WO2005090572A2 - Compositions and methods for treating pancreatic cancer - Google Patents

Compositions and methods for treating pancreatic cancer Download PDF

Info

Publication number
WO2005090572A2
WO2005090572A2 PCT/JP2005/005619 JP2005005619W WO2005090572A2 WO 2005090572 A2 WO2005090572 A2 WO 2005090572A2 JP 2005005619 W JP2005005619 W JP 2005005619W WO 2005090572 A2 WO2005090572 A2 WO 2005090572A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
double
sirna
cdh3
pcdhl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2005/005619
Other languages
English (en)
French (fr)
Other versions
WO2005090572A3 (en
Inventor
Yusuke Nakamura
Hidewaki Nakagawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
University of Tokyo NUC
Original Assignee
Oncotherapy Science Inc
University of Tokyo NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc, University of Tokyo NUC filed Critical Oncotherapy Science Inc
Priority to EP05721546A priority Critical patent/EP1735442A2/en
Priority to JP2006525966A priority patent/JP2007530431A/ja
Publication of WO2005090572A2 publication Critical patent/WO2005090572A2/en
Publication of WO2005090572A3 publication Critical patent/WO2005090572A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed

Definitions

  • the present invention relates to the field of biological science, more specifically to the field of cancer research.
  • the present invention relates a composition comprising a nucleic acid capable of inhibiting expression ofthe genes encoding PCDHl, CDH3 or GPR107.
  • the compound is a small interfering RNA (siRNA) corresponding to a subsequence from these genes.
  • Pancreatic ductal adenocarcinoma is the fifth leading cause of cancer death in the western world and has one ofthe highest mortality rates of any malignancy, with a 5-year survival rate only 4%.
  • PDACa pancreatic ductal adenocarcinoma
  • RNA small interfering RNA
  • the invention also provides methods for inhibiting tumor cell growth in a subject. Such methods include administering to a subject a composition comprising a small interfering RNA (siRNA) that hybridizes specifically to a sequence from PCDHl, CDH3 or GPRl 07.
  • siRNA small interfering RNA
  • Another aspect ofthe invention provides methods for inhibiting the expression ofthe PCDHl, CDH3 or GPRl 07 gene in a cell of a biological sample.
  • RNA double stranded ribonucleic acid
  • Another aspect ofthe invention relates to products including nucleic acid sequences and vectors as well as to compositions comprising them, useful, for example, in the provided methods.
  • siRNA molecules having the property to inhibit expression ofthe PCDHl, CDH3 or GPRl 07 gene when introduced into a cell expressing said gene.
  • Such molecules are those that comprise a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a PCDHl, CDH3 or GPRl 07 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand.
  • the sense and the antisense strands ofthe molecule hybridize to each other to form a double-stranded molecule.
  • the term "organism" refers to any living entity comprised of at least one cell.
  • a living organism can be as simple as, for example, a single eukaryotic cell or as complex as a mammal, including a human being.
  • biological sample refers to a whole organism or a subset of its tissues, cells or component parts (e.g. bodily fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, arnniotic fluid, amniotic cord blood, urine, vaginal fluid and semen).
  • bodily fluids including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, arnniotic fluid, amniotic cord blood, urine, vaginal fluid and semen.
  • Biological sample further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof.
  • biological sample refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as proteins or nucleic acid molecules.
  • the invention features methods of inhibiting cell growth.
  • Cell growth is inhibited by contacting a cell with a composition of a small interfering RNA (siRNA) of PCDHl, CDH3 or GPRl 07.
  • the cell is further contacted with a transfection-enhancing agent.
  • the cell is provided in vitro, in vivo or ex vivo.
  • the subject is a mammal, e.g., a human, non- human primate, mouse, rat, dog, cat, horse, or cow.
  • the cell is a pancreatic ductal cell.
  • the cell is a tumor cell ( t ' .e., cancer cell) such as a carcinoma cell or an adenocarcinoma cell.
  • the cell is a pancreatic ductal adenocarcinoma cell.
  • siRNA is meant a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA includes a sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence, an anti-sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence or both.
  • the siRNA may comprise two complementary molecules or may be constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin, which, in some embodiments, leads to production of micro RNA (miRNA).
  • the method is used to alter gene expression in a cell in which expression of PCDHl, CDH3 or GPRl 07 is up-regulated, e.g., as a result of malignant transformation of the cells.
  • the length ofthe oligonucleotide is at least about 10 nucleotides and may be as long as the naturally- occurring PCDHl, CDH3 or GPRl 07 transcript.
  • the oligonucleotide is about 19 to about 25 nucleotides in length.
  • the oligonucleotide is less than about 75, about 50, or about 25 nucleotides in length.
  • siRNA oligonucleotides of PCDHl, CDH3 or GPRl 07 which inhibit PCDHl, CDH3 or GPRl 07 expression in mammalian cells include oligonucleotides containing target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 or 24, respectively.
  • Methods for designing double stranded RNA having the ability to inhibit gene expression in a target cell are known. (See for example, US Patent No. 6,506,559, herein incorporated by reference in its entirety). For example, a computer program for designing siRNAs is available from the Ambion website
  • siRNA Target Sites 1. Beginning with the AUG start codon ofthe transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl et al.,Targeted mRNA degradation by double-stranded RNA in vitro.
  • BLAST can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/ 3. Select qualifying target sequences for synthesis. Selecting several target sequences along the length ofthe gene to evaluate is typical.
  • isolated nucleic acid molecules that include the nucleic acid sequence of target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 and 24 or a nucleic acid molecule that is complementary to the nucleic acid sequence of nucleotides of SEQ ID NOs: 22, 23 and 24.
  • an "isolated nucleic acid” is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state.
  • isolated nucleic acid includes DNA, RNA, and derivatives thereof. hen the isolated nucleic acid is RNA or derivatives thereof, base "t" should be replaced with "u” in the nucleotide sequences.
  • complementary refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule
  • binding means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof.
  • Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. For the purposes of this invention, two sequences having 5 or fewer mismatches are considered to be complementary.
  • the sense strand and antisense strand ofthe isolated nucleotide ofthe present invention can form double stranded nucleotide or hairpin loop structure by the hybridization.
  • such duplexes contain no more than 1 mismatch for every 10 matches.
  • where the strands ofthe duplex are fully complementary such duplexes contain no mismatches.
  • the nucleic acid molecule is less than 3851, 3205, or 6840 nucleotides in length for PCDHl, CDH3 or GPRl 07, respectively.
  • the nucleic acid molecule is less than about 500, about 200, or about 75 nucleotides in length.
  • a vector containing one or more ofthe nucleic acids described herein is included in the invention, and a cell containing the vectors.
  • the isolated nucleic acids ofthe present invention are useful for siRNA against PCDHl, CDH3 or GPR107, or DNA encoding the siRNA,
  • the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than 21 nucleotides.
  • the invention is based in part on the discovery that the gene encoding PCDHl, CDH3 or GPRl 07 is over-expressed in pancreatic ductal adenocarcinoma (PDACa) compared to non-cancerous pancreatic tissue.
  • PDACa pancreatic ductal adenocarcinoma
  • the cDNA of PCDHl, CDH3 or GPRl 07 is 3851, 3205 or 6840 nucleotides in length.
  • the nucleic acid and polypeptide sequences of PCDHl, CDH3 or GPR107 are shown in SEQ ID NO: 1 and 2, 3 and 4 or 5 and 6, respectively.
  • the sequence data are also available via following accession numbers.
  • GPRl 07 NM_032925, NM_020960, (KIAA1624: R39794)
  • AB046844 Transfection of siRNAs comprising SEQ ID NOs: 22, 23 and 24 resulted in a growth inhibition of PDACa cell lines.
  • PCDHl belongs to the protocadherin family, the largest subgroup of cadherin superfamily of calcium-dependent cell-cell adhesion molecules. Many ofthe protocadherin are highly expressed in the central nervous system and they are likely to play roles in neuronal circuit development and the modulation of synaptic transmission (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin- related molecules in central nervous system. EMBOJ., 12:2249-56, 1993.Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002).
  • CDH3 is also a classical member ofthe cadherin family (Shimoyama Y, Yoshida T, Terada M, Shimosato Y, Abe O, Hirohashi S. Molecular cloning of a human Ca2+- dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues. JCell Biol, 109:1787-94. 1989) and they link to catenins and cytoskeletons through its conserved intracellular domain, mediating signal- transduction that control cell polarity, differentiation, motility and cell growth (Christofori G.
  • GPRl 07 (KIAA1624) is one ofthe G protein-coupled receptors (GPCR) with seven transmembranes. A large percentage of today's prescription drugs target one or more GPCRs with most major therapeutic area being served to some extent by several GPCR- based drugs. Clearly, GPCRs are in the highest rank in the terms of drug discovery potential. GPRl 07 is expressed without restriction in normal heart, placenta, skeletal muscle, prostate, testis, ovary, spinal cord as shown in Northern blot analysis ( Figure 3C). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • the present invention relates to inhibiting cell growth, i.e, cancer cell growth by inhibiting expression of PCDHl, CDH3 or GPRl 07. Expression of PCDHl, CDH3 or
  • GPRl 07 is inhibited, for example, by small interfering RNA (siRNA) that specifically target the PCDHl, CDH3 or GPRl 07 gene.
  • PCDHl, CDH3 or GPRl 07 targets include, - for example, nucleotides of SEQ ID NOs: 22, 23 and 24.
  • dsRNA double-stranded RNA
  • RNAi RNA interference
  • dsRNA is processed into 20-23 nucleotides dsRNA called small interfering RNA (siRNA) by an enzyme containing RNase III motif.
  • siRNA specifically targets complementary mRNA with a multicomponent nuclease complex (Hammond SM, Bernstein E, Beach D, Hannon GJ.
  • An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000 Mar 16;404(6775):293- 6; Hannon GJ. RNA interference. Nature. 2002 Jul 11;418(6894):244- 51.).
  • siRNA composed of 20 or 21-mer dsRNA with 19 complementary nucleotides and 3' terminal noncomplementary dimmers of thymidine or uridine, have been shown to have a gene specific knock-down effect without inducing global changes in gene expression (Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411(6836):494-8.).
  • plasmids containing small nuclear RNA (snRNA) U6 or polymerase III HI -RNA promoter effectively produce such short RNA recruiting type III class of RNA polymerase III and thus can constitutively suppress its target mRNA Miyagishi M, Taira K.
  • U6 promoter- driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells.Nat Biotechnol. 2002 May;20(5):497-500. ; Brummelkamp TR, Bernards R, Agami R. A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science. 296(5567):550-553, April 19, 2002.).
  • the growth of cells are inhibited by contacting a cell, with a composition containing a siRNA of PCDHl, CDH3 or GPRl 07.
  • the cell is further contacted with a transfection agent. Suitable transfection agents are known in the art.
  • inhibition of cell growth is meant the cell proliferates at a lower rate or has decreased viability compared to a cell not exposed to the composition.
  • Cell growth is measured by methods known in the art such as, the MTT cell proliferation assay.
  • the siRNA of PCDHl, CDH3 or GPRl 07 is directed to a single target of PCDHl, CDH3 or GPRl 07 gene sequence. Alternatively, the siRNA is directed to multiple target of PCDHl, CDH3 or GPRl 07 gene sequences.
  • the composition contains siRNA of PCDHl, CDH3 or GPRl 07 directed to two, three, four, or five or more target sequences of PCDHl, CDH3 or GPRl 07.
  • PCDHl, CDH3 or GPRl 07 target sequence is meant a nucleotide sequence that is identical to a portion ofthe PCDHl, CDH3 or GPRl 07 gene.
  • the target sequence can include the 5' untranslated (UT) region, the open reading frame (ORF) or the 3' untranslated region ofthe human PCDHl, CDH3 or GPRl 07 gene.
  • the siRNA is a nucleic acid sequence complementary to an upstream or downstream modulator of PCDHl, CDH3 or GPRl 07 gene expression.
  • upstream and downstream modulators include, a transcription factor that binds the PCDHl, CDH3 or GPRl 07 gene promoter, a kinase or phosphatase that interacts with the PCDHl, CDH3 or GPRl 07 polypeptide, a PCDHl, CDH3 or GPRl 07 promoter or enhancer.
  • siRNA of PCDHl , CDH3 or GPRl 07 which hybridize to target mRNA decrease or inhibit production ofthe PCDHl, CDH3 or GPRl 07 polypeptide product encoded by the PCDHl, CDH3 or GPRl 07 gene by associating with the normally single- stranded mRNA transcript, thereby interfering with translation and thus, expression ofthe protein.
  • siRNA molecules ofthe invention can be defined by their ability to hybridize specifically to mRNA or cDNA from a PCDHl , CDH3 or GPRl 07 gene under stringent conditions.
  • hybridize or “hybridize specifically” are used to refer the ability of two nucleic acid molecules to hybridize under “stringent hybridization conditions.”
  • stringent hybridization conditions refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • T m thermal melting point
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions can be as following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 50°C.
  • the siRNA ofthe invention is less than about 500, about 200, about 100, about 50, or about 25 nucleotides in length. Preferably the siRNA is about 19 to about 25 nucleotides in length.
  • nucleic acid sequence for the production of PCDHl, CDH3 or GPR107 siRNA include the sequences of nucleotides of SEQ ID NOs: 22, 23 or 24 as the target sequence, respectively.
  • nucleotide "u” can be added to 3 'end ofthe antisense strand ofthe target sequence.
  • the number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5.
  • the added "u”s form single strand at the 3'end of the antisense strand ofthe siRNA.
  • the cell is any cell that expresses or over-expresses PCDHl, CDH3 or GPRl 07.
  • the cell is an epithelial cell such as a pancreatic ductal cell.
  • the cell is a tumor cell such as a carcinoma, adenocarcinoma, blastoma, leukemia, myeloma, or sarcoma.
  • the cell is a pancreatic ductal adenocarcinoma.
  • An siRNA of PCDHl, CDH3 or GPRl 07 is directly introduced into the cells in a form, that is capable of binding to the mRNA transcripts.
  • the DNA encoding the siRNA of PCDHl, CDH3 or GPRl 07 is in a vector.
  • Vectors are produced for example by cloning a PCDHl, CDH3 or GPRl 07 target sequence into an expression vector operatively-linked regulatory sequences flanking the PCDH1, CDH3 or GPRl 07 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505.).
  • RNA molecule that is antisense to PCDHl, CDH3 or GPR107 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3 ' of the cloned DNA) and an RNA molecule that is the sense strand for the PCDHl, CDH3 or GPRl 07 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' ofthe cloned DNA).
  • the sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing of the PCDHl, CDH3 or GPRl 07 gene.
  • two constructs are utilized to create the sense and anti-sense strands of a siRNA construct.
  • Cloned PCDHl, CDH3 or GPRl 07 can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene.
  • a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure.
  • the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA from PCDHl, CDH3 or GPRl 07.
  • [A] is a ribonucleotide sequence corresponding to a sequence selected from the group consisting of nucleotides of SEQ ID NOs: 22, 23 and 24, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A]
  • the region [A] hybridizes to [A'j, and then a loop consisting of region [B] is formed.
  • the loop sequence may be preferably about 3 to about 23 nucleotide in length.
  • the loop sequence for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb_506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-1 replication by RNA interference. Nature 418 : 435-438.). CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M (2002)
  • the loop sequence can be selected from group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • Preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA (SEQ ID NO:35)).
  • siRNAs are transcribed intracellularly by cloning the PCDHl, CDH3 or GPRl 07 gene templates into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
  • transfection-enhancing agent can be used. FuGENE (Roche Diagnostices), Lipofectamine 2000 (Invitrogen),
  • Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent.
  • Oligonucleotides and oligonucleotides complementary to various portions of PCDHl, CDH3 or GPRl 07 mRNA were tested in vitro for their ability to decrease production of PCDHl, CDH3 or GPR107 in tumor cells (e.g., using the pancreatic cell line such as pancreatic ductal adenocarcinoma(PDACa) cell line) according to standard methods.
  • a reduction in PCDHl, CDH3 or GPRl 07 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence ofthe candidate composition is detected using specific antibodies of PCDHl, CDH3 or GPRl 07 or other detection strategies. Sequences which decrease production of PCDHl, CDH3 or GPRl 07 in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth. Sequences which inhibit cell growth in vifro cell-based assay are test in vivo in rats or mice to confirm decreased PCDHl, CDH3 or GPRl 07 production and decreased tumor cell growth in animals with malignant neoplasms.
  • PDACa pancreatic ductal adenocarcinoma
  • Such patients are identified by standard methods ofthe particular tumor type.
  • Pancreatic ductal adenocarcinoma (PDACa) is diagnosed for example, by CT, MRI, ERCP, MRCP, computer tomography, or ultrasound.
  • Treatment is efficacious if the treatment leads to clinical benefit such as, a reduction in expression of PCDHl, CDH3 or GPRl 07, or a decrease in size, prevalence, or metastatic potential ofthe tumor in the subject.
  • "efficacious" means that the treatment retards or prevents tumors from forming or prevents or alleviates a symptom of clinical symptom of the tumor. Efficaciousness is determined in association with any known method for diagnosing or treating the particular tumor type.
  • siRNA therapy is carried out by administering to a patient a siRNA by standard vectors encoding the siRNAs ofthe invention and/or gene delivery systems such as by delivering the synthetic siRNA molecules.
  • siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo.
  • Methods for preparing chemically stabilized RNA molecules are well known in the art.
  • such molecules comprise modified backbones and nucleotides to prevent the action of ribonucleases.
  • Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties. (Song et al. Nature Med. 9:347-351 (2003)).
  • Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, or viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others.
  • a therapeutic nucleic acid composition is formulated in a pharmaceutically acceptable carrier.
  • the therapeutic composition may also include a gene delivery system as described above.
  • Pharmaceutically acceptable carriers are biologically compatible vehicles which are suitable for administration to an animal, e.g., physiological saline.
  • a therapeutically effective amount of a compound is an amount which is capable of producing a medically desirable result such as reduced production of a PCDHl, CDH3 or GPRl 07 gene product, reduction of cell growth, e.g., proliferation, or a reduction in tumor growth in a treated animal.
  • Parenteral administration such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver siRNA compositions of PCDHl, CDH3 or GPRl 07.
  • splenic artery For treatment of pancreatic tumors, direct infusion the celiac artery, splenic artery, or common hepatic artery, is useful. Dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular nucleic acid to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosage for intravenous administration of nucleic acids is from approximately 10 6 to 10 22 copies ofthe nucleic acid molecule.
  • the polynucleotides are administered by standard methods, such as by injection into the interstitial space of tissues such as muscles or skin, introduction into the circulation or into body cavities or by inhalation or insufflation.
  • Polynucleotides are injected or otherwise delivered to the animal with a pharmaceutically acceptable liquid carrier, e.g., a liquid carrier, which is'aqueous or partly aqueous.
  • a pharmaceutically acceptable liquid carrier e.g., a liquid carrier, which is'aqueous or partly aqueous.
  • the polynucleotides are associated with a liposome (e.g., a cationic or anionic liposome).
  • the polynucleotide includes genetic information necessary for expression by a target cell, such as a promoters.
  • Figure 1 depicts photographs showing the results of validation of over expression of PCDHl (A) and CDH3 (B) in the PDACa cells by RT-PCR.
  • Figure 2 depicts photographs showing the result of immunohistochemistry in PDACa tissues. Over-expression of CDH3 protein was observed in pancreatic ductal adenocarcinoma, but not in normal pancreatic duct.
  • Figure 3 depicts photographs of Northern blot analysis showing the expression pattern in normal adult tissues of each target genes for pancreatic cancer.
  • A PCDHl
  • B CDH3
  • C GPR107.
  • Figure 4 depicts photographs showing the effect of Knocking-down endogenous PCDHl in PDACa cell, PK-45P, by siRNA.
  • Figure 4 (A) shows the results of RT-PCR. It validated knockdown effect of PCDHl mRNA by transfection of siRNA expression vector 410si, but not by EGFPsi. The 410si was designed specifically for PCDHl mRNA sequence, and EGFP was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 4 (B) is a photograph showing the results of Colony formation assay.
  • Figure 4 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with 410si but not by EGFPsi.
  • Figure 5 depicts photographs showing the effect of Knocking-down endogenous CDH3 in PDACa cell, KLM-1, by siRNA.
  • Figure 5 (A) shows the results of RT-PCR. It validated knockdown effect of CDH3 mRNA by transfection of siRNA expression vectors si24 but not by EGFPsi. The si24 was designed specifically for CDH3 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 5 (B) is a photograph showing the results of Colony formation assay.
  • Figure 5 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with si24, but not by EGFPsi.
  • Figure 6 depicts photographs showing the effect of Knocking-down endogenous GPRl 07 in PDACa cell, KLM-1, by siRNA.
  • Figure 6 (A) shows the results of RT-PCR. It validated knockdown effect of GPRl 07 mRNA by transfection of siRNA expression vectors 1003 si, but not by and EGFPsi. The 1003 si was designed specifically for GPRl 07 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 6 (B) is a photograph showing the results of Colony formation assay.
  • Figure 6 (C) is a bar chart showing the results MTT assay. It also showed decreased number ofthe grown cells transfected with 1003si, but not by EGFPsi.
  • RNA samples from PDACa cells and normal duct epithelium were labeled by reverse transcription with Cy5-dCTP and Cy3-dCTP, respectively (Amersham Biosciences). Hybridization, washing, and detection were carried out as described previously (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000).
  • the primer sequences the present inventors used were 5 '-AGAAGGAGACCAAGGACCTGTAT-3 ' (SEQ.ID.NO.7) and 5'-AGAACTTTATTGTCAGGGTCAAGG-3' (SEQ.ID.NO.8) for PCDHl, 5'-CTGAAGGCGGCTAACACAGAC-3' (SEQ.ID.NO.9) and 5'-TACACGATTGTCCTCACCCTTC-3' (SEQ.ID.NO.10) for CDH3, and ' 5'-CATCCACGAAACTACCTTCAACT-3' (SEQ.ID.NO.il) and 5'-TCTCCTTAGAGAGAAGTGGGGTG-3 ' (SEQ.ID.NO.12) for ACTB.
  • Immunohistochemistry Formalin-fixed and paraffin-embedded PDACa sections were immunostained using a mouse anti-CDH3 monoclonal antibody (BD Transduction Laboratories) for CDH3 expression.
  • Deparaffinized tissue sections were placed in 10 mM citrate buffer, pH 6.0, and heated to 108°C in an autoclave for 15 minutes for antigen retrieval. Sections were incubated with a 1:10 dilution or a 1:100 dilution of primary antibody for CDH3, respectively, in a humidity chamber for an hour at room temperature, and developed with peroxidase labeled-dextran polymer followed by diaminobenzidine (DAKO Envision Plus System; DAKO Corporation, Carpinteria, CA). Sections were counterstainedwith hematoxylin. For negative controls, primary antibody was omitted.
  • Northern blot analysis 32 Human multiple-tissue Northern blots (Clontech) were hybridized with a [ ⁇ P] dCTP-labeled PCR product amplified by the primers described above. Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were auto-radiographed with intensifying screens at -80°C for 5 days.
  • the genomic fragment ofthe snRNA U6 gene containing the promoter region was amplified by PCR using a set of primers, 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No: 27), and 5'-TAGGCCCCACCTCCTTCTAT-3' (SEQ ID No: 28) and human placental DNA as a template.
  • the product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen).
  • the BamRl, Xhol fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 29) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' (SEQ ID No: 30).
  • the ligated DNA was used for a template of PCR with primers,
  • psiU6BX-EGFP was prepared by cloning double-stranded oligonucleotides of 5'-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCT
  • GCTTC-3' (SEQ IDNo: 33) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCT
  • siRNA-expressing constructs The nucleotide sequences ofthe siRNAs were designed using an siRNA design computer program available from the Ambion website. (http://www.ambion.com/techlib/misc/siRNA_finder.html). Briefly, nucleotide sequences for siRNA synthesis are selected using the following protocol.
  • siRNA Target Sites 1. Starting with the AUG start codon ofthe each gene transcript, scan downstream for an AA dinucleotide sequences. The occurrence of each AA and the 3' adjacent 19 nucleotides are recorded as potential siRNA target sites. Tuschl et al. don't recommend against designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75bases) as these may be richer in regulatory protein binding sites.
  • UTRs untranslated regions
  • start codon within 75bases
  • UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex. 2.
  • the potential target sites are compared to the appropriate genome database
  • target sequences with significant homology to other coding sequences. 3. Qualifying target sequences are selected for synthesis. Several target sequences along the length ofthe gene are selected for evaluation.
  • oligonucleotides used for siRNAs of PCDHl, CDH3 or GPRl 07 are shown below.
  • Each oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence ofthe target sequence.
  • the nucleotide sequences ofthe hairpin loop structure and target sequence are shown in SEQ ID NO:19 to SEQ ID NO:21 and SEQ ID NO:22 to SEQ ID NO:24, respectively (endonuclease recognition cites are eliminated from each hairpin loop structure sequence).
  • Example 2 Reduction ofthe expression ofthe genes PCDHl, CDH3 or GPRl 07 and growth suppression of cancer cells by siRNA
  • PDACa cells comparing with the expression pattern of normal pancreatic ductal epithelium that was thought to be the origin of PDACa (Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, Ishikawa O, Ohgaki, Kashimura N, Miyamoto M, Hirano S, Kondo S, Katoh H, Nakamura Y, and Katagiri T. Genome-wide cDNA microarray analysis of gene-expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelium cells selected for purity by laser microdissection. Oncogene, 2004 Feb 9, Epub ahead of print).
  • the present inventors selected three over-expressing genes, and PCDHl and CDH3 were validated their overexpression in PDACa by RT-PCR using the cDNA from microdissected PDACa cells ( Figure 1 A, B) or immunohistochemistry ( Figure 2).
  • PCDHl Protocadherin 1 (Genbank Accession No.NM_002587; SEQ ID No.l, 2)
  • RNAi mammalian vector-based RNA interference
  • PCDHl is expressed inrestrictedly in normal heart, placenta, prostate as shown in Northern blot analysis ( Figure 3A). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • PCDHl and other protocadherins are supported to have homophilic interaction on the cell surface by means of their cadherin domains and modulate intercellular signal transduction for cytoskeleton conformation, cell motility or cell growth (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J. , 12:2249-56, 1993, Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002.). According to our data, PCDHl is likely to modulate positive signal for pancreatic cancer cell growth through its homophilic interaction in cell-cell adhesion.
  • CDH3 P-cadherin (Genbank Accession No.NM_001793; SEQ ID No.3, 4)
  • the present inventors validated CDH3 over-expression in PDACa cells by RT-PCR
  • CDH3 over-expression was one ofthe most predominant patterns among more than 200 up-regulated genes in our PDACa profiles.
  • CDH3 is expressed inrestrictedly in normal thymus, prostate, ovary, trachea as shown in Northern blot analysis ( Figure 3B). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • RNAi mammalian vector-based RNA interference
  • GPRl 07 G protein-coupled receptor 107) (Genbank Accession No. AB046844; SEQ ID No.5, 6)
  • the present inventors identified this orphan GPCR as a target for pancreas cancer, which function and ligands are unknown.
  • GPRl 07 is expressed inrestrictedly in normal heart, placenta, skeletal muscle, testis, ovary, spinal cord as shown in Northern blot analysis ( Figure 3C).
  • Figure 3C Northern blot analysis
  • the present inventors knocked down their endogenous expression of GPRl 07 specifically by siRNA in PDACa cell line.
  • siRNA small interfering RNA
  • PDACa pancreatic ductal adenocarcinoma

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/JP2005/005619 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer Ceased WO2005090572A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP05721546A EP1735442A2 (en) 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer
JP2006525966A JP2007530431A (ja) 2004-03-24 2005-03-18 膵臓癌を治療するための組成物および方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55580904P 2004-03-24 2004-03-24
US60/555,809 2004-03-24

Publications (2)

Publication Number Publication Date
WO2005090572A2 true WO2005090572A2 (en) 2005-09-29
WO2005090572A3 WO2005090572A3 (en) 2006-04-13

Family

ID=34961863

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2005/005619 Ceased WO2005090572A2 (en) 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer

Country Status (4)

Country Link
EP (1) EP1735442A2 (enExample)
JP (1) JP2007530431A (enExample)
CN (1) CN1977044A (enExample)
WO (1) WO2005090572A2 (enExample)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009001562A1 (en) * 2007-06-27 2008-12-31 Oncotherapy Science, Inc. Compositions and methods of treating cancer
US8383590B2 (en) 2007-02-21 2013-02-26 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
US8435749B2 (en) 2008-06-30 2013-05-07 Oncotherapy Science, Inc. Anti-CDH3 antibodies labeled with radioisotope label and uses thereof
US8455444B2 (en) 2007-08-20 2013-06-04 Oncotherapy Science, Inc. CDH3 peptide and medicinal agent comprising the same
US8815211B2 (en) 2010-02-10 2014-08-26 Fujifilm Ri Pharma Co., Ltd. Radioactive metal-labeled anti-cadherin antibody
US9017669B2 (en) 2009-12-28 2015-04-28 Oncotherapy Science, Inc. Anti-CDH3 antibodies and uses thereof
US10005836B2 (en) 2014-11-14 2018-06-26 Novartis Ag Antibody drug conjugates
US11118185B2 (en) 2016-03-01 2021-09-14 University Of Florida Research Foundation, Incorporated AAV vectors for treatment of dominant retinitis pigmentosa
US12203074B2 (en) 2018-06-01 2025-01-21 University Of Florida Research Foundation, Incorporated Compositions and methods for treatment of dominant retinitis pigmentosa

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101825799A (zh) * 2010-05-26 2010-09-08 福州华映视讯有限公司 裸眼立体显示器的组立方法
CN108866058B (zh) * 2018-07-12 2021-09-10 苏州吉玛基因股份有限公司 靶向KRAS的siRNA及其在制备胰腺癌治疗药物中的应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1432724A4 (en) * 2002-02-20 2006-02-01 Sirna Therapeutics Inc INTERFERENCE MEDIATION INHIBITION OF GENE RNA FROM MAP KINASE

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9067973B2 (en) 2007-02-21 2015-06-30 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
US8383590B2 (en) 2007-02-21 2013-02-26 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
US9284349B2 (en) 2007-02-21 2016-03-15 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
US8623829B2 (en) 2007-02-21 2014-01-07 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
US8759481B2 (en) 2007-02-21 2014-06-24 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing tumor-associated antigens
WO2009001562A1 (en) * 2007-06-27 2008-12-31 Oncotherapy Science, Inc. Compositions and methods of treating cancer
US8455444B2 (en) 2007-08-20 2013-06-04 Oncotherapy Science, Inc. CDH3 peptide and medicinal agent comprising the same
US8435749B2 (en) 2008-06-30 2013-05-07 Oncotherapy Science, Inc. Anti-CDH3 antibodies labeled with radioisotope label and uses thereof
US9017669B2 (en) 2009-12-28 2015-04-28 Oncotherapy Science, Inc. Anti-CDH3 antibodies and uses thereof
US8815211B2 (en) 2010-02-10 2014-08-26 Fujifilm Ri Pharma Co., Ltd. Radioactive metal-labeled anti-cadherin antibody
US10005836B2 (en) 2014-11-14 2018-06-26 Novartis Ag Antibody drug conjugates
US10626172B2 (en) 2014-11-14 2020-04-21 Novartis Ag Antibody drug conjugates
US11118185B2 (en) 2016-03-01 2021-09-14 University Of Florida Research Foundation, Incorporated AAV vectors for treatment of dominant retinitis pigmentosa
US12203074B2 (en) 2018-06-01 2025-01-21 University Of Florida Research Foundation, Incorporated Compositions and methods for treatment of dominant retinitis pigmentosa

Also Published As

Publication number Publication date
WO2005090572A3 (en) 2006-04-13
CN1977044A (zh) 2007-06-06
JP2007530431A (ja) 2007-11-01
EP1735442A2 (en) 2006-12-27

Similar Documents

Publication Publication Date Title
Wang et al. Knockdown of c-Myc expression by RNAi inhibits MCF-7 breast tumor cells growth in vitro and in vivo
Li et al. Use of RNA interference to target cyclin E-overexpressing hepatocellular carcinoma
Heidenreich et al. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t (8; 21)-positive leukemic cells
JP2011078418A (ja) 肺癌を治療するための組成物および方法
ZA200304127B (en) Method for inhibiting the expression of a target gene.
Zhang et al. MicroRNA‐146a targets PRKCE to modulate papillary thyroid tumor development
CA2432350A1 (en) Method for inhibiting the expression of a target gene
Gong et al. Resistin promotes 3T3-L1 preadipocyte differentiation
US20100086526A1 (en) Nucleic acid constructs and methods for specific silencing of h19
KR20100017422A (ko) 작은 간섭 RNA(siRNA)를 이용하여 기억 형성에 관여하는 유전자를 확인하는 방법
WO2010008069A1 (ja) 細胞増殖阻害剤
Takigami et al. Synthetic siRNA targeting the breakpoint of EWS/Fli‐1 inhibits growth of Ewing sarcoma xenografts in a mouse model
CN101796184A (zh) 治疗癌症的组合物及方法
EP1735442A2 (en) Compositions and methods for treating pancreatic cancer
JP4467559B2 (ja) 細胞増殖を阻害する組成物および方法
JP2006500916A (ja) hnRNPA1およびA2核酸分子と関連がある新形成を治療するための方法および組成物
Zhang et al. RNA interference, A potential strategy for isoform-specific phosphatidylinositol 3-kinase targeted therapy in ovarian cancer
US20090215863A1 (en) Gene Silencing of Protease Activated Receptor 1(Par1)
KR102707587B1 (ko) miR-4487를 유효성분으로 함유하는 항암제 민감성 증진용 조성물
US20060003956A1 (en) Materials and methods for the derepression of the E-cadherin promoter
WO2021016061A2 (en) Inhibitors of microrna 451a for treatment of endometriosis
JP2009165357A (ja) ネコ伝染性腹膜炎ウイルス(fipv)の予防及び治療剤
Pu et al. Suppression of EGFR Expression by Antisense RNA and RNAi
TW201718854A (zh) 供p21基因調控之RNA干擾劑

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006525966

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

WWE Wipo information: entry into national phase

Ref document number: 2005721546

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200580016673.5

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005721546

Country of ref document: EP