WO2005108574A1 - Gm1プロモーター及びその利用 - Google Patents
Gm1プロモーター及びその利用 Download PDFInfo
- Publication number
- WO2005108574A1 WO2005108574A1 PCT/JP2005/005077 JP2005005077W WO2005108574A1 WO 2005108574 A1 WO2005108574 A1 WO 2005108574A1 JP 2005005077 W JP2005005077 W JP 2005005077W WO 2005108574 A1 WO2005108574 A1 WO 2005108574A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- gml
- gene
- substance
- protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4722—G-proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/22—Anxiolytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/24—Antidepressants
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4719—G-proteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the present invention relates to the promotion of the gene encoding the trimeric G protein subunit Gml and its use.
- the G protein is a seven-transmembrane receptor, a G protein-coupled receptor (hereinafter sometimes referred to as GPCR; G-protein in coupled recep tor). Acts as a transmitter to carry into.
- GPCR G protein-coupled receptor
- the G protein consists of ⁇ 3 subunits. In an inactive G protein with GDP bound to the ⁇ subunit, when receptor agonists such as hormones and neurotransmitters bind to the GPCR, GDP is released from the subunit and GTP binds instead.
- the activated G protein in which GTP is bound to the ⁇ subunit separates from the GPCR and dissociates into the GTP-bound subunit and 3) subunit.
- G protein regulates various cell functions by promoting or inhibiting target effectors such as adenylate cyclase, Ca 2+ channel, K + channel, and phospholipase C] 3.
- GTP bound to the ⁇ subunit of the activated G protein becomes GDP by the action of the GTPase of the ⁇ subunit and returns to the inactive form.
- target effectors such as adenylate cyclase, Ca 2+ channel, K + channel, and phospholipase C] 3.
- GTP bound to the ⁇ subunit of the activated G protein becomes GDP by the action of the GTPase of the ⁇ subunit and returns to the inactive form.
- G proteins have been identified in mammalian cells. Each of these G proteins has a unique tissue distribution. For example, G proteins distributed in nerve cells, olfactory cells, visual cells, taste cells, lung cells, kidney cells, hepatocytes and the like are known. The G protein plays an important role in hormone reception, neurotransmission,
- G protein ⁇ -subunit Gs causes pituitary tumor, thyroid tumor or McCune-Albright syndrome. Diseases such as herd are induced.
- loss of the function of G protein ⁇ subunit Gs induces pseudohypoparathyroidism.
- the constant activation of G protein ⁇ -subunit Gi 2 induces pituitary tumor, adrenal cortex tumor or uterine tumor (for example, G protein mutations in endocrine diseases, European Journal of Endocrinology). (2001) vol.145, 545-559). Disclosure of the invention
- the present invention provides a polynucleotide having a nucleotide sequence capable of controlling transcription of a gene encoding a trimeric G protein subunit Gml.
- the polynucleotide is used for the treatment / improvement / prevention of diseases caused by abnormal expression of trimeric G protein ⁇ -subunit Gml or abnormal signal transduction via the promoter of the gene encoding the subunit. It can be used in a method for searching for a compound as an active ingredient of a drug (ie, a therapeutic drug, an improving drug or a prophylactic drug). More specifically, the present invention provides
- a polynucleotide characterized by having a base sequence of a promoter region of a gene encoding a trimeric G protein ⁇ -subunit Gml hereinafter, sometimes referred to as the polynucleotide of the present invention
- a gene comprising a base sequence in which one or more bases have been deleted, substituted or added in the base sequence of (1) or (2), and which encodes a trimeric G protein subunit Gml; A nucleotide sequence capable of controlling transcription; and
- a plasmid containing the polynucleotide according to the above 1 or 2 (hereinafter sometimes referred to as the plasmid of the present invention);
- a plasmid comprising the polynucleotide according to 1 or 2 above and further comprising, downstream of the polynucleotide (3 'side), a polynucleotide whose transcription is controlled by the polynucleotide;
- a plasmid comprising the polynucleotide according to 1 or 2 above and further comprising, downstream of the polynucleotide (3 'side), a reporter gene whose transcription is regulated by the polynucleotide. ;
- a transformed cell into which the plasmid described in the preceding item 5 has been introduced (hereinafter sometimes referred to as the transformed cell of the present invention collectively as the transformed cells described in the preceding items 5 and 6);
- a method for evaluating the ability of a substance to regulate signal transduction via a promoter of a gene encoding a trimeric G protein subunit Gml (1) the first step of bringing a test substance into contact with the transformed cells according to item 8;
- a third step of evaluating the ability to regulate the evaluation method (hereinafter sometimes referred to as the present invention evaluation method);
- FIG. 1 is a diagram showing that the Gml promoter of the present invention has transcription activation ability.
- FIG. 2 is a diagram showing the expression of trimeric G protein ⁇ subunit Gml in brain tissue (cerebral cortex, hippocampus, cerebellum).
- FIG. 3 is a diagram showing the expression of the trimeric G protein ⁇ -subunit Gm1 in brain tissue of a psychiatric patient.
- the genetic engineering techniques used in the present invention include, for example, ⁇ Mo ecu 1 ar CI on i ng: AL abo ratory Manu al 2nd edit on j (1989), Cold Spring Harbor Borratory Press and DNA cloning (DNA C onion) by D., M., G. Lover, published by IRL, 1985, etc.
- Trimer G protein The ⁇ subunit Gml is highly expressed in neurons in the cerebral cortex, hippocampus, and cerebellum, For example, in the brain of patients with neurological and psychiatric disorders (schizophrenia, manic depression, depression and anxiety), Decreased expression Decreased expression level of G protein causes a decrease in the function of transmitting extracellular signals into cells, which indicates that decreased expression level of Gml is associated with these neurological and psychiatric disorders ( Schizophrenia, manic depression, depression and anxiety) It is suggested to be involved in the symptoms.
- the polynucleotide of the present invention encodes a trimeric G protein subunit Gml. It is a polynucleotide having a base sequence of a region (about 3.8 kb) located upstream of the coding region in a gene, and is a kind of a regulatory gene called a promoter.
- the nucleotide sequence of the polynucleotide is, for example, a site at which RNA polymerase having a sigma factor binds to initiate transcription of the operon, and includes a nucleotide sequence necessary for promoting transcription.
- nucleotide sequence of the polynucleotide may be induced by, for example, a promoter element sequence under cell type-specific or tissue-specific control, or an exogenous signal or factor (eg, a transcriptional activator protein).
- Promoter-dependent gene expression may be sufficient to cause expression of the promoter-dependent gene.
- a transformed cell containing the polynucleotide of the present invention and a plasmid containing a reporter gene whose transcription is controlled by the polynucleotide downstream (3 'side) of the polynucleotide is introduced into mammalian cells.
- the expression level of the reporter gene is higher than that of a transformed cell into which a plasmid containing the reporter gene and not containing the polynucleotide is introduced.
- the polynucleotide of the present invention has the ability to regulate the transcription of a gene downstream thereof, for example, in a mammalian cell, and thus, the polynucleotide encoding the trimeric G protein subunit Gml It is a polynucleotide having a base sequence capable of controlling transcription.
- Specific examples of the polynucleotide of the present invention include a polynucleotide having a base sequence described in any one of the following (1) to (4).
- a nucleotide sequence having the ability to control the transcription of the gene encoding Gml (hereinafter, this ability may be referred to as the present transcription control ability).
- a polynucleotide comprising the nucleotide sequence of (1) or (2) and a stringent A nucleotide sequence complementary to the nucleotide sequence of a polynucleotide that hybridizes under simple conditions and capable of controlling the transcription of a gene encoding a trimeric G protein ⁇ subunit Gm1.
- the nucleotide sequence of the polynucleotide can be obtained by deleting a part of the nucleotides of the polynucleotide of the present invention while maintaining the ability to control the transcription of the gene encoding the trimeric G protein and the subunit Gml.
- the base sequence of the polynucleotide (for example, prepared by cutting out with an appropriate restriction enzyme) can also be used.
- Nucleotide sequence represented by nucleotide numbers 200 to 3871, nucleotide sequence represented by nucleotide numbers 300 to 3871 in the nucleotide sequence represented by SEQ ID NO: 1, represented by SEQ ID NO: 1 The base sequence represented by base numbers 400 to 3871 in the base sequence shown, the base sequence represented by base numbers 500 to 3871 in the base sequence represented by SEQ ID NO: 1, etc. I can give it.
- a gene consisting of a base sequence in which one or more bases have been deleted, substituted or added in any of the above base sequences, and encoding a trimer G protein ⁇ -subunit Gml A nucleotide sequence that has the ability to control the transcription of a nucleotide sequence, or a nucleotide sequence that hybridizes under stringent conditions with a polynucleotide consisting of any of the above nucleotide sequences, and that is complementary to the trimeric G protein. Base sequences having the ability to control the transcription of the gene encoding the subunit Gml can also be mentioned.
- such a polynucleotide of the present invention can be produced by a conventional genetic engineering method, for example, “Takaaki Tamura (published by Yodosha), New Transcription Control Mechanism (2000)”, pp. 33-40. It can be prepared according to the method described in Shintaro Nomura and Toshiki Watanabe (published by Shujunsha), Deisotope Experiment Protocol (1998), and the like. The ability of the prepared polynucleotide to control the transcription of the gene encoding the trimer G protein ⁇ subunit Gm1 is determined by the method described below, for example, by containing the polynucleotide and preparing the polynucleotide.
- the “polynucleotide” (including an oligonucleotide) also includes a polynucleotide having a base sequence complementary to a base sequence of a polynucleotide.
- the term “polynucleotide” includes both DNA and RNA unless otherwise specified.
- DNA includes, in addition to single-stranded DNA having the base sequence, single-stranded DNA and double-stranded DNA complementary thereto. Furthermore, “DNA” includes cDNA, genomic DNA and synthetic DNA unless otherwise specified. “RNA” includes total RNA, mRNA, rRNA, and synthetic RNA unless otherwise specified.
- the “modification that does not cause loss of transcription activity” can be performed, for example, on a portion having low homology to various transcription regulatory sequences already identified (that is, nucleotide sequences capable of controlling transcription). It means modification or the like.
- the “base sequence in which one or more bases have been deleted, substituted or added” including such a modification the ability to control the transcription of the gene encoding the trimer G protein ⁇ subunit Gml is impaired.
- An index of how many bases can be deleted, substituted or added without being evaluated can be evaluated and confirmed by the method described later.
- Such a modification may be made by artificially introducing a mutation. Specifically, for example, it can be obtained by randomly introducing a mutation using a method described in A. Greener, M. Callahan, Strategies (1 994) 7, 32-34, etc. , W. Kramer, et 1., Nucleic Acids Research (1 1984) 12, 9441, or W. Kramer, H. J. Frits, Methodsin Enz ymo lo gy (1 98 7) gapped dup 1 ex method described in 154, 350, etc., or TA Knoke Proc. of Natl. Ac ad. Sci.
- a polynucleotide or the like comprising the nucleotide sequence of SEQ ID NO: 1, one or several partial nucleotide sequences are obtained by preparing a chimeric DNA in which a part of the polynucleotide of another promoter is replaced. For example, it is described in S. Henikoff, eta 1., Gene (1984) 28, 351, C. Yan isch-Perr on, et al., Gene (1985) 33, 103, etc.
- polynucleotide that hybridizes under stringent conditions refers to the following polynucleotides. That is, (1) under high ion concentration [for example, 6XSSC (containing 90 OmM sodium chloride and 90 mM sodium citrate)]. Then, hybridization was carried out at a temperature of 65 ° C. to form a polynucleotide-polynucleotide hybrid. (2) Under a low ion concentration [for example, 0.2 IX SSC (15 mM sodium chloride and 1. Containing 5 mM sodium citrate). A polynucleotide capable of maintaining the hybrid even after washing at a temperature of 65 for 30 minutes.
- 6XSSC containing 90 OmM sodium chloride and 90 mM sodium citrate
- the base sequence of such a polynucleotide includes a base sequence derived from another species (eg, human and rat) corresponding to the base sequence derived from mouse.
- a base sequence can be selected, for example, by NCBI blast search (ww.ncbi.nlm.nih.gov/BLAST/).
- NCBI blast search using the nucleotide sequence near the translation initiation codon of the Gml gene having the nucleotide sequence of SEQ ID NO: 3 as a target sequence, it is highly homologous from the genome sequence database of other species.
- the base sequence can be searched.
- polynucleotide consisting of the base sequence upstream of the translation start point of the base sequence selected by the search it is possible to select a polynucleotide consisting of the base sequence containing the promoter region of the corresponding other species. it can. Selected poly
- the ability of nucleotides to control transcription of the gene encoding the trimeric G protein subunit Gm1 can be confirmed by the method described below. Examples of the method for preparing the polynucleotide of the present invention include a chemical synthesis method, PCR, and a hybridization method.
- an automatic DNA synthesizer such as a DNA synthesizer model 380A (manufactured by ABI) can be used.
- a method for preparing the polynucleotide of the present invention using PCR will be described.
- genomic library is described in, for example, "Mocular Cloning: A Labratory Manu al 2nd edition J (1989), Cold Spring Harbor Laboratory Press, etc.” It can be prepared from mammalian tissues such as human, mouse, rat, etc.
- commercially available genomic DNA such as human genome DNA (manufactured by Clontech), and human genome war kit ( A commercially available genomic library such as Clontech Co., Ltd. can be used.
- a primer consisting of the nucleotide sequence of base numbers 1 to 20 in the nucleotide sequence of SEQ ID NO: 1 and the primers of base numbers 3851 to 3871 in SEQ ID NO: 1 PCR is performed using a primer consisting of a nucleotide sequence complementary to the nucleotide sequence, and the primer can be appropriately designed based on the nucleotide sequence shown in SEQ ID NO: 1.
- 'A terminal may be added with a restriction enzyme recognition sequence, etc.
- the DNA amplified as described above may be obtained from "Molecular C 1 oning: A Laboratory Manual 2nd edition” (1989), Co. ld Sp ri ng Harbor Labo ratory Press, “Curent Protocols In Molecular Biol ogy” (1987), John Wiley & Sons, Inc. I SBN 0—471—50338 _ Vector according to the usual method described in X etc. Can be cloned. Specifically, for example, cloning can be performed using a plasmid vector contained in a cloning kit manufactured by Invit 1 "03 611 or a plasmid vector such as pBluescriptll manufactured by Stratage.
- the nucleotide sequence of the cloned polynucleotide can be found in F. Sanger, S. Nicklen, AR Cou ls on, Proceeding ng sof Na ti al al Ad emy of Science USA (1977), 74, 5463-5467, etc., and can be analyzed by the dideoxy mineralization method, etc. Next, a method for preparing the polynucleotide of the present invention using the hybridization method will be described.
- the DNA used for the probe is labeled.
- a polynucleotide having at least a part of the nucleotide sequence of the polynucleotide of the present invention to be prepared for example, a nucleotide represented by nucleotides 603 to 3871 in the nucleotide sequence represented by SEQ ID NO: 1
- Polynucleotides comprising a lost, substituted or added nucleotide sequence, polynucleotides which hybridize with the above-mentioned polynucleotides under stringent conditions, and the like can be mentioned.
- DNA consisting of the base sequence represented by base numbers 100 to 3871 in the base sequence represented by SEQ ID NO: 1, and represented by base numbers 200 to 3871 in the base sequence represented by SEQ ID NO: 1 DNA consisting of the base sequence, DNA consisting of the base sequence Nos. 300 to 3871 in the base sequence shown in SEQ ID No. 1, and showing the base sequence Nos. 400 to 3871 in the base sequence shown in SEQ ID No. 1
- the DNA used for the probe is, for example, a chemical synthesis method, PCR, hybridization, or the like.
- the polynucleotide can be obtained by the usual method for preparing a polynucleotide described above as the “method for preparing the polynucleotide of the present invention” such as the Chillon method.
- labeling can also be performed by performing a PCR reaction using the DNA used in the probe as a ⁇ type.
- a fluorescent dye or an enzyme for example, EC FD irect Nucleic Acid Label and Detection System (Amersh Am Pharmacia Biotech) or A1 kphos Direct DNA labeling and detection kit (Amersh Am Pharmacia Biotech) or the like can be used.
- a genomic DNA library derived from an animal such as a rodent such as a mouse or a rat or a primate such as a human can be used.
- DNA library a commercially available genomic DNA library can be used, or “Mocular C 1 oning: A Laboratory Manua 1 2nd edition” (1989), Cold Spring Harbor L abo ratory Press ⁇ “Cu rrent Protocols In Molecular Biolgy” (1987), John Wi 1ey & Sons, Inc.I SBN0—471—50338—X, etc.
- ⁇ vectors such as ⁇ FIXII, ⁇ EMBL 3> ⁇ EMBL4, ⁇ DASH II manufactured by Stratage ne, and Gig ap ackpackaging Extracts
- S A genomic DNA library can be prepared using in vitro packaging (tratagene) or the like and used.
- the hybridization method includes a colony hybridization primer. Hybridization can be mentioned, and it is preferable to select a method according to the type of vector used for preparing the library. For example, if the library to be used is a library constructed with plasmid vectors, colony hybridization can be performed.
- transformed cells are obtained by introducing the library DNA into a host microorganism, and the resulting transformed cells are diluted and plated on an agar medium, and incubated at 37 ° C until colonies appear. Perform culture.
- the library to be used is a library constructed with a fuzz vector
- plaque hybridization can be performed. Specifically, first, the host microorganism and the phage of the library are mixed under conditions that allow infection, and then mixed with a soft agar medium, and spread on an agar medium. Then culture at 37 ° C until plaques appear. More specifically, for example, Molecular Cloning 2nd edition (J. Sam Rook, EF Frisch, T. Maniatis, Cold Spring Laboratory Press 1989) 2.
- a membrane filter is placed on the surface of the agar medium on which the above-mentioned culture has been performed, and the transformed cells or phage carrying the plasmid are transferred to the membrane filter. .
- the membrane filter is subjected to an alkali treatment, a neutralization treatment, and a treatment for fixing DNA to the filter.
- a nitrocellulose filter or a nylon filter such as Hybond-N + (manufactured by Amersham Pharmacia Biotech) is placed on the agar medium and allowed to stand for about 1 minute to remove phage particles. Adsorb the membrane fill at night. Next, the filter is soaked in an alkaline solution (1.5M sodium chloride, 0.5N sodium hydroxide) for about 3 minutes.
- a neutral solution 1.5 M sodium chloride, 0.5 M Tris-HCl, pH 7.5
- a washing solution (30 OmM sodium chloride, 3 OmM sodium citrate, 200 mM Tris-HCl) for about 5 minutes, for example, by baking at about 80 ° C for about 90 minutes
- the phage DN Fix A to Phil Yuichi. Hybridization is performed using the thus prepared filter and the probe.
- containing 450-90 OmM sodium chloride, 45-90 mM sodium citrate and containing sodium dodecyl sulfate (SDS) at a concentration of 0.1-1.0% (W / V) Contains non-specific DNA at a concentration of 0 to 200 ⁇ g / mL, and may optionally contain albumin, ficoll, polyvinylpyrrolidone, etc. at a concentration of 0 to 0.2% (W / V).
- Prehybridization solution preferably 90 OmM sodium chloride, 9 OmM sodium citrate, 1% (W / V) SDS and 100 g / mL denatured C a 1 f — t hymu s DNA
- a pre-hybridization solution containing the solution is prepared at a rate of 50 to 200 L per 1 cm 2 of the filter prepared as described above, and the filter is immersed in the solution to obtain a solution at 42 to 68 ° C. Incubate for ⁇ 4 hours, preferably at 45 ° C for 2 hours.
- a hybridization solution containing a concentration of 0 to 200 gZmL and optionally containing albumin, ficoll, polyvinylpyrrolidone, etc. at a concentration of 0 to 0.2% (W / V) Preferably, a hybridization solution containing 90 OmM sodium chloride, 9 OmM sodium citrate, 1% (WZV) SDS and 100 gZmL of denatured C a1 f-thymus DNA, and the method described above.
- a solution obtained by mixing a probe obtained by the above procedure (for example, a 32 P-labeled probe with an equivalent amount of 1.0 ⁇ 10 4 to 2.0 ⁇ 10 6 cpm / cm 2 filter) is used.
- the filter Incubate at 45 ° C for 16 hours to perform the hybridization reaction. After the hybridization reaction, the filter is taken out and contains 15 to 30 OmM sodium chloride, 1.5 to 3 OmM sodium citrate, and 0.1 to 1.0% (W / V) SDS etc. Filter for 10-60 minutes with a wash solution at 68 ° C, preferably a wash solution at 55 ° C containing 30 OmM sodium chloride, 30 mM sodium citrate, and 1% (W / V) SDS Wash one to four times, preferably twice for 15 minutes. In addition, lightly rinse the filter with 2 XS SC solution (containing 30 OmM sodium chloride and 30 mM sodium citrate) and dry.
- 2 XS SC solution containing 30 OmM sodium chloride and 30 mM sodium citrate
- This filter is subjected to, for example, autoradiography to detect the position of the probe on the filter, thereby detecting the position of the DNA that hybridizes with the used probe on the filter.
- autoradiography By specifying a clone corresponding to the position of the detected DNA on the filter on the original agar medium and picking it, a clone having the DNA can be isolated.
- the filter is exposed to an imaging plate (Fuji Film) for 4 hours, and the plate is then exposed to an imaging analyzer B A
- a phage clone containing a DNA comprising a base sequence that hybridizes with the probe used can be obtained.
- the DNA possessed by the clone obtained by performing the screening by hybridization as described above is a plasmid vector that can be easily prepared and analyzed, for example, commercially available pUC 18, pUC 19, pBLUESCR I PT KS 10, pBL Plasmid DNA was prepared by subcloning into UESCR I PT KS-, etc., and written by F. Sanger, S.
- the plasmid into which the polynucleotide of the present invention (here, the polynucleotide of the present invention means DNA) may be inserted as long as it is a plasmid capable of functioning in a desired cell.
- a marker gene for example, a kanamycin resistance gene, a hygromycin resistance gene, a neomycin resistance gene, etc. for selecting cells into which the plasmid has been introduced.
- a gene insertion site is further provided at a position where the polynucleotide of the present invention and a desired gene are operably linked on a plasmid, for example, downstream of a site where the polynucleotide of the present invention is inserted.
- the gene insertion site is, for example, a nucleotide sequence that can be specifically recognized and cleaved by a restriction enzyme generally used in gene engineering techniques, and is a kind of a type that is present only on a plasmid having the polynucleotide of the present invention.
- Restriction enzyme recognition sequences are preferred.
- Escherichia coli is used as a host
- PUC-based plasmids such as PBR322 (manufactured by Boehringer Mannheim), pUC12, pUC118, and pUC119 (manufactured by Takara Shuzo), and Bacillus bacteria such as pBluescript are used as hosts.
- PBR322 manufactured by Boehringer Mannheim
- pUC12, pUC118, and pUC119 manufactured by Takara Shuzo
- Bacillus bacteria such as pBluescript
- pUBl10, pC194 and the like can be mentioned.
- yeast When yeast is used as a host, Yip5, Yep24 and the like can be mentioned.
- insect cells are used as a host, AcNPV and the like can be mentioned.
- pUC18, PUC19 and the like can be mentioned.
- Insertion of the polynucleotide of the present invention into the above-mentioned plasmid can be carried out by a conventional method, for example, as described in "Molecular C 1 oning: AL aboratory Manu al 2 ndediti onj (1989), Cold Spring, Harbor L aboratory P. ress, "Curent Protocols In Molecular Biology” (1987), John Wiley & Sons, Inc. ISBN 0-471_50338-X It can be carried out.
- the plasmid to be introduced into the transformed cell used in the search method of the present invention includes, for example, a polynucleotide whose transcription is controlled by the polynucleotide downstream (3 'side) of the polynucleotide of the present invention.
- the plasmid of the present invention containing the luciferase gene under the control of the polynucleotide of the present invention is capable of controlling the transcription of the present invention contained in the plasmid. It can be preferably used when measuring.
- a plasmid should be prepared using a commercially available plasmid containing the luciferase gene, for example, a plasmid such as PGL 3_basic (produced by Romega) or PicaGeneBasic Vector (produced by Toyo Ink). Can be.
- a polynucleotide containing the luciferase gene under the control of the polynucleotide of the present invention is inserted into the pGL3-basic gene insertion site in a functional manner by a conventional method.
- Inventive plasmids can be made.
- the method for preparing the transformed cell of the present invention ie, the transformed cell into which the polynucleotide of the present invention or the plasmid of the present invention has been introduced) will be described below.
- Examples of host cells into which the polynucleotide of the present invention or the plasmid of the present invention is introduced include bacteria such as Escherichia coli (for example, K12) and Bacillus bacteria (for example, MI114), yeast (for example, AH22), cells such as plant cells and animal cells. Any cell may be used as long as the polynucleotide of the present invention or the plasmid of the present invention is retained in the cell.
- the host cell for preparing the transformed cell of the present invention used in the search method of the present invention is preferably an animal cell (eg, PC-12 cell, Neuro-2a cell, IMR-32 cell, C0S-7 cell, Vero Cell, CH0 cell, ES cell, etc.), and particularly preferably a nerve cell.
- the transformed cell of the present invention in which the host cell is an ES cell is the polynucleotide of the present invention or the plasmid of the present invention. It includes a transformed cell into which the introduced ES cell has been differentiated, and a transformed cell into which the polynucleotide of the present invention or the plasmid of the present invention has been introduced into the cell after the ES cell has been differentiated.
- the transformed cells of the present invention also include cells that exist in animal individuals (ie, transformed animals) produced by generating from these transformed cells.
- a method for introducing the polynucleotide of the present invention or the plasmid of the present invention into host cells a method depending on the cell can be applied.
- a method depending on the cell for example, calcium phosphate method, electrotransfer method, DEAE dextran method, micelle formation can be applied to animal cells. Laws and the like can be applied.
- the calcium phosphate method the method described in Grimm, S. et 1., Proc. Natl. Accad. Sci. USA, 93, 10923-10927, etc. may be mentioned.
- Examples of the electrophoresis method and the DEAE dextran method include the methods described in Ting, ATeta 1., EMBO J., 15, 6189-6196, and the micelle formation method. Hawkins, CJ et al., Proc. Natl. Accad. Sci. USA, 93, 13786-13790.
- the micelle formation method for example, commercially available reagents such as Ribofectamine (manufactured by Gibeo BRL) and Fugen (manufactured by Boehringer Mannheim) can be used.
- a cell to which the polynucleotide of the present invention or the plasmid of the present invention has been introduced may be, for example, a selectable marker gene introduced into a host cell simultaneously with the polynucleotide or the plasmid of the present invention, or a selectable marker contained in the plasmid of the present invention.
- the transformed cells can be selected by using the gene or the like and culturing the cells in a culture medium under selection conditions according to the selection marker gene.
- the present invention provides a method including a step of bringing a test substance into contact with the transformed cell of the present invention. That is, a method for searching for a signal transmission regulator via a promoter of a trimeric G protein ⁇ -subunit Gml,
- test substance is introduced into a transformed cell containing the polynucleotide of the present invention and having a plasmid containing a repo overnight gene introduced downstream (3 ′ side) of the polynucleotide.
- This search method is a method for searching for a substance having the ability to regulate signal transduction via a promoter of a gene encoding a trimeric G protein subunit Gml using a so-called repo overnight gene atsy.
- the transformed cells of the present invention using mammalian cells as host cells are preferable.
- mammalian cells for example, PC-12 cells, Neuro-2a cells, IMR-32 cells, Vero cells, Helo cells
- the transformed cell of the present invention in which a known mammalian cell such as a cell, CV1 cell, C0S1 cell, CH0 cell, and ES cell is a host cell, is particularly preferred.
- the transformed cells may be prepared as described above.
- a test substance to be brought into contact with a transformed cell containing the polynucleotide of the present invention and having a plasmid containing a repo all-in-one gene downstream (3 'side) of the polynucleotide is introduced.
- the concentration may be generally about 0.001 M to about 10; preferably about 0.01 M to about 10; more preferably about 0.1 M to about 10; uM.
- the time for bringing the cells into contact with the test substance is usually about 1 hour to about 5 days, preferably several hours to about 4 days. Preferably, it is about 18 hours or more and about 60 hours, and more preferably about 24 hours to about 40 hours.
- the contact between the cell and the test substance may be performed while culturing under conditions that allow the cell to grow.
- D_MEM, OPTI-MEM, RPMI 1640 medium Gibco_BRL manufactured by Gibco_BRL
- RPMI 1640 medium Gibco_BRL manufactured by Gibco_BRL
- Can be cultured in a commercially available medium such as Culture is usually performed at about 30 ° C to about 40 ° C, about 2% (V / V) to: L 0% (V / V) in the presence of carbon dioxide. More preferably, it is carried out in the presence of about 4% (VZV) to about 6% (V / V) carbon dioxide.
- the number of cells in contact with the test substance may be, for example, about 1 ⁇ 10 4 cells / to about 1 ⁇ 10 5 cells / ⁇ in a 96-well plate. 10 4 Z Ueru to about 8 X 10 4 Noueru are preferred.
- the method of “monitoring the expression level of a reporter gene or an index value correlated therewith” includes a method of monitoring the expression level of the repo overnight gene in the transformed cells or the index value correlated therewith with time. Any method can be used as long as it can be measured continuously or discontinuously along the line.
- a method for detecting the expression product of the reporter gene that is, mRNA corresponding to the gene or a protein encoded by the gene (specifically, Northern blotting, Western blotting, etc.) can be used.
- a method for measuring the activity of the enzyme may be used.
- the amount of mRNA corresponding to the reporter gene can be measured by, for example, Northern blotting using a polynucleotide containing a part of the reporter gene, RT_PCR, or the like.
- the amount of the protein corresponding to the reporter gene can be measured using an antibody against the protein produced from the reporter gene.
- reporter genes that can be used include, for example, luciferase gene, secreted alkaline phosphatase (SEAP) gene, chloramphenico-l-acetyltransferase. Preferred are those whose measurement of the activity of the expressed protein is easy, such as the lase gene and the i3 galactosidase gene.
- the expression level of the luciferase gene can be determined by adding luciferin (for example, manufactured by Toyo Ink Co., Ltd.) as a luminescent substrate to the cell lysate and measuring the luminescence due to the decomposition of the substrate using a luminometer, liquid scintillation counter, or a top counter. What is necessary is just to measure.
- the expression level of the alkaline phosphatase gene can be measured using, for example, Lumi-Phos530 (manufactured by Wako Pure Chemical Industries, Ltd.).
- the expression level of the chloramphenico-lucacetyltransferase gene can be measured by using FAST CAT Chrola immediately henicol Acetyltransferase Assay Kit (manufactured by Wako Pure Chemical Industries, Ltd.).
- the expression level of the 3-galactosidase gene can be measured using Aurora Gal-XE (manufactured by Wako Pure Chemical Industries, Ltd.).
- the protein encoded by the gene emits fluorescence, such as the GFP (Green Fluo rescent Protein) gene as a repo overnight gene, measure the amount of fluorescence emitted by the produced protein. do it.
- fluorescence such as the GFP (Green Fluo rescent Protein) gene
- the contact between the cell and a test substance and the measurement of the present transcription control ability of the polynucleotide of the present invention in the cell are performed, and an increase in the transcription control ability is detected as compared with a control (for example, when a change such as an increase of about 30%, preferably about 50%, and more preferably about 100% is observed, or when a decrease is detected (for example, about 30%, preferably about 50%, More preferably, when a change such as a decrease of about 100% is observed), the test substance acts on the promoter to regulate the transcription control ability, that is, the trimer G protein ⁇ subunit Gml Can be selected as a signal transduction regulator via the promoter of the gene encoding the gene.
- the type of the test substance is not particularly limited. Examples include proteins, peptides, non-peptidic compounds (sugars, lipids, etc.), organic low molecular weight compounds, inorganic low molecular weight compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. .
- the expression level of the reporter gene operably linked to the polynucleotide of the present invention in the cells after contacting with the test substance was determined as follows.
- the transcription control ability of the test substance may be evaluated by comparing the expression level in the cell (hereinafter referred to as measured value 2).
- the main transfer control capability may be obtained as a transfer control ratio using the above measured value according to the following equation.
- Transfer control rate (%) ⁇ (measured value 1-measured value 2) Z measured value 2 ⁇ X I 0 0
- a substance showing a statistically significant value in the transcription control rate representing the present transcription control ability of the test substance specifically, for example, a substance showing at least 30%, more preferably at least 50%
- the substance is selected as a substance having the transcription control ability.
- the main transcription of the substance based on the difference obtained by comparing the change in the expression level of the repo overnight gene in each of the plots in which two or more different substances as test substances were used independently was The control ability may be evaluated.
- a substance having the main transfer control ability can be selected based on the main transfer control ability evaluated in this way.
- at least one of the two or more different substances may be a substance not having the transcription control ability (eg, a solvent, a test system solution serving as a background, or the like).
- the transcription control ability of the other test substance may be evaluated. Further, the transcription control ability of the other test substance may be evaluated based on the transcription control ability of at least one of the two or more different substances.
- the kit of the present invention is a kit comprising a test cell holding a recombinant repo overnight vector having the polynucleotide of the present invention (here, DNA) and a reagent for measuring reporter activity.
- the kit of the present invention may further include a control cell into which a plasmid having no polynucleotide of the present invention (here, DNA) is introduced. Such control cells can be used as a negative control.
- the kit is based on the book It can be used for the invention search method.
- the substance selected by the above-described search method can control the activity of the polynucleotide of the present invention
- the expression of the gene under the control of the polynucleotide of the present invention in cells can be controlled. Therefore, the substance or a pharmaceutically acceptable salt thereof is used as a transcription control agent characterized in that the substance or the pharmaceutically acceptable salt contains them as an active ingredient and is formulated into a pharmaceutically acceptable carrier. May be used.
- the substance is useful, for example, as a medicament for a disease caused by overexpression or underexpression of a translation product of the gene.
- the substance has an effect on nerve cells, such as a gene of interest linked under the control of the polynucleotide of the present invention, for example, a gene presumed to be associated with a neurological or psychiatric disorder, and the expression level of Gm1. It can also be used as a transcriptional regulator when examining the effects on diseases caused by abnormalities in chromosomes or signal transmission via the Gm1 gene promoter (particularly, neurological and psychiatric disorders).
- the method for selecting a substance that binds to the polynucleotide of the present invention comprises a first step of bringing the polynucleotide of the present invention into contact with a test substance; A second step of examining the presence or absence of complex formation between the polynucleotide and the test substance after the step, and selecting a substance that binds to the polynucleotide based on the analysis result of the presence or absence of complex formation obtained in the second step Including the third step.
- the polynucleotide used in the first step of bringing the polynucleotide of the present invention into contact with a test substance can be obtained by labeling the polynucleotide of the present invention with, for example, a commercially available DNA labeling kit using a radioisotope or a fluorescent dye compound. It is preferable in that it facilitates detection of the complex of the polynucleotide and the test substance.
- a radioisotope for example, a commercially available R and om Lingling Kit or the like can be used.
- the dCTP conventional PCR reactions in the composition in place in the shed one 32 P] dCTP, rows PC R The reaction was polynucleotides of the present invention to ⁇
- the polynucleotide can be labeled.
- a fluorescent dye for example, EC FD irect Nucleic Acid Labeling and Detection System can be used.
- the polynucleotide of the present invention and a test substance are subjected to about 4 ° C to about 37 ° C, preferably about 2X to about 30 ° C, for about 5 minutes to about 60 minutes, preferably for about 10 minutes to about Contact for 30 minutes in a suitable buffer, for example in a buffer of Tris, Hepes, MES, etc., preferably in a Hepes buffer.
- the concentration of the test substance may be generally about 0.1 ⁇ 1 to about 1,000, preferably 1 M to 100 M.
- the amount of the polynucleotide may be generally about 1 fmo1 to about 10 fmo1, and preferably 2 fmo1 to 7 fmo1.
- Examples of a method for examining the presence or absence of a complex between the polynucleotide of the present invention and a test substance include a gel shift method, a footprint method, and a BIACORE method.
- a gel shift method, a footprint method, or the like may be used.
- the BI ACORE method for example, "Real-time analysis and experiment method for biological material interaction, co-authored by Kazuhiro Nagata and Handa Hiroshi-Focusing on BI ACORE-Springer's Fairark Tokyo Co., Ltd.” The method described may be used.
- a mixed solution of the polynucleotide of the present invention and a test substance is subjected to polyacrylamide gel electrophoresis by an ordinary method.
- the polyacrylamide gel after electrophoresis is dried, it is subjected to, for example, photoradiography to detect the position of the polynucleotide on the gel to determine whether the polynucleotide and the test substance are bound.
- the dried gel is exposed to an imaging plate for about 1 hour to about 1 mm, more preferably 6 to 8 hours, and an image image is obtained with an imaging analyzer.
- test substance in which the shift force of the band is detected can be selected as a substance that binds to the polynucleotide of the present invention. Since the binding substance thus selected can bind to the polynucleotide of the present invention, it can control the transcription control ability of the polynucleotide of the present invention. Furthermore, the expression of a gene under the control of the polynucleotide of the present invention in a cell can be controlled.
- the substance or a pharmaceutically acceptable salt thereof is used as a transcription control agent characterized by containing the active ingredient as an active ingredient and being formulated in a pharmaceutically acceptable carrier. May be used.
- the substance is useful as a medicament for diseases caused by overexpression or underexpression of the translation product of the gene.
- the substance may be a desired gene linked under the control of the polynucleotide of the present invention, such as a gene that is presumed to be associated with a neurological or psychiatric disorder or a gene that is presumed to be associated with behavior or memory.
- the purification method of the present invention comprises: a first step of bringing a polynucleotide of the present invention into contact with a sample to form a complex of the polynucleotide and a substance that binds to the polynucleotide contained in the sample; and After the first step, a second step of isolating the binding substance from the produced complex is included.
- the polynucleotide of the present invention When the polynucleotide of the present invention is brought into contact with a sample, usually, when the polynucleotide is brought into contact with a sample in a form in which the polynucleotide is bound to a carrier, a complex of the polynucleotide or the polynucleotide and a binding substance is obtained. Is preferred because it can be easily recovered.
- the type of carrier to which the polynucleotide is bound is not particularly limited. For example, a commercially available carrier for affinity mouth chromatography, preferably cyanogen bromide-activated Sepharose 4B (manufactured by Amersham Pharmacia Biotech) or the like is used. can do.
- the polynucleotide When binding the polynucleotide to a carrier, the polynucleotide There are a method in which the tide is directly bonded to the carrier and a method in which the tide is bonded via a spacer.
- Conditions for binding include, for example, mixing the polynucleotide and cyanogen bromide-activated Sepharose 4B, stirring at about 4 ° C. to about 10 at 1 ⁇ 100 rpm, and mixing the polynucleotide. On the Sepharose. Then, in order to eliminate unreacted cyanogen bromide active groups, a buffer containing a compound having an amino group, for example, a sodium hydrogencarbonate solution containing 1 M glycine, for example, at about 4 ° C.
- the obtained gel may be brought into contact with a sample by an ordinary batch method, and the gel is filled in a commercially available chromatographic tube to prepare an affinity column for a substance that binds to the polynucleotide of the present invention.
- the sample may be brought into contact with the sample by ordinary column chromatography.
- the sample is subjected to the above-described affinity column to form a complex of the polynucleotide of the present invention and the polynucleotide-binding substance, followed by washing of the carrier and removal of the binding substance.
- the bound substance can be isolated.
- a sample is first loaded on the affinity column described above, and then the column is washed with a buffer having the same composition as when loading, to remove components in the sample that did not form a complex. Thereafter, a substance that binds to the polynucleotide of the present invention is isolated by performing a gradient elution in which the salt concentration contained in the buffer is increased to elute the substance that has bound to the polynucleotide of the present invention from the column.
- the salt used for elution include sodium chloride, potassium chloride, ammonium sulfate and the like.
- a substance that is selected by the above-described selection method for a substance that controls the present transcription control ability of the polynucleotide of the present invention or a substance that binds to the polynucleotide of the present invention by the purification method of the present invention is selected by the above-described selection method.
- a transcription control agent comprising a substance selected by the method of the present invention or the method of the present invention for searching for a binding substance or a pharmaceutically acceptable salt thereof as an active ingredient can be administered orally or parenterally to humans or the like. It can be administered to mammals.
- the present transcription controlling agent can be used in a usual form such as a tablet, a capsule, a syrup, a suspension and the like.
- the present transcription control agent When administered parenterally, can be used in the form of ordinary liquid preparations such as solutions, emulsions and suspensions.
- a method for parenterally administering the present transcription control agent in the above-mentioned form include a method for injection and a method for administration to the rectum in the form of a suppository.
- the above-mentioned appropriate dosage form is to mix a substance selected by the present search method or a pharmaceutically acceptable salt thereof with an acceptable ordinary carrier, excipient, binder, stabilizer, diluent, etc. Can be manufactured.
- an acceptable buffer, solubilizing agent, isotonic agent and the like can be added.
- the dosage varies depending on the age, sex, weight, degree of disease, type of the transcription control agent, dosage form, etc., of the mammal to be administered.
- the above-mentioned daily dose can be administered once or in several divided doses.
- Diseases to which the present transcription regulator can be applied include diseases caused by abnormal signal transduction through the promoter of the G protein gene (particularly, neurological and psychiatric disorders). Neurological and psychiatric disorders such as schizophrenia, manic depression, depression and anxiety.
- the transcription control agent may be used to treat, improve, and prevent these diseases.
- Example 1 (Cloning of Polynucleotide Containing Mouse Gml Promoter One Region)
- a polynucleotide containing the mouse Gml promoter region was isolated as follows.
- a probe DNA containing the 5 'upstream region of the mouse Gm1 gene was prepared by the following procedure.
- an IOM feed primer mGmg-1 (5'tgttctcccgacccttcagggatcttcttt; SEQ ID NO: 4), and a linear primer of ⁇ ⁇ ⁇ .
- Amplified DNA was obtained by PCR using Limer mGmg_2 (5, 1 acctatgagcagcaatggatagagtctat; rooster column number 5) and TAKARATaq polymerase (TAKARALATaq with GC Buffer, manufactured by Takara Shuzo).
- the PCR conditions were 95 cycles of 95 seconds for 30 seconds, then 60 t for 30 seconds, and then 72 cycles of 2 minutes for 35 cycles.
- the DNA was subjected to agarose gel electrophoresis, the DNA was purified using QIAquick Gel Extraction kit (manufactured by QIAGEN) and collected. The recovered DNA was used as type II DNA for probe in the following experiments.
- mouse Gml promoter was isolated by the following procedure.
- phages were inoculated on 20 15 cm NZY plates, and cultured at 37 ° C. for 8 hours to form plaques.
- Nitrocellulose membrane is brought into contact with the plaque-formed plate to Transferred onto rocellulose membrane.
- the nitrocellulose membrane and the probe DNA labeled with alkaline phosphatase were hybridized using an Alkphos Direct DNA labeling and detection kit (manufactured by Amersham Bioscience) according to the protocol attached to the kit. A trial was conducted. The detection of signals by hybridization was also performed using an Alkphos Direct DNA labeling and detection kit (manufactured by Amersham Bioscience) according to the protocol attached to the kit.
- Example 2 (Construction of repo overnight vector containing mouse Gml promoter region)
- the phage DNA containing the mouse Gm1 promoter region obtained in Example 1 was digested with Sacl.
- the resulting digest was subjected to agarose gel electrophoresis, and then purified using a QIAquick Gel Extraction kit (manufactured by QIAGEN) to recover DNA.
- the recovered DNA was used as an insert DNA in the following experiments.
- vector DNA was prepared by treatment with phospholipase. Then, 50 ng of the prepared vector DNA and 10 ng of the above-described insert DNA were ligated using a T4 ligase to prepare a Gml promoter overnight reporter vector-pGL-Gml / ScI.
- nucleotide sequence represented by SEQ ID NO: 2 (the sequence corresponds to the nucleotide sequence represented by nucleotide numbers 603 to 3871 in SEQ ID NO: 1) Inserted into the Sacl site of pGL3.
- a phage DNA containing the mouse Gm1 promoter region obtained in Example 1. was digested with Nhel. The resulting digest was subjected to agarose gel electrophoresis, and then purified using a QIAquick Ge 1 Extraction kit (manufactured by QIAGEN) to recover DNA. The recovered DNA was used as an insert DNA in the following experiments.
- pGL3 was digested with Nhel and treated with alkaline phosphatase to prepare vector-DNA.
- the resulting Gml promoter repo overnight vector pGL_Gml / NheI was prepared by ligating 50 ng of the prepared vector DNA and the insert DNA10118 using a ligation probe.
- pGL-Gm1ZSacI was double-digested with Ndel and Xhol, the resulting digest was subjected to agarose gel electrophoresis, and the 2 kb DNA was purified using QIAquick Ge1 Extraction kit (QIAGEN). , Collected. The recovered DNA was used as an insert DNA in the following experiments.
- pGL—Gml / NheI was double digested with Ndel and Xhoi.
- a Gml promoter-reporter vector pGL-Gml was prepared by ligating 50 ng of the obtained digest (vector-DNA) and 10 ng of insert DNA using T4 ligase.
- the nucleotide sequence represented by SEQ ID NO: 1 is inserted between the Sacl site and the Nhel site of pGL3.
- Example 3 Measurement of transcription activity of mouse Gm1 promoter
- the transcription activation ability of the Gm1 promoter of the present invention obtained in Example 2 was measured as follows.
- PC12 cells were seeded at 5 ⁇ 10 4 cells / well in each well of a 96-well plate and cultured for about 24 hours.
- the cultured cells were treated with the Gml promoter repo overnight obtained in Example 2 pGL-Gml (0.2 g) or pGL-GmlZSacI (0.2 g) by the lipofection method.
- Test cells were prepared by transfection.
- Control cells were prepared by transfection of the cells seeded in the same manner as described above with a repo overnight vector (pGL3; 0.2 g) containing no Gml promoter using the lipofection method. did.
- the expression distribution of the trimeric G protein ⁇ -subunit Gm1 protein in the brain was analyzed by fluorescent tissue immunostaining using an anti-Gml antibody. That is, a mouse brain section (manufactured by Novagen) fixed with paraformaldehyde was deparaffinized, and then autoclaved (120, 15 minutes) in a 0.01M citric acid solution. Next, the brain slice was incubated at 4 ° C for 1 hour in an anti-Gml antibody (1/100 dilution) diluted using a blocking reagent included in TSA Kit # 12 (Morkyura Probe). .
- the brain slice was washed twice with a PBS solution, and then incubated at 4: 1 for 1 hour in an HRP-labeled anti-heron IgG antibody attached to TSA kit # 12 (manufactured by Molecular Probes).
- TSA kit # 12 manufactured by Molecular Probes
- the brain section was washed twice with a PBS solution, and then using a tyramide signal amplification kit included in TSA kit # 12 (Molecular Probe) according to the protocol attached to the kit. Detection of the fluorescent signal was performed. The fluorescence signal was observed using a fluorescence microscope. The result is shown in figure 2.
- Trimeric G protein ⁇ subunit Gml protein was found to be highly expressed in cerebral cortex, hippocampus, and cerebellar neurons.
- Example 5 Immunostaining using anti-Gm1 antibody in brain tissue of a psychiatric patient
- the expression of the trimeric G protein subunit Gml protein in the brain of a patient with a human psychiatric disorder was analyzed by a tissue immunostaining method using an anti-Gml antibody.
- a human brain slice slide LandMark Low Density Neuropsychiatric Tissue MicroArrays (manufactured by Ambion Chito) fixed with paraformaldehyde was removed.
- Raffin After the treatment, the slides were autoclaved in an MM citrate solution (120 ° C, 15 minutes), and the slides containing the brain sections (hereinafter abbreviated as “slides”) were washed with ultrapure water. After that, the slides were incubated in methanol containing 3% hydrogen peroxide for 10 minutes at room temperature, and the incubated slides were washed three times with a TN solution (0.1 M Tris pH 7.5, 0.15 M NaCl).
- a TN solution 0.1 M Tris pH 7.5, 0.15 M NaCl
- the slides were then incubated for 30 minutes at room temperature in the blocking reagent provided with the TS A Piotin System NEL 700 (Perkinelmer), and then slides were incubated with the TS A Piotin System NEL 700 (PerkinelEmer). After incubating for 1 hour at 4 in anti-Gml antibody (diluted 1: 100) diluted with the blocking reagent attached to the lmer (made by Lmer Inc.), this was added to a TN solution (0.1 M Tris pH 7.5, (0.15M NaCl) three times.
- a TN solution 0.1 M Tris pH 7.5, (0.15M NaCl
- the slides were then incubated at 4 ° C in HRP-labeled anti-Egret IgG antibody (1Z200 dilution) diluted in the blocking reagent provided with the TSA Biotin System NEL700 (PerkinElmer) at 4 ° C. After incubation for an hour, it was washed three times with a TN solution (0.1 M Tris pH 7.5, 0.15 M NaCl).
- the slides were incubated at room temperature for 10 minutes in a piotinylated tyramide amplification reagent attached to TSA Piotin System NEL700 (PerkinElmer), and then the TN solution ( Washed three times with 0.1M Tris pH7.5, 0.15M NaCl).
- the slides were incubated at room temperature for 30 minutes in an anti-HRP-labeled anti-avidin antibody attached to TSA Biotin System NEL700 (manufactured by PerkinElmer), and then the TN solution (0.1 M Washed three times with Tris pH7.5, 0.15M NaCl).
- Example 6 (Construction of Reporter Vector Containing Mouse Gml Promoter Region) p, which is a reporter vector containing the nucleotide sequence of the mouse Gml promoter region GL-Gml / 843-3900 is constructed as follows.
- the phage DNAlOng containing the region was used for type I, and 10 / iM of pharmacophoric acid—prmGmg—843 (5—atcatcacaacaggaaagtaataaaa; rooster column number 6), 10 M reverse primer—prmGmg-3900 (5 ′ Perform PCR using attgtgcatccttcgaacgtccca; SEQ ID NO: 7) and TAKARA LA Taq polymerase (TAKARA LA Taq with GC Buffer, manufactured by Takara Shuzo).
- the PCR conditions are as follows: for 30 seconds at, then at 30 at 60 and then at 72 ° C for 2 minutes for 1 cycle, and this cycle is performed for 35 cycles.
- the DNA is purified and recovered using a QIAquick Gel Extraction kit (manufactured by QIAGEN). The recovered DNA is used as insert DNA in the following experiments.
- Plasmid pDrive—Gml / 843-3900 is obtained by ligating the insert DNAlOng with 50 ng of pDrive vector (QIAGEN) using T4 ligase.
- the resulting plasmid pDrive—Gml / 843-3900 was double digested with Mlul and Sacl.
- the obtained digest is subjected to agarose gel electrophoresis, and then purified using QIAquick Gel Extraction kit (manufactured by QIAG EN) to recover DNA. Use the recovered DNA as insert DNA in the following experiments.
- base number 843 of SEQ ID NO: 1 Amplifies the DNA having the nucleotide sequence represented by No. 3776 from pGL-Gml / 843-3, which is a repo all-in-one vector containing the nucleotide sequence of the mouse Gm1 promoter region by the same procedure as above. Build 776.
- the transcription activation ability of the Gml promoter of the present invention is measured as follows.
- Test cells are prepared by transfection of the cultured cells with the Gml promoter-reporter vector (pGL-Gml; 0.2 g) obtained in Example 2 using the lipofection method.
- Gml promoter-reporter vector pGL-Gml; 0.2 g
- the medium in the well is removed. After adding 0.10 ml of fresh medium to the well, add 0.1 ⁇ to 10 ⁇ of the test substance and incubate at 37 ° C for 24 hours.
- the medium in the well was removed, and the well was washed with a PBS buffer solution.
- a cell lysis solution (Pitka Gene Luciferase Kit, manufactured by Toyo Ink Mfg. Co., Ltd.)
- a luminescent substrate (Pitka Gene Luciferase Kit, manufactured by Toyo Ink Mfg.) Is added to the wells. Is measured using a luminometer overnight. As a control, the luminescence intensity is similarly measured for cells not contacted with the test substance.
- the transcriptional activation ability of the Gm1 promoter of the present invention obtained in Example 2 is measured as follows.
- the Gm1 promoter reporter vector (pGL-Gml or pGL-GmlZSacI; 0.2 g each) obtained in Example 2 was transfected into the cultured cells by the lipofection method.
- Test cells In addition, control cells are prepared by transfection of a repo overnight vector (pGL3; 0.2 g) having no Gml promoter overnight using the lipofection method.
- the medium in the well was removed, and the well was washed with a PBS buffer solution.
- a cell lysate (Pitka Gene Luciferase Kit, manufactured by Toyo Ink Mfg.)
- a luminescent substrate (Pitka Gene Luciferase Kit, manufactured by Toyo Ink Mfg.) Is added to the wells. Measure the emission intensity of the well using a luminometer. As a control, the luminescence intensity is similarly measured for cells not contacted with the test substance.
- the plasmid pGL-Gml58 of the present invention described in Example 3 is digested with 101 and M1uI each at 10 U at 37 in a 20 / L reaction solution for 1 hour.
- the restriction enzyme digestion reaction mixture is subjected to agarose gel electrophoresis, and the insert DNA is purified using QI Aquick Gel Reaction Kit.
- TE solution 1 OmM Tris-HCl and ImMEDT A (hereinafter referred to as TE solution).
- TE solution 1 OmM Tris-HCl and ImMEDT A (hereinafter referred to as TE solution).
- t G 50 MicroCollums (Amersham Pharmacia Biotech) and centrifugation (room temperature, 1200 rpm, 1 minute) to elute the labeled DNA.
- the resulting radioactivity of the eluate was measured with a scintillation Isseki one to obtain a 10 4 c pm Bruno L to become so diluted with TE solution labeled DNA solution.
- 5X binding buffer (5 OmM Hepes potassium monoxide (pH 7.8), 250 mM potassium chloride, 5mM EDTA (pH 8.0), 25mM magnesium chloride, 50% (W / V) glycerol, 25mM dithiothreitol, 3.5mM PMS F, 10g / mL A protinin, 10g / Contains mL Pestatin, 10 II g / mL Leupeptin, and 5 mM sodium orthovanadate. ) 5 / xL, 2 ng / L polydl dC 1.5 L, 10 L of 10 M test substance and 2 L of labeled DNA solution are mixed and made up to a total of 25 L with distilled water.
- test substance that has been selected is selected as a substance that binds to the polynucleotide of the present invention.
- Example 11 1 Purification of a binding substance to the polynucleotide of the present invention by the purification method of the present invention
- Plasmid of the present invention P GL— Gml 200 / g Is digested with 50 U of each of XhoI and MluI in a 200 L reaction solution at 37 ° C for 1 hour.
- the restriction enzyme digestion reaction solution is subjected to agarose gel electrophoresis, and the DNA is obtained by purifying using a QIAQ Quick Gel Extraction Kit.
- a medium containing FBS is added in an amount of about 10 times the amount of trypsin-EDTA solution to obtain a cell suspension. Centrifuge the obtained cell suspension (room temperature, 1,300 rpm, 5 minutes), and remove the supernatant. Suspend the cell pellet in 15 mL of phosphate buffer, centrifuge again at room temperature at 1,300 rpm for 5 minutes, and remove the supernatant. Thereafter, the cell precipitate was ice-cooled in 10 mL of 1 OmM Hepes potassium hydroxide (pH 7.8), 1 OmM potassium chloride, 0.1 mM EDTA (pH 8.0) (hereinafter referred to as buffer A).
- a polynucleotide or the like characterized by having a base sequence that is a promoter region of a trimeric G protein ⁇ -subunit Gml.
- the polynucleotide and the like can be obtained by a method for searching for a signal transduction regulator via the promoter of the trimeric G protein subunit Gml, and a method for obtaining the trimer G protein ⁇ subunit Gm1 obtained by the searching method. It is useful for research and development of pharmaceuticals for neurological and psychiatric disorders, characterized by containing a compound having the ability to regulate signal transduction through a promoter or a pharmaceutically acceptable salt thereof as an active ingredient.
- Oligonucleotide primers designed for PCR Oligonucleotide primers designed for PCR.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Psychiatry (AREA)
- Pain & Pain Management (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05721227A EP1736544A4 (en) | 2004-03-15 | 2005-03-15 | GM1 PROMOTER AND ITS USE |
US10/593,216 US20070178467A1 (en) | 2004-03-15 | 2005-03-15 | Gm1 promoter and use thereof |
CA002560264A CA2560264A1 (en) | 2004-03-15 | 2005-03-15 | Gm1 promoter and use thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2004-072244 | 2004-03-15 | ||
JP2004072244 | 2004-03-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2005108574A1 true WO2005108574A1 (ja) | 2005-11-17 |
Family
ID=35320231
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2005/005077 WO2005108574A1 (ja) | 2004-03-15 | 2005-03-15 | Gm1プロモーター及びその利用 |
Country Status (4)
Country | Link |
---|---|
US (1) | US20070178467A1 (ja) |
EP (1) | EP1736544A4 (ja) |
CA (1) | CA2560264A1 (ja) |
WO (1) | WO2005108574A1 (ja) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1889905A4 (en) * | 2005-05-17 | 2009-05-20 | Sumitomo Chemical Co | METHOD FOR MITIGATING MOISTURE DISORDER-INDUCED PATHOLOGY |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002034575A (ja) * | 2000-07-28 | 2002-02-05 | Shiseido Co Ltd | ヒトII型5α−レダクターゼのプロモーター遺伝子およびその用途 |
EP1382613A1 (en) * | 2002-07-16 | 2004-01-21 | Sumitomo Chemical Company, Limited | Novel G protein, polynucleotide encoding the same and utilization thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5489519A (en) * | 1992-10-27 | 1996-02-06 | Queen's University At Kingston | Multidrug resistance protein |
-
2005
- 2005-03-15 WO PCT/JP2005/005077 patent/WO2005108574A1/ja active Application Filing
- 2005-03-15 EP EP05721227A patent/EP1736544A4/en not_active Withdrawn
- 2005-03-15 US US10/593,216 patent/US20070178467A1/en not_active Abandoned
- 2005-03-15 CA CA002560264A patent/CA2560264A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002034575A (ja) * | 2000-07-28 | 2002-02-05 | Shiseido Co Ltd | ヒトII型5α−レダクターゼのプロモーター遺伝子およびその用途 |
EP1382613A1 (en) * | 2002-07-16 | 2004-01-21 | Sumitomo Chemical Company, Limited | Novel G protein, polynucleotide encoding the same and utilization thereof |
Non-Patent Citations (1)
Title |
---|
See also references of EP1736544A4 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1889905A4 (en) * | 2005-05-17 | 2009-05-20 | Sumitomo Chemical Co | METHOD FOR MITIGATING MOISTURE DISORDER-INDUCED PATHOLOGY |
Also Published As
Publication number | Publication date |
---|---|
EP1736544A1 (en) | 2006-12-27 |
CA2560264A1 (en) | 2005-11-17 |
EP1736544A4 (en) | 2007-12-19 |
US20070178467A1 (en) | 2007-08-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Lee et al. | Molecular evolution of multiple forms of kisspeptins and GPR54 receptors in vertebrates | |
JP3438186B2 (ja) | 糖尿病治療剤スクリーニング方法 | |
Von Dannecker et al. | Ric-8B, an olfactory putative GTP exchange factor, amplifies signal transduction through the olfactory-specific G-protein Gαolf | |
JP3464796B2 (ja) | 副甲状腺ホルモンのレセプターとそれをコードしているdna | |
Hannedouche et al. | Identification of the C3a receptor (C3AR1) as the target of the VGF-derived peptide TLQP-21 in rodent cells | |
JP4446737B2 (ja) | Gタンパク質共役型レセプターChemR23の天然リガンドとその使用 | |
EP1354200B1 (en) | Method of screening for gpr40 ligands | |
KR20150123803A (ko) | 향상된 이식유전자 발현 및 가공 | |
Cohen‐Barak et al. | Sox6 regulation of cardiac myocyte development | |
Zhang et al. | The Asp298Asn polymorphism of melanocortin‐4 receptor (MC4R) in pigs: Evidence for its potential effects on MC4R constitutive activity and cell surface expression | |
Zhang et al. | A truncated six transmembrane splice variant MOR-1G enhances expression of the full-length seven transmembrane μ-opioid receptor through heterodimerization | |
Gu et al. | Alternative translation initiation of human regulators of G-protein signaling-2 yields a set of functionally distinct proteins | |
JP2007534297A (ja) | ChemerinRのリガンドを含む組成物及び方法 | |
JP2002517195A (ja) | 2871レセプターと名付けられたgタンパク質共役型レセプター | |
EP1329508B1 (en) | Novel g protein-coupled receptor protein and dna thereof | |
WO2005108574A1 (ja) | Gm1プロモーター及びその利用 | |
WO2015128894A1 (ja) | Gタンパク質共役型受容体のシグナル伝達の検出方法 | |
US7674891B2 (en) | Nucleic acid molecules encoding GPR84 | |
Beekman et al. | Protein 4.1 G binds to a unique motif within the FcγRI cytoplasmic tail | |
Rumsby et al. | Molecular endocrinology: genetic analysis of hormones and their receptors | |
CA2439175C (en) | Opiate receptors | |
Davey et al. | Androgen receptor expression and function in osteoclasts | |
JP2005296003A (ja) | 三量体Gタンパク質αサブユニットGm1のプロモーター及びその利用 | |
Kim et al. | Endocrinology and Metabolism | |
JP2003315332A (ja) | スクリーニング方法 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2560264 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005721227 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2005721227 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10593216 Country of ref document: US Ref document number: 2007178467 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 10593216 Country of ref document: US |