WO2005090601A1

WO2005090601A1 - Biomarker of hypertension

Info

Publication number: WO2005090601A1
Application number: PCT/IB2005/000617
Authority: WO
Inventors: Peter James Colman; Michelle Ann Penny
Original assignee: Pfizer Limited; Pfizer Inc.
Priority date: 2004-03-19
Filing date: 2005-03-08
Publication date: 2005-09-29

Abstract

A single nucleotide polymorphism designated -54E3 A/G in the human soluble guanylate cyclase GUCY1A2 gene is a biomarker hypertension or a predisposition to hypertension, and is useful for diagnosis of hypertension or predisposition thereto, or for selecting patients likely to respond to treatment with an sGC activator compound.

Description

Biomarker of Hypertension

This invention relates to a biomarker for hypertension, namely a single nucleotide polymorphism (SNP) of the soluble gyanylate cyclase subunit gene GUCY1 A2, and to the diagnosis of hypertension or a predisposition to hypertension in a human subject by determining the presence of that SNP, or any.SNP of GUCY1 A2 which is in linkage disequilibrium therewith, in a biological sample taken from the subject.

Background to the Invention.

Soluble guanylate cyclase (sGC) is a haem-containing heterodimeric protein with and β subunits, which binds nitric oxide (NO) and catalyses the formation of cyclic guanosine monophosphate (cGMP) from guanosine triphosphate (GTP) to mediate many physiological actions including neurotransmission, smooth muscle relaxation, vasodilation and platelet aggregation. The protein has three domains, the N-terminal haem-binding domain, a dimerisation domain and a catalytic domain. Heterodimeric association between two sGC subunits is required to produce a catalytically active protein. The α1 β1 is considered to be the "universal heterodimer" with the greatest activity. However, combinations between the four subunits could give rise to four different sGC isoforms each potentially having different activities.

Four sGC subunit genes have been identified in humans, known as α 1 , α2, β 1 and β2. Genes encoding the α1 and β1 subunits (GUCY1A3 and GUCY1 B3) map close to each other on chromosome 4q31. The α2 subunit gene (GUCY1 A2) is situated on chromosome 11 q22.3, and GUCY1 B2 encoding the β2 subunit is located on chromosome 13q14.3. The genomic structure of the sGC subunit genes is known, for example from www.ensembl.org, where the gene IDs are ENSG00000152402, ENSG00000164116, ENSG00000123201 , ENSG0000061918 for the GUCY1A2, -A3, - B2 and -B3 genes respectively. Those genes show different levels of expression and tissue distribution. The α . and β 1 subunits are expressed in most tissues, but, for example, are not expressed in a 1 :1 ratio in the brain, and the expression of the α2 subunit is more restricted, being highest in the brain. In addition, all four of these genes undergo alternative splicing to produce several transcripts that may also play a role in regulation of cellular responses to NO. The role of sGC in the NO-signalling pathway and regulation of blood pressure, together with observations of altered sGC subunit expression in rat models of hypertension suggests the sGC gene may play a role in hypertension. Genetic mapping in Dahl rats suggested the orthologous 1 , β1 and β2 loci were good candidates for genes controlling salt-sensitive hypertension [Azam et. al. Hypertension, 1998, 32(1), pp.149-54]. Sib-pair analysis of markers close to sGC subunit genes (α1 , β1 and β2) and hypertension in white Caucasians, however, showed no evidence of genetic linkage between the loci and hypertension [Danziger et. al. J. Hypertens, 2000, 18(3) pp. 263-6].

Compounds that activate sGC are considered useful as pharmaceuticals for the treatment of hypertension and/or reduction of risk of hypertension in predisposed individuals.

Brief Description of the Invention

This invention is based on the finding that there is a significant association between a SNP (herein referred to as -54E3 A/G) in the GUCY1 A2 gene and hypertension. This finding leads to the use of that SNP, and/or SNPs in linkage disequilibrium therewith, as a biomarker of hypertension or propensity to hypertension, and as a pharmacogenetic marker for selection of patients likely to respond to treatment with antihypertensive soluble guanylate cyclase activator compounds.

Detailed Description of the Invention

The present invention provides a method for the diagnosis of hypertension, or a predisposition to hypertension, in a human subject, comprising determining in vitro the genotype of the -54E3 A/G single nucleotide polymorphism in the human GUCY1 A2 gene, and/or one or more SNPs of GUCY1 A2 which is/are in linkage disequilibrium therewith, in DNA extracted from the subject, the presence of the G-allele at this locus being taken as indicative of hypertension or a predisposition to hypertension in the subject.

In another aspect, the invention provides a method of selecting a hypertensive, or potentially hypertensive, human subject likely to respond to treatment with an sGC activator compound, comprising determining in vitro the genotype of the -54E3 A/G single nucleotide polymorphism in the human GUCY1A2 gene, and/or one or more SNPs of GUCY1A2 which is/are in linkage disequilibrium therewith, in DNA taken from the subject, the identification of the G allele at this locus being taken as a signal for selection of that subject.

The -54E3 A/G SNP with which this invention is concerned is herein defined with reference to SEQ ID No.1 in Fig 1 , which is a section of the 5'→ 3' strand of genomic DNA of the human GUCY1 A2 gene, encompassing part of intron 2 and the whole of exon 3 (the latter being underlined). The SNP occurs 54 nucleotides 5' of the start of exon 3, and involves a change from A (emphasised in bold type and underlined) in the common allele, to G in the rare allele. The designation -54E3 A/G used herein is chosen to reflect the position ("-54E3" = 54 nucleotides 5' of the start of exon 3) and the nucleotide change ("A/G" = change from common A to rare G).

SNPs are in linkage disequilibrium when they are inherited together in a population more frequently than by chance. Hence, SNPs in GUCY1 A2 which are in linkage disequilibrium with the -54E3 A/G SNP are detected by sequence comparison of DNA samples from subjects already known to have the -54E3 A/G SNP. Statistical techniques for doing this analysis are well known, for example linkage disequilibrium parameters such as D' measure the association between a set of alleles on a particular chromosome.

The genotype of the -54E3 A/G polymorphism, and SNPs in linkage disequilibnrium therewith, may be ascertained by testing DNA extracted from any tissue taken from the subject. Usually it will be simplest to draw a blood sample, and extract DNA from the white blood cells.

There are several well-known analytical methods that can be used to detect the SNP(s). For a recent review of known methods, see, for example Pui-Yan Kwok "Methods for Genotyping Single Nucleotide Polymorphisms", Annu. Rev. Genomics Hum. Genet. 20001, 2:235-58. Well known PCR or other amplification techniques can of course be used to amplify the GUCY1 A2 gene prior to analysis. Direct detection methods include manual DNA sequencing or automated fluorescent sequencing. More conveniently, allele specific oligonucleotide (ASO) hybridization can be used. The identification of the -54E3 A/G SNP as a marker for hypertension has been established (as described below) in subjects of African ethnicity, but there is no evidence the observation will not hold true for other ethnicities such as Caucasian and Oriental.

The invention also includes a kit for carrying out the method of the invention, which comprises means for identifying the genotype of the -54E3 A/G SNP, and/or one or more SNPs of GUCY1A2 which is/are in linkage disequilibrium therewith, in the human GUCY1 A2 gene in DNA extracted from the subject. That may be done, for example, by fluorescence polarisation (FP) analysis . FP analysis is a well known procedure, and a typical protocol is as follows:

PCR products are generated from genomic DNA samples, using appropriate PCR primers. The resulting PCR products are treated with alkaline phosphatase and exonuclease I to remove residual dNTP's and PCR primers, respectively. PCR product (100 ng) is treated with 2 units shrimp alkaline phosphatase and 1 unit exonuclease I in a buffer containing 0.05 M Tris-CL, pH 8.5 and 5 mM MgCl2 in a final reaction volume of 20μl. The samples are incubated at 37θC for 60 min followed by incubation at 95^C for 15 min to inactivate enzymes.

Primer extension reactions are then used to query SNPs by using an oligonucleotide primer designed to hybridize to a region of interest that ends one base 5' from the SNP that is under investigation. The extension primer is used as a template in an enzymatic extension reaction that incorporates a fluorescently labelled ddNTP in the next position. A primer extension reaction is performed by adding 0.5 μM of an extension primer, 0.8 Units Thermosequenase (Amersham Pharmacia) and 62.5 nM dye-labelled ddNTP mix in a buffer containing 26 mM Tris-CI, pH 9.5 and 6.5 mM MgC.2- Reactions are incubated at 94^C for 1 min and then thermocycled at 94°C for 10 sec, followed by incubation at 55°C for 30 sec 35 times.

Samples are analyzed with an LJL Analyst instrument using the appropriate polarizing filter sets to detect which ddNTP is incorporated in the primer extension reaction. Fluorescence polarization detection is achieved by using light from a monochromatic source passing through a vertical polarizing filter to excite fluorescent molecules in the sample well. Only molecules orientated in the vertically polarized plane absorb light, become excited, and emit a fluorescent signal. The emission light intensity is measured both parallel and perpendicular to the excitiation light source. The vertical light intensity that is emitted in the horizontal plane is a measure of the amount of rotation the fluorescently labelled molecule has undergone during the excited state and is a measure of its relative size. mP (milli Polarization) values are calculated from parallel and perpendicular signal intensities.

For FP analysis to identify the genotype of the -54E3 A/G single nucleotide polymorphism with which this invention is concerned, suitable primers are easily designed, for example the following:

Left Primer : GCAAATGCTGATGTGAATGG (SEQ ID No. 2),

Right Primer : TGGAAATTCTTTTCTGCATCC (SEQ ID No. 3), and

Reverse FP Primer: GAAATTTTTGAAAGCATCTGCGAA (SEQ ID No. 4).

Likewise, primers to identify the genotypes of SNPs in linkage disequilibrium with the - 54E3 A/G SNP are easily designed with knowledge of the locus of the SNP in GUCY1 A2.

Evidence for the link between the -54E3 A/G SNP and hypertension will now be described:

Hypertensive patients of black South African ethnic origin attending hypertension clinics at two centres, Johannesburg General Hospital and Baragwanath Hospital, Soweto were recruited. Control subjects were recruited from surrounding communities. Control subjects were screened for the absence of hypertension (3 auscultatory blood pressure recordings <140/90). Any control subject noted to have elevated blood pressure was referred for further management and excluded as a control.

All subjects had three measurements of systolic (SBP) and diastolic (DBP) blood pressures taken, sitting, over 10-15 minute period using auscaltatory technique accurate to the nearest 2 mmHg. These recordings were taken from patients at least two weeks after stopping all anti hypertensive medication. Additional blood pressure measurements were taken using an ambulatory blood pressure monitor, to provide mean 24 hour day and night recordings and heart rate measurements, at least two weeks after stopping all anti hypertensive medication. Last medication received prior to blood pressure measurement was noted.

Further phenotypic, clinical data was also collected from hypertensive patients, including a 12 lead echocardiograph, haematology, blood biochemistry, renal data on urea and creatinine, and retinal damage noted on fundoscopy.

Information on gender, age, height, weight, significant smoking and alcohol history (i.e. >5 cigarettes, > 2 beers daily), previous medical history, relatives with hypertension were taken from all subjects recruited in to the study.

A SNP in the α2 subunit gene, GUCY1 A2, (-54E3 A/G SNP) was genotyped in DNA from the subjects in the study using fluorescence based genotyping. The frequency of the common A allele in the total black South African population, was observed to be 80%, the frequency of the rare G allele was 20%.

Calculations of Hardy-Weinberg Equilibrium (HWE) were performed for the SNP (tablel), the -54E3 A/G SNP did not deviate from HWE in this population.

Table 1 Test for HWE for GUCY1A2 SNP calculated in all subjects in Norton population

Genotype

GUCY1A2 -54E3 A/G 711 A/A 473 476.41 0.74 0.390 G/A 218 211.19 G/G 20 23.41 The -54E3 A/G SNP in GUCY1 A2 was significantly associated with hypertension (table 2). The association identified shows that individuals homozygous and heterozygous for the G allele were increased in the hypertensive population compared to the controls.

Table 2. Frequency of -54E3 A/G GUCY1 A2 genotype in hypertensive and control subjects

GUCY1 A2 -54E3 A/G 711 A/A 252 7283 221 60.55 1536 0.0001 G/A 90 26.01 128 3507 G/G 4 1.16 16 4.38

Adjusting for the effects of age, gender and BMI the -54E3 A/G allele of the GUCY1 A2 gene remained significantly associated with increased odds of being hypertensive.

Secondary analysis was performed on a subpopulation where hypertensive patients were classified according to diagnosis of hypertension and BP reading >140 and >90. The distribution of continuous variables was similar to that seen in the total population. Allele frequencies and HWE data in this sub population were also comparable to those obtained from the whole population. Significant association with hypertension was again observed with -54E3 A/G in GUCY1 A2 (table 3).

Table 3. Frequency of GUCY1A2 genotypes in hypertensive and control subjects

The odds of being hypertensive for -54E3 A/G GUCY1A2 SNP remain significant after adjustment for effects of age, gender and BMI in this subpopulation.

Claims

Claims:

1. A method for the diagnosis of hypertension, or a predisposition to hypertension, in a human subject, comprising determining in vitro the genotype of the -54E3 A/G single nucleotide polymorphism in the human GUCY1 A2 gene, and/or one or more single nucleotide polymorphisms of GUCY1A2 which is/are in linkage disequilibrium therewith, in DNA taken from the subject, the presence of the G-allele at this locus being taken as indicative of hypertension or a predisposition to hypertension in the subject.

2. A method of selecting a hypertensive, or potentially hypertensive, human subject likely to respond to treatment with an sGC activator compound, comprising determining in vitro the genotype of the -54E3 A/G single nucleotide polymorphism in the human GUCY1 A2 gene, and/or one or more single nucleotide polymorphisms of GUCY1A2 which is/are in linkage disequilibrium therewith, in DNA taken from the subject, the identification of the G allele at this locus being taken as a signal for selection of that subject.

3. A method as claimed in claim 1 or claim 2 wherein the DNA is extracted from white blood cells.

4. A method as claimed in any of the preceding claims wherein the subject is of African ethnicity.

5. A kit for the diagnosis of hypertension or a predisposition to hypertension in a human subject, or for the selection of a human subject likely to respond to treatment with an sGC activator compound, comprising means for identifying the genotype of the -54E3 A/G single nucleotide polymorphism of the human GUCY1 A2 gene, and/or one or more single nucleotide polymorphisms of GUCY1A2 which is/are in linkage disequilibrium therewith, in DNA taken from the subject.