WO2005062812A2 - Systeme a base de raav pour la disruption genique de cellules somatiques - Google Patents

Systeme a base de raav pour la disruption genique de cellules somatiques Download PDF

Info

Publication number
WO2005062812A2
WO2005062812A2 PCT/US2004/042597 US2004042597W WO2005062812A2 WO 2005062812 A2 WO2005062812 A2 WO 2005062812A2 US 2004042597 W US2004042597 W US 2004042597W WO 2005062812 A2 WO2005062812 A2 WO 2005062812A2
Authority
WO
WIPO (PCT)
Prior art keywords
homology arms
locus
desired human
cells
human locus
Prior art date
Application number
PCT/US2004/042597
Other languages
English (en)
Other versions
WO2005062812A3 (fr
Inventor
Bert Vogelstein
Kenneth W. Kinzler
Manu Kohli
Carlo Rago
Original Assignee
The Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Johns Hopkins University filed Critical The Johns Hopkins University
Publication of WO2005062812A2 publication Critical patent/WO2005062812A2/fr
Publication of WO2005062812A3 publication Critical patent/WO2005062812A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Definitions

  • This invention is related to the area of somatic cell genetics. In particular, it relates to methods and reagents for making genetic modifications to somatic cell genes.
  • Targeted gene inactivation is the most definitive method for evaluating the function of a gene within a specific cell type or organism.
  • Gene disruption through homologous recombination can now be efficiently accomplished in a variety of cell types, including those from bacteria, yeast, chickens and rodents (1).
  • the same methods, when applied to human somatic cells are generally inefficient (2).
  • KO knockout
  • knockdown approaches can provide important information quickly, the interpretation of such experiments can be difficult because of non-specific effects or incomplete inactivation of the gene product of interest (4-6). This has stimulated efforts to improve the efficiency of KO approaches, particularly in human cells (7-10).
  • Recombinant adeno-associated viruses can be used to obtain higher frequencies of targeted gene disruptions than generally obtained with conventional plasmid KO vectors (11,12).
  • AAV is a human parvovirus which possesses a single- stranded DNA genome of 4.7 kb.
  • the wild-type virion possesses two open reading frames (ORFs), termed rep and cap, flanked by two inverted terminal repeats (ITRs).
  • the rep ORF encodes proteins involved in viral replication, and the cap ORF encodes proteins necessary for viral packaging.
  • ORFs are deleted and replaced with a gene expression cassette of interest.
  • a method for producing a recombinant AAV is provided.
  • Left and right homology arms from human genomic DNA are amplified using primers which introduce (a) restriction endonuclease recognition and cleavage sites flanking the left and right homology arms, and (b) first and second linker sequences on the non-flanking ends of the right and left homology arms, respectively.
  • Amplified left and right homology arms are formed; the left and right homology arms comprise portions of a desired human locus and/or genomic DNA flanking the desired human locus.
  • Three template molecules are then co-amplified to form a fusion product.
  • the first template molecule is the amplified right homology arm
  • the second template molecule is the amplified left homology arm
  • the third template molecule comprises one or more selectable marker genes flanked by two loxP sites.
  • the two loxP sites are flanked by the first and second linker sequences, respectively.
  • the fusion product is digested with the restriction endonuclease.
  • the digested fusion product is ligated to a linearized vector to form a ligated fusion product;
  • the linearized vector comprises AAV right and left inverted terminal repeats at the left and right termini of the linearized vector, respectively.
  • Human cells are transfected with the ligated fusion product.
  • the human cells comprise AAV rep and cap genes, and adenovirus genes E2A, E4, and VA. Virus produced by the human cells is harvested.
  • a second embodiment of the invention provides a recombinant adeno-associated virus (AAV) virion that encapsidates a recombinant AAV viral genome.
  • the AAV viral genome comprises AAV left and right inverted terminal repeats flanking left and right homology arms.
  • the left and right homology arms comprise portions of a desired human locus and/or genomic DNA flanking the desired human locus.
  • the left and right homology arms flank two or more loxP sites.
  • the loxP sites flank one or more selectable marker genes.
  • a third embodiment of the invention is a method of creating a mutation in a desired human locus.
  • Cells comprising one or more alleles of the desired human locus are infected with recombinant adeno-associated virus (AAV) virions encapsidating a recombinant AAV viral genome.
  • the AAV viral genome comprises AAV left and right inverted terminal repeats flanking left and right homology arms.
  • the left and right homology arms comprise portions of the desired human locus and/or genomic DNA flanking the desired locus.
  • the left and right homology arms flank two or more loxP sites.
  • the loxP sites flank one or more selectable marker genes.
  • the infected cells are subjected to conditions which are selective for the one or more selectable marker genes.
  • Infected cells are identified in which a portion of the recombinant AAV viral genome between the left and right homology arms has integrated in the desired locus.
  • the identified infected cells comprise an insertion mutation.
  • the identified cells can be optionally treated to cause excision of the insertion.
  • FIG. 1 A Structure of pNeDaKO-Neo and pNeDaKO-Hyg plasmid vectors. Restriction sites for the generation of pNeDaKO fragments used for fusion PCR are shown.
  • a and B refer to linkers A and B (see Example 1); yellow arrows: loxP sites; PGK: phosphoglycerate kinase eukaryotic promoter; Neo: neomycin resistance gene; Hyg: hygromycin resistance gene; EM 7: EM7 prokaryotic promoter; Zeo: zeomycin resistance gene; Amp: ampicillin resistance gene.
  • Fig. IB Associated plasmids necessary for rAAV production. The three plasmids shown were purchased from Stratagene. The fusion PCR products are cloned into the Notl sites in pAAV- MCS.
  • L-ITR left inverted terminal repeat
  • R-ITR right inverted terminal repeat
  • CMV cytomegalovirus promoter
  • MCS multiple cloning site
  • hGH pA human growth hormone poly- adenylation signal
  • AAV-2 rep and AAV-2 cap rep and cap sequences required for rAAV replication and packaging
  • adeno E2A, adeno E4, adeno VA adenovirus accessory proteins required for efficient rAAV replication.
  • Fig. 2 Generation of rAAV for gene targeting.
  • Homology arms HAs
  • HAs Homology arms
  • Notl restriction sites allow cloning of the fusion product into the AAV plasmid containing the ITR sequences necessary for viral packaging. Dual selection results in a population of plasmids containing the intended targeting cassettes flanked by ITRs.
  • Co-transfection of packaging cells with the targeting plasmid and helper plasmids produces rAAV capable of genomic integration or deletion.
  • a strategy to produce rAAV for the deletion of a generic exon is depicted.
  • PCR primers used for amplification PI, P2, P3 and P4) and fusion PCR (PI and P4) are shown. Abbreviations are defined in Figure 1.
  • FIG. 3 A to Fig. 3C Analytical agarose gels representing various steps in the generation of rAAV targeting constructs.
  • the first lane in each gel contains ⁇ 500 ng of 1 kb + DNA ladder (Invitrogen).
  • Fig. 3A DNA components used in fusion PCR.
  • Lane 2 pNeDaKO-Neo Pvul fragment
  • lane 3 pNeDaKO-Hyg BspHI fragment
  • lanes 4 and 5 left (L) and right (R) homology arm PCR products for FHIT
  • lanes 6 and 7 left (L) and right (R) homology arm PCR products for CCR5.
  • FIG. 3B Fusion PCR products for FHIT and CCR5.
  • Fig. 3C Confirmation of gene targeting vector construction. FHIT and CCR5 targeting constructs were digested with Notl and separated by electrophoresis on a 0.8% agarose gel. HAs: homology arms
  • FIG. 4A to 4E Screen for targeting events.
  • rAAV-Hyg-FHIT was used to generate a 1165 bp deletion of FHIT that included exon 8 and surrounding intronic sequences. Following rAAV-Hyg-FHIT infection, cells were selected for hygromycin resistance. Targeted integration removed exon 8 and surrounding sequences.
  • FF FHIT forward screening primer; HR: hygromycin reverse screening primer (Fig. 5).
  • Fig. 4B rAAV-Neo-CCR5 was used to generate a 46 bp deletion within exon 4 of CCR5. Following rAAV infection, cells were selected for geneticin resistance.
  • CF CCR5 forward screening primer
  • NR neomycin reverse screening primer
  • FIG. 5 Representative gel showing PCR products of 24 HCT116 hygromycin-resistant clones after infection with rAAV- Hyg-FHIT obtained with primers FF and HR. The FHIT gene in clone 21 was correctly targeted.
  • FIG. 4D Representative gel showing PCR products of 24 hTERT- immortalized RPE geneticin-resistant clones after infection with rAAV-Neo-CCR5 obtained with primers CF and NR. The CCR5 gene in clones 1, 2, 8 and 19 was correctly targeted.
  • FIG. 7 Sequence of pNeDaKO-Hyg between linkers A and B.
  • SEQ ID NO: 22 Features: Blue: Linkers A and B; Bold and underlined: BstX I and Kpn I sites; Yellow: loxP sites; Green: PGK eukaryotic promoter, hygromycin resistance gene, polyadenylation site; Red: EM-7 prokaryotic promoter and zeomycin resistance gene.
  • FIG. 23 Sequence of pNeDaKO-Neo between linkers A and B.
  • SEQ ID NO: 23 Features: Blue: Linkers A and B; Bold and underlined: Sac II and Kpn I sites; Yellow: loxP sites; Green: PGK eukaryotic promoter, geneticin resistance gene, bovine growth hormone polyadenylation site; Red: EM-7 prokaryotic promoter and zeomycin resistance gene
  • the inventors have developed methods of generating and using recombinant adeno- associated virus (AAV) for the generation of insertion and deletion mutations in human cells.
  • AAV adeno- associated virus
  • Step 1 Amplification of homology arms.
  • the optimal packaging size of rAAV is between 4.1 and 4.9 kb (15).
  • the size of homology arms used can vary based on the size of the other components being used in the rAAV.
  • the homology arms can be, for example, at least 500 bp, at least 750 bp, at least 900, or at least 1 kb.
  • Both the forward primer for amplifying the left homology arm and the reverse primer for amplifying the right homology arm contain restriction sites so that the final constructs can later be cloned into a vector for subsequent viral packaging.
  • the forward and reverse primer also contains a linker sequence. These linkers provide sequence overlap with the plasmid fragment used in step 2.
  • the size of the linker is at least about 18 bp, at least about 20 bp, or at least about 25 bp.
  • Step 2 Fusion PCR.
  • the amplified homology arms are mixed in equimolar ratios with plasmid vector restriction fragments and PCR is performed with two or more primers which hybridize to the homology arms.
  • the amplification results in a fusion PCR product containing a drug resistance cassette from the plasmid vector restriction fragment flanked by the left and right homology arms.
  • the fusion amplification product can be digested with a restriction endonuclease, the site for which was part of the forward and reverse primers used to amplify the left and right homology arms.
  • the digested fusion amplification product can then be ligated to a linearized plasmid vector, (preferably linearized with the same restriction endonuclease or with one which makes complementary sticky ends.)
  • the ligation product can be transformed into electro-competent E.coli and double-selected for a selectable phenotype conferred by the plamid vector and a selectable phenotype conferred by the fusion amplification product. The double selection ensures that all recovered plasmids contain the desired sequences.
  • DNA from the pooled population of doubly resistant clones grown in liquid culture can be used for the generation of rAAV virions. Cloning is not generally necessary and the pooled DNA can be directly used for rAAV virion production.
  • Step 4 Viral packaging. DNA from the recovered plasmids can be used to transfect into human cells. AAV genes rep and cap and adeno virus genes El A, E4, and VA can be supplied to the human cells as well. Virions of the rAAV can be harvested from the transfected cells' culture medium.
  • the virions can be used to infect human cells and to make insertions and/or deletions. Insertions will result if the rAAV DNA integrates. Insertions will also result after Cre-mediated excision if the left and right homology arms are derived from contiguous portions of the genome. If the left and right homology arms are derived from non-contiguous portions of the genome, then a deletion of genomic DNA will also occur upon Cre-mediated excision.
  • Non-contiguous portions of the genome which can be used as left and right homology arms can be separated by any number of intervening base pairs.
  • gaps between the two portions can be from 1-5 bp, from 5-50 bp, from 50-500 bp, from 500-1500 bp, and beyond. Gaps may be larger, for example, from about 1 kb ⁇ -2 kbp, from 2-3 kbp, and from 4-10 kbp.
  • the portions can be contiguous, i.e., separated by zero bp.
  • Any DNA amplification process known in the art can be used in the present invention. Although the polymerase chain reaction is very will known (see PCR Protocols, a guide to methods and applications, Innes et al., eds. Academic Press 1990, San Diego, California), other processes can be used as well, including strand displacement amplification, rolling circle amplification, ligase amplification reaction, transcription based amplification, cycling probe reaction, Q ⁇ replicase amplification. See M J Wolcott, Advances in nucleic acid-based detection methods. Clin Microbiol Rev. 1992, vol. 5, pp. 370-386.
  • Necessary genes and proteins for packaging a recombinant AAV virus can be supplied to a human cell by co-transfection of suitable expression vectors with the rAAV DNA.
  • the recipient human cell can be transfected with the necessary genes before or after transfection with the rAAV DNA.
  • Selectable marker genes are typically antibiotic resistance genes, although other genes such as a green fluoresecent protein (GFP) gene can be used. Depending on the expression control system employed, the genes can be expressed in either bacteria or in mammalian cells.
  • the rAAV constructs of the present invention employ at least one selectable marker gene under the control of a mammalian promoter and at least one selectable marker gene under the control of a bacterial promoter. In some embodiments, at least one of the selectable marker genes does not have a promoter driving its expression; only if the rAAV construct integrates at a locus where an endogenous promoter drives its expression will the selectable marker gene be expressed.
  • the human locus at which an insertion and/or deletion mutation is made according to the present invention may be any type of genomic feature present in the human genome.
  • the locus can be a protein coding or non-coding sequence. It can, for example, be an intron or an exon. It can be an enhancer element, a promoter element, a ct-v-acting element, or a regulatory sequence.
  • the locus may comprise a wild-type or mutant form.
  • the locus may contain a somatic mutation such that the particular allele of the locus is no longer identical with the germ-line allele of the locus.
  • the use of the term allele denotes a copy of a particular locus or genomic feature.
  • EXAMPLE 1 Material and Methods Cells and reagents.
  • HCT116 human colon cancer cell line HCT116 (ATCC, Manassas, Virginia) was maintained in HCT116 growth medium [McCoy's 5 A modified medium (HyClone, Logan, UT) supplemented with 10% FBS (HyClone), 100 units/ml penicillin and 100 ⁇ g/ml streptomycin (Invitrogen Corp., Carlsbad, CA)].
  • HCT116 growth medium McCoy's 5 A modified medium (HyClone, Logan, UT) supplemented with 10% FBS (HyClone), 100 units/ml penicillin and 100 ⁇ g/ml streptomycin (Invitrogen Corp., Carlsbad, CA)].
  • the human retinal pigment epithelial cell line hTERT-RPEl (Clontech, Palo Alto, CA) was maintained in RPE growth medium [Dulbecco's modified Eagle's medium (DMEM)-Nutrient Mixture F- 12 Ham (Sigma-Aldrich Corp., St Louis, MO) supplemented with 10% FBS, 100 units/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L-glutamine (HyClone) and 0.35% sodium bicarbonate (HyClone)].
  • DMEM modified Eagle's medium
  • F- 12 Ham Ham (Sigma-Aldrich Corp., St Louis, MO) supplemented with 10% FBS, 100 units/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L-glutamine (HyClone) and 0.35% sodium bicarbonate (HyClone)].
  • HEK 293 cells were obtained from ATCC and cultured in 293 growth medium [DMEM (HyClone) supplemented with 10% FBS (HyClone), 100 units/ml penicillin and 100 ⁇ g/ml streptomycin].
  • DMEM HyClone
  • FBS HyClone
  • streptomycin 100 units/ml penicillin and 100 ⁇ g/ml streptomycin.
  • the media were supplemented with either geneticin (0.4 mg/ml, Invitrogen) or hygromycin B (100 ⁇ g/ml, Calbiochem, San Diego, CA). All cell lines were maintained at 37°C in 5% CO 2 . All enzymes were purchased from New England Biolabs (Beverly, MA) except where indicated otherwise.
  • pNeDaKO (pronounced 'p-Need a Knockout') plasmid vectors contain either a gene conferring resistance to neomycin (Neo) or hygromycin (Hyg) linked in tandem to a gene conferring zeomycin resistance (Zeo).
  • neo neomycin
  • Hyg hygromycin
  • Zeo zeomycin resistance
  • the first fragment derived from pKO SelectNeo (Stratagene, La Jolla, CA), was for selection in mammalian cells and contained the Neo gene driven by the phosphoglycerate kinase (PGK) promoter and also contained a polyadenylation signal (pA).
  • An upstream loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT; SEQ ID NO: 21; see also Sauer, 1987, Mol. Cell. Biol. 7:2087-2096) and SacII site were incorporated into the forward primer used to generate this fragment by PCR.
  • the second fragment derived from pZeoSV (Invitrogen), was for selection in bacterial cells and contained Zeo driven by the EM7 promoter.
  • PNeDaKO-Hyg was constructed similarly except that the Hyg gene was derived from pIREShyg2 (Clontech) and BstXI replaced SacII.
  • HCT116 genomic DNA was used as the template for generating the left and right homology arms for gene targeting. Regions with minimal numbers of repeated sequences, assessed using RepeatMasker (website at repeatmasker.geome.washington.edu), were chosen whenever possible. All PCR reactions were performed with Platinum Taq DNA Polymerase High Fidelity (Invitrogen) using the conditions specified by the manufacturer.
  • the homology arms were generated by PCR in 12 separate 10 ⁇ l reactions in 96-well plates using the following cycling conditions: 1 cycle of 94°C for 1 min; 4 cycles of 94°C for 10 s, 64°C for 30 s, 68°C for 1 min; 4 cycles of 94°C for 10 s, 61°C for 30 s, 68°C for 1 min; 4 cycles of 94°C for 10 s, 58°C for 30 s, 68°C for 1 min; 22 cycles of 94°C for 10 s, 56.5°C for 30 s, 68°C for 1 min; 1 cycle of 68°C for 5 min.
  • the 12 products were pooled into one tube, extracted with phenol-chlorofo ⁇ n, ethanol precipitated and dissolved in 20 ⁇ l of water. After electrophoresis on a 0.8% agarose gel, the PCR products were purified using a Qiagen Gel Extraction Kit (Qiagen, Valencia, CA) and eluted into 50 ⁇ l of Qiagen Elution Buffer.
  • the forward primer contained a Notl site at its 5' end (Fig. 2 and Table 1).
  • the reverse primer contained the sequence 5'-GCTCCAGCTTTTGTTCCCTTTAG; SEQ ID NO: 3, which is the reverse complement of Linker A engineered into the plasmids described above (Fig.2 and Table 1).
  • the forward primer contained the sequence 5'-CGCCCTATAGTGAGTCGTATTAC; SEQ ID NO: 4 of Linker B and the reverse primer contained a Notl site (Fig. 5).
  • Fusion PCR linking homology arms to selectable markers.
  • the pNeDaKO-Neo plasmid was digested with Pvul, extracted with phenol- chloroform and ethanol precipitated.
  • the 4 kb Pvul fragment containing the drug marker was gel purified with a Qiagen Gel Extraction Kit.
  • the pNeDaKO-Hyg plasmid was digested with BspHI and the 4.5 kb fragment was purified in like fashion.
  • the left and right homology arms were mixed with one of these fragments and the PI forward primer and the P4 reverse primer were added (Fig. 2 and Fig. 5).
  • a total reaction volume of 360 ⁇ l containing pNeDaKO Pvul fragment (-400 ng), homology arms (-350 ng each) and primers (at 0.3 ⁇ M) generated sufficient fusion product for subsequent steps.
  • the reaction mix was divided into twelve 30 ⁇ l aliquots for PCR, which was performed using the following parameters: 1 cycle of 94°C for 2 min; 20 cycles of 94°C for 30 s, 56°C for 30 s, 68°C for 4 min; 1 cycle of 68°C for 5 min.
  • the 12 PCR reactions were combined into one tube and the primers were removed from the PCR mix using a Qiagen PCR Purification Kit.
  • the fusion PCR products were eluted into 50 ⁇ l of Qiagen Elution Buffer and digested with 60 units of Notl in a total volume of 200 ⁇ l for 3 h at 37°C.
  • the cleaved products were extracted with phenol and chloroform, precipitated with ethanol and dissolved in 20 ⁇ l of water.
  • the -4.0 or -4.5 kb band was purified using a Qiagen Gel Extraction Kit and eluted into 40 ⁇ l of Qiagen Elution Buffer.
  • fusion PCR products were similar in size to the restriction fragments of the pNeDaKO vectors that served as templates and no attempt was made to separate them; the appropriately sized fragments containing both the fusion PCR products and the restriction fragments of pNeDaKO were simply excised from the gel and co-purified.
  • the pAAV-MCS vector carries the ITR sequences necessary for AAV packaging plus Notl sites useful for cloning the fusion PCR product (Figs. 1A and IB).
  • Two micrograms of pAAV-MCS plasmid (Stratagene) was digested with 40 units Notl for 2 h at 37°C in 200 ⁇ l. To this tube, 2 ⁇ l of 10 000 units/ml calf intestinal alkaline phosphatase was added and incubated at 37°C for an additional 15 min. The digest was extracted with phenol and chloroform, precipitated with ethanol and dissolved in 20 ⁇ l of water.
  • the 3.0 kb fragment containing the plasmid backbone and ITR sequences was purified using a Qiagen Gel Extraction Kit and eluted into 50 ⁇ l of Qiagen Elution Buffer. Ligation was performed with the Rapid DNA Ligation Kit (Roche, Basel, Switzerland) by adding 1 ⁇ l (-10 ng) of the pAAV-MCS Notl fragment and 7 ⁇ l (-70 ng) of the fusion PCR product to 2 ⁇ l of 5x DNA dilution buffer, 10 ⁇ l of 2x T4 DNA ligase buffer and 1 ⁇ l of T4 DNA ligase and incubating at room temperature for 1 h.
  • the reaction was extracted with phenol and chloroform, precipitated with ethanol and dissolved in 40 ⁇ l of water.
  • Half of the DNA (20 ⁇ l) was electroporated into 10 ⁇ l of DH10B electro-competent Escherichia coli cells (catalog #18290015, Invitrogen).
  • Seven hundred microliters of Luria Bertani (LB) broth was added to the electroporation cuvette, and the contents were transferred to a 1.5 ml tube and incubated for 15 min at 37°C.
  • Half of this (350 ⁇ l) was then transferred to a 50 ml conical tube containing 10 ml of LB containing 40 ⁇ g/ml zeomycin and 100 ⁇ g/ml ampicillin.
  • the tube was incubated at 37°C shaking at 250 r.p.m. until log phase growth was evident (16-36 h, depending on efficiency of ligation). Other aliquots from the electroporated bacteria were spread on agar plates when individual clones were desired. Plasmid DNA was purified from E.coli cells using a Qiagen Mini Prep Kit, and proper ligation was confirmed with a Notl digest (Fig.3C). Packaging of rAAV targeting constructs.
  • the targeting construct made above (2.5 ⁇ g) was mixed with pAAV-RC and pHelper plasmids (2.5 ⁇ g of each) from the AAV Helper-Free System (Stratagene) and transfected into HEK 293 cells (ATCC) using Lipofectamine (Invitrogen).
  • This DNA was dissolved in Opti-MEM reduced-serum media (Invitrogen) to a total volume of 750 ⁇ l (i.e. if volume of DNA was 50 ⁇ l, volume of Opti-MEM was 700 ⁇ l).
  • Opti-MEM reduced-serum media Invitrogen
  • 54 ⁇ l of Lipofectamine was dissolved in Opti-MEM to a total volume of 750 ⁇ l.
  • HEK 293 cells at 70-80% confluence in a 75 cm 2 flask were washed with Hank's Balanced Salt Solution (HBSS, HyClone) and then 7.5 ml Opti-MEM was added. To this, the 1.5 ml DNA-Lipofectamine mixture was added dropwise, and the cells were incubated at 37°C for 3-4 h. The Opti-MEM was replaced with 293 growth medium and the cells were allowed to grow for 48 h prior to harvesting virus. Virus was harvested according to the AAV Helper-Free System instructions with minor modifications.
  • the media was aspirated from the flask and the 293 cells were scraped into 1 ml of phosphate-buffered saline (Invitrogen), transferred to a 2 ml microfuge tube, and subjected to three cycles of freeze-thaw. Each cycle consisted of 10 min freeze in a dry ice-ethanol bath, and 10 min thaw in a 37°C water bath, vortexing after each thaw. The lysate was then clarified by centrifugation at 12 000 r.p.m. in a microfuge to remove cell debris and the supernatant containing rAAV was divided into three aliquots of -330 ⁇ l each and frozen at -80°C.
  • phosphate-buffered saline Invitrogen
  • the cells to be targeted were grown in a 75 cm 2 flask until 60-80% confluence (6-8 x 10° cells/flask). The cells were washed lx with HBSS, the HBSS was removed, and then 330 ⁇ l of rAAV lysate and 4 ml of the appropriate growth media were added to the flask. The virus was allowed to infect cells at 37°C for 2-3 h. Afterwards, 8 ml of growth media was added to the flask and the cells were allowed to grow for 48 h. After 48 h, the cells in each 75 cm 2 flask were harvested by trypsinization and distributed into ten 96-well plates with media containing either geneticin or hygromycin B. The plates were wrapped in cling film to minimize evaporation and incubated at 37°C for 2-3 weeks prior to harvest.
  • Genomic DNA was extracted from colonies grown in 96-well plates using the Qiagen 96 Well Blood Kit (Qiagen), and DNA was eluted in 100 ⁇ l of Elution Buffer according to the manufacturer's instructions. Locus-specific targeting events were screened by PCR using a forward primer that was situated outside of the left homology arm and a reverse primer that was situated within the Neo (or Hyg) gene. A forward primer within the drug resistance gene and a reverse primer outside of the right homology arm could also be used to screen for recombinants. Sequences of the primers used in the experiments presented below are listed in Fig. 5.
  • PCR screening was carried out in 10 ⁇ l reaction volumes using the same conditions, cycling times and temperatures noted above for amplification of the homology arms except that all the extension times were 130 s instead of 1 min, and 30 cycles instead of 22 cycles were used for 56.5°C step.
  • the presence of a PCR product of the correct size (-1.6 kb) was indicative of a specific targeting event at the locus of interest.
  • Southern blot analysis was performed as described in (9). Genomic DNA was digested with Xbal (FHIT) or PvuII (CCR5) and the blots probed with -600 bp probes derived from sequences downstream of the right homology arms (Fig. 4A, B and E).
  • Step 1 PCR-amplification of homology arms.
  • the optimal packaging size of rAAV is between 4.1 and 4.9 kb (15).
  • the Hyg cassette plus other features of pNeDaKO-Hyg that were incorporated into the rAAV added up to 2.7 kb.
  • the combined length of the ITRs was 282 bp, leaving up to -1.9 kb for the homology arms. We therefore generally used -900 bp for each arm.
  • the forward primer used to PCR-amplify the left homology arm and the reverse primer used to amplify the right homology arm both contained Notl restriction sites so that the final constructs could be cloned into the pAAV-MCS vector (Figs. 1A and IB) for subsequent viral packaging.
  • the reverse primer used to PCR-amplify the left homology arm also contained a 23 bp linker sequence (reverse complement of linker 'A' in Figure 1A and IB).
  • the forward primer used to generate the right homology arm contained the sequence (not the reverse complement) of linker 'B'.
  • Step 2 Fusion PCR.
  • the amplified homology arms were mixed with pNeDaKO-Hyg or pNeDaKO-Neo restriction fragments in equimolar ratios and PCR was performed with primers PI and P4 (Fig. 2). This generated a fusion PCR product containing the drug resistance cassette flanked by the left and right homology arms.
  • Step 3 Ligation.
  • the fusion PCR product was digested with Notl and ligated into the pAAV-MCS Notl fragment.
  • the ligation product was transformed into electro- competent E.coli and double selected with ampicillin and zeomycin.
  • the AAV-MCS component provided the Amp element and the fusion PCR product provided the Zeo element.
  • the double selection ensured that all recovered plasmids contained the desired sequences.
  • Step 4 Viral packaging. DNA from the targeting construct plus pHelper and pAAV- RC DNAs were co-transfected into HEK 293 cells using Lipofectamine.
  • the pHelper plasmid contained the adeno E2A, E4 and VA genes while the pAAV-RC contained the rep and cap genes necessary for efficient packaging.
  • the rAAV preparations generally contained ⁇ 3 x 10 rAAV particles/ml, as determined by real-time PCR (17), and 330 ⁇ l aliquots generated -2000 (Neo) or -200 (Hyg) drug-resistant colonies upon infection of one 75 cm 2 flask of HCT116 cells. In general, one third of the virus generated from one 75 cm 2 flask was sufficient for infection of one 75 cm 2 flask containing the cells to be targeted.
  • rAAV targeting could be used to generate deletions of endogenous sequences, even though rAAV targeting has historically resulted in the insertion of rAAV sequences between two adjacent nucleotides.
  • deletions up to 1165 bp in length, as described below.
  • Such deletions can be very useful for certain purposes, such as study of the null phenotype or delineation of the role of a specific exon within a given gene (following cre-mediated excision of the inserted Neo or Hyg sequences).
  • Figure 3A shows an ethidium bromide-stained agarose gel containing pNeDaKO plasmid fragments and PCR products of homology arms from the FHIT and CCR5 loci (Step 1).
  • Figure 3B shows fusion PCR products generated with these homology arms plus the restriction fragments from pNeDaKO-Hyg and pNeDaKO-Neo for FHIT and CCR5, respectively (Step 2).
  • Figure 3C shows Notl digests of plasmids obtained after cloning the fusion PCR products into pAAV-MCS and selecting with ampicillin and zeomycin (Step 3).
  • FIG. 4A and 4B Cartoons depicting the FHIT and CCR5 loci are shown in Figure 4A and 4B, respectively.
  • FHIT targeting we chose to delete an entire exon and surrounding intronic sequences, while for CCR5, 46 bp from exon 4 were deleted when homologous integration occurred.
  • Figure 4C and D show a typical PCR-based screen for successful targeting events. Because the homology arms used for targeting were generally only 900 bp (as noted above), the sizes of the PCR products generated from successful targeting events were relatively small ( ⁇ 1600 bp).
  • FIG. 4C and D depict typical results obtained upon such screening.
  • the FHIT gene was found to be correctly targeted in two of 92 HCT116 clones resistant to hygromycin after infection with rAAV generated with a pNeDaKO-Hyg-derived vector (Fig. 4C).
  • the CCR5 gene was found to be correctly targeted in 12 of 173 hTERT-immortalized RPE clones resistant to geneticin after infection with rAAV generated from pNeDaKO-Neo-derived vectors (Fig. 4D).
  • 13 of 244 HCT116 Neo-resistant clones obtained after infection with the rAAV for CCR5 were properly targeted. Southern blots were used to confirm the validity of the PCR-based screen with randomly chosen clones (Fig. 4E).
  • the sequence of the final targeting vector (in pAAV-MCS) should be determined, along with the sequence of the endogenous locus in the cells to be targeted. Though a few mismatches are tolerable, clones with the least number of mismatches are preferable.
  • the targeting frequency may be higher when the stretch of endogenous sequences that are to be deleted is relatively small, so that deletions of one or a few base pairs is preferable over deletions encompassing 1000 bp (Fig. 4).
  • the efficiency can sometimes be improved by simply targeting a different exon.
  • the homology arms are each ⁇ 1 kb in size, and the vectors are so easy to generate, it is generally not difficult to construct several targeting vectors for different regions of the same gene.
  • the techniques described above should greatly facilitate the manipulation of endogenous sequences in human cells. Preparation of the homology arms and final pNeDaKO vectors are considerably simpler and faster than is possible with conventional systems, in part due to the small size of the homology arms required with this approach.
  • the targeting efficiency obtained with rAAV-based targeting is often 10-lOOx higher than obtained with methods that employ plasmid DNA transfection rather than rAAV infection (18).
  • gene disruption is currently the most direct and interpretable approach to assess gene function.
  • function of many genes is both cell-type- and species-dependent (19)
  • gene disruptions in model systems such as Drosophila, Caenorhabditis elegans and Mus musculus can provide essential information about function but do not always reflect the gene's functional role in specific types of human cells.
  • KO cell lines and their parental controls provide excellent tools for drug discovery (20).

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Une nouvelle manifestation donne à penser que des vecteurs viraux adéno-associés recombinants (rAAV) peuvent être utilisés pour le ciblage de gènes spécifiques dans des cellules somatiques humaines. Nous avons développé une procédure de construction de vecteurs rAAV utilisant la PCR de fusion et une étape de clonage unique qui simplifie considérablement le processus d'inactivation. Nous démontrons son utilité par la disruption de gènes à des emplacements spécifiques au sein de cellules humaines du cancer du colon et de cellules épithéliales normales immortalisées. Cette technologie devrait être largement applicable à des études in vitro nécessitant la manipulation du génome humain.
PCT/US2004/042597 2003-12-22 2004-12-21 Systeme a base de raav pour la disruption genique de cellules somatiques WO2005062812A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US53175103P 2003-12-22 2003-12-22
US60/531,751 2003-12-22

Publications (2)

Publication Number Publication Date
WO2005062812A2 true WO2005062812A2 (fr) 2005-07-14
WO2005062812A3 WO2005062812A3 (fr) 2005-09-09

Family

ID=34738691

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/042597 WO2005062812A2 (fr) 2003-12-22 2004-12-21 Systeme a base de raav pour la disruption genique de cellules somatiques

Country Status (1)

Country Link
WO (1) WO2005062812A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2814969A4 (fr) * 2012-02-10 2016-02-17 Univ Minnesota Assimiliation de l'adn

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474935A (en) * 1990-05-23 1995-12-12 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus (AAV)-based eucaryotic vectors
US5948653A (en) * 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
US6274354B1 (en) * 1996-09-06 2001-08-14 The Trustees Of The University Of Pennsylvania Methods using cre-lox for production of recombinant adeno-associated viruses

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474935A (en) * 1990-05-23 1995-12-12 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus (AAV)-based eucaryotic vectors
US6274354B1 (en) * 1996-09-06 2001-08-14 The Trustees Of The University Of Pennsylvania Methods using cre-lox for production of recombinant adeno-associated viruses
US5948653A (en) * 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2814969A4 (fr) * 2012-02-10 2016-02-17 Univ Minnesota Assimiliation de l'adn

Also Published As

Publication number Publication date
WO2005062812A3 (fr) 2005-09-09

Similar Documents

Publication Publication Date Title
Kohli et al. Facile methods for generating human somatic cell gene knockouts using recombinant adeno‐associated viruses
Miller et al. Human gene targeting by adeno-associated virus vectors is enhanced by DNA double-strand breaks
JP2023081975A (ja) アデノ随伴ウイルスベクターの産生方法
EP3219799A1 (fr) Expression sgrna crispr conditionnelle
EP3494997B1 (fr) Protéines de liaison à l'adn inductibles, outils de perturbation du génome et leurs applications
AU2019226527A1 (en) Closed-ended DNA (ceDNA) vectors for insertion of transgenes at genomic safe harbors (GSH) in humans and murine genomes
JP2001506132A (ja) Ａａｖベクターの産生における使用のためのリコンビナーゼ活性化可能ａａｖパッケージングカセット
KR20170096999A (ko) 신규한 cho 통합 부위 및 이의 용도
EP3310369B1 (fr) Vecteurs viraux à limitation automatique codant pour des nucléases
US20060246422A1 (en) Methods and compositions for use in spliceosome mediated RNA trans-splicing
CA3068072A1 (fr) Procedes et compositions pour evaluer une disruption ou une excision mediee par crispr/cas et une recombinaison induite par crispr/cas a l'aide d'un acide nucleique donneur exogene in vivo
IL148152A (en) DNA recombination with a unique sequence in eukaryotic cells
US20230102342A1 (en) Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use
US20220154223A1 (en) Nucleic acid constructs for simultaneous gene activation
WO2005062812A2 (fr) Systeme a base de raav pour la disruption genique de cellules somatiques
KR20220018410A (ko) 세포질에서 자가전사가 가능하고 유전체 편집을 제공하는 rna/dna 시스템
WO2020117992A9 (fr) Systèmes de vecteurs améliorés pour l'administration de protéine cas et de sgrna, et leurs utilisations
JP5999602B2 (ja) 遺伝子ターゲティングベクター、その作製方法及び利用方法
WO2023240162A1 (fr) Vecteurs aav pour l'édition de gènes
WO2023086889A1 (fr) Procédés de ciblage de cellules mutantes
CA3238939A1 (fr) Modele de maladie impliquant une myociline mutante et ses utilisations
WO2024047587A1 (fr) Compositions cas-phi et méthodes d'utilisation
WO2023225662A2 (fr) Systèmes protac-cid destinés à être utilisés dans la régulation de gènes multiplex
WO2023220654A2 (fr) Compositions de protéines effectrices et procédés d'utilisation associés
Class et al. Patent application title: RECOMBINANT VIRUS AND PREPARATIONS THEREOF Inventors: Feng Zhang (Cambridge, MA, US) Feng Zhang (Cambridge, MA, US) Mark D. Brigham (Somerville, MA, US) Le Cong (Cambridge, MA, US) Le Cong (Cambridge, MA, US) Silvana Konermann (Zurich, CH)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase