WO2005085203A1 - Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors - Google Patents
Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors Download PDFInfo
- Publication number
- WO2005085203A1 WO2005085203A1 PCT/EP2005/051022 EP2005051022W WO2005085203A1 WO 2005085203 A1 WO2005085203 A1 WO 2005085203A1 EP 2005051022 W EP2005051022 W EP 2005051022W WO 2005085203 A1 WO2005085203 A1 WO 2005085203A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compounds
- hydrogen
- alkoxy
- formula
- alkyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 C*C(C(*)C*)[C@]1c(cc(*)c(*)c2)c2C(/C2=C/C=C/C(C)(*)/C=*(\*)/C2)=*C1 Chemical compound C*C(C(*)C*)[C@]1c(cc(*)c(*)c2)c2C(/C2=C/C=C/C(C)(*)/C=*(\*)/C2)=*C1 0.000 description 3
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D221/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00
- C07D221/02—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00 condensed with carbocyclic rings or ring systems
- C07D221/04—Ortho- or peri-condensed ring systems
- C07D221/06—Ring systems of three rings
- C07D221/10—Aza-phenanthrenes
- C07D221/12—Phenanthridines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/473—Quinolines; Isoquinolines ortho- or peri-condensed with carbocyclic ring systems, e.g. acridines, phenanthridines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/08—Bronchodilators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/10—Drugs for genital or sexual disorders; Contraceptives for impotence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/08—Vasodilators for multiple indications
Definitions
- the invention relates to novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridine derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
- the International Patent applications W099/57118 and WO0205616 describe 6-phenylphenanthridines as PDE4 inhibitors.
- WO99/05112 substituted 6-alkylphenanthridines are described as bronchial therapeutics.
- EP 0490823 dihydroisoquinoline derivatives are described which are useful in the treatment of asthma.
- phenanthridines substituted in the 6-position are described as bronchial therapeutics.
- the International Patent applications WO2004/019944 and WO2004/019945 disclose hydroxy- substituted 6-phenylphenanthridines as PDE4 inhibitors.
- the invention thus relates to compounds of formula I,
- R1 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-4C-alkoxy, and
- R2 is 2,2-difluoroethoxy, or, in a second aspect (aspect 2) according to the present invention,
- R1 is 2,2-difluoroethoxy
- R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycIoalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-4C-alkoxy,
- R3 is hydrogen or 1-4C-alkyl
- R31 is hydrogen or 1-4C-alkyl
- R4 is -0-R41 , in which
- R41 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alk l, hydroxy-2-4C-alkyl, 1-7C-alkylcarbonyl, or completely or predominantly fluorine-substituted 1-4C-alkyl, and
- R5 is hydrogen or 1-4C-alkyl, or, in a second embodiment (embodiment b) according to the present invention,
- R4 is hydrogen or 1-4C-alkyl
- R5 is -0-R51, in which
- R51 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alkyl, hydroxy-2 ⁇ 4C-alkyl, 1-7C-alkylcarbonyl, or completely or predominantly fluorine-substituted 1-4C-alkyl,
- R6 is hydrogen, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, halogen, nitro, cyano, hydroxyl, 1-4C- alkylcarbonyloxy, amino, mono- or d MC-alkylamino, phenyl, phenyl-1-4C-alkyl, 1-4C-alkyl- carbonylamino, phenoxy, 1 ⁇ 4C-alkylcarbonyl, or C(0)OR61, wherein
- R61 is hydrogen, 1-7C-alkyl, 3-7C-cyclo alkyl or 3-7C-cycloalkylmethyl,
- R7 is hydrogen, 1-4C-alkyl, hydroxyl, halogen, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy or C(0)OR61 , and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- 1-4C-Alkyl represents a straight -chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and preferably the ethyl and methyl radicals.
- 1-7C-Alkyl represents a straight -chain or branched alkyl radical having 1 to 7 carbon atoms. Examples which may be mentioned are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neo- hexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethyIpropyl), butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl or methyl radicals.
- 1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight -chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobu- toxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
- 3-7C-Cycloalkoxy represents cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy and cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
- 3-7C-Cycloalkylmethoxy represents cyclopropyl methoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexylmethoxy and cycloheptylmethoxy, of which cyclopropyl methoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
- fluorine-substituted 1-4C-alkoxy for example, the 2,2,3,3,3-pentafluoro- propoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy, in particular the 1 ,1 ,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and preferably the difluoro methoxy radicals may be mentioned.
- "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy radicals are replaced by fluorine atoms.
- fluorine-substituted 1-4C-alkyl for example, the 2,2,3,3,3-pentafluoro- propyl, the perfluoroethyl, the 1 ,2,2-trifluoroethyI, in particular the 1 ,1,2,2-tetrafluoroethyl, the 2,2,2-tri- fluoroethyl, the trifluoromethyl and particularly the difluoromethyl radicals may be mentioned.
- "Predomi- nantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkyl radicals are replaced by fluorine atoms.
- 1-2C-Alkylenedioxy represents, for example, the methylenedioxy [-O-CH 2 -O-] and the ethylenedioxy [-0-CH 2 -CH 2 -0-] radicals.
- 1-4C-Alkoxy-1-4C-alkyl represents one of the abovementioned 1-4C-alkyl radicals, which is substituted by one of the abovementioned 1-4C-alkoxy radicals.
- Examples which may be mentioned are the methoxy- methyl, the methoxyethyl and the isopropoxyethyl radicals, particularly the 2-methoxyethyl and the 2- isopropoxyethyl radicals.
- 1 - C-Alkylcarbonyl represents a radical which, in addition to the carbonyl group, contains one of the abovementioned 1-4C-alkyl radicals.
- An example which may be mentioned is the acetyl radical.
- 1-7C ⁇ Alkylcarbonyl represents a radical which, in addition to the carbonyl group, contains one of the abovementioned 1-7C-alkyl radicals. Examples which may be mentioned are the acetyl, propionyl, bu- tanoyl and hexanoyl radicals.
- Hydroxy-2-4C-alkyl represents 2-4C-alkyl radicals, which are substituted by a hydroxyl group. Examples which may be mentioned are the 2-hydroxyethyI and the 3-hydroxypropyl radicals.
- mono- or di-1 ⁇ 4C-alkylamino radicals contain one or two of the above- mentioned 1-4C-alkyl radicals.
- Di-1 -4C-alkylamino is preferred and here, in particular, dimethyl-, diethyl- or diisopropylamino.
- Halogen within the meaning of the invention is bromine, chlorine or fluorine.
- 3-7C-Cycloalkyl represents cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, of which cyclopropyl, cyclobutyl and cyclopentyl are preferred.
- 3-7C-Cycloalkylmethyl represents a methyl radical which is substituted by one of the abovementioned 3-7C-cycloalkyl radicals.
- the 3-5C-cycloalkylmethyl radicals cyclopropyl methyl, cyclobutyl- methyl and cyclopentylmethyl may be mentioned.
- Phenyl-1-4C-alkyl represents one of the abovementioned, phenyl-substituted 1-4C-aikyl radicals. Examples which may be mentioned are the phenethyl and the benzyl radicals.
- 1-4C-Alkylcarbonyloxy represents a carbonyloxy group to which one of the abovementioned 1-4C-alkyl radicals is bonded.
- An example which may be mentioned is the acetoxy radical [CH 3 C(0)-0-].
- 1-4C-Alkylcarbonylamino represents an amino radical which is substituted by one of the abovementioned 1-4C-alkylcarbonyl radicals.
- An example which may be mentioned is the acetamido radical [CH 3 C(0)-NH-].
- phenyl radicals substituted by R6 and R7 which may be mentioned are the radicals 4-acet- a idophenyl, 3-acetamidophenyl, 4-acetoxyphenyl, 3-aminophenyl, 4-aminophenyl, 2-bromophenyl, 4-bromophenyl, 2-chlorophenyl, 3-chlorophenyl, 4-chlorophenyl, 3-bromophenyl, 2,3-dichlorophenyl, 2,4- dichlorophenyl, 2-chloro ⁇ -nitrophenyl, 4-diethylamino-2-methylphenyl, 4-methoxyphenyl, 3-methoxy- phenyl, 2-chloro-5-nitrophe ⁇ yl, 4-chloro-3- ⁇ itrophenyl, 2,6-dichlorophenyl, 3,5-dichlorophenyl, 2,5-di- chlorophenyl, 2,6-dibromophenyl,
- N-oxides compounds comprising nitrogen atoms can form N-oxides.
- N- pyridine-type nitrogen
- N-oxide(s) as used in this invention therefore encompasses all possible, and in particular all stabile, N-oxide forms, such as mono-N-oxides, bis-N-oxides or multi-N-oxides, or mixtures thereof in any mixing ratio.
- Possible salts for compounds of the formula I -depending on substitution- are all acid addition salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable salts of the inorganic and organic acids and bases customarily used in pharmacy. Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulfosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulfonic acid, methanesulfonic acid or 3-hydroxy-2-naphthoic acid, it being
- salts with bases are also suitable.
- salts with bases which may be mentioned are alkali metal (lithium, sodium, potassium) or calcium, aluminum, magnesium, titanium, ammonium, meglumine or guanidinium salts, where here too the bases are employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
- Pharmacologically intolerable salts which can initially be obtained, for example, as process products in the preparation of the compounds according to the invention on an industrial scale are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
- the compounds according to the invention and their salts when they are isolated, for example, in crystalline form, can contain various amounts of solvents.
- the invention therefore also comprises all solvates and in particular all hydrates of the compounds of the formula I, and also all solvates and in particular all hydrates of the salts of the compounds of the formula I.
- R6 and R7 of compounds of formula I can be attached in the ortho, meta or para position with respect to the binding position in which the 6-phenyl ring is bonded to the phenanthridine ring system, whereby preference is given to the attachement in the meta or in the para position.
- R7 is hydrogen, and R6 is bonded to the meta or para position.
- R1 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalky I methoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 2,2-difluoroethoxy, or, in a second aspect (aspect 2) according to the present invention, R1 is 2,2-difluoroethoxy
- R2 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is hydrogen or 1-4C-alkylcarbonyl
- R5 is hydrogen, or, in a second embodiment (embodiment b) according to the present invention,
- R4 is hydrogen
- R5 is -0-R51, in which
- R51 is hydrogen or 1-4C-alkylcarbonyl
- R6 is 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, 3-7C-cycloalkylmethoxy, halogen, nitro, cyano, hydroxyl, 1-4C-alkylcarbonyloxy, mono- or di-1-4C-alkylamino, 1-4C-alkylcarbonylamino, phenoxy or C(0)OR61 , wherein
- R61 is hydrogen or 1-4C-alkyl
- R7 is hydrogen, halogen, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, or 3-7C-cycloalkylmethoxy, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 2,2-difluoroethoxy, or, in a second aspect (aspect 2) according to the present invention, R1 is 2,2-difluoroethoxy, and
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which R41 is hydrogen or 1-4C-alkylcarbonyl
- R5 is hydrogen
- R6 is 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, 3-7C-cycloalkylmethoxy, halogen, nitro, cyano, hydroxyl, 1-4C-alkylcarbonyloxy, mono- or di-1-4C-alkylamino, 1-4C ⁇ alkylcarbonylamino, phenoxy or C(0)OR61 , wherein R61 is hydrogen or 1-4C-alkyl, R7 is hydrogen, halogen, 1-4C-alkoxy, completely or predominantly fluorine-substit
- R1 is 1-2C-alkoxy
- R2 is 2,2-difluoroethoxy, or, in a second aspect (aspect 2) according to the present invention,
- R1 is 2,2-difluoroethoxy
- R2 is 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is halogen, in detail fluorine
- R7 is halogen, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, 3-7C- cycloalkylmethoxy, or, particularly, hydrogen, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy
- R2 is 2,2-difluoroethoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is cyano, or halogen such as e.g. fluorine,
- R7 is hydrogen, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- a special interest in the compounds according to this invention relates to those compounds which are included by one or, when possible, by more of the following embodiments:
- a special embodiment of the compounds of the present invention include those compounds of formula I, in which R1 is 1-2C-alkoxy and R2 is 2,2-difluoroethoxy.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is 1-2C-alkoxy and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R7 is hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I, in which R5 or, particularly, R4 is the radical (1-4C-alkylcarbonyl)-0- such as e.g. acetoxy, or hydroxyl, and all the other substituents are as defined in any compound which is said to be mentioned above.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R5 or, particularly, R4 is hydroxyl.
- a preferred embodiment according to the present invention is aspect 1.
- a further preferred embodiment according to the present invention is embodiment a.
- a further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1 is 1-2C-alkoxy and R2 is 2,2- difluoroethoxy, and R3 and R31 are hydrogen.
- a yet further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1 is methoxy and R2 is 2,2- difluoroethoxy, and R3 and R31 are hydrogen.
- Suitable compounds according to the present invention include those compounds of formula I, in which R5 or, particularly, R4 is hydroxyl.
- the compounds of formula I are chiral compounds having chiral centers at least in positions 4a and 10b and depending on the meanings of R3, R31, R4 and R5 additional chiral centers in positions 1, 2, 3 and 4.
- the invention includes all conceivable stereoisomers in pure form as well as in any mixing ratio. Preference is given to compounds of formula I in which the hydrogen atoms in positions 4a and 10b are in the cis position relative to one another.
- the pure cis enantiomers and their mixtures in any mixing ratio and including the racemates are more preferred in this context.
- Preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formulae lb ** and lb *** and lb* *** :
- More preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formula lb*****:
- the enantiomers can be separated in a manner known per se (for example by preparation and separation of appropriate diastereoisomeric compounds).
- an enantiomer separation can be carried out at the stage of the starting compounds having a free amino group such as starting compounds of formulae IVa or Vllb as defined below.
- Separation of the enantiomers can be carried out, for example, by means of salt formation of the racemic compounds of the formulae IVa or Vllb with optically active acids, preferably carboxylic acids, subsequent resolution of the salts and release of the desired compound from the salt.
- optically active acids preferably carboxylic acids
- optically active carboxylic acids which may be mentioned in this connection are the enantiomeric forms of mandelic acid, tartaric acid, O,0'-dibenzoyltartaric acid, camphoric acid, quinic acid, glutamic acid, pyroglutamic acid, malic acid, camphorsulfonic acid, 3-bromocamphorsulfonic acid, -methoxyphenylacetic acid, ⁇ -methoxy- -trifluoromethylphenylacetic acid and 2-phenylpropionic acid.
- enantiomerically pure starting compounds can be prepared via asymmetric syntheses.
- Enantiomerically pure starting compounds as well as enantiomerically pure compounds of the formula I can be also obtained by chroma- tographic separation on chiral separating columns; by derivatization with chiral auxiliary reagents, subsequent diastereomer separation and removal of the chiral auxiliary group; or by (fractional) crystallization from a suitable solvent.
- the compounds according to the invention can be prepared, for example, as shown in the reaction schemes below and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
- the nitro group of compounds of the formula Va in which R1, R2, R3, R31, R41 and R5 have the meanings mentioned above in embodiment a whereby R41 is other than hydrogen, is reduced to the amino group of the corresponding compounds of the formula IVa.
- Said reduction is carried out in a manner known to the person skilled in the art, for example as described in J. Org. Chem. 1962, 27, 4426 or as described in the following examples.
- the reduction can be carried out, for example, by catalytic hydrogenation, e.g.
- the reduction is carried out using a hydrogen-producing mixture, for example, metals such as zinc, zinc-copper couple or iron with organic acids such as acetic acid or mineral acids such as hydrochloric acid. More preferably, the reduction is carried out using a zinc-copper couple in the presence of an organic or an inorganic acid. Such a zinc-copper couple is accessible in a way known to the person of ordinary skill in the art.
- compounds of the formula lla can also be prepared from the corresponding compounds of the formula IVa and corresponding compounds of the formula III, in which X is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodi- imides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hy- drochloride), azodicarboxylic acid derivatives (e.g. diethyl azodicarboxylate), uranium salts [e.g.
- amide bond linking reagents are uroniu salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride.
- Said cyclocondensation reaction is carried out in a manner known per se to the person skilled in the art or as described by way of example in the following examples, according to Bischler-Napieralski (e.g. as described in J. Chem. Soc, 1956, 4280-4282) in the presence of a suitable condensing agent, such as, for example, polyphosphoric acid, phosphorus pentachloride, phosphorus pentoxide or phosphorus oxy- chloride, in a suitable inert solvent, e.g.
- a chlorinated hydrocarbon such as chloroform
- a cyclic hydrocarbon such as toluene or xylene
- another inert solvent such as isopropyl acetate or acetonitrile
- said cyclocondensation reaction can be carried out in the presence of one or more suitable Lewis Acids such as, for example, suitable metal halogenides (e.g. chlorides) or sulphonates (e.g. tri- flates), including rare earth metal salts, such as e.g. anhydrous aluminum trichloride, aluminum tribro- mide, zinc chloride, boron trifluoride ethereate, titanium tetrachloride or, in particular, tin tetrachloride, and the like.
- suitable metal halogenides e.g. chlorides
- sulphonates e.g. tri- flates
- rare earth metal salts such as e.g. anhydrous aluminum trichloride, aluminum tribro
- Suitable reducing agents for the abovementioned reduction reaction may include, for example, metal hydride compounds such as, for example, diisopropy- laluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoboro- hydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec-butylborohydride, lithium tri- sec-butylborohydride, ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]nonane and the like.
- metal hydride compounds such as, for example, diisopropy- laluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoboro- hydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec-butylborohydride, lithium tri- sec-butylborohydride, ⁇ -isopinocampheyl-9-
- the preferred examples of said reducing agents are sodium cyanoborohydride, ⁇ -isopinocampheyl-9- borabicyclo[3.3.1]nonane and potassium tri-sec-butylborohydride.
- the most preferred examples of the abovementioned reducing agents are ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]nonane and potassium tri- sec-butylborohydride, which both allow to prepare compounds of the formula Via stereoselectively.
- “Stereoselectively" in this connection means that those compounds of the formula Via, in which the hydrogen atoms in positions 1 and 3 are located at the opposite side of the plane defined by the cyclohex- ane ring, are obtained preferentially.
- the compounds of the formula Vila in which R1, R2, R3, R31 and R5 have the meanings mentioned in embodiment a, are either known or can be obtained by the reaction of compounds of the formula IXa, in which R1 and R2 have the meanings mentioned above, with compounds of the formula Villa, in which R3, R31 and R5 have the meanings mentioned above in embodiment a.
- the cycloaddition reaction is carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the compounds of the formulae Villa and IXa are either known or can be prepared in a known manner.
- the compounds of the formula IXa can be prepared, for example, in a manner known to the person skilled in the art from corresponding compounds of the formula Xa as described, for example, in d. Chem. Soc. 1951, 2524 or in J. Org. Chem. 1944, 9, 170 or as described in the following examples.
- the reduction can be carried out, for example, by contacting compounds of the formula Vlllb with a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- the reduction can be carried out by selective reduction of the nitro group in a manner known to the person skilled in the art, for example by hydrogen transfer reaction in the presence of a metal catalyst, for example palladium or preferably Raney nickel, in a suitable solvent, preferably a lower alcohol, using, for example ammonium formiate or preferably hydrazine hydrate as hydrogen donor.
- compounds of the formula Vlb in which R1, R2, R3, R31, R4, R6 and R7 have the meanings given above in embodiment b, can also be prepared, for example, from corresponding compounds of the formula Vllb and corresponding compounds of the formula III, in which X is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g.
- azodicarboxylic acid derivatives e.g. diethyl azodicarboxylate
- uronium salts e.g. O-(benzotriazoM-yl)- N,N,N',N'-tetramethylur
- preferred amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochioride.
- compounds of the formula Vlb are converted into corresponding compounds of the formula Vb by epoxidation reaction, which can be carried out as described in the following examples or in a manner known to one of ordinary skill in the art employing, for example, suitable epoxidation methods or suitable epoxidation reagents such as, for example, peracids (e.g. m-chloroperbenzoic acid) or organic or inorganic peroxides (e. g. dimethyldioxirane, hydrogene peroxide or persulfates).
- suitable epoxidation methods or suitable epoxidation reagents such as, for example, peracids (e.g. m-chloroperbenzoic acid) or organic or inorganic peroxides (e. g. dimethyldioxirane, hydrogene peroxide or persulfates).
- compounds of the formula Vb can be converted largely regio- and diastereoselectively into compounds of the formula IVb, wherein the hydroxyl radical in position 1 and the amido radical in position 3 are located at the same side of the plane defined by the cyclohexane ring.
- said inversion of configuration of position 1 of compounds of the formula IVb can be also obtained, for example, as described by way of example in the following examples according to subsequently specified two step procedure shown in reaction scheme 4 below.
- exemplary compounds of the formula IVb* in which R1, R2, R6 and R7 have the meanings indicated above in embodiment b, and R3, R31 and R4 are hydrogen and position 1 has the R configuration, are converted by oxidation reaction into corresponding compounds of the formula IXb.
- Said oxidation is likewise carried out under conditions customary per se using, for example, chloranil, atmospheric oxygen, manganese dioxide or, preferably, chromium oxides as an oxidant.
- compounds of the formula IXb obtained are converted by art-known reduction reaction of the keto group, preferably with metal hydride compounds or, more specifically, metal borohydrides, such as, for example, sodium borohydride, into corresponding compounds of formula IVb* * , in which position 1 has now S configuration and thus the configuration of the carbon atom in position 1 is now inverted regarding to said compounds of the formula IVb * .
- the cycloaddition is in this case carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the compounds of the formula Xb are either known or can be prepared in a known manner.
- compounds of the formula lib in which R1 , R2, R3, R31 , R4, R51 , R6 and R7 have the meanings given above in embodiment b whereby R51 is other than hydrogen (particularly compounds of formula lib, in which R1, R2, R51 , R6 and R7 have the meanings given above in embodiment b whereby R51 is other than hydrogen, and R3, R31 and R4 are all hydrogen) can also be obtained as shown in reaction scheme 6 and as described by way of example in the following examples.
- the amino group of compounds of the formula Vllb is protected with an art-known protective group PG1, such as e.g. the tert-butoxycarbonyl group.
- the proteced compounds are subjected to hydroboration reaction to obtain over two steps compounds of formula Xlb.
- Said hydroboration reaction is carried out as described in the following examples using an appropriate (hydro)borating agent, such as e.g. 9-BBN, isopinocampheylborane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- an appropriate (hydro)borating agent such as e.g. 9-BBN, isopinocampheylborane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- the product obtained via said hydroboration reaction or, suitably, the R51 -substituted derivative thereof is purified from resulting stereo- and/or regioisomeric side products by methods known to the person skilled in the art, such as e.g. by chromatographic separation techniques.
- compounds of the formula I can be also converted into further compounds of the formula I by methods known to one of ordinary skill in the art. More specifically, for example, from compounds of the formula I in which a) R41 or R51 is hydrogen, the corresponding ester compounds can be obtained by esterification reactions; b) R41 or R51 is hydrogen, the corresponding ether compounds can be obtained by etherification reactions; c) R41 or R51 is an acyl group, such as e.g. acetyl, the corresponding hydroxyl compounds can be obtained by deesterification (e.g. saponification) reactions; d) R6 is a nitro group, the corresponding amino group can be obtained by reduction reaction using a suitable reducing agent.
- the methods mentioned under a), b), c) and d) are expediently carried out analogously to the methods known to the person skilled in the art or as described by way of example in the following examples.
- compounds of the formula I can be converted into their salts, or, optionally, salts of the compounds of the formula I can be converted into the free compounds.
- the compounds of the formula I can be converted, optionally, into their N-oxides, for example with the aid of hydrogen peroxide in methanol or with the aid of m-chloroperoxybenzoic acid in dichloro- methane.
- the person skilled in the art is familiar on the basis of his/her expert knowledge with the reaction conditions which are specifically necessary for carrying out the N-oxidation.
- the substances according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.
- Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as acetone, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or diox- ane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular-weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added.
- the salts are obtained by filtering, reprecipitating, precipitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by acidification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
- the conversions mentioned in this invention can be carried out analogously or similarly to methods which are familiar per se to the person skilled in the art.
- the person skilled in the art knows on the basis of his/her knowledge and on the basis of those synthesis routes, which are shown and described within the description of this invention, how to find other possible synthesis routes for compounds of the formula I. All these other possible synthesis routes are also part of this invention.
- m.p. stands for melting point, h for hour(s), min for minutes, R. for rentention factor in thin layer chromatography, s.p. for sintering point, EF for empirical formula, MW for molecular weight, MS for mass spectrum, for molecular ion, fnd. for found, calc. for calculated, other abbreviations have their meanings customary per se to the skilled person.
- the symbols RS and SR are used to denote the specific configuration of each of the chiral centers of a racemate.
- the term “(2RS,4aRS,10bRS)” stands for a racemate (racemic mixture) comprising the one enantiomer having the configuration (2R,4aR,10bR) and the other enantiomer having the configuration (2S,4aS,10bS).
- the title compound can be obtained from its pyroglutamate salt (compound B1b) using sodium hydrogen- carbonate solution in a water/dichloromethane mixture.
- Example G2 The title compound is prepared analogously as described in Example G2 starting from the appropriate starting compound known to the person skilled in the art or obtainable in an art-known manner or analogously or similarly to an art-known manner.
- the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
- selective cyclic nucleotide phosphodiesterase (PDE) inhibitors specifically of type 4
- they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action but also on account of their respiratory rate- or respiratory drive- increasing action) and for the removal of erectile dysfunction on account of their vascular dilating action, but on the other hand especially for the treatment of disorders, in particular of an inflammatory nature, e.g.
- the compounds according to the invention are distinguished by a low toxicity, a good enteral absorption (high bioavailability), a large therapeutic breadth and the absence of significant side effects.
- the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: acute and chronic (in particular inflammatory and allergen-induced) airway disorders of varying origin (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); dermatoses (especially of proliferative, inflammatory and allergic type) such as psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrhoeic eczema, Lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other prolife
- the compounds of the invention are useful in the treatment of diabetes insipidus and conditions associated with cerebral metabolic inhibition, such as cerebral senility, senile dementia (Alzheimer's disease), mem- ory impairment associated with Parkinson's disease or multiinfarct dementia; and also illnesses of the central nervous system, such as depressions or arteriosclerotic dementia; as well as for enhancing cognition.
- the compounds of the invention are useful in the treatment of diabetes mellitus, leukaemia and osteoporosis.
- the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
- the method is characterized in that a therapeutical ly active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
- the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions for treating disorders which are mediated by phosphodiesterases, in particular PDE4-mediated disorders, such as, for example, those mentioned in the specification of this invention or those which are apparent or known to the skilled person.
- the invention also relates to the use of the compounds according to the invention for the manufacture of pharmaceutical compositions having PDE4 inhibitory activity.
- the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned comprising one or more of the compounds according to the invention.
- compositions comprising one or more compounds according to this invention and a pharmaceutically acceptable carrier.
- Said compositions can be used in therapy, such as e.g. for treating, preventing or ameliorating one or more of the abovementioned diseases.
- the invention still yet furthermore relates to pharmaceutical compositions according to this invention having PDE, particularly PDE4, inhibitory activity.
- the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 4 (PDE4), ameliorating the symptoms of an PDE4-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE4-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention.
- the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
- compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
- the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
- suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between
- auxiliaries, excipients, carriers, vehicles, diluents or adjuvants which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
- solvents for example a ⁇ ti- oxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
- compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
- suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
- the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
- Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of mi- cronized active compounds from inhalation capsules.
- the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of me- tered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
- propellants e.g. Frigen in the case of me- tered aerosols
- surface-active substances e.g. Frigen in the case of me- tered aerosols
- emulsifiers emulsifiers
- stabilizers emulsifiers
- preservatives e.g. lactose in the case of powder inhal
- the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application.
- suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
- compositions according to the invention are prepared by processes known per se.
- the dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
- Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
- the dose for administration by inhalation is customarly between 0.01 and 3 mg per day.
- the customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.003 and 3 mg/kg per day.
- the dose for administration by inhalation is between 0.1 and 3 mg per day, and the dose in the case of systemic therapy (p.o. or i.v.) is between 0.03 and 3 mg/kg per day.
- the second messenger cyclic AMP (cAMP) is well-known for inhibiting inflammatory and immunocompe- tent cells.
- the PDE4 isoenzyme is broadly expressed in cells involved in the initiation and propagation of inflammatory diseases (H Tenor and C Schudt, in ..Phosphodiesterase Inhibitors", 21-40, sentThe Handbook of Immunopharmacology", Academic Press, 1996), and its inhibition leads to an increase of the intracellu- lar cAMP concentration and thus to the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
- Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991) or eosinophilic (A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995) granulocytes, which can be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor- in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231, 1997, and Pulmonary Pharmacol Therap 12: 377-386, 1999).
- neutrophilic C Schudt et al., Arch Pharmacol 344: 682-690, 1991
- eosinophilic A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995
- granulocytes which can be measured as luminol- enhanced chemiluminescence, or the synthesis of
- the PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAATGAAGG -3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Gron- ingen, NL).
- the recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells.
- the expression plasmid was cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg).
- Wt virus-free recombinant virus supernatant was selected using plaque assay methods. After that, high-titre virus supernatant was prepared by amplifying 3 times.
- PDE was expressed in SF21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Pais- ley, UK). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.
- the SF21 insect cells were resuspended, at a concentration of approx. 10 7 cells/ml, in ice-cold (4°C) ho- mogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCl, 3.8 mM KCI, 1 mM EGTA, 1 mM MgCI 2 , 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 ⁇ M leupeptin, 10 ⁇ M pepstatin A, 5 ⁇ M trypsin inhibitor) and disrupted by ultrasonication. The homogenate was then centrifuged for 10 min at 1000xg and the supernatant was stored at -80°C until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Kunststoff) using BSA as the standard.
- PDE4B2 activity is inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's).
- modified SPA sintillation proximity assay
- the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ lvl cAMP (including about 50,000 cpm of [3H]cAMP), 1 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions.
- the final concentration of DMSO in the assay (1 % v/v) does not substantially affect the activity of the PDE investigated.
- the reaction is started by adding the substrate (cAMP) and the assay is incubated for a further 15 min; after that, it is stopped by adding SPA beads (50 ⁇ l).
- the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop.
- the MTP's are analyzed in commercially available luminescence detection devices.
- the corresponding IC 50 values of the compounds for the inhibition of PDE activity are determined from the concentration-effect curves by means of non-linear regression.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Pulmonology (AREA)
- Rheumatology (AREA)
- Heart & Thoracic Surgery (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Ophthalmology & Optometry (AREA)
- Pain & Pain Management (AREA)
- Biomedical Technology (AREA)
- Cardiology (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Gynecology & Obstetrics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Dermatology (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Other In-Based Heterocyclic Compounds (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/591,472 US20070259909A1 (en) | 2004-03-10 | 2005-03-08 | Novel Difluoroethoxy-Substituted Hydroxy-6-Phenylphenanthridines and Their Use as Pde4 Inhibitors |
| BRPI0508471A BRPI0508471A8 (pt) | 2004-03-10 | 2005-03-08 | compostos de hidróxi-6-fenilfenantidinas substituídas por difluoroetóxi, composição farmacêutica e uso para a produção dos mesmos |
| EP05716950A EP1725532A1 (en) | 2004-03-10 | 2005-03-08 | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| AU2005219581A AU2005219581A1 (en) | 2004-03-10 | 2005-03-08 | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as PDE4 inhibitors |
| JP2007502337A JP2007527898A (ja) | 2004-03-10 | 2005-03-08 | ジフルオロエトキシ置換された新規のヒドロキシ−6−フェニルフェナントリジン及びpde4インヒビターとしてのそれらの使用 |
| CA002558532A CA2558532A1 (en) | 2004-03-10 | 2005-03-08 | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| IL177498A IL177498A0 (en) | 2004-03-10 | 2006-08-15 | Difluoroethoxy -substituted hydroxy-6-phenylphenanthridine derivatives and pharmaceutical compositions containing the same |
| NO20064491A NO20064491L (no) | 2004-03-10 | 2006-10-03 | Nye difluomtoksysubstituee hydroksy-6-fenylfenantridiner og deres anvendelse som PDE4-inhibitorer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04100989 | 2004-03-10 | ||
| EP04100989.5 | 2004-03-10 | ||
| EP05100539.5 | 2005-01-27 | ||
| EP05100539 | 2005-01-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005085203A1 true WO2005085203A1 (en) | 2005-09-15 |
Family
ID=34921315
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/051022 Ceased WO2005085203A1 (en) | 2004-03-10 | 2005-03-08 | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20070259909A1 (https=) |
| EP (1) | EP1725532A1 (https=) |
| JP (1) | JP2007527898A (https=) |
| KR (1) | KR20070011349A (https=) |
| AU (1) | AU2005219581A1 (https=) |
| BR (1) | BRPI0508471A8 (https=) |
| CA (1) | CA2558532A1 (https=) |
| IL (1) | IL177498A0 (https=) |
| NO (1) | NO20064491L (https=) |
| WO (1) | WO2005085203A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US7723391B2 (en) | 2007-10-04 | 2010-05-25 | Roche Palo Alto Llc | Cyclopropyl aryl amide derivatives and uses thereof |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| CN103936661A (zh) * | 2014-04-04 | 2014-07-23 | 常州大学 | 一种6-烷基菲啶衍生物的合成方法 |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2495827C (en) * | 2002-08-29 | 2012-05-08 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| AR049419A1 (es) * | 2004-03-03 | 2006-08-02 | Altana Pharma Ag | Hidroxi-6-fenilfenantridinas sustituidas con heterociclilo |
| JP2007527901A (ja) * | 2004-03-10 | 2007-10-04 | アルタナ ファルマ アクチエンゲゼルシャフト | アミド置換された新規のヒドロキシ−6−フェニルフェナントリジン及びpde4インヒビターとしてのそれらの使用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997035854A1 (de) * | 1996-03-26 | 1997-10-02 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Neue in 6-position substituierte phenanthridine |
| WO2004019945A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| WO2004019944A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| UA48216C2 (uk) * | 1996-01-31 | 2002-08-15 | Бік Гулден Ломберг Кеміше Фабрік Гмбх | Фенантридини та лікарський засіб для лікування захворювань дихальних шляхів |
| US6127378A (en) * | 1996-03-26 | 2000-10-03 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Phenanthridines substituted in the 6 position |
| DE69822162T2 (de) * | 1997-07-25 | 2005-01-27 | Altana Pharma Ag | Neue tetrazolderivate |
| JP2001510827A (ja) * | 1997-07-25 | 2001-08-07 | ビイク グルデン ロンベルク ヒエーミツシエ フアブリーク ゲゼルシヤフト ミツト ベシユレンクテル ハフツング | 置換6−フェニルフェナントリジン |
| DK1075477T3 (da) * | 1998-05-05 | 2003-06-30 | Altana Pharma Ag | Nye benzonaphthyridin-N-oxider |
| EP1650193A3 (en) * | 1999-01-15 | 2006-10-04 | ALTANA Pharma AG | 6-Phenylphenanthridines with PDE-IV inhibiting activity |
-
2005
- 2005-03-08 EP EP05716950A patent/EP1725532A1/en not_active Withdrawn
- 2005-03-08 JP JP2007502337A patent/JP2007527898A/ja not_active Withdrawn
- 2005-03-08 AU AU2005219581A patent/AU2005219581A1/en not_active Abandoned
- 2005-03-08 US US10/591,472 patent/US20070259909A1/en not_active Abandoned
- 2005-03-08 WO PCT/EP2005/051022 patent/WO2005085203A1/en not_active Ceased
- 2005-03-08 KR KR1020067020295A patent/KR20070011349A/ko not_active Withdrawn
- 2005-03-08 CA CA002558532A patent/CA2558532A1/en not_active Abandoned
- 2005-03-08 BR BRPI0508471A patent/BRPI0508471A8/pt not_active IP Right Cessation
-
2006
- 2006-08-15 IL IL177498A patent/IL177498A0/en unknown
- 2006-10-03 NO NO20064491A patent/NO20064491L/no not_active Application Discontinuation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997035854A1 (de) * | 1996-03-26 | 1997-10-02 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Neue in 6-position substituierte phenanthridine |
| WO2004019945A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| WO2004019944A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US8202880B2 (en) | 2002-08-29 | 2012-06-19 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as PDE4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US8329906B2 (en) | 2004-02-18 | 2012-12-11 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8883818B2 (en) | 2004-03-03 | 2014-11-11 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8318944B2 (en) | 2004-03-03 | 2012-11-27 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8324391B2 (en) | 2004-03-03 | 2012-12-04 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9962377B2 (en) | 2004-03-03 | 2018-05-08 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9387205B2 (en) | 2004-03-03 | 2016-07-12 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8455653B2 (en) | 2004-03-03 | 2013-06-04 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9149479B2 (en) | 2004-03-03 | 2015-10-06 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8829189B2 (en) | 2005-03-02 | 2014-09-09 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8754218B2 (en) | 2005-03-02 | 2014-06-17 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8354535B2 (en) | 2005-03-02 | 2013-01-15 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US7723391B2 (en) | 2007-10-04 | 2010-05-25 | Roche Palo Alto Llc | Cyclopropyl aryl amide derivatives and uses thereof |
| CN103936661A (zh) * | 2014-04-04 | 2014-07-23 | 常州大学 | 一种6-烷基菲啶衍生物的合成方法 |
| CN103936661B (zh) * | 2014-04-04 | 2016-08-24 | 常州大学 | 一种6-烷基菲啶衍生物的合成方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| BRPI0508471A8 (pt) | 2019-01-15 |
| JP2007527898A (ja) | 2007-10-04 |
| IL177498A0 (en) | 2006-12-10 |
| KR20070011349A (ko) | 2007-01-24 |
| AU2005219581A1 (en) | 2005-09-15 |
| CA2558532A1 (en) | 2005-09-15 |
| NO20064491L (no) | 2006-10-03 |
| BRPI0508471A (pt) | 2007-07-31 |
| EP1725532A1 (en) | 2006-11-29 |
| US20070259909A1 (en) | 2007-11-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1536798B1 (en) | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors | |
| US7329676B2 (en) | 2-hydroxy-6-phenylphenanthridines as PDE-4 inhibitors | |
| US8329906B2 (en) | Guanidinyl-substituted hydroxy-6-phenylphenanthridines | |
| US20080161339A1 (en) | Novel Thio-Containing Hydroxy-6-Phenylphenanthridines and their Use as Pde4 Inhibitors | |
| EP1725532A1 (en) | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors | |
| US20070191414A1 (en) | Novel isoamido-substituted hydroxy-6-phenylphenanthridines | |
| NZ549109A (en) | Novel hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors | |
| MXPA06010044A (en) | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006/06779 Country of ref document: ZA Ref document number: 177498 Country of ref document: IL Ref document number: 200606779 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 549256 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007502337 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580006521.7 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2558532 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/010044 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005716950 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10591472 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020067020295 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005219581 Country of ref document: AU Ref document number: 1172/MUMNP/2006 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2005219581 Country of ref document: AU Date of ref document: 20050308 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005219581 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005716950 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067020295 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: PI0508471 Country of ref document: BR |
|
| WWP | Wipo information: published in national office |
Ref document number: 10591472 Country of ref document: US |