / ^Kb transgenic mice have been shown to be useful as models for human T cell recognition of viral antigens. Briefly, in the influenza and hepatitis B virus system, the mouse T cell receptor repertoire recognizes the same antigenic determinants as those recognized by human T cells. In both systems, the CTL response generated in the HLA A2.1 / K ^b transgenic mice is substantially directed to the same epitope as recognized by the human CTL of the HLA A2.1 haplotype (Vitiello et al.). J. Exp. Med. 173: 1007-1015.
Vitilello et al., Abstract of Molecula.
r Biology of Hepatitis B Virus Sympo
sia, 1992).

[0067] The immunogenic proteins of the present invention can also be manipulated by various methods known in the art to make them more immunogenic. Representative examples of such methods include: addition of an amino acid sequence corresponding to a T helper epitope; promotion of cellular uptake by addition of hydrophobic residues; formation of a particulate structure; or any of these. (Generally Hart, supra), Milich et al., Proc. Natl. Acad. Sci. USA 85: 1610-1614.
, 1988; Willis, Nature 340: 323-324,198.
9; Griffiths et al. Virol. 65: 450-456, 1991
).

The sequences encoding the above nucleic acid molecules can be obtained from a variety of sources. For example,
Plasmids containing sequences encoding altered cell products may be obtained from a depository such as the American Type Culture Collection (ATCC, Rockville, Maryland), or Advanced Biothologies (
(Columbia, Maryland).
Representative examples of plasmids containing some of the above sequences include ATCC No. 4
1000 (including a G to T mutation at the 12th codon of ras), and ATCC No. 41049 (including a G to A mutation at the 12th codon).

[0069] Other nucleic acid molecules that encode the above-described materials, as well as other nucleic acid molecules that are advantageous for use in the present invention, are available from a variety of sources, such as the American Type Culture Collection (ATCC, Rockville, Maryland). Including the depository institutions) or from British Bio-Technology L.
It is readily available from commercial sources such as limited (Cowley, Oxford England). Representative examples include: BBG
12 (including the GM-CSF gene encoding a mature protein of 127 amino acids), BBG6 (which includes the sequence encoding gamma interferon), ATC
C number 39656, which contains the sequence encoding TNF, ATCC number 2
0663 (which contains the sequence encoding alpha interferon), ATCC numbers 31902, 31902 and 39517 (which contains the sequence encoding beta interferon), ATCC 67024 (which contains interleukin-1b)
ATCC Nos. 39405, 39452, 39516
, 39626 and 39673, which contain the sequence encoding interleukin-2, ATCC numbers 59399, 59398, and 67326, which contain the sequence encoding interleukin-3, ATCC number 57592 (
This includes the sequence encoding interleukin-4), ATCC number 593.
94 and 59395, which contains the sequence encoding interleukin-5, and ATCC No. 67153, which contains the sequence encoding interleukin-6.

[0070] Molecularly cloned genomes encoding hepatitis B virus are available, for example, from the American Type Culture Collection (ATCC, Rockville,
(Maryland). For example, ATCC No. 45020 shows that the whole genome D of hepatitis B at the BamHI site of pBR322.
NA (extracted from purified Dane particles) (Blum et al., TIG 5 (5): 1
54-158, 1989 (see FIG. 3).
rc. Natl. Acad. Sci. USA 78: 2606-2610, 1
981). (Note that a correctable error occurs in the sequence of ATCC No. 45020).

Alternatively, a cDNA sequence for use in the present invention can be obtained from a cell that expresses or contains this sequence. Briefly, in one embodiment, mRNA from cells expressing the gene of interest is reverse transcribed with reverse transcriptase using oligo dT or random primers. The single-stranded cDNA can then be amplified by PCR (U.S. Pat. Nos. 4,683,202; 4,683,191).
No. 5, and No. 4,800,159). PCR using oligonucleotide primers complementary to the sequence on either side of the desired sequence
Technology: Principles and Applicati
ons for DNA Amplification, Erlich (eds.)
See also, Stockton Press, 1989. In particular, the double-stranded D
NA stands for thermostable Taq polymerase, sequence-specific DNA primers, ATP,
Denatured by heating in the presence of CTP, GTP, and TTP. Double-stranded DNA is produced when synthesis is complete. This cycle can be repeated many times, resulting in a factorial amplification of the desired DNA.

[0072] Nucleic acid molecules carried and / or expressed by the lentiviral vectors described herein may also be used, for example, in Applied Biosystems.
Inc. DNA synthesizer (for example, APB DNA synthesizer model 392 (Foste
r City, California).

Methods for Utilizing Lentiviral Vector Particles As described above, the present invention also provides a method for delivering a selected heterologous sequence to a vertebrate or insect, the method comprising: Administering a lentiviral vector particle as described herein, which is capable of expressing a selected heterologous sequence, to a vertebrate or insect. Such lentiviral vector particles can be directly (eg, intravenously, intramuscularly, intraperitoneally, subcutaneously, orally, rectally, intraocularly, intranasally) or lipofection (Felgner). Pro
c. Natl. Acad. Sci. USA 84: 7413-7417, 198.
9), direct DNA injection (Fung et al., Proc. Natl. Acad. Sci.
ScL USA 80: 353-357, 1983; Seeger et al., Proc. Nat
l. Acad. Sci. USA 81: 5849-5852; Acsadi et al.
Nature 352: 815-818, 1991);
ms et al., PNAS 88: 2726-2730, 1991); some types of liposomes (e.g., Wang et al., PNAS 84: 7851-7855, 198).
7); CaPO ₄ (Dubensky et al., PNAS 81: 7529-7533, 1984); DNA ligands (Wu et al., J. Biol. Chem.).
. 264: 16985-16897, 1989); Administration of nucleic acid alone (WO 9
0/11092); or administration of DNA conjugated to killed adenovirus (Cur
iel et al., Hum. Gene Ther. 3: 147-154, 1992); through the use of receptor-specific ligands via polycationic compounds such as polylysine; and psoralen inactivation such as Sendai or adenovirus. It can be administered either with a virus. Further, the lentiviral vector particles can be administered directly (ie, in vivo) or can be administered to the removed cells, which are subsequently returned.
(Ex vivo).

As discussed in more detail below, lentiviral vector particles are administered to vertebrate or insect organisms or cells for a wide variety of therapeutic or production purposes, including, for example, the following purposes: Obtain: for the purpose of stimulating a specific immune response; for the purpose of inhibiting the interaction of a host cell receptor with a factor; for the purpose of expressing a palliative, including, for example, a conditional palliative; for immunologically modulating the immune system To express a marker for replacement gene therapy and / or to produce a recombinant protein. These and other uses are discussed in more detail below.

(1. Immunostimulation) In one aspect of the present invention, lentiviral vector particles capable of preventing, inhibiting, stabilizing, or reversing an infectious disease, a cancerous disease, an autoimmune disease, or an immune disease are administered. Compositions and methods are provided. Representative examples of such diseases include: viral infections (eg, HIV, HBV, HC
V, HTLV I, HTLV II, CMV, EBV and HPV), melanoma,
Diabetes, graft-versus-host disease, Alzheimer's disease, and heart disease. More specifically, in one aspect of the invention, an immune response to the virulence factor (either humoral or cell-mediated) is stimulated such that the virulence factor is either killed or inhibited. And compositions and methods are provided. Representative examples of virulence factors include bacteria, fungi, parasites, viruses, and cancer cells.

In one embodiment of the invention, the virulence factor is a virus and a specific immune response using lentiviral vector particles that directs the expression of the antigen or a modified form thereof on susceptible cells. Provided is a method for stimulating the virus and inhibiting viral transmission, wherein the lentiviral vector particles are capable of (1) eliciting an immune response to a viral antigen or (2) providing a cellular receptor required for viral interaction Occupation can prevent virus transmission. Expression of the vector nucleic acid-encoding protein can be transient or stable over time. If the immune response is to be stimulated against a pathogenic antigen, the lentiviral vector described above preferably stimulates the immune response and reduces the virulence of the antigen, as compared to the native antigen. Designed to express a modified form. This immune response indicates that the cells are in a precise manner (ie, CD3
(Eg, in the context of MHC class I and / or II molecules with accessory molecules such as ICAM-1, ICAM-2, LFA-1, or analogs thereof) (eg, Altmann et al.). , Nature 338
: 512, 1989). Cells infected with lentiviral vector particles are expected to do this efficiently. Because they closely mimic real viral infections, and (a) can infect non-replicating cells, (b) are not integrated into the host cell genome, and (c) are not associated with any life-threatening diseases And (d) express high levels of the heterologous protein. Because of these differences, lentiviral vectors can easily be considered as safe viral vectors that can be used in healthy individuals for vaccine use.

[0077] This aspect of the invention is anticipated that the presenting cells will function in a similar manner in that they are fully viable and healthy, and express low levels of viral antigen as compared to the heterologous gene. It has additional advantages over other systems obtained. This shows a distinct advantage. Because the expressed antigenic epitopes can be altered by selective cloning of subfragments of the antigen's gene into lentiviral vector particles, or immunogenic epitopes that would otherwise be masked by immunodominant epitopes Leads to a response to Such an approach can be extended to the expression of peptides with multiple epitopes, where one or more of these epitopes are from different proteins. Furthermore, this aspect of the invention provides for efficient stimulation of cytotoxic T lymphocytes (CTLs) directed against antigenic epitopes and peptide fragments of the antigen encoded by subfragments of the gene. This is achieved through intracellular synthesis of peptide fragments and association with MHC class I molecules. This approach can be used to map key immunodominant epitopes for CTL induction.

The immune response can also be achieved by directing appropriate immune cells (eg, T lymphocytes) to a gene for a specific T cell receptor that recognizes the antigen of interest (if necessary, in the context of the appropriate MHC molecule). A gene for an immunoglobulin that recognizes the antigen of
Alternatively, it can be achieved by transferring genes for two hybrids that provide a CTL response in the absence of the MTC context. Thus, the lentiviral vector particles described above can be used as immunostimulators, immunomodulators, or vaccines.

In another embodiment of the present invention, there is provided a method for producing an inhibitor palliative, wherein the lentiviral vector delivers a defective interfering viral structural protein, which inhibits viral assembly. And express. Such lentiviral vector particles can encode defective gag, pol, env, or other virion proteins or peptides, and these predominantly inhibit virion assembly. This occurs because the interaction of the normal subunit of the virion is interrupted by interaction with the defective subunit.

In another embodiment of the present invention, there is provided a method for expression of an inhibitory peptide or protein specific for a viral protease. Briefly, viral proteases cleave viral gag and gag / pol proteins into a number of smaller peptides. This cleavage failure in all cases leads to a complete inhibition of the production of infectious retroviral particles. By way of example, HIV proteases are known to be aspartyl proteases, and these
It is known to be inhibited by peptides generated from amino acids from proteins or analogs. Lentiviral vectors that inhibit HIV express a fused copy of one or more of such peptide inhibitors.

Another embodiment relates to the delivery of a suppressor gene, which, when deleted, mutated or not expressed in a cell type, leads to tumor formation in that cell type. Reintroduction of the deleted gene by lentiviral vector particles leads to a regression of the tumor phenotype in these cells. Examples of such cancers are retinoblastoma and Wilms tumor. Since the malignancy can be considered to be the inhibition of cell terminal differentiation as compared to cell proliferation, administration of the lentiviral vector particles described above and expression of the gene product that leads to tumor differentiation generally regress. Should lead.

[0082] In yet another embodiment, the lentiviral vector is a ribozyme (
RNA enzymes) (Haseloff and Gerlach, Nature 33)
4: 585, 1989) to provide a therapeutic effect, and this ribozyme cleaves and thus inactivates RNA molecules corresponding to pathogenic functions. Ribozymes function by recognizing a specific sequence in a target RNA, and since this sequence is usually 12-17 bp, this implies specific recognition of a particular RNA species, such as RNA or a retroviral genome. enable. Further specificity may be achieved in some cases by making it a conditional safener (see below).

One way to increase the efficacy of an inhibitory palliative is to express a viral inhibitory gene in combination with expression of a gene that increases the likelihood of infection of resistant cells by the virus in question. This result indicates that the non-productive "dead-
end) "event, which competes with a productive infection event. In certain cases of HIV, it inhibits HIV replication (by expressing antisense tat and the like, as described above), and also proteins necessary for infection (eg, CD4).
Lentiviral vector particles overexpressing can be delivered. In this way, a relatively small number of vector-infected, HIV-resistant cells act as "sinks" or "magnets" for multiple non-productive fusion events involving free virus or virus-infected cells. I do.

2. Blocking Factors Many infectious diseases, cancers, autoimmune diseases, and other diseases are produced by viral particles and cells, cells by cells, or cells by themselves or other cells. And interaction with In viral infections, viruses generally enter cells via receptors on the surface of susceptible cells. In cancer or other proliferative conditions (eg, restenosis), cells may respond inappropriately or not at all to signals from other cells or factors, or certain factors may be mutated. It can be obtained, overexpressed, or underexpressed, resulting in a loss of proper cell cycle control. In autoimmune diseases, there is inappropriate recognition of "self" markers. In the present invention, such interactions can be blocked by producing analogs for any of the interaction partners in vivo. Alternatively, cell cycle control can be restored by preventing the transition from one phase to another (eg, G1 to S phase) with a blocking factor that is absent or underexpressed. This blocking action can occur intracellularly, on the cell membrane, or extracellularly, and the action of the lentiviral vector particles carrying the gene for the blocking factor can be from inside a sensitive cell or from a version of this blocking protein. It may be mediated either by secretion, to block pathogenic interactions locally.

[0085] In the case of HIV, the two factors of interaction are the gp120 / gp41 envelope protein and the CD4 receptor molecule. Thus, suitable blockers are HIV env that block HIV entry without causing pathogenic effects
Lentiviral vectors expressing either analogs or CD4 receptor analogs. This CD4 analog is secreted and functions to protect neighboring cells, whereas gp120 / gp41 is secreted or produced only intracellularly, to protect only vector-containing cells. It may be advantageous to add CD4 to human immunoglobulin heavy chains or other components for enhanced stability or complementary lysis. Administration of such lentiviral vector particles encoding hybrid soluble CD4 to a host results in a continuous supply of stable hybrid molecules. The efficacy of treatment can be assayed by measuring the usual indicators of disease progression, including antibody levels, viral antigen production, infectious HIV levels, or levels of non-specific infection.

In the case of uncontrolled growth conditions (eg, cancer or restenosis), cell cycle progression is halted by the expression of a number of different factors that affect signaling by cyclins or cyclin-dependent kinases (CDKs). obtain. For example, cyclin dependent kinase inhibitors p16, p21, and p27
Each regulates cyclin: CDK-mediated cell cycle signaling. Overexpression of these factors by lentiviral vector particles in cells results in cytostatic suppression of cell growth. Blocking factors or other factors used therapeutically as targets include, for example, wild-type or mutant Rb, p53, Myc, Fos
, Jun, PCNA, GAX, and p15.

3. Expression of Relaxants A technique similar to that described above produces lentiviral vector particles that direct the expression of virulence factors or factors (or “palliatives”) that can inhibit the function of the gene. Can be used to In the present invention, "capable of inhibiting a function" means that a palliative can directly inhibit this function or, for example, reduce factors present in cells from those that do not normally inhibit the function of a virulence factor. , Which can be indirectly inhibited by conversion to an inhibitor. Examples of such functions for viral diseases include virus adsorption, replication, gene expression, assembly, and export from infected cells. Examples of such functions for cancer cells, cancer-promoting growth factors, or uncontrolled growth conditions (eg, restenosis) include viability, cell replication, altered sensitivity to external signals (eg, contact inhibition), And lack or production of mutant forms of the anti-oncogene protein.

(A. Inhibitor Alleviating Agent) In an aspect of the present invention, the above-mentioned lentiviral vector directs the expression of a gene capable of interfering with the function of a virulence factor in, for example, a viral disease or a malignant disease. Such expression may be continuous in nature, or may involve the above-described pathogenic conditions or specific cell types ("identifying agents").
") In response to the presence of another factor in the cell. In addition, vector delivery can be performed as described above for the desired cell type (eg,
Virus-infected cells or malignant cells).

One method of administration is leukapheresis, where about 20% of an individual's PBL is
Removed at any time and manipulated in vitro. Therefore, about 2 × 1
⁰⁹ cells can be treated and replaced. Repeat treatments can also be performed. Alternatively, bone marrow may be processed and allowed to amplify the above effects. In addition, packaging cell lines that produce the vector may be directly injected into a subject to allow for continuous production of recombinant virions.

In one embodiment, a lentiviral vector particle that expresses RNA complementary to a key pathogenic gene transcript (eg, a viral gene product or an activated cellular oncogene) is converted to a protein of the transcript. (Eg, inhibiting translation of the HIV tat protein). Since the expression of this protein is essential for viral replication, cells containing the lentiviral vector particles described above are resistant to HIV replication.

In a second embodiment, if the virulence factor is a single stranded virus having a packaging signal, the viral packaging signal (eg, the palliative is directed against HIV) In the case of a retrovirus, the association of these molecules with the viral packaging signal will result in the formation of stem loops or the necessary stem cells necessary for proper capsid formation or replication. Inhibits tRNA primer binding.

In a third embodiment, a lentiviral vector particle may be introduced, which may be a moderating agent capable of selectively inhibiting the expression of a virulence gene, or the activity of a protein produced by the virulence factor. Develop a potential moderator. In the case of HIV, one example is a mutant tat protein that lacks the ability to transactivate expression from the HIV LTR and prevents (in a trans-dominant manner) the normal functioning of the tat protein. Such a variant is designated as HTLV II
tat protein have been identified for the ( "XII Leu ^5" mutant; W achsman et al., Science 235: 674,1987 see)
. The mutant transrepressor tat should inhibit replication in HSV-1 to the same extent as shown for similar mutant repressors (Fri
edmann et al., Nature 335: 452, 1988).

[0093] Such transcription repressor proteins can be selected in tissue culture using any virus-specific transcription promoter whose expression is stimulated by a virus-specific transactivator protein (described above). In the specific case of HIV, cell lines expressing the HIV tat protein and the HSVTK gene driven by the HIV promoter described above die in the presence of ACV.
However, when a series of mutated tat genes are introduced into the system, mutants with the appropriate properties (ie, repress transcription from the HIV promoter in the presence of wild-type tat) will grow and be selected. Is done. This mutant gene is then
They can be isolated again from these cells. Cell lines containing multiple copies of the conditional lethal vector / tat system can be used to ensure that surviving cell clones are not caused by endogenous mutations in these genes. Then, a series of randomly mutagenized tat genes were identified as "rescueable (resc
a) lentiviral vector (ie, which expresses this mutant tat protein and contains a bacterial origin of replication and a drug resistance marker for growth and selection in bacteria), is introduced into these cells. You. This allows a large number of random mutations to be evaluated and facilitates subsequent molecular cloning of the desired mutant cell line. This procedure can be used to identify and utilize mutations in various viral transcription activator / viral promoter systems for potential antiviral therapy.

(B. Conditional Toxic Alleviators) Another approach to inhibiting pathogenic agents is to express a palliative that is toxic to cells expressing this pathogenic condition. In this case, the expression of a temporary relief agent from the lentiviral vector, in order to avoid destruction of non-pathogenic cells,
It should be limited by the presence of the entity associated with the virulence factor (eg, a specific viral RNA sequence that identifies this pathogenic state).

In one embodiment of the present method, lentiviral particles can be utilized to express a toxic gene (described above) from a cell-specific response vector. In this manner, rapidly replicating cells, which contain RNA sequences capable of activating the cell-specific response vectors described above, are preferably destroyed by cytotoxic factors produced by the lentiviral particles described above. You.

In a manner similar to the previous embodiment, the lentiviral vector described above carries a gene for phosphorylation, phosphoribosylation, ribosylation, or other metabolism of a purine-based drug or a pyrimidine-based drug. obtain. The gene may have no equivalent in mammalian cells and may be derived from an organism such as a virus, bacterium, fungus, or protozoa. This example is described in E.I. coli guanine phosphoribosyltransferase gene product, which is lethal in the presence of thioxanthine (Besnard et al., Mol. Cell. Biol. 7: 4).
139-4141, 1987). This type of conditional lethal gene product (
“Prodrugs” or “prodrug activating enzymes” are many of the currently known purine or pyrimidine-based anticancer agents, which are often intracellular ribosylated or phosphorylated to become effective cytotoxic agents. (Requires oxidation). The conditional lethal gene product can also be metabolized to a non-toxic drug, which is not a purine or pyrimidine analog for the cytotoxic form (
Seele et al., Brit. J. Cancer 53: 377-384,198.
6).

[0097] In another aspect of the present invention, there is provided a lentiviral vector which directs the expression of a gene product capable of activating an otherwise inactive precursor to an active inhibitor of the virulence factor. For example, the HSVTK gene product can be used to more efficiently metabolize potentially antiviral nucleotide analogs such as AZT or ddC. The HSVTK gene can be expressed under the control of a cell-specific response vector and can be introduced into these cell types. AZT (and other nucleoside antiviruses) must be metabolized by cellular mechanisms to the nucleotide triphosphate form in order to specifically inhibit retroviral reverse transcriptase, and thus HIV replication (Furman et al., Proc. Natl.A
cad. Sci. ScL USA 83: 8333-8337, 1986). HSVTK
(Nucleosides and nucleoside kinases with very broad substrate specificity)
Constitutive expression results in more efficient metabolism of these drugs into their biologically active nucleotide triphosphate form. AZT or ddC treatment is thereby more effective, allowing lower doses, lower systemic toxicity, and higher efficacy against productive infections. Although its nucleotide triphosphate form shows selectivity for retroviral reverse transcriptase, additional nucleoside analogs that are not phosphorylated as a result of cellular nucleoside and nucleotide kinase substrate specificity become more effective.

[0098] Administration of these lentiviral vector particles to human T cells and macrophage / monocyte cell lines has been shown to reduce Can increase the tolerance of Treatment with AZT avoids toxic side effects at lower levels than usual, but still effectively inhibits HIV transmission. The course of treatment is similar to that described for the blockers above.

In one embodiment, the lentiviral vector particles described above carry a gene that specifies the product, which is not itself toxic, but a protein such as a protease specific for a virus or other pathogen. When converted or converted into a toxic form. For example, the lentiviral vector may carry a gene encoding a proprotein for ricin A chain, which is processed by HIV protease to become toxic. More specifically, the synthetic inactive proprotein form of the toxin ricin or diphtheria A chain is H
The protease encoded by the IV virus can be cleaved into its active form by arranging the appropriate "pro" elements to recognize and cleave.

In another embodiment, the lentiviral vector described above expresses a “reporting product” on the surface of a target cell in response to the presence of an identifying factor in the cell (eg, expression of a viral gene). obtain. The surface protein may be recognized by a cytotoxic factor (eg, an antibody for a reporting protein) or a cytotoxic T cell. In a similar manner, such a system can be used as a detection system (see below) to easily identify cells having a particular gene that expresses the identified protein.

[0101] Similarly, in another embodiment, surface proteins that are themselves therapeutically beneficial can be expressed. In the specific case of HIV, in particular, expression of the human CD4 protein in HIV infected cells may be beneficial in two ways: Intracellular binding of CD4 to HIV env inhibits the formation of viable virions, to the same extent as soluble CD4 has been shown to inhibit for free virus, but with systemic clearance and possible Without immunogenicity issues. Because the protein remains bound to the membrane and the endogenous C
This is because it is structurally identical to D4 (to which patients should be immunologically tolerated).

[0102] 2. Since the CD4 / HIV env complex has been implicated as a cause of cell death, further expression of CD4 (excessive HIV-en present in HIV infected cells)
v), leads to faster cell death and thus inhibits the spread of the virus.
This suggests that monocytes and macrophages, which act as reservoirs for virus production as a result of their relative refraction to HIV-induced cytotoxicity,
Apparently due to the relative deletion of CD4 at their cell surface).

In another embodiment, the lentiviral vector particles described above can provide a ribozyme that cleaves and inactivates RNA molecules essential for the viability of vector infected cells. Specific RNA sequences that direct ribozyme production to a pathogenic state (eg, HIV
tat), the toxicity is specific to this pathogenic state.

4. Expression of Markers In response to specific RNA sequences, the above-described technique of expressing a moderating agent in a cell also requires the use of specific genes (such as those expressed in cells expressing the same protein).
For example, it can be modified to allow for the detection of a gene that is carried by a particular virus), which allows for the detection of cells carrying this virus. In addition, this technique allows for the detection of viruses (eg, HIV) in clinical samples of cells having the same protein associated with the virus.

This modification can be achieved by providing a genome encoding the product.
The presence of the product can be easily identified in lentiviral vectors that respond to the presence of the same protein in infected cells ("marker product"). For example, H
This creates tat and rev when the IV infects the appropriate cells. Therefore, the indicator cells are alkaline phosphatase gene, β-galactosidase gene,
Or provided along with a genome encoding a marker gene such as a luciferase gene, which is expressed by lentiviral particles upon activation by tat and / or revRNA transcription (eg, by infection with an appropriate lentiviral particle). obtain. In the case of β-galactosidase or alkaline phosphatase, exposure of the cells to the substrate analog results in a color or fluorescence change if the sample is positive for HIV. In the case of luciferase, exposure of the sample to luciferin will result if the sample is positive for HIV,
This produces luminescence. For intracellular enzymes such as β-galactosidase, virus titer can be measured directly by counting colored or fluorescent cells, or by making cell extracts and performing appropriate assays. For the membrane-bound form of alkaline phosphatase, virus titer can also be measured by performing an enzyme assay on the cell surface using a fluorescent substrate. For secreted enzymes, such as engineered forms of alkaline phosphatase, a small sample of the culture supernatant can be assayed for activity. This allows for continuous monitoring of a single culture over time. Thus, different forms of this marker system can be used for different purposes. These include counting active virus, or sensitive and simple measurement of virus spread in culture, and blocking this spread by various agents.

In addition, specificity can be incorporated into the aforementioned systems by testing for the presence of the virus, with or without neutralizing antibodies to the virus. For example, in some of the clinical samples being tested, neutralizing antibodies to HIV may be present; in other parts, however, no neutralizing antibodies are present.
If the test was negative in the system in which the antibody was present and positive in the system without the antibody, this would help confirm the presence of HIV.

In similar systems for in vitro assays, the presence of a particular gene, such as a viral genome, can be determined in a cell sample. In this case, a sample of the cells is made up of the appropriate lentiviral vector particles (which
That carry the reporter gene, which is expressed only in the presence of the transcript). After introduction into a sample cell, the reporter gene will express its report product (eg, β-galactosidase or luciferase) only if the host cell expresses the appropriate viral protein.

[0108] These assays are faster and more sensitive. This is because the reporter gene can express more report product than the same drug present, producing an amplification effect.

5. Immune Downregulation As described above, the present invention also provides lentiviral vector particles that can suppress one or more elements of the immune system in target cells infected with lentivirus. provide. Briefly, the specific down-regulation of an inappropriate or undesired immune response in the transplantation of xenogeneic tissue such as, for example, chronic hepatitis or bone marrow, is caused by immunosuppressive viral genes that suppress the surface expression of transplant (MHC) antigens It can be manipulated using the product. Group C adenoviruses Ad2 and Ad5
Has a 19 kd glycoprotein (gp19) encoded in the E3 region of the virus. The gp19 molecule binds to class I MHC molecules in the endoplasmic reticulum of the cell and prevents terminal glycosylation and transfer of class I MHC to the cell surface.
For example, prior to bone marrow transplantation, donor bone marrow cells can be infected with a gp19-encoded lentiviral vector that blocks surface expression of MHC class I transplantation antigen for gp19 expression. These donor cells can be transplanted with low risk of graft rejection and require a minimal immunosuppressive regime for the transplant patient. This may allow an acceptable donor recipient chimera state with less complications. Similar treatments have been used to treat so-called autoimmune diseases (lupus erythroleukemia (lupus).
erythromiatis), including multiple sclerosis, rheumatoid arthritis, or chronic hepatitis B infection). In the context of arthritis, lentiviral vectors can be utilized to transduce synovial cells directly, either in vivo or ex vivo.

An alternative method involves the use of antisense messages, ribozymes, or other specific gene expression inhibitors specific for T cell clones, which are naturally autoreactive. These block the expression of the T cell receptor of a particularly unwanted clone responsible for the autoimmune response. Antisense, ribozymes or other genes can be introduced using a viral vector delivery system.

6. Substitution or Augmentation Gene Therapy One further aspect of the present invention relates to transforming vertebrate or insect cells with a lentiviral vector that provides a gene sequence capable of expressing a therapeutic protein. Within one embodiment of the invention, the lentiviral vector prevents, prevents, stabilizes or abolishes genetic or non-genetic genetic deficiencies in metabolism, immunoregulation, hormonal regulation, enzyme function or membrane-associated structural function. Can be designed to express a therapeutic protein. This embodiment also describes lentiviral vector particles that can transduce individual cells. This allows the therapeutic protein to be expressed systemically or partially from specific cells or tissues, whereby the therapeutic protein is (a) replaced with absent or defective cellular proteins or enzymes,
Alternatively, (b) it allows for the supplementary production of a deficiency of a slightly expressed cellular protein or enzyme. Such diseases may include cystic fibrosis, Parkinson's disease, hypercholesterolemia, adenosine deaminase deficiency, β-globin disorder, hemophilia A and B, Gauche's disease, diabetes and leukemia. Within certain preferred embodiments, the vectors described herein are utilized to provide long-term expression of a desired gene of interest.

A. Treatment of Gauche Disease As an example of the present invention, lentiviral vector particles can be constructed and utilized to treat Gauche disease. Briefly, Gauche's disease is a genetic disorder characterized by a deficiency in the enzyme glucocerebrosidase. This type of treatment
An example of a single gene replacement therapy by providing a functional cellular enzyme. This enzyme deficiency leads to the accumulation of lysosomal glucocerebroside in all cells in the body. However, the disease phenotype is only manifested in macrophages, except for very rare forms of neurological disease. The disease usually leads to increased liver and spleen and bone lesions. (For review, Science 256: 794, 19
92, and The Metabolic Basis of Inherit
ed Disease, Vol. 6, Scriver et al., Vol. 2, p. 1677).

B. Lentiviral Vector Particles Expressing Human Factor VIII and Factor IV for Treatment of Hemophilia Within one embodiment of the present invention, a B domain deleted Factor VIII protein is A lentiviral vector particle to be expressed is provided ("Methods for Administration of Recombinant Gene").
Delivery Vehicles for Treatment of H
P entitled "emophilia and other Disorders"
See also CT WO 91/09122 and Attorney Docket No. 1155.505).

[0114] Briefly, the B domain separates the second and third A domains of FVIII factor of a newly synthesized single-stranded molecule. The B domain is described in Wood et al., 1984, N
According to atature 312: 330-337, it spans amino acids 712 to 1648. The proteolytic activity of factor VIII was 372, 740, and 16
For cleavage at a specific Arg residue located at position 89. Thrombin or Xa
Cleavage of plasma factor VIII at Arg372 and Arg1689 by factors is essential for factor VIII involved in coagulation. Therefore, activated Factor VIII comprises amino acids residues 1-372 (including the A1 domain) and residues 3
73-740 (including the A2 domain), and residues 1690-2332 (A3-
(Including the C1-C2 domain).

An important advantage in the use of FVIII molecules lacking the B domain is that the addition of plasma-derived albumin is not necessary for the stabilization of the final product, since the reduced size tends to have less proteolysis. is there. As used herein with respect to the factor VIII protein, the term "B domain deletion" refers to the factor VIII protein, wherein some of all or some of the amino acids between residues 711 and 1694 are Biologically active FVII with or without all the deletions deleted
I molecule still protected).

A range of B domain deletions exists, depending on which amino acid residues in the B domain have been deleted, and thereby still protect the biological activity of the FVIII molecule. A specific B domain deletion called SQN caused Ser743 to Gln16.
38 is present in the deletion created by fusing (Lind et al., 199).
5, Eur J. et al. Biochem 323: 19-27 and PCT WO9.
1/09122). This is because the Ser-G between A2 and A3FVIII domains
amino acid residues 744 to 1 from the B domain creating the lu-Asn (SQN) linkage
637 is deleted. When compared to plasmid-derived FVIII, FVIII B
Domain SQN deletion did not affect its in vivo pharmacokinetics (Fijn
vandraat et al. R. Schattauer Vertagsgese
llschatt mbH (Stuttgart) 77: 298-302,19.
97). As used herein, the term “Factor VIII SQN deletion” or “S
A “QN deletion” refers to protecting a single SQN tripeptide sequence and
This and other deletions that result in a deletion of the amino acid sequence between the domain SQN sequences (see PCT WO 91/09122 for a description of this amino acid sequence).

There are many other B domain deleted forms of factor VIII. CDNAs encoding all of these B domains lacking the factor VIII protein can be inserted into lentiviral vector particles by using standard biological techniques. For example, a cDNA molecule encoding the following B domain factor VIII deletion can be constructed as described below:

[0118]

[Table 1]

A B domain deletion with an inserted IgG hinge region can also be used. For example, this type of deletion can be obtained from the plasmid PSVF8-tβ2, which is designed to link the short hinge region from immunoglobulin A with the heavy and light chains. To obtain a truncation at the end of the heavy chain and to release the light chain, some residues of the β domain are included on either side of the hinge sequence. The 5 'untranslated leader peptide and the signal peptide, together with the Kozak consensus sequence at the initiation codon as in pSVF8-302, were added to human factor VIII: C
It is derived from cDNA. A description of this vector is contained in Chapman et al., US Pat. No. 5,595,886. The 3 'untranslated region is the same fused Factor VIII and tPA sequence found in pSVF8-80K.

The construction can be completed in two steps: an oligomer with cohesive ends for EcoRI and BclI (117 bp) is cloned into the transfer vector pF8GM7, the DNA sequence of this oligomer being m13 subcloning and Sa
Checked by Nger sequencing.

Next, the final plasmid was constructed by ligation of the following three fragments: (a) the FspI-EcoRI fragment from pSVF8-92S; (b) the oligomer and the EcoRI-NdeI fragment of the transfer vector pF8GM7; (C) FspI-NdeI fragment of pSVF8-80K.

A description of pSVF8-92S and pSVF8-80K can be found in Chapman et al.
No. 5,595,886.

Of particular interest for inclusion in the lentiviral vector particles of the present invention, three additional B-domain deleted Factor VIII constructs can be prepared as follows. Plasmid pSVF8-500 contains the amino acid 770 of the deleted full length factor VIII.
Encodes a Factor VIII protein having 1656. Furthermore, the total length V
Threonine at position 1672 of the factor III sequence was also deleted. The following is a description of the construction of this vector.

The pSVF8-500 plasmid is a derivative of pSVF8-302, in which the 92K and 80K coding regions fuse with a small 21 amino acid binding β region and retain the natural proteolytic processing site. . This plasmid is constructed in the following manner: (1) a 1984 bp SalI-KpnI fragment containing the region encoding the 92K protein (excluding the carboxy-terminal end) and the carboxyl of the 80K protein having a 3 'untranslated region. 2186b containing the region encoding the ends
The BstXI-SalI fragment of p was isolated by gel electrophoresis after digestion of pSVF8-302 with restriction enzymes. (2) 1705 bp Bc containing most of the region encoding the 80K protein
The lI-BstXI fragment was isolated after electrophoresis of the BamHI-XbaI fragment of pUC12F8. (PUCF812 is prepared from pF8-102, which is described in U.S. Patent No. 5,045,455.
2 is digested with Bam-XhaI and ligated to vector pUC12 by in vitro mutagenesis at the BclI site using the following primers: 5′-AC
TACTCTTCAATCTGATCAAGAGGAA 3 '(SEQ ID NO :))
. (3) The KpnI-EcoRI fragment containing the carboxyl terminus of the 92K protein and a part of the β region (4 amino acids) were replaced with ppn in KpnI and EcoRI.
Obtained by digestion of the SalI cassette from SVF8-302. (4) Ligation of four pieces of synthetic DNA (shown in FIG. 39) to the fragments of steps (2) and (3) and digestion with KpnI. (5) Final ligation of the fragments from steps (1) and (4); digestion with SalI and gel purification of the 6428 bp SalI cassette. (6) Ligation of the SalI cassette to the pSV7d vector; transformation of HB101 and colony hybridization to isolate pSVF8-500 (
(FIG. 40). The sequence of the joining region encoding 92K-β-80K was confirmed by the DNA sequence after cloning in M13.

This sequence can be altered so that the unique NruI and M
Incorporated into the luI restriction site. These sites were also used to construct two other additional B domain deletion vectors, described below.

The pSV500BΔThr was constructed from pSVF8-500. The threonine deletion at position 1672 was maintained. Using a synthetic linker, pSV500BΔTh
r was constructed. This linker is compatible with the Ser (pSVF8-500 vector)
From the unique NruI site at 765) to the unique MluI site at Ile (1659). This linker was replaced with the corresponding region of pSVF8-500.

A third vector, pSVF8-500B, was constructed from pSV500BΔThr. This vector is the same as pSVF8-500B, except that the codon for threonine 1672 has been reinserted using standard mutagenesis methods.
The relationship between pSVF8-500 and pSVF8-500B and pSVF8-500BΔThr is further illustrated in the following table. The number of amino acid sequences in the table is
Determined by reference to the factor III sequence.

[0128]

[Table 2]

In all cases, the BglII- of each modified cDNA listed above
The 1.35 kb fragment of PflI is known to those of skill in the art and is inserted into the lentiviral vector particles described herein using standard molecular biology procedures described herein. Can be done.

[0130] The full length factor VIII cDNA can also be inserted into a lentiviral vector particle of the invention (see, eg, WO 96/21035). Various VII
Factor I deletions, mutations, and polypeptide analogs of Factor VIII can also be introduced into lentiviral vector particles of the invention, including lentiviral vector particles, by modification of the procedures described herein. These analogs include, for example, the analogs described in PCT Patent Applications WO 97/03193, WO 97/03194, WO 97/03195, and WO 97/03191 (all of which are described herein). Incorporated by reference in the book).

Hemophilia B can also be treated with systemically administered Factor IX expressing lentiviral vector particles, including lentiviral vector particles. Human factor IX deficiency (Christmas disease or hemophilia B) mainly affects men. This is because it is transmitted as a sex-linked recessive trait. In the United States, it affects about 2000 people. The human factor gene encodes 416 amino acids of the mature protein.

Human Factor IX cDNA is described, for example, in Kurachi and Davie, 19
82, PNAS 79 (21): 6461-6464, by constructing the plasmid pHfIXI. The cDNA sequence is
Approximately 1.5 kb of PstI, blunt-ended using T4 DNA polymerase
It can be excised as a fragment. The factor cDNA fragment can be easily inserted, for example, into a SrfI site introduced into a lentiviral vector particle.

C. Lentiviral Vector Particles Expressing Other Coagulation Factors i. Factor V Lentiviral vector particles can be constructed using molecular biology techniques known to those skilled in the art. For example, Factor V cDNA is digested with SalI to give p
MT2-V (Jenny, 1987, Proc. Natl. Acad. Sci.
USA 84: 4846; ATCC accession number 40515). 7kb
CDNA bands are excised from agarose gels and cloned into lentiviral vector particles using standard molecular biology techniques.

[0134] Either full length or B domain deletions or substitutions of the Factor V cDNA can be expressed by the gene therapy vectors of the invention. Marquette, 1995
, Blood 86: 3026 and Kane, 1990, Biochemis.
Factor V B domain deletions, such as the vector reported by try 29: 6762, can be made as described by these investigators.

(Ii. Antithrombin III) Lentiviral vector particles capable of expressing ATIII cDNA can be readily constructed using standard molecular biology techniques known to those skilled in the art. For example, ATI
Lentiviral vector particles expressing II can be excised by excision with PstI.
The vector pKT218 (Prochonik, 1983, J. Biol. Ch.
em. 258: 8389; ATCC No. 57224/57225). The 1.6 kb cDNA insert can be recovered from an agarose gel and cloned into the PstI site of vector SK-. This insert can be recovered by restriction enzyme digestion and cloned into the lentiviral vector particles described herein by the restriction enzyme.

III. Protein C The lentiviral vector particles of the invention that can express protein C can be made using a wide variety of techniques presented in this disclosure. For example, protein C c
DNA was obtained from published vectors (Foster, 1984, Proc. Natl.
, Acad. Sci. USA 81: 4766; Beckmann, 1985,
Nucleic Acids Res 13: 5233). The 1.6 kb insert can be recovered from an agarose gel and cloned under standard conditions into the multiple cloning site of vector SK-.
The insert can be recovered by restriction enzyme digestion and cloned into lentiviral vector particles; for example, excision by XhoI / NotI digestion followed by cloning into XhoI / NotI digested lentiviral vector particles.

(Iv. Prothrombin) Lentiviral vector particles expressing prothrombin and its variants are:
By using variations on the methods described herein, they can be constructed by methods known to those skilled in the art. For example, prothrombin cDNA can be obtained from published vectors (Degen, (1983) Biochemistry 22).
: 2087). The 1.9 kb cDNA insert can be recovered from an agarose gel and cloned into the multiple cloning site of the SK-vector. This insert can be recovered by restriction enzyme digestion and cloned into lentiviral vector particles using restriction enzyme digestion.

V. Thrombomodulin Lentiviral vector particles expressing thrombomodulin and variants thereof can be constructed using techniques known to those skilled in the art. For example, the thrombomodulin cDNA can be excised with SalI to obtain the puc19TM15 vector (Jac
kman, 1987, Proc. Natl. Acad. Sci. USA 84:
6425; Shirai, 1988, J. Mol. Biochem. 103: 281; W
en, 1987, Biochemistry 26: 4350; Suzuki,
1987, EMBO J .; 6: 1891; ATCC No. 61348, 6134
9). The 3.7 kb cDNA insert can be recovered from an agarose gel and cloned into the SalI site of a lentiviral vector particle.

D. Lentiviral Vector Particle Treatment of Genetic Disorders and Other Conditions There are many proteins useful for treating genetic disorders that can be expressed in vivo by the methods of the present invention. Many inherited diseases caused by inheritance of the defective gene (eg, Mediterranean anemia, phenylketonuria, Lesch-Nyhan syndrome, severe combined immunodeficiency (SCID), hemophilia A and B, cystic fibrosis, Duchenne muscular dystrophy, hereditary emphysema and familial hypercholesterolemia) result in a failure to produce normal gene products (Mulliga et al., 1993;
Science 260: 926; Anderson et al., 1992, Science.
ce 256: 808; Friedman et al., 1898, Science.
244: 1275). Genetic disorders can occur in the absence of gene products, but endocrine disorders such as diabetes and pituitary dysfunction are caused by the ability of the gene to produce appropriate levels of the appropriate hormones insulin and human growth hormone, respectively. Caused by not having.

Gene therapy according to the methods of the present invention is a powerful approach for treating these types of disorders. This treatment involves introducing a normal recombinant gene into somatic cells so that new or defective proteins are produced in the cells of the patient. Adenine deaminase deficiency, cystic fibrosis, many genetic disorders including alpha ₁ antitrypsin deficiency, Gaucher syndrome and non-genetic diseases can be treated by gene therapy. Other representative diseases include lactase for treatment of genetic lactose intolerance, AD for treatment of ADA deficiency, and α1 antitrypsin for treatment of α1 antitrypsin deficiency. For a description of gene therapy treatments for hereditary disorders, see F.S. D. Ledley, 1987; Pediatrics 1
10: 157-174; Verma, Scientific Ameri
can (1987, November) pp. 68-84; and "Gene Therapy".
Treatment for a Variety of Diseases
and PCT Patent Application WO 95/2751 entitled "And Disorders"
See FIG.

One such disorder is clinically due to lifelong elevation of low density lipoprotein (LDL), the major cholesterol transport lipoprotein in human plasma; leading to the premature coronary heart, Familial hypercholesterolemia is a disease that is pathologically characterized by LDL-induced cholesterol deposition in tendons, skin and arteries; and genetically by autosomal dominant traits. Heterozygotes amount to one in 500 people worldwide. These cells can bind to cholesterol in a proportion that is about half that of normal cells. These plasma cholesterol levels show a two-fold rise starting at birth. The number of heterozygotes reaches one in one million. They have a severe cholesterol disease with death usually occurring before the age of 20 years. The disease (arteriosclerosis) is geographically dependent. This is 100,00 in the United States.
It affects 15.5 individuals per 0 individuals (20,000 total) and 100,0 in Japan.
It affects 3.3 individuals per 00 individuals. Lentiviral vector particles expressing the LDL receptor for the treatment of disorders in which elevated serum LDL is prominent can be constructed by techniques known to those skilled in the art. An example of a lentiviral vector particle that expresses the LDS receptor is provided in Example 32 herein.

There are a variety of other proteins for therapeutic purposes that can be expressed in vivo by lentiviral vector particles using the methods of the present invention. For a confirmed example, the in vivo expression of tissue factor blocking protein (TFPI) was detected in sepsis and DIC.
And for preventing reperfusion injury.
(See PCT patent applications WO 93/24143, WO 93/25230 and WO 96/06637). Nucleic acid sequences encoding various forms of TFPI are described, for example, in U.S. Patent Nos. 4,966,852;
833; and 5,466,783, and can be incorporated into lentiviral vector particles as described herein.

Other proteins for therapeutic purposes such as erythropoietin (EPO) and leptin can also be expressed in vivo by lentiviral vector particles according to the methods of the present invention. For example, EPO is useful for gene therapy treatment of various disorders, including anemia (see "Gene Therapy for Treatment for Gene Therapy").
See PCT Application No. WO 95/13376, entitled "f Anemia"). Sustained gene therapy delivery of leptin according to the methods of the invention is useful for treating obesity. (For a description of the leptin gene and its use in treating obesity, see Obesity Polypeptides available to
WO96 / 0530 entitled "Modulate body weight"
9). Lentiviral vector particles expressing EPO or leptin can be readily produced using the methods described herein, the constructs of which are described in these two patent publications.

[0144] Various other diseases can also be treated by the methods of the present invention. For example, the confirmed in vivo systemic production of apolipoprotein E or apolipoprotein A by the lentiviral vector particles of the present invention can be used for the treatment of hyperlipidemia. (Breslow, J. et al., Biotechnology 12,3.
65 (1994). ) Further, the confirmed production of angiotensin receptor inhibitors (TL Goodfriend et al., 1996, NE
ngl. J. Med. 334: 1469) can be effected by the gene therapy methods described herein. As yet a further example, long-term in vivo systemic production of angiostatin by the lentiviral vector particles of the present invention is useful for treating various tumors. (O'Reilly et al., 1996, Nature M.
ed. 2: 689).

7. Lymphokines and Lymphokine Receptors As noted above, the present invention also provides lentiviral vector particles that can direct the expression of one or more cytokines or cytokine receptors among other functions. Briefly, in addition to these roles as cancer treatments, cytokines
It can have a negative effect resulting in certain pathological conditions. For example, most resting T cells, B cells, larger granular lymphocytes and monocytes do not express IL-2R (receptor). In contrast to the lack of IL-2R expression in normally resting cells, IL-2R is a specific leukemia (ATL leukemia, hairy cell leukemia, Hodgkin's leukemia, acute and chronic granulocytic leukemia), It is expressed by abnormal cells in patients with autoimmune disease and is associated with allograft rejection. Interestingly, in most of these patients, serum levels of the soluble form of IL-2R are elevated. Thus, according to certain embodiments of the invention, treatment may be effected by increasing the serum concentration of the soluble form of the cytokine receptor. For example, IL-2
In the case of R, the lentiviral vector is engineered and soluble IL-2R and I
It produces both L-2R, which creates a high affinity soluble receptor. In this configuration, serum IL-2 levels are reduced and inhibit the paracrine loop. This same strategy may also be effective against autoimmune diseases. In particular, some autoimmune diseases (eg, rheumatoid arthritis, SLE) are also associated with aberrant expression of IL-2, so by increasing serum levels of the receptor,
Blocking the action of L-2 can also be used to treat such autoimmune diseases.

In other cases, inhibition of the level of IL-1 may be beneficial. Briefly, IL
-1 consists of two polypeptides, IL-1 and IL-1, each of which has a pleiotropic effect. IL-1 is mainly synthesized by mononuclear phagocytes in response to stimulation by microbial products or inflammation. IL
There are naturally occurring antagonists of the IL-1R, referred to as -1 receptor antagonists ("IL-1Ra"). This IL-1R antagonist has the same molecular size as mature IL-1 and is structurally related thereto. However, binding of IL-1Ra to IL-1R does not initiate any receptor signaling. Thus, this molecule has a different mechanism of action than the soluble receptor, which complexes with the cytokine and thus blocks its interaction with the receptor. IL-1 does not appear to play an important role in normal homeostasis. In animals, antibodies to the IL-1 receptor reduce inflammation and eating disorders due to endotoxins and other pro-inflammatory agents.

In the case of septic shock, IL-1 induces a secondary compound that is a potent vasodilator. In animals, exogenously supplied IL-1 reduces mean arterial pressure and causes leukopenia. Neutralizing antibodies to IL-1 reduced endoxin-induced fever in animals. In a study of patients with septic shock treated with a constant infusion of IL-1R for 3 days, mortality at day 28 was 16% compared to 44% of patients receiving placebo infusion. In the case of autoimmune diseases, reduced activity of IL-1 reduces inflammation. Similarly, blocking the activity of IL-1 by a recombinant receptor may result in increased allograft survival in animals, probably by reducing inflammation as well.

[0148] These diseases provide further examples. In that example, the lentiviral vector particles can be engineered to produce a soluble receptor, or more specifically, an IL-1Ra molecule. For example, in patients with septic shock, a single injection of IL-1Ra producing vector particles may replace current approaches that require a constant infusion of recombinant IL-1R.

[0149] Cytokine responses, or more specifically, inaccurate cytokine responses, may also be involved in failure to control or reverse infectious disease. Perhaps the best studied example is the incurable form of Ruschmaniasis in mice and humans with a strong but adverse T _H 2 dominant response. Similarly, lepromatous of leprosy is the dominant are associated with inappropriate T _H 2 response. In these conditions, lentiviral vector particles may be useful for increasing circulating levels of IFNγ, contrary to the proposed site-directed approach for solid cancer therapy. IFNγ
It is produced by T _H -1 T cells, and functions as a negative regulator of T _H -2 subtype proliferation. IFNγ is also a major source of IL-
Antagonize 4-mediated effects, including isoform switching to IgE.

[0150] IgE, mast cells and eosinophils are involved in mediating allergic reactions. I
L-4 acts on differentiation of T cells, stimulates T _H -2 growth, inhibiting T _H -1 responses. Thus, lentivirus-based gene therapy can also be achieved in combination with traditional allergy treatment. One possibility is to deliver lentiviral vector particles that produce IL4R with a small amount of annoying allergens (ie classic allergic shots). Soluble IL-4R inhibits the activity of IL-4, thus preventing the induction of a strong _TH- 2 response.

A. Lentiviral Vector Particles for the Treatment of Viral Hepatitis Lentiviral vector particles containing the described lentiviral vector particles and methods of administration include viral hepatitis, including hepatitis B and C. Useful for the treatment of For example, lentiviral vector particles of the invention have been used to express interferon alpha for the treatment of viral hepatitis. Without wishing to be bound by theory, lentiviral vector particles injected intravenously preferably transduce hepatocytes. Thus, the method of intravenous delivery described in the present invention for lentiviral vector particles may be used for the treatment of liver diseases, such as hepatitis and especially viral hepatitis, where lentiviral vector particles such as Therapeutic proteins expressed by the lentiviral vector particles can preferably be delivered to the liver.

Currently, the only approved treatment for chronic hepatitis B, C and D infections is α
The use of interferons 2a and 2b. Alpha interferon is a secreted protein that is induced by B lymphocytes, macrophages, and null lymphocytes by foreign cells, virus-infected cells, tumor cells, bacterial cells and products, and the viral envelope. The mechanism of interferon's antiviral action is by inducing the synthesis of effector proteins: the two most important are 2 ', 5' oligoadenylation synthetase (OAS) and dsRNA-dependent protein kinase (RDDPK). . OAS is RNaseL (this is
Adenylation oligomers that activate viral single-stranded RNA) are synthesized. RDPK phosphorylates the initiation factor eIF-2a, thereby inhibiting translation of viral proteins. In addition to its direct antiviral effect, α-interferon has immunomodulatory effects that are important for viral infection. These immunomodulatory effects include enhanced expression of both class I and class II major histocompatibility complex (MHC) molecules, regulation of interleukin 2 receptor, TNF-α receptor, transferrin receptor expression, spontaneous natural killer (NK) enhancement of cytotoxicity and regulation of antibody production by B cells. In chronic hepatitis B infection, the beneficial effects of interferon alpha appear to be from immunomodulatory effects, whereas in chronic hepatitis C infections, the beneficial effects depend on its antiviral activity. (Bre
sters, D.S. , Hepatitis C Virus, pp. 121-136,
Reesink HW (ed.) 1994). The mechanism of action at interferon alpha for the treatment of chronic hepatitis D is not fully understood (Rizzetto
, M .; And Rosina, F .; Viral Hepatitis, 363-
369, Zuckerman, A .; J. And Thomas H.S. C. (Eds.), 1993).

Localized expression of interferon alpha in the liver from lentiviral vector particles, such as lentiviral vector particles, may be an effective treatment for hepatitis. Without wishing to be bound by theory, delivery of α-interferon at the site of infection by a gene therapy vector of the present invention, including lentiviral vector particles, results in localized high concentrations of cytokines, thereby causing adjacent infected Concentrate antiviral and immune effects on hepatocytes. A further advantage of this treatment is that the current systemic mode of systemic alpha interferon therapy may either be unnecessary or reduce the dose and frequency of treatment. This reduction may reduce the adverse side effects associated with systemic delivery of alpha interferon therapy. Thus, the gene therapy approaches described herein can be used in combination with the administration of alpha interferon protein formulations.

The construction of many different lentiviral vector particles that express interferon alpha can be readily accomplished by the disclosure provided herein. There are at least 24 different human alpha interferon genes or pseudogenes. There are two distinct families (I and II); mature human alpha interferon (I) is 166 amino acids long (one is 165 amino acids), while alpha interferon (II) has 172 amino acids. Eighteen genes are present in the alpha interferon I family, including at least four pseudogenes. Six genes are present in the alpha interferon II family, which includes five pseudogenes (Callard, R. and Gearing, A. Cytokine).
Facts Book, Academic Press, 1994 148
-154). In Example 33 herein, we use alpha interferons 2a, 2b, 2c, 54 and 76, all of which are members of the alpha interferon (I) family. Similar techniques can be used to insert other members of the α-interferon I family (eg, α-interferons F and N) into lentiviral vector particles. Thus, in addition to 2a, 2b, 2c, 54 and 76 as described herein, other biologically active forms of alpha interferon are also expressed by the lentiviral vector particles of the invention. And for the treatment of viral hepatitis.

Patients with viral hepatitis can be treated with a combination gene therapy approach. Lentiviral vector particles expressing a protein drug such as alpha interferon can be administered intravenously or directly to the liver by the methods described herein. This therapeutic approach can be combined with intramuscular delivery of lentiviral vector particles expressing hepatitis B or hepatitis C antigen to induce an immune response to viral hepatitis. The construction of specific hepatitis B and C antigens and lentiviral vector particles expressing such antigens useful for this type of therapy are described herein and in PCT Patent Application No. WO 93/15207. You. In addition, molecularly cloned genomes encoding viral hepatitis B are available, for example, from the American Type Culture Collection (ATCC, Roc).
kville, Maryland). For example, ATCC No. 45020 is compatible with pBR322 (Moriarty et al., 1981).
Proc. Natl. Acad. Sci. USA 78: 2606-2610
) At the BamHI site (extracted from purified Dane particles) (Blum et al., 1989, TIG5 (5): 154-158, FIG. 3).
See). (Note that correctable errors occur in the sequence with ATCC number 45020).

8. Suicide Vectors One further aspect of the present invention relates to the use of lentiviral vector suicide vectors to limit the spread of wild-type lentivirus in packaging / producer cell lines. For example, within one embodiment, the lentiviral vector particles include a prodrug activating enzyme as discussed above. This results in the death of cells containing the vector particles upon administration of the prodrug (eg, ganciclovir).

9. Lentiviral Vectors for Preventing Metastatic Tumor Spread One further aspect of the present invention relates to the use of lentiviral vector particles to inhibit or reduce the invasiveness of malignant tumors. Briefly, the degree of malignancy typically relates to tumor angiogenesis. One cause of tumor angiogenesis is soluble tumor angiogenic factor (TAF) (Pawelet), which is expressed by several tumors.
z et al., Crit. Rev .. Oncol. Hematol. 9: 197, 1989
). Within one aspect of the invention, tumor angiogenesis can be demonstrated using a lentiviral vector to express an antisense or ribozyme RNA molecule specific for TAF. Alternatively, anti-angiogenic factors (Moses et al., Sc
issue 248: 1408, 1990; Shapiro et al., PNAS 84:
2238, 1987) can be expressed either alone or in combination with a ribozyme or antisense sequence described above to delay or inhibit tumor angiogenesis. Alternatively, lentiviral vector particles can also be used to express antibodies specific for the TAF receptor of the surrounding tissue.

10. Modulation of Transcription Factor Activity In yet another embodiment, lentiviral vector particles can be used to modulate the growth control activity of transcription factors on infected cells. Briefly, transcription factors directly affect the pattern of gene expression by sequence-specific transactivation or repression (Karin, New Biologist 21: 126-131, 1990).
). Thus, it is not surprising that mutant transcription factors represent a family of oncogenes. For example, lentiviral particles may be used to enhance or inhibit tumor cells whose unregulated growth cooperates in oncogene transcription factor and homodimer or heterodimer transactivation or repression transcription factor complex formation. (Activated by proteins that do).

One way to reverse cell growth is to inhibit the transactivation potential of the c-myc / Max heterodimer transcription factor complex. Briefly, the nuclear oncogene c-myc is expressed by growing cells and can be activated by several different mechanisms, including retorl virus insertion, amplification, and chromosomal translocation. Max protein is expressed in quiescent cells,
And, independently of c-myc, either alone or in combination with unidentified factors, functions to suppress the expression of the same gene activated by the myc / Max heterodimer (Cole, Cell 65: 715-716, 199
1).

Inhibition of c-myc or c-myc / Max proliferation of tumor cells can be achieved by overexpression of Max in target cells controlled by a lentiviral vector. The Max protein has only 160 amino acids (480 nucleotides R
(Corresponding to NA length), and independently or in combination with antisense / ribozyme moieties targeted to other genes and / or factors that deregulate cell growth, Be incorporated.

Modulation of homo / heterocomplex binding is another approach to controlling transcription factor activated gene expression. For example, translocation of the transactivating transcription factor NF-B from the cytoplasm to the nucleus is prevented while in a heterodimeric complex with the inhibitor protein IB. Upon induction by various factors, including certain cytokines, IB becomes phosphorylated and NF-B is released and translocated to the nucleus, where it can perform sequence-specific transactivation functions (Baeuerle
And Baltimore, Science 242: 540-546,198.
8). Dissociation of the NF-B / IB complex can be prevented by masking the IB phosphorylation site with an antibody. This approach effectively inhibits the transactivating activity of the NF-IB transcription factor by preventing its nuclear import. Expression of IB phosphorylation site-specific antibodies or proteins in target cells can be achieved with lentiviral gene transfer vectors. An approach similar to the approach described herein was used to inhibit the binding between jun and the fos protein, thereby transactivating the transcriptional heterodimer AP-1 (Turner and Tijan, Science 243: 1689). -1694, 1989).

Formulation Within another aspect of the invention, the infectious lentiviral vector particles are stored so that the lentiviral vector particles can infect mammalian cells upon reconstitution. (See US Application No. 08 / 153,342). Briefly, purified or concentrated lentiviral vector particles are pharmaceutically active by first adding a sufficient amount of formulation buffer to the medium containing the lentiviral vector particles to form an aqueous suspension. The compound or medicament can be stored or formulated into an aqueous suspension. This formulation buffer contains saccharide,
An aqueous solution containing high molecular weight structural additives and buffering components in water. A "buffering compound" or "buffering component" utilized within the context of the present invention may comprise any desired pH.
Should be understood to refer to substances that function to maintain an aqueous suspension. The aqueous solution may also contain one or more amino acids.

[0163] Lentiviral vector particles can also be stored in purified form. More specifically, prior to the addition of formulation buffer, the crude lentiviral vector particles described above are clarified by passing through a filter, and then, for example, cross-linked.
flow) concentration system (Filtron Technology Corp.).
, Norborough, MA). Within one embodiment, DNase is added to the concentrate to digest exogenous DNA. The digest is then diafiltered to remove excess media components and establish the lentiviral vector particles in a more desirable buffered solution. The diafiltrate is then passed through a Sephadex S-500 gel column and the purified lentiviral vector particles are eluted. A sufficient amount of formulation buffer is added to the eluate to reach the desired final concentration of the construct, and to dilute the lentiviral vector particles to a minimum, and then the aqueous suspension is preferably Store at 70 ° C. or dry immediately. As noted above, the formulation buffer is an aqueous solution containing saccharides, high molecular weight structural additives, and buffering components in water. The aqueous solution may also contain one or more amino acids.

The crude lentiviral vector particles can also be purified by ion exchange column chromatography (see US patent application Ser. No. 08 / 093,436). Generally, the crude lentiviral vector particles are clarified by passing them through a filter, and the filtrate is loaded onto a column containing a highly sulfonated cellulose matrix. The lentiviral vector particles are eluted from the column in purified form by using a high salt buffer.
The high salt buffer is then exchanged for a more desired buffer by passing the eluent through a molecular exclusion column. A sufficient amount of formulation buffer is then added to the purified lentiviral vector particles, as described above, and the aqueous suspension is either immediately dried or stored (preferably at -70 ° C). Or do.

This aqueous suspension, in crude or purified form, may be dried at ambient temperature by lyophilization or evaporation. Specifically, lyophilization is a step of cooling the aqueous suspension below the glass transition temperature or below the eutectic point of the aqueous suspension, and, from the cooled suspension, lyophilized by removing water by sublimation. Forming a lentivirus. Briefly, an aliquot of the formulated lentiviral vector particles was transferred to an Edwards Refrigerated Chamer (3-stage RC) fitted with a lyophilizer (Supermodulyo 12K).
3S unit). Phillips et al. (Cryobiology 18)
: 414, 1981), and the formulated lentiviral vector particles were lyophilized, preferably at -40 ° C to -45 ° C. The remaining composition contains less than 10% water by weight of the lyophilized lentivirus. Once lyophilized, the lentiviral vector particles are stable and can be stored at -20C to -25C.

In the evaporation process, water is removed from this aqueous suspension by evaporation at ambient temperature. In one embodiment, the moisture is spray dried (EP52).
0,748). In the spray drying process, the aqueous suspension is delivered to a pre-heated gas (usually atmospheric) stream, where moisture evaporates quickly from the suspension droplets. Spray dryers are available from a number of manufacturers (eg, Drytec, Ltd. Tonbridge, England).
d; Lab-Plant, Ltd. Huddersfield, England
). Once dehydrated, the lentiviral vector particles are stable, and-
It can be stored at 20-25 ° C. In the method described herein, the resulting water content of these dried or lyophilized lentiviruses is determined by Karl
-Fischer device (EM Science Aquastar ^™ V1B
It can be determined by use of a volumetric titrator, Cherry Hill, NJ) or by gravimetry.

The aqueous solutions used for the formulations as described previously consist of saccharides, additives of high molecular weight structure, buffer components and water. The solution may also contain one or more amino acids. The combination of these components acts to retain the activity of the lentiviral vector particles upon freezing and lyophilization or drying by evaporation. The preferred saccharide is lactose, but other saccharides (eg,
Sucrose, mannitol, glucose, trehalose, inositol, fructose, maltose or galactose) can also be used. In addition, combinations of saccharides may also be used (eg, lactose and mannitol, or sucrose and mannitol (eg, lactose concentration is 3-4% by weight).
). Preferably, the concentration of the saccharide ranges from 1% to 12% by weight.

The high molecular weight structural additives assist in protecting virus aggregates during freezing and provide structural support in the lyophilized or dry state. In the context of the present invention, structural additives are considered "high molecular weight" if they exceed a molecular weight of 5000. A preferred high molecular weight structural additive is human serum albumin. However, other substances such as hydroxyethylcellulose, hydroxymethylcellulose, dextran, cellulose, gelatin, or povidone can also be used. A particularly preferred concentration of human serum albumin is 0.1% by weight.
Preferably, the concentration of the high molecular weight structured additive ranges from 0.1 to 10% by weight.

The amino acids, when present, function upon cooling and melting of the aqueous solution to further retain viral infectivity. In addition, the amino acids further retain the infectivity of the virus during sublimation of this chilled aqueous solution and during lyophilization.
The preferred amino acid is arginine, but other amino acids such as lysine, ornithine, serine, glycine, glutamine, asparagine, glutamic acid or aspartic acid can also be used. A particularly preferred arginine concentration is 0.1% by weight. Preferably, the amino acid concentration ranges from 0.1% to 10% by weight.

The buffering component acts to buffer the solution by maintaining a relatively constant pH. Various buffers may be used to provide a desired pH range (preferably pH 7.0-7.0).
7.8) can be used. Suitable buffers include phosphate buffers and citrate buffers. Particularly preferred pH of this lentiviral vector particle formulation
Is 7.4, and the preferred buffer is tromethamine.

Furthermore, the aqueous solution preferably contains neutral salts used to adjust the final formulated lentiviral vector particles to an appropriate isotonic salt concentration. Suitable neutral salts include sodium chloride, potassium chloride or magnesium chloride. A preferred salt is sodium chloride.

Aqueous solutions containing the desired concentrations of the components described above can be prepared as concentrated stock solutions.

Store lentiviral vector particles in lyophilized state for later reconstitution 1
One method comprises (a) combining the infectious lentiviral vector particles with an aqueous solution to form an aqueous suspension, wherein the aqueous suspension contains 4% by weight lactose,
. 1% by weight of human serum albumin, 0.03% by weight or less of NaCl, 0.1% by weight of arginine, and an effective amount of tromethamine buffer to provide a pH of this aqueous suspension of approximately pH 7.4. (B) cooling the suspension to a temperature of -40C to -45C to form a frozen suspension; and (b) stabilizing the infectious lentiviral vector particles; c) removing water from the frozen suspension by sublimation to form a lyophilized composition having less than 2% water by weight of the lyophilized composition, wherein the lyophilized composition is reconstituted during reconstitution. Infecting mammalian cells. This lentiviral vector particle is replication defective,
It is also preferred that it is suitable for administration to humans upon reconstitution.

Given the disclosure provided herein, it may be preferable to utilize a particular saccharide in the aqueous solution when the lyophilized lentivirus is intended for storage at room temperature. Will be apparent to those skilled in the art. More specifically,
It is preferred that disaccharides (eg, lactose or trehalose) be particularly utilized for storage at room temperature.

The lyophilized or dehydrated lentivirus of the present invention can be reconstituted using various substances, but is preferably reconstituted using water. In certain cases, a dilute salt solution that provides isotonicity to the final formulation may also be used. In addition, it may be advantageous to use aqueous solutions containing components known to enhance the activity of the reconstituted lentivirus. Such components include cytokines (eg, I
L-2), polycations (eg, protamine sulfate), or other components that enhance the transduction efficacy of the reconstituted lentivirus. The lyophilized or dehydrated lentiviral vector particles can be reconstituted with any convenient volume of water or the reconstituting agent described above to allow substantial and, preferably, complete lysis of the lyophilized or dehydrated sample. Can be configured.

(Administration) As described above, the recombinant lentiviral particles of the present invention can be administered to a wide variety of sites (eg, cerebrospinal fluid, bone marrow, joints, arterial endothelial cells, rectum, buccal / sublingual, vaginal, An organ selected from the group consisting of: lung, liver, spleen, skin, blood and brain
Alternatively, it can be administered to a site selected from the group consisting of tumor and interstitial space.
In other related embodiments, the lentiviral vector particles are intra-articular,
It can be administered intraocularly, intranasally, sublingually, prone, topically, intravesically, intrathecally, topically, intravenously, intraperitoneally, intracranial, intramuscularly, or subcutaneously. Other typical routes of administration include gastroscopy, ECRP and colonoscopy, which do not require complete surgical procedures and hospitalization, but may require the presence of a health care professional.

Considerations for administering the compositions of the present invention include the following.

Oral administration is easy, convenient, economical (sterile conditions are not required), safe (
Overdosing can be treated in most cases), allowing for a controlled release of the active ingredient (the lentiviral vector particles) of the composition. Conversely, there may be local stimuli such as nausea, nausea or diarrhea, biased absorption for less soluble drugs, and the lentiviral vector particles may be "first-pass" by hepatic metabolism and degradation by stomach acids and enzymes. Effect. Furthermore, the onset of action may be slow, efficient plasma levels may not be achieved, requires patient cooperation, and diet may affect absorption. A preferred embodiment of the present invention involves the oral administration of lentiviral vector particles that express genes encoding erythropoietin, insulin, GM-CSF cytokines, various polypeptides or peptide hormones, agonists or antagonists thereof. Here, these hormones can be derived from the pituitary, hypothalamus, kidney, endothelial cells, liver, pancreas, bone, hematopoietic bone marrow and adrenal gland. Such polypeptides can be used for inducing proliferation, restoring tissues, suppressing the immune response, apoptosis, gene expression, blocking receptor-ligand interactions, immune responses, and for certain anemias, diabetes, infectious diseases, Hypertension, abnormal blood chemistry (eg, high blood cholesterol, deficiency of blood clotting factors, low H
High LDL with DL), the level of Alzheimer-related amyloid protein,
It can be a treatment for bone erosion / calcium accumulation and control of levels of various metabolites such as steroid hormones, purines and pyrimidines. Preferably, the lentiviral vector particles are first lyophilized, then filled into capsules and administered.

[0179] Buccal / sublingual administration is a convenient method of administration that provides rapid onset of action of the active ingredients of the compositions of the present invention and avoids first-pass metabolism. Thus, there is no gastric acid or enzymatic degradation and absorption of lentiviral vector particles is possible. There is high bioavailability and virtually immediate discontinuation of treatment is possible. Conversely, such administration requires relatively low dosages (typically about 10-15 mg
) And is impossible to eat, drink, or swallow at the same time. Preferred embodiments of the present invention include buccal / sublingual administration of lentiviral vector particles containing a gene encoding an autologous and / or exogenous MHC, or immunomodulator, for the treatment of oral cancer; IgA or IgE anti- Treatment of Sjögren's syndrome via buccal / sublingual administration of such lentiviral vector particles containing sense genes; and treatment of gingivitis and periodontal disease via buccal / sublingual administration of IgG or cytokine antisense genes .

Rectal administration provides negligible first-pass metabolic effects (good vascular / phosphorus)
There is a supply of pa tract and the absorbed substance is brought directly into the inferior vena cava
), And this method is appropriate for children, patients with vomiting, and unconscious people
. This method avoids degradation by gastric acids and enzymes, and changes the ionization of the composition
do not do. Because rectal fluid has no buffer capacity (pH 6.8; charged)
Compositions are best absorbed). Conversely, loosening, poor or unstable absorption,
There may be irritation, degradation by bacterial flora, and a narrow absorbing surface (about 0.05 m ^Two ) Exists. In addition, lipophilic and water-soluble compounds are preferred for absorption by the rectal mucosa, and absorption enhancers (eg, salts, EDTA, NSAIDs) are required.
obtain. A preferred embodiment of the invention is a colon cancer antigen, autologous and / or foreign.
Lentiviral vector containing a gene encoding an MHC or an immunomodulator
Including rectal administration of ter particles.

Nasal administration avoids first-pass metabolism and degradation with stomach acids and enzymes and is convenient. In a preferred embodiment, nasal administration is useful for administration of lentiviral vector particles, where the lentiviral vector particles are capable of expressing a polypeptide having properties as described in the present invention. Conversely, such administration may cause local irritation, and absorption may depend on the condition of the nasal mucosa.

Pulmonary administration also avoids first-pass metabolism and degradation with stomach acids and enzymes and is convenient. In addition, pulmonary administration allows for local effects that minimize the dosage required for systemic side effects and efficacy, and allows rapid onset of action and self-medication. Conversely, if only a small portion of the administered composition does not reach the bronchioles / alveoli, local irritation may be present and overdose is possible. In addition, patient cooperation and understanding is preferred, and sprays for dosing may have toxic effects. A preferred embodiment of the present invention relates to a gene encoding IgA or IgE for the treatment of conditions such as asthma, hay fever, allergic alveolitis or fibrotic alveolitis, for the treatment of cystic fibrosis. Includes pulmonary administration of lentiviral vector particles that express the CFTR gene, and proteases such as α-1-antitrypsin and collagenous inhibitors for the treatment of emphysema. Or,
Many of the same types of polypeptides or peptides listed above for oral administration can also be used.

Ophthalmic administration provides a local effect and is capable of prolonging the effect if the administration is through an insert. In addition, first-pass metabolism and avoidance of degradation by gastric acids and enzymes and self-administration via the use of inserts such as eye drops or contact lenses are possible. Conversely, this administration is not always efficient. Because
This administration causes lacrimation. Preferred embodiments of the present invention include ocular administration of lentiviral vector particles expressing a gene encoding IgA or IgE for the treatment of hay fever conjunctivitis or spring and radioconjunctivitis; and melanoma-specific antigens (eg, high Ocular administration of lentiviral vector particles comprising genes encoding autologous and / or foreign MHC, or immunomodulators.

Transdermal administration allows for rapid discontinuation of treatment and prolonged action, leading to good compliance. In addition, local treatment is possible and avoids first-pass metabolism and degradation with stomach acids and enzymes. Conversely, such administration can cause local irritation, development of tolerance is particularly sensitive, and is typically not preferred for very potent compositions. Preferred embodiments of the present invention include transdermal administration of lentiviral vector particles expressing a gene encoding IgA or IgE for the treatment of conditions such as atopic dermatitis and other skin allergies; and melanoma-specific Transdermal administration of lentiviral vector particles containing a gene encoding an antigen (eg, a high molecular weight melanoma-associated antigen), autologous and / or foreign MHC, or an immunomodulator.

Vaginal administration provides one preferred route for topical and hormonal administration. In addition, such administration avoids first-pass metabolism and degradation with stomach acids and enzymes, and is preferred for administration of the composition when the lentiviral vector particles express the peptide. Preferred embodiments of the present invention are self and / or
Or vaginal administration of foreign MHC or lentiviral vector particles containing a gene encoding an immunomodulator. Another preferred embodiment involves vaginal administration of a gene encoding a component of a sperm, such as histone, flagellin, etc., to promote the production of sperm-specific antibodies and thereby prevent pregnancy. This effect can be reversed and / or pregnancy in some women is enhanced by delivering a lentiviral vector particle vector encoding an immunoglobulin antisense gene that interferes with the production of sperm-specific antibodies. obtain.

Intravesical administration provides local treatment for urine generation problems, avoids systemic side effects,
It allows for first-pass metabolism and avoids degradation by gastric acids and enzymes.
Conversely, this method requires urine catheterization and requires highly skilled personnel. A preferred embodiment of the present invention involves intravesical administration of lentiviral vector particles encoding an anti-tumor gene such as a prodrug activating gene (eg, thymidine kinase) or various immunomodulatory molecules (eg, cytokines).

[0187] Endoscopic retrograde cholangiopancreatography (ERCP) (through the mouth; does not require skin piercing) takes advantage of long gastroscopy and provides selective access to the biliary and pancreatic ducts Enable close access. Conversely, this method requires very skilled personnel and is uncomfortable for the patient.

Many of the routes of administration described herein (eg, to CSF, to bone marrow,
Into joints, intravenously, intraarterially, intracranial, intramuscularly, subcutaneously, into various organs, into tumors,
(To the interstitial space, intraperitoneally, intralymphatic, or into the capillary bed) may be achieved by direct administration simply by using a needle, catheter or related device. In particular, in certain embodiments of the invention, one or more doses are administered directly in the indicated manner at a dose of 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ or 10 ¹¹ cfu or more. Can be done.

[0189] Lentiviral vector particles can be delivered to the target from outside the body (as an outpatient procedure) or as a surgical procedure. Here, the vector is administered as part of a procedure with other purposes or as a procedure explicitly designed for administering the vector. Other routes and methods for administration are described in PCT / US9
Non-traumatic pathway disclosed in 5/16967, as well as PCT / US95 / 164
71, including administration via multiple sites.

The following examples are provided by way of illustration, and not by way of limitation.

(Example) (Example 1) (Construction of vector based on HIV-1) (A. Construction of vector backbone) The plasmid pSK-ΔH3 was replaced with pBluescript SK (-) (Str
(Atagene, La Jolla, Calif.) by digestion, filling and blunt-end ligation of the unique HindIII site.

Molecular clone pNL4-3 (Adachi et al., J. Virol. 1986, 5).
9,284 / NIH AIDS Research and Reference
HIV-1 LTR from e reagent program catalog number 114)
Is amplified by the polymerase chain reaction (PCR) using the following oligomers: LTRB5: 5 'TAG GAT CCT GGA AGG GCT AA
TTTGG 3 ′ (SEQ ID NO :) and LTRB3: 5 ′ (TAG GAT
CCT TTC GCT TTC AAG TTC C 3 '(SEQ ID NO :)
(Both show a BamHI restriction site at their 5 'end). 681 bp
The long amplified fragment is cloned into the unique BamHI site of pSK-ΔH3. The resulting plasmid is named pHIV-LTR.

The HindIII to 1181 bp fragment of pNL4-3 (including the 3 ′ end of the 5 ′ LTR and the 5 ′ portion of the gag gene) were cloned into pBlu.
SK (-) cloned into the unique HindIII site
Create HIV-H3F5 '.

The 916 bp fragment of HidIII to SphI from pHIV-H3F5 ′ was ligated to the 3482 bp fragment of HindIII to EcoRI from pHIV-LTR using a SphI-EcoRI adapter to form a pHIV-EcoRI adapter.
LTR 5 'is obtained.

To abolish the expression of the gag gene portion present in the pHIV-LTR 5 ′ construct, the start codon region was changed from GAG ATG GGT to GAG AAC C G
Oligonucleotide 5′GGA GGC TAG AAG GAG AGA GAA CCG mutated to GT (SEQ ID NO :) by site-directed mutagenesis (Muta-gene kit, Biorad, Hercules, CA)
It is modified using GTG CGA GAG CGT CG3 '(SEQ ID NO :). This modification results in ATG codon disruption and +1 frame shift of the HIV gag gene open reading frame. This mutation also has a unique A
A gel site (ACCGGT) is created.

To eliminate unwanted restriction sites, the EcoR of plasmid pHIV-LTR
The region consisting of between I and XhoI is destroyed by digestion with the corresponding enzymes, filling and subsequent religation to obtain pHIV-LTRΔRI / Xho.

The XhoI-HindIII 719 bp fragment from pNL4-3 was ligated with the XbaI-HindIII fragment from pHIV-LTR-ΔRI / Xho using an XbaI-XhoI adapter to form pLTR-HIV3.
Get '.

To create an HIV-1 based vector backbone (designated vHIV-1), a 1510 bp NotI-XhoI fragment from pHIV-LTR5 ′ is inserted into the NotI and XhoI sites of pHIV-LTR3 ′ ( See FIG. 1).

B. Addition of Nuclear Translocation Elements To enable vector transcripts to be efficiently transferred from the cell nucleus to the cytoplasm, nuclear translocation elements can be added to vHIV.

The HIV-1 Rev responsive element (RRE) was cloned into pNK4-3 by PCR.
From the following oligomers: RRE1: 5 ′ GCA AGC TT
C TGC AGA GCA GTG GGA ATA GG 3 '(SEQ ID NO :) and RRE2: 5' GCA AGC TTA CCC CAA ATC
CCC AGG AGC TG 3 '(SEQ ID NO :) (these are their 5'
With a HindIII site at the end). The resulting 283 bp amplified fragment is inserted into the BanHI site of pSK (-) to create pRRE.

The RRE fragment was extracted from pRRE using the enzymes EcoRI and ClaI and inserted into the EcoRI and ClaI sites of vHIV to insert the vHIV
Get R.

[0202] Hepatitis B virus (HBV) post-transcriptional regulatory element (PRE) (Liang and Huang, Mol. Cell. Biol. 13: 7476, 1993) or the constitutive transport element of Mason-Petizer monkey virus (MPMV) (
CTE) (Bray et al., Proc. Natl. Acad. Sci. USA 91).
: 1256, 1994) were amplified by PCR using specific primers that also display a HindIII restriction site at their 5 ′ end, and HI in vHIVR
Instead of V-1 PRE, insert into the EcoRI and ClaI sites in vHIVT to obtain vHIVP and vHIVC, respectively.

(C. Addition of Gene of Desired Sequence to Vector Backbone) pSP6-βgal (Shapira et al., Gene 25: 71-82, 19)
83) from the XbaI-SstI fragment of pSP6-βgal
1.1 kb SstI-SmaI fragment and 2.6 kb Xba from
Ligated with pUC19 DNA digested with I-SmaI, pUC-βga
1 are formed. The β-galactosidase gene is then extracted from pUC-β-Gal by cutting with the restriction enzymes SalI and SmaI. A 750 bp fragment containing the human cytomegalovirus (hCMV) early gene promoter is also known as pCMV-G (Yee et al., Proc. Natl. Acad. Sci.
USA. 91: 9564, 1994) by digestion with XbaI and SalI. These two fragments were ligated together and pBlue
insert (SK-) at the XabI and SmaI sites to insert pCMV-
Obtain β-Gal.

The 3800 bp NotI to HindIII fragment was ligated with pCMV-β-G
After extraction from al and blunting the site, it is inserted into the XhoI site of vHIVR to yield vHRC-β-Gal. The XhoI site is recreated by ligation of NotI and XhoI at the blunted site. A similar cloning strategy was applied to vHIVC to create vHCC-β-Gal and vHIVP
To produce vHPC-β-Gal.

D. Tissue-Specific Promoters To limit the expression of a gene of interest in certain cell types, the β-galactosidase gene is placed under the control of two different tissue-specific promoters.

More specifically, to induce liver tissue-specific expression of the transgene, an 88 bp HincII-RsaI fragment from construct pΔCCAT7 (Yee, Science, 1989, 246, 658), which is a hepatitis B Virus (HBV), including liver-specific enhancers), and herpes simplex virus (HSV).
) Cloning upstream of the thymidine kinase (TK) gene promoter,
Drives expression of β-galactosidase instead of the MV promoter.

Similarly, the CD2 gene enhancer (Lake et al., EMBO J. 9: 312
9, 1990) was cloned upstream of the HSV TK gene promoter,
Induces lymphocyte-specific expression.

E. Expression of dicistronic cassettes Two types of dicistronic constructs are designed to achieve expression of two or more transgenes driven by the same promoter from a single vector.

In a first construct, a 2.1 kb BamHI to HindIII fragment encoding firefly luciferase gene sequence (luc) and pLL78N
The neomycin phosphotransferase gene sequence (neo) 78 nucleotides distal from L (Levine et al., Gene 108: 167, 1991) is
Insertion into the SalI to SalI backbone of HRC-β-gal creates vHRCL78N. With a 78 nucleotide linker between these two genes,
Before the large ribosomal subunit is detached from the mRNA, translation of the second open reading frame can be restarted.

[0210] In a second type of construct, the poliovirus internal ribosome entry site (PO-
IRES) is inserted between these two gene sequences (Adam, J. Vi.
rol. 65, 4985, 1991). This IRES allows the start of the second open reading frame independent of the start of the first.

(Example 2) (Generation of packaging cell line) (A. Construction of gag / pol expression cassette: pCMV-HIV-1) To construct the packaging cassette pCMV-HIV-1, pCMVD was used.
PIenvpA (Parolin et al., J. Virol. 68: 3888-38).
95, 1994) with a 0.7 base pair (kb) BamHI-SphI fragment with a 19 base pair (bp) deletion at the putative packaging signal of pNL4-3 (the full-length genome of infectious HIV-1). Including, Adachi et al.
Virol. 59: 284, 1986, 8 kb SphI-HindIII (obtained from NIH AIDS Reagent program) (positions 1447 to 9606).
Position) fragment and pCMV-G (Yee et al., Proc. Natl. Aca
d. Sci. USA 91: 9564-9568, 1994).
AllI-EcoRI fragment was fused. In addition, a 580 bp BglI
A deletion of the I (position 7031 of pNL4-3) -BglII (position 7611 of pNL4-3) fragment was made in the HIV-1 Env coding region to eliminate expression of this protein and to reduce expression during vector generation. Reduced the possibility of helper virus production.

1. Generation of nef (-) Mutants In order to generate pCMV-HIVnef (-), the H of pCMV-HIV-1 was
paI (position 8650 of pNL4-3) and HindIII (9 of pNL4-3)
606).

(2. Generation of vif (−) Mutant) In order to generate pCMV-HIVvif (−), pCMV-HIV-1 was prepared by:
It was digested with NdeI (position 5123 of pNL4-3) and repaired with the Klenow fragment to create a 2 bp insert into the coding region of the vif gene.

3. Generation of vpu (-) Mutants In order to generate pCMV-HIV vpu (-), the start codon of Vpu was site-directed mutagenized (Mutagene kit, Biorad, Hercules,
CA), the oligonucleotide 5'TGCTACTATTATATAGGTT
Mutation was performed using GTACCATGTACTACTACTG3 '.

4. Generation of vpr (−) Variants To generate pCMV-HIV vpr (−), pCMV-HIV-1 was
It was digested with EcoRI (position 5747 of pNL4-3) and repaired with the Klenow fragment to create a 4 bp insert into the coding region of the vpr gene.

(5. Generation of vpr (-) nef (-) Double Mutant) pCMV-HIV The vpr (-) nef (-) double mutant was
-Nef (-) is made by digesting with EcoRI as described above,
And repaired with Klenow fragment.

6. Generation of pCH-GP-1 To generate pCH-GP-1, a 0.66 kb fragment between the SphI site at positions 766 and 1447 of pNL4-3 was ligated with the polymerase chain. reaction(
PCR), the oligonucleotide Gag5'5'GAGGATCCTAG
AAGGAGAGAGATGGGGT3 'and Gag3'GAGGATCCA
Amplification was carried out using ATAGGCCCTGCCATGCACTG3 ′. The resulting fragment was cloned with a 3.7 kb SphI-NdeI fragment from pNL4-3 and pC4.
Ligation with a 4 kb SalI-EcoRI fragment from MV-G.

B. Addition of nuclear translocation signal 1. Addition of RRE pCH-GP for efficient translocation of gag / pol transcript from nucleus to cytoplasm
In order to add the RRE sequence to -1, the RRE (77 in HXB-2 (33))
Between positions 54 and 8013) by PCR from pv653RSN (31)
Oligonucleotide RRE5 5'GCAAGCTTCTGCAGAGCA-G
TGGGAATAGG3 'and RRE3 5'GCAAGCTTAC CCC
Amplification was performed using AAATCCC CAGGAGCTG 3 'and the gag / pol gene was cloned into pCHGP-1 shortly thereafter. This construct was named pCH-GP-2 (FIG. 3A).

2. Addition of PRE In order to insert the HBV PRE sequence for efficient transfer of gag / pol transcripts, pCCAT-1 (Yee, Science 246: 658, 1989).
) Spanning the PRE region in StuI-HindIII HBV fragment (Liang and Huang, Mol. Cell. Biol. 13:
7346, 1993; Huang and Yen, J. Mol. Virol. 68: 319
3, 1994; Donello et al. Virol. 70: 4345, 1996
) Was inserted into the EcoRV site of pBluescript SK (-),
A K-PRE was formed. The PRE fragment of pSK-PRE was isolated by digestion with ClaI and EcoRI, and cloned into ClaI and EcoRI digested pCH-GP-1 to form pCH-GP-3 (FIG. 3B).
.

3. Addition of CTE Mason-Petizer monkey virus (MPMV) (Bray et al., Proc. N
atl. Acad. Sci. USA 91: 1256, 1994)
To insert the sequence into pCH-GP-1, the CTE sequence in pGem7fz (−) MPMV is amplified by PCR using the following primer pair: 5′GT
CATCGATA GACTGGACAG CCAATG3 '(SEQ ID NO :) and 5' CTAGAATTCC CAAGACATCA TCCGGG3 '(SEQ ID NO :), which contain ClaI and EcoRI, respectively, as described above. This PCR product was digested with ClaI and EcoRI in pCH-GP
-1 to form pCH-GP-4 (FIG. 3C).

C. Generation of Stable Packaging Cell Line To establish a stable packaging cell line, an amphipathic env or VSV
Any of -G can be expressed in place of the HIV env to render this HIV vector pseudotyped. The first strategy uses the H necessary for efficient expression of vector genomic RNA.
To establish a 293 cell line that expresses IV tat. To construct a tat expression plasmid, a 360 bp Sa spanning the first exon of the tat gene
The lI-BamHI fragment is isolated from pCV1 (Arya et al., Sci.
nce 229: 69, 1985). A 1390 bp XbaI-XhoI fragment containing the CMV promoter and rabbit β-globin gene splice signal is isolated from pCM-G. A 3295 bp BamHI-XbaI fragment containing the polyadenylation site of the rabbit β-globin gene was also obtained from pCMV
-Isolate from G. All three fragments were ligated together to form pCMV
-Tat is formed (FIG. 4A). To establish a stable tat expressing cell line, 2
93 cells were purified from pCMV-tat and pSV2-gpt (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78: 2072).
Co., 1981, obtained from the ATCC) in a 10: 1 ratio. The transfected cells are subjected to selection on a medium containing mycophenolic acid, xanthine and HAT. Viable cells are pooled and clones are isolated by limiting dilution. To screen for tat expression, culture supernatant from each clone was spotted on a nylon membrane and tat was analyzed using an ECL western blot system (Amersham, Arlington He.
light, IL), an anti-tat antibody (Advanced Biotec)
hnologies Inc. , Columbia, MD).

To express HIV gag / pol, pCH-GP-3 or pCH-pol
GP-4, pFR400 (Proc. Natl. Acad. Sci. USA)
80: 2495, 1983) and co-transfect 293 / tat cells. The transfected cells are selected in methotrexate (Mtx) containing medium and cloned by limiting dilution. Mtx resistant clones were picked and gag / pol expression was determined using HIV p24 in the culture supernatant.
Assay by expression of 293 / tat expressing highest levels of p24
/ Gag / pol clones are expanded and used for stable expression of amphipathic env.

To express the amphipathic env gene, pCMVenv ^am DraI (PCT
No. WO92 / 05266; U.S. Pat. No. 5,591,624), and pTK-p
uro (Chen et al., Proc. Natl. Acad. Sci. USA 93:
10057, 1996), 293 / tat / gag / pol cells are co-transfected. 293 / tat / gag / pol / env clones are isolated from puromycin resistant colonies by limiting dilution. Expression of the env gene was determined by Western blot analysis using the anti-env polyclonal antibody, RLVgP69 / 71 (Quality Biotech Inc., Cam.
den, NJ). The clone expressing the highest level of env is identified and expanded.

A packaging cell line expressing VSV-G instead of amphipathic env is also established. The VSV-G gene is derived from pTetO-G-2 (Chen et al., Proc.
Natl. Acad. Sci. USA 93: 10057, 1996) under the control of an inducible promoter of the tet system (Gossen and Bujar).
d, Proc. Natl. Acad. Sci. USA 89: 5547,199
2, from Bujard). This is because stable VSV-G expression resulted in cell death. To express VSV-G, the transactivator for this inducible promoter, tTAER (Chen et al., Proc.
tl. Acad. Sci. USA 93: 10057, 1996) must first be established. 293 / tat described above
Cells were purified from phyg-CMV-tTAER (Chen et al., Proc. Natl. A.
cad. Sci. USA 93: 10057, 1996) and hygromycin resistant clones are isolated by limiting dilution. To identify clones expressing the highest levels of tTAER, cells from these clones were cloned into pUHC13-3 (Gossen and Bujard, Pro
c. Natl. Acad. Sci. USA 89: 5547, 1992, Buj.
and luciferase (luc) activity is determined 48 hours after transfection in the presence of tetracycline or β-estradiol. A 293 / tat / tTAER clone expressing the highest level of lux activity in the presence of β-estradiol is identified and expanded.

To express HIV gag / pol, pCH-GP-3 or pCH-
GP-4 co-transfects 293 / tat / tTAER cells with pFR400 and 293 / tat / expresses the highest level of p24.
The tTAER / gag / pol clone is isolated as described above. To introduce the VSV-G gene, 293 / tat / tTAER / gag / pol cells were transformed with p
Transfect with TetO-G-2 and select on media containing puromycin. 293 / tat / tTAER / expressing low levels of VSV-G /
The gag / pol / G clone was isolated by limiting dilution of puromycin-resistant cells, followed by induction of β-estradiol for VSV-G expression, and a monoclonal antibody specific for I1 (G (Burns et al., Proc. Natl. Acad.
. Sci. USA 90: 8033, 1993). Clones expressing low levels of VSV-G are isolated. Because of the high level of VS
VG expression leads to rapid (within 4-5 days) cell death, while low levels of VS
VG expression has little effect on cell growth and extends the period of virus collection (
(Up to 2 weeks) (Chen et al., Proc. Natl. A.).
cad. Sci. USA 93: 10057, 1996).

[0226] The packaging cells described above contain HIV gag and pol, CTE and P
It is expressed using RE sequences, which circumvent the requirement for rev and RRE for efficient transfer of gag / pol mRNA from the nucleus to the cytoplasm. r
To determine whether ev and RRE can produce higher virus titers, 293 / tat / tTAER cells are co-transfected with pCH-GP-2 and pFR400 and the transfected Cells
Clones with selection in medium containing tx and limiting dilution. Mtx resistant clones are picked and gag / pol expression is assayed by introducing the rev gene into these clones. To introduce rev, these clones were cloned into a KT-1 virus containing the HIV rev gene in an MLV-based vector (Chiron Technologies, San Diego, CA).
Infect. HIV p24 in the culture supernatant is assayed 48 hours after infection. 293 / tat / tTAE expressing highest level of p24 upon introduction of rev
The R / gag / pol clone is expanded and used for stable expression of rev.

Since high levels of rev expression can be toxic to cells, the rev gene was placed under the control of an inducible promoter in the tet system. 72 including rev cDNA
A 2 bp Bsu36I fragment was isolated from pCV1 and pUHG10
-3 (Gossen and Bujard, Proc. Natl. Acad. Sc.
i. USA 89: 5547, 1992, obtained from Bujard) to form pTetO-rev (Figure 4B). rev
To introduce the gene, pTetO-rev, pTK phleomycin (Ye
e, personal communication) co-transfect 293 / tat / tTAER / gag / pol cells. Clones expressing the highest levels of rev are identified by limiting dilution of phleomycin-resistant cells, followed by β-estradiol induction and detection of p24 in the culture supernatant.

The VSV- in 293 / tat / tTAER / gag / pol / rev cells
VSV in pTetO-G-2 to express G or amphipathic env
-The G gene or the amphipathic env gene in pCMVenv ^am DraI
293 / tat / tTAER / gag / pol / rev cells and
Clones expressing either SV-G or env are isolated as described above.

D. Auxiliary Proteins The genes encoding the auxiliary proteins can be PCR amplified from pNL4-3 and cloned into pCMV-Bam for expression. With this plasmid,
PCMUIV-K containing mouse H-2K cDNA (Song et al., J. Biol)
. Chem. 269: 7024, 1994, Per Peterson, The.
Scripts Research Institute, La Jolla
, Obtained from CA) and one of the above packaging cell lines. Transfected cells are isolated by FACS sorting using Y3, a monoclonal antibody for H-2K. Clones expressing the highest levels of accessory proteins are identified using Western blot analysis using a specific polyclonal antibody (obtained from NIH AIDS Reagent Program). It is known to block the cell cycle in the G2 phase (Planelles et al., J. Virol. 70: 2516).
, 1996), the PCR amplified Vpr cDNA was replaced with pU
Insert into HG10-3 under the control of a tet inducible promoter as described for rev expression. In this construct, along with pCMUIV-K ^b, it was cotransfected package managing cell lines and clones expressing Vpr isolated as described above.

In addition to the 293-based packaging cell line, human HT1080 and He
Cell lines based on La cells, canine cf2 and D17 are established and tested for viral titer potency using the same strategy as described above.

To generate stable VCL, pCMV-G and pCMVΔR9 (Naldini et al., Science 272: 263, Ve
293 cells along with rma, obtained from The Sark Institute, La Jolla, CA). Virus harvested 48 hours after transfection was used to infect one of the packaging cell lines described herein, and the VCL clone was replaced with a neo selection or marker gene (β- gal, alkaline phosphatase, or nerve growth factor receptor). The titer potency for these clones is determined by infecting HT1080 cells with the virus collected from each clone, followed by neo selection or FACS analysis.

Example 3 Transient Production of Infectious Vector Particles A. Protocol To generate infectious HIV vectors, 293T cells were plated at 4 × 10 4 per 10 cm diameter culture dish. Inoculated at a density of ⁶ cells. Infectious vector containing all auxiliary proteins was added to 10 μg pCMV-HIV-1, 10 μg pCM
CMV-G and 20 μg pv653CMVb-gal were co-precipitated with calcium phosphate (Graham and van der Eb, Virology 52:
456-467, 1973) by co-transfection. The culture medium was replaced after 6-8 hours, and the culture supernatant was collected 18 hours after transfection, passed through a 0.45 μm filter and stored at -80 ° C. To generate a vector without any accessory proteins, 293T cells were co-transfected with the following five plasmids: 8
μg pCHGP plasmid series (gag / pol plasmid), 8 μg pC
MV-G (VSV-G plasmid), 16 μg pv653CMV β-gal
(HIV vector), 4 μg pCMV-Tat and 4 μg pCMV-Re
v. In certain experiments, 0-10 mM sodium butyrate is added to the medium during transfection. Using this five plasmid transfection protocol, all accessory proteins were removed. In addition, the potential for producing replication competent viruses is significantly reduced.

To determine vector titers, 5 × 10 ⁴ HT1080 cells were plated in 12-well plates 24 hours prior to infection in the presence of 8 μg / ml polybrene. The cells are infected overnight with various dilutions of the vector, and
Time was assayed for β-gal activity.

To assay for β-gal activity, cells were washed once with PBS and
. Fix in 25% glutaraldehyde for 15 minutes and 4 hours at 37 ° C. for 5 minutes
mM ferriferrocyanide potassium, 400 μg / ml X-gal (GBT,
St Louis, and stained in a solution containing MO) and ImM MgCl _2.

(B. Results) The results are shown in FIG. Briefly, as can be seen from this table, deletion of the auxiliary protein from this vector particle does not appear to have much effect on vector titer.

The results are also shown in FIG. Briefly, CTE from Mason-Petizer monkey virus could replace the function of RRE. However, both RRE and rev still appear to produce the highest levels of gag production.

The results of the five plasmid transfection protocols are shown in FIG. Briefly, as described above, all five accessory proteins can be removed using these five plasmid transfection protocols. In addition, the potential for producing replication competent viruses is significantly reduced.

The results of using sodium butyrate in these five plasmid transfection protocols are shown in FIG. Briefly, the addition of sodium butyrate to the transfection medium can enhance vector particle production by more than 10-fold.

Example 4 Effect of Auxiliary Proteins on Vector Infectivity In order to study the ability of HIV vectors to infect quiescent cells and the effects of these auxiliary proteins on infectivity, HeLa cells were exposed to gamma irradiation. The cells were then arrested in the G2 phase of the cell cycle. More particularly, HeL with growth or cessation of growth.
a cells were transformed into MLV-β-gal, MLV vector containing β-gal gene or H
Transduction was performed with either the IV-1 based vector v653CMVβ-gal (+) (which contains all four accessory proteins) or v653CMVβ-gal (-) (without accessory proteins). Positive cells were scored by X-gal staining two days after transduction.

The results in HeLa cells are expressed as a percentage of the titer observed in the same virus preparation in growing HT1080. As shown in FIG. 10, significant differences in titers were indicated by the v653CMVβ-gal (+) vector or v653C
Proliferative or resting HeL transduced with any of the MVβ-gal (−) vectors
It was not observed in a cells. In contrast, the transduction efficiency of MLV vectors in quiescent cells was reduced by more than 2000-fold. Similar results were observed in irradiated HT1080 cells transduced with these three vectors (data not shown).

To confirm that the observed β-gal activity was not due to mock transduction of the β-gal activity present in the vector preparation, growing HeLa cells transduced with this vector were gradually expanded. Concentration of 3'-azido-3'-deoxythymidine (AZ
T). Both blue cells and β activity in cell extracts decreased with increasing concentrations of AZT (data not shown). These results indicate that, in contrast to MLV vectors, HIV-1 based vectors can efficiently transduce quiescent cells, and that the accessory proteins encoded by HIV-1 can transduce these cells. Demonstrate that it is not necessary.

To test the infectivity of HIV-1 based vectors in other cell types,
Human primary human dermal fibroblasts were either grown or cultured to confluence and then infected with the three retroviral vectors described above. Fibroblasts that had grown to confluence became contact-inhibited and arrested in the G0 / G1 phase of the cell cycle (data not shown). As shown in FIG. 11, these three vectors show similar transformation efficiencies in dividing fibroblasts. However, in quiescent cells, MLV-β-gal vector transduction was reduced to almost undetectable levels. The capacity of v653CMVβ-gal (+) was unchanged. In contrast, v653CMVβ-gal (−), which is deficient for the HIV-1 auxiliary protein, has a 4- to 4-fold efficiency level of transducing contact inhibited fibroblasts compared to the v653CMVβ-gal (+) vector. Showed a 7-fold reduction. These results suggest that the requirement for accessory proteins depends on the cell type for efficient transduction with HIV-1 based vectors.

[Brief description of the drawings]

FIG. 1 is a schematic diagram of one representative HIV-1-based vector.

FIGS. 2A, 2B, and 2C show pCMV-HIV-1, pV653, respectively.
FIG. 3 is a schematic diagram of CMV-βgal and pCMU-G.

FIGS. 3A, 3B, 3C, and 3D show pCH-GP-1, pCH-
It is a schematic diagram of GP-2, pCH-GP-3, and pCH-GP-4.

FIGS. 4A and 4B are schematic diagrams of pCMV-tat and pTetO-rev.

FIG. 5 is a flowchart of one exemplary method of generating a packaging cell line.

FIG. 6 is a schematic diagram showing a comparison of the genomic organization of lentivirus and oncoretrovirus.

FIG. 7 is a table showing HIV-1 accessory proteins sensitized for vector production.

FIG. 8 is a table showing p24 expression levels in pCHGP transfected cells.

FIG. 9 is a bar graph showing stimulation of vector production by sodium butyrate. Briefly, vectors derived from either pCMV-HIV-1 (closed box) or PCHGP-2 (hatched box) were generated from 293T cells in the presence of the indicated varying concentrations of sodium butyrate. Titers were determined in HT1080 cells as described in Materials and Methods. The values are the ratio of the titer with sodium butyrate to the titer without sodium butyrate for each vector.

FIG. 10 is a bar graph showing transfection efficiency in HeLa cells. Briefly,
Using 300 μl of different virus preparations, in a 12 well plate,
HeLa cells that were actively dividing or had stopped growing were transduced. Cells were harvested two days after transduction and total β-galactosidase activity was determined by X-Gal
Determined by counting blue cells after staining. Results are the percentage of vector titers observed in HT1080 cells for each virus preparation ((HeL
titer in a (split or resting) / titer in HT1080 x 100).

FIG. 11 is a bar graph showing transduction efficiency in human dermal fibroblasts.
Briefly, 10 μl of the different types were used to infect dividing and quiescent fibroblasts in 12-well plates. Two days after transduction, X-
The titer was determined by counting the blue cells after Gal staining. Data for transduction of quiescent and dividing fibroblasts are reported as the percentage of the titer observed in growing HT1080 for each virus preparation (titer in fibroblasts (growing or quiescent) / force in HT1080). (Value) × 100). Values are the average of four experiments.

────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁷ Identification FI FI Theme Court ゛ (Reference) A61K 38/00 A61K 37/02 38/43 37/465 (72) Inventor E. Jin Quan United States of America California 92014, Del Mar, Durango Drive 13951 (72) Inventor Jolly, Douglas J. United States California 92024, Rear Cadia, Hillcrest Drive 277

Claims (29)

[Claims] 1. Includes a 5 'lentivirus LTR, a tRNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, a second strand DNA synthesis origin, and a 3' lentivirus LTR. A lentiviral vector, wherein the lentiviral vector contains a nuclear translocation element that is not an RRE. 2. The vector according to claim 1, wherein the nuclear localization element is obtained from MRMV or HBV. 3. The vector according to claim 1, wherein the packaging signal is an extended packaging signal. 4. The vector according to claim 1, wherein said promoter is a tissue-specific promoter. 5. The method according to claim 1, wherein the promoter is a CMV promoter.
The vector according to claim 1. 6. The target gene may be a cytokine, a factor VIII, or a factor I.
2. The vector of claim 1, wherein the vector is selected from the group consisting of factor X, LDL receptor, prodrug activating enzyme, trans-dominant negative viral or cancer-associated protein, and tyrosine hydroxylase. 7. The vector of claim 1, further comprising an internal ribosome entry site. 8. The vector of claim 1, wherein said promoter is operably linked to two genes of interest separated by less than 80 nucleotides. 9. The lentivirus is selected from the group consisting of HIV, HIV-1, HIV-2,
The vector according to claim 1, which is selected from the group consisting of FIV and SIV. 10. A gag / pol expression cassette comprising a promoter, a sequence encoding gal / pol, and a sequence encoding at least one of vpr, vpu, nef, or vif, wherein the gag / pol expression cassette comprises: A gag / pol expression cassette, wherein the promoter is operably linked to gag / pol and vpr, vpu, nef, or vif. 11. A tat expression cassette comprising a promoter and a sequence encoding tat, and a sequence encoding at least one of vpr, vpu, nef or vif, wherein the promoter is tat ,
And toperably linked to vpr, vpu, nef, or vif.
at expression cassette. 12. A rev expression cassette comprising a promoter and a sequence encoding rev and a sequence encoding at least one of vpr, vpu, nef or vif, wherein the promoter is rev. ,
And r operatively connected to vpr, vpu, nef, or vif.
ev expression cassette. 13. A VSV-G expression cassette comprising a promoter and a sequence encoding VSV-G, and a sequence encoding at least one of vpr, vpu, nef or vif, wherein the VSV-G expression cassette comprises: The promoter is
VSV-G and a VSV-G expression cassette operably linked to vpr, vpu, nef, or vif. A host cell comprising the expression cassette according to any one of claims 10 to 13. 15. A packaging cell line comprising a promoter, a sequence encoding gag / pol, and an expression cassette containing a nuclear translocation element, wherein the promoter is replaced by a sequence encoding the gag / pol. An operably linked packaging cell line. 16. A packaging cell line comprising an expression cassette comprising a promoter and a sequence encoding tat, wherein the promoter comprises:
A packaging cell line operably linked to the sequence encoding the tat. 17. A packaging cell line comprising an expression cassette comprising a promoter and an envelope-encoding sequence, wherein the promoter is operably linked to the envelope-encoding sequence. Cell line. 18. A packaging cell line comprising an expression cassette comprising a promoter and a sequence encoding rev, wherein the promoter comprises:
A packaging cell line operably linked to the sequence encoding rev. 19. The packaging cell line may be nef, vif, vpu,
Or further comprising a sequence encoding any one or more of vpr.
19. The packaging cell line according to any one of 16, 17, or 18. 20. The expression cassette according to claim 15, wherein the expression cassette is stably integrated.
19. The packaging cell line of any one of claims 16, 16, 17, or 18. 21. The cell line, wherein the lentiviral vector is transfected with 1
19. The packaging cell line according to any one of claims 15, 16, 17, or 18, which produces a particle concentration of greater than 0 ⁵ cfu / ml. 22. The method of claim 15, wherein said promoter is inducible.
19. The packaging cell line according to any one of 17 and 18. 23. The packaging cell line according to claim 17, wherein said envelope is VSV-G. 24. The method according to claim 15, wherein the cell line produces particles free of replication competent virus upon introduction of a lentiviral vector.
Or the packaging cell line according to any one of 18. 25. An expression cassette for directing the expression of the gag / pol gene, e.
A packaging cell line comprising an expression cassette that directs nv gene expression, an expression cassette that directs Tat expression, and an expression cassette that directs Rev expression. 26. The env gene encodes VSV-G.
The packaging cell line according to 1. 27. A vector-producing cell line comprising the packaging cell line of claim 25 and a lentiviral vector. 28. A method for enhancing the production of an infectious virus, comprising the step of infecting a packaging cell line with a viral vector, wherein:
A method wherein butyrate is added following or after infection of the packaging cell line. 29. The method of claim 28, wherein said butyrate is sodium butyrate.