WO2005058142A2 - Diabetes diagnostic - Google Patents

Abstract

A method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance is provided. The method is performed by identifying an expression profile typical of Type II diabetes in which selected genes are upregulated and/or selected genes are downregulated. This expression profile correlates with an A3243G mutation level of 10% to 55%.

Description

DIABETES DIAGNOSTIC CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional application serial no. 60/530068 filed December 16, 2003, incorporated herein to the extent not inconsistent herewith.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under NIH grants NS21324 and AG13154. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[0003] One of the most puzzling aspects of mitochondrial disease is that certain mtDNA mutations can be associated with a wide range of seemingly unrelated clinical phenotypes. This has been correlated with differences in the percentage of mutant mtDNAs present in different patients. However, the distribution of the percentage of mutant mtDNAs can be continuous among heteroplasmic individuals, while individual phenotypes are discontinuous. The best known example of this phenomenon is seen for the common tRNA^Leu(UUR) A to G mutation at nucleotide pair (np) 3243. Prior investigators have found that when this mutation is present in patient's cells at 10% to 30% heteroplasmy in blood (likely higher in post-mitotic tissues), it is associated with Type II diabetes mellitus, with or without sensory neural hearing loss (van den Ouweland, J.M. et al., "Mutation in mitochondrial tRNA^Leu(UUR) gene in a large pedigree with maternally transmitted Type II diabetes mellitus and deafness," Nature Genetics 1 , 368-371 (1992)). However, when this same mutation is present in over 70% of a patient's mtDNAs, it is associated with life threatening mitochondrial encephalomyopathy (Goto, Y., Nonaka, I. and Horai, S. A., "Mutation in the tRNA^Leu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies," Nature 348, 651-653 (1990); Ciafaloni, E. et al., "Widespread tissue distribution of a tRNA^Leu(UUR) mutation in the mitochondrial DNA of a patient with MELAS syndrome," Neurology 41 , 1663-1665 (1991)) which can encompass a plethora of clinical symptoms including mitochondrial myopathy, opthalmoplegia, cardiomyopathy, or the MELAS syndrome (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes). Yet, diabetes mellitus is not commonly observed in these later cases.

[0004] Diabetes mellitus has been associated with mtDNA rearrangement mutations (Ballinger, S.W. et al., "Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion," Nature Genetics 1 , 11-15 (1992); Ballinger, S.W., Shoffner, J.M., Gebhart, S., Koontz, D.A. and Wallace, D.C., "Mitochondrial diabetes revisited," Nature Genetics 7, 458-459 (1994)), a control region np T16189C polymorphism (Poulton, J. et al., "Type II diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study," Human Molecular Genetics 11 , 1581-1583 (2002)), and the tRNA^Leu(UUR) A3243G mutation at low heteroplasmy levels (van den Ouweland, J.M. et al., "Mutation in mitochondrial tRNA^Leu(UUR) gene in a large pedigree with maternally transmitted Type II diabetes mellitus and deafness," Nature Genetics 1 , 368-371 (1992)). In fact, the A3243G mutation has been reported to account for 0.5 to 1 % of all Type II diabetes worldwide (Poulton, J. et al., "Type II diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study," Human Molecular Genetics 11 , 1581-1583 (2002); Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common Diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)). Patients harboring mtDNA rearrangements or the A3243G mutation can exhibit insulin resistance before becoming insulin dependent (Gebhart, S.S., Shoffner, J.M., Koontz, D., Kaufman, A. and Wallace, D., "Insulin resistance associated with maternally inherited diabetes and deafness, "Metabolism 45, 526-531 (1996)). Insulin resistant patients have been found to have systemic defects in mitochondrial oxidative phosphorylation (OXPHOS) by ³¹P NMR spectroscopy (Petersen, K.F., Dufour, S., Befroy, D., Garcia, R. and Shulman, G.I., "Impaired mitochondrial activity in the insulin-resistant offspring of patients with Type II diabetes," N Engl J Med 350, 664-71 (2004)), and to have an approximately 20% overall reduction in nuclear DNA (nDNA) mitochondrial gene expression as assessed by Affymetrix oligonucleotide microarray analysis (Mootha, V.K. et al., "PGC-1 alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes," Nat Genet 34, 267-73 (2003); Patti, M.E. et al., "Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1 ," Proc Natl Acad Sci U S A 100, 8466-71 (2003)).

[0005] In contrast to diabetes, the MELAS syndrome is seen in patients with a much higher percentages of A3243G mtDNA, in excess of 70% in affected tissues (Heddi, A., Stepien, G., Benke, P.J. and Wallace, D.C., "Coordinate induction of energy gene expression in tissues of mitochondrial disease patients," Journal of Biological Chemistry 274, 22968-22976 (1999); (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)). Studies of transmitochondrial somatic cell cybrids harboring percentages of the A3243G mutation over 90% exhibit a marked reduction in mitochondrial oxygen consumption. This loss in respiratory function has been proposed to result from a defect in the processing of the tRNA^Leu(UUR)-ND1 transcript (King, M.P., Koga, Y., Davidson, M. and Schon, E.A., "Defects in mitochondrial protein synthesis and respiratory chain activity segregate with the tRNA^Leu(UUR) mutation associated with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes," Molecular and Cellular Biology 12, 480-490 (1992)), inhibition of mitochondrial protein synthesis and/or misincorporation of amino acids into mitochondrial proteins (Helm, M., Florentz, C, Chomyn, A. and Attardi, G., "Search for differences in post-transcriptional modification patterns of mitochondrial DNA-encoded wild-type and mutant human tRNALys and _tRNA ^Leu₍uu^R) „ _Nuci_ej_c Acids Research 27, 756-763 (1999); Borner, G.V. et al., "Decreased aminoacylation of mutant tRNAs in MELAS but not in MERRF patients, " Hum Mol Genet 9, 467-75 (2000); Chomyn, A., Enriquez, J.A., Micol, V., Fernandez- Silva, P. and Attardi, G., "The mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode syndrome-associated human mitochondrial tRNALeu(UUR) mutation causes aminoacylation deficiency and concomitant reduced association of mRNA with ribosomes," Journal of Biological Chemistry 275, 19198-19209 (2000)); or a failure to appropriately modify a base in the tRNA^Leu(UUR) anti-codon (Yasukawa, T., Suzuki, T., Ueda, T., Ohta, S. and Watanabe, K., "Modification defect at anticodon wobble nucleotide of mitochondrial tRNAs^(Leu)(UUR) with pathogenic mutations of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes," Journal of Biological Chemistry 275, 4251-4257 (2000)). However, none of these proposals provide an explanation for why different percentages of the A3243G mutation result in different phenotypes.

[0006] The mitochondrial genome is composed of approximately 1500 genes, 37 encoded by the mtDNA and the remainder dispersed across the nuclear DNA (nDNA). The genes of the mtDNA include the 12S and 16S rRNAs, 22 tRNAs and 13 essential subunits of OXPHOS. The 13 mtDNA subunits include ND1 , 2, 3, 4L, 4, 5, 6 of the 46 polypeptides of complex I (NADH dehydrogenase); cytochrome b of the 11 subunits of complex III (bci complex); COI, II, III of the 13 subunits of complex IV (cytochrome c oxidase), and ATPase 6 and 8 of the 15 subunits of complex V (ATP synthase).

[0007] The pathophysiology of mitochondrial disease is currently thought to involve the interaction of three physiological processes of the mitochondrion: production of energy by OXPHOS, generation of most of the endogenous cellular reactive oxygen species (ROS) as a toxic by-product of OXPHOS, and initiation of programmed cell death (apoptosis) via activation of the mitochondrial permeability transition pore (mtPTP) in response to declining mitochondrial energy charge and increased oxidative stress (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases, (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)). These processes are intimately interrelated within the mitochondrion and perturbation of one process, say energy metabolism, can be associated with changes in the expression of the genes that regulate the other processes such as anti-oxidant defenses and apoptosis (Murdock, D., Boone, B.E., Esposito, L. and Wallace, D.C, "Upregulation of nuclear and mitochondrial genes in the skeletal muscle of mice lacking the heart/muscle isoform of the adenine nucleotide translocator," Journal of Biological Chemistry 274, 14429-14433 (1999)). Hence, an explanation for the anomalous correlation between mtDNA genotype and phenotype is that changes in the percentage of the A3243G mutation cause a progressive change in the cellular physiology, but that the cell can only respond to changes in physiological state with a limited number of adjustments in gene expression profile. As a result, the patient's phenotype appears to change abruptly when the cell passes a physiological threshold and switches from one gene expression state to another.

[0008] Type II diabetes is known to be much more likely to be inherited from an affected mother than an affected father (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)), mtDNA rearrangement (Ballinger, S.W. et al., "Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion," Nature Genetics 1 , 11-15 (1992); Ballinger, S.W., Shoffner, J.M., Gebhart, S., Koontz, D.A. and Wallace, D.C, "Mitochondrial diabetes revisited," Nature Genetics 7, 458-459 (1994))., A3243G base substitution (van den Ouweland, J.M. et al., "Mutation in mitochondrial tRNALeu(UUR) gene in a large pedigree with maternally transmitted Type II diabetes mellitus and deafness," Nature Genetics 1 , 368-371 (1992)), and control region (Poulton, J. et al., "Type II diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study," Human Molecular Genetics 11 , 1581-1583 (2002)) mutations have all been linked to Type II diabetes.

[0009] The A3243G mutation has been reported to account for up to 1 % of Type II diabetes worldwide (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)). Patients harboring the mtDNA diabetes rearrangement or A3243G mutations have been shown to initially present with insulin resistance (Gebhart, S.S., Shoffner, J.M., Koontz, D., Kaufman, A. and Wallace, D., "Insulin resistance associated with maternally inherited diabetes and deafness," Metabolism 45, 526-531 (1996)), and mitochondrial energetics, as assessed by ³¹P-MR spectroscopy, is impaired in the insulin-resistant offspring of Type II diabetics (Petersen, K.F., Dufour, S., Befroy, D., Garcia, R. and Shulman, G.I., "Impaired mitochondrial activity in the insulin-resistant offspring of patients with Type II diabetes," N Engl J Med 350, 664-71 (2004)). Finally, transgenic mouse models affecting mitochondrial ATP production or ATP signaling in the pancreatic β-cells result in diabetes (Silva, J.P. et al., "Impaired insulin secretion and beta-cell loss in tissue-specific knockout mice with mitochondrial diabetes," Nature Genetics 26, 336-340 (2000); Koster, J.C, Marshall, B.A., Ensor, N., Corbett, J.A. and Nichols, C.G., "Targeted overactivity of beta cell K(ATP) channels induces profound neonatal diabetes," Cell 100, 645-654 (2000); Wallace, D.C, "Mouse models for mitochondrial disease," American Journal of Medical Genetics 106, 71-93 (2001)). Taken together, these observations show that Type II diabetes mellitus is caused by mild, systemic, defects in mitochondrial energy metabolism (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)).

[0010] All publications referred to herein are incorporated by reference to the extent not inconsistent herewith.

SUMMARY OF THE INVENTION

[0011] This invention provides a method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance. Type II diabetes is a mild form of diabetes mellitus that develops gradually in adults. It can be precipitated by obesity or severe stress or menopause or other factors and can usually be controlled by diet and hypoglycemic agents without injections of insulin. Insulin resistance is when the body produces enough insulin but does not adequately respond to or use the insulin it produces.

[0012] The term "likely to have Type II diabetes or insulin resistance" means that there is about a 10% to about a 20% chance that the patient has one of these conditions. The term "at risk for developing Type II diabetes or insulin resistance" means having at least about a 10% chance, preferably about a 10% to about 20% chance, of developing one of these conditions. Insulin resistance refers to the body's inability to respond to and use insulin.

[0013] The method comprises identifying, in a sample derived from a patient, upregulation of expression of selected genes, or downregulation of selected genes, or both. The term "gene" as used herein includes gene fragments and expressed sequences identified by the probes described herein as more fully described in the Tables hereof. [0014] A sample derived from a patient, as known to the art, can be any bodily fluid or tissue. The sample must contain gene expression products such as RNA, cDNA, or proteins or polypeptides. The sample can be tissue, blood, urine, cerebral spinal fluid (CSF), sputum, semen, cervicovaginal swab, intestinal wash, or other sample known to the art containing gene expression products. Pancreatic tissue is a preferred tissue. The sample as taken from the patient is preferably a cell-containing sample. The sample derived from the patient which is tested in the method of this invention may be a fluid or fraction extracted from the original sample taken from the patient, or a portion of the original sample. The sample derived from the patient may also be a cell culture of the patient's cells, or of hybrid cells constructed from the patient's cells, or cybrid cells as described herein.

[0015] Genes having upregulated expression in patients likely to have, or at risk of developing, Type II diabetes or insulin resistance include the following: NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs and EST similar to CH60 60 kD HSP (See Table 2A).

[0016] Genes having downregulated expression in such patients include the following: ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4 (See Table 3A).

[0017] The upregulation and downregulation described above are associated with mutation levels of A3243G. Specifically, the inventors have found that mutation levels in the following ranges: from about 10% to about 55%, about 25% to about 55%, about 25% to about 50 percent, or above 30% to about 55%, e.g. about 31 % to about 55%, give rise to expression profiles in which upregulation and downregulation are as described above. [0018] Detecting upregulation of expression means detecting increased presence in the sample of expression products of genes. Detecting downregulation of expression means detecting decreased presence in the sample of expression products of genes Preferably, the expression products are cDNA or RNA, although protein products may also be detected. For identifying upregulation and downregulation, a change of at least about 1.5-fold compared to normal is preferred, more preferably at least about 1.7-fold, and most preferably at least about 2-fold. Normal expression levels are those found in patients not having detectable A3243G mutation levels.

[0019] It is preferred that expression levels of at least three genes be tested in the methods of this invention. More preferably, expression levels of at least three genes should be tested for upregulation, and/or expression levels of at least three genes should be tested for downregulation. Preferred genes for testing upregulation include NDUFB3, ATP5F1 , ANT2, CYC, TXNRD1 and HSPA9B, more preferably, TXNRD1 , NDUFB3, and CYC. Preferred genes for testing downregulation include NDUFV2, GSPC, MTHFD2, GYS1 , HYAL3, APAF1 and CASP6, more preferably, GSPC, APAF1 , and MTHFD2. The genes whose expression levels are tested can include any gene described herein as being upregulated or downregulated when A3243G mutation levels are within the above-described ranges, or any other gene which is upregulated or downregulated in patients having Type II diabetes.

[0020] Detection of expression levels can be performed by any means known to the art. Preferably, detection includes contacting the sample with an array comprising nucleic acid sequences identifying genes selected for identifying upregulation and/or genes selected for identifying downregulation. Arrays are described, e.g., in PCT Patent Publication No. WO 03/020220, "Mitochondrial Biology Expression Arrays," Wallace, Douglas C. et al., inventors, published March 13, 2003, incorporated herein by reference to the extent not inconsistent herewith. Arrays including large numbers of probes, such as described in Table 1 , or the human MITOCHIP described in said PCT publication, may be used, or arrays containing only probes capable of identifying genes whose expression is altered in patients having Type II diabetes may be used. [0021] The array preferably comprises nucleic acid sequences identifying the following genes: NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs, EST similar to CH60 60 kD HSP, ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4. The nucleotide sequences may be or include those listed in Tables 2 and 3, or alternatively may be or include any other sequences that identify these genes. Such identifying sequences may be obtained by those skilled in the art without undue experimentation.

[0022] Patients who have been identified by the methods of this invention as likely to have, or at risk for developing, Type II diabetes, or insulin resistance can then be counseled on diabetes prevention and management, including counseling on diet, weight control, and exercise. Further tests, including periodic follow-up tests, for diabetes can also be undertaken.

[0023] This invention also provides a nucleotide array consisting essentially of nucleotide sequences identifying at least three genes selected from the group consisting of NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs, EST similar to CH60 60 kD HSP, and/or at least three genes selected from the group consisting of ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4. Sequences identifying any other genes whose expression is known to be altered in patients having Type II diabetes may also be included. The array may include sequences identifying all of said genes, or any subset of sequences identifying at least three of said genes. For example, the array may include only sequences for identifying genes that are upregulated in patients having Type II diabetes, or only sequences for identifying genes that are downregulated in patients having Type II diabetes, or subsets of these categories, or any combination of sequences identifying genes from each category, provided it includes at least three genes. The term "consisting essentially of as used in this context means not including sequences identifying genes whose expression does not change in patients having Type II diabetes.

[0024] The arrays of this invention may be part of a system including means for reading and analyzing the results of hybridization of sample components to the array, such additional components being known to the art, for example as described in PCT Publication No. WO 03/020220.

[0025] This invention also provides a method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance, comprising testing a sample derived from said patient for percent A3243G mutations present in the sample by identifying an expression profile of genes in said sample associated with Type II diabetes or insulin resistance. The expression profile may be associated with about varying levels of A3243G mutations, such as about 10% to about 55%; about 25% to about 50% or 55%, or more than 30%, e.g. about 31 % or about 35% to about 50% or about 55%.

[0026] In one embodiment of this invention, a method is provided for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance, comprising identifying in a sample derived from said patient an A3243G mutation level of greater than 30%, e.g., about 31 % or about 35% to about 50% or 55%. This mutation level may be determined by methods known to the art, by identifying an expression profile characteristic of these mutation levels, or by pyrosequencing nucleic acid derived from the sample or performing FRET RT-PCR on nucleic acid derived from the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1. Comparison of samples assayed via pyrosequencing and FRET qRT-PCR analysis.

[0028] Figure 1 A. Pyrogram demonstrating the level of A3243A to A3243G heteroplasmy in two cybrid cell lines, DW5 (Figure A1) and DW7 (Figure A2). The SNP is an A to G transition at mtDNA np 3243. The presence and level of each base is determined by the level of pyrophosphate-generated light emitted after sequential addition of each base to the template and annealed primer. DW5 was found to harbor 25% and DW7 55% A3243G mtDNA.

[0029] Figure 1 B. FRET qRT-PCR melting profile curves showing the relative increase in fluorescence following the melting of the heteroduplexes (left) and homoduplexes (right) as the temperature was increased. In this experiment the FITC probe was homologous to the A3243A (wild type) base. The results for two cybrids DW5 and DW7 are shown together with mixtures of cloned mutant and wild type mtDNA containing 100%, 50% and 30% A3243G mutant as referenced in this analysis. DW5 was determined to contain 30% mutant mtDNAs while DW7 contained 50%.

[0030] Figure 2. Mean relative expression levels and hierarchical clustering of the individual genes from the MITOCHIP seen for the 0, 25%, 55%, 70% cybrids and the 143B TK^" p° cell line. Each horizontal bar represents one gene, where a red bar indicates that the gene was upregulated and a blue bar indicates that the gene was downregulated relative to 143B TK^" p⁺. Each column provides the individual expression values for all of the MITOCHIP genes (see Table 1) for one cell line. The dendrogram on the left demonstrates the relatedness of the gene expression changes to one another. The dendrogram on the top illustrates the relatedness of all of the gene expression changes in each cell line to the other experimental cell line. Four coordinate expression groups are labeled as follows:

[0031] A: Selected upregulated genes at 25 and 55% A3243G mutant.

[0032] B: Selected downregulated genes at 25 and 55% A3243G mutant. [0033] C: Selected upregulated genes at 70% A3243G mutant and in the ρ° cell line.

[0034] D: Selected downregulated mtDNA genes at 70% A3243G mutant and in the p° cell line.

[0035] Data for these selected genes is set forth in Table 4.

[0036] Figure 3. Quantification of complex I mtDNA mRNAs for NADH dehydrogenase subunits ND2, 4L, 5 and 6 by qRT-PCR for the 0, 25, 55, and 70% A3243G cybrids. Levels of mtDNA transcripts were normalized to the GAPDH mRNA levels. The mtDNA levels are reported as percentages of the transcript levelσ oφ 143B (TK-) p⁺. The error bars represent standard deviation from four independent determinations.

DETAILED DESCRIPTION OF THE INVENTION

[0037] Patients harboring the mitochondrial DNA (mtDNA) tRNA^Leu(UUR) nucleotide pair A3243G mutation can present with diabetes if up to 50% to 55% of their mtDNAs are mutant. When more than 70% of their mtDNAs are mutant, patients can present with mitochondrial encephalomyopathy. Cybrid cell lines harboring 0%, 25%, 55%, and 70% mutant (A3243G) mtDNAs were prepared and their MITOCHIP microarray expression profiles compared. This revealed that the mitochondrial gene expression profile underwent two changes in state: one between 0 and 25% A3243G mtDNAs and the other between 55 and 70% A3243G mtDNAs. Cell lines with 25-55% A3243G mtDNA exhibited a partial reduction in various nuclear DNA transcripts including multiple oxidative phosphorylation genes. By contrast, cell lines with 70% mutant exhibited a partial restitution of the expression of most of these downregulated genes, but a dramatic downregulation of the mtDNA gene transcripts. Quantitative Real time- PCR confirmed that mtDNA complex I subunit transcripts were mildly downregulated in 25 to 55% A3243G mtDNA cell lines, but were precipitously downregulated 62 to 75 % in the 70% A3243G cell line. A3243G diabetes is a mild mitochondrial disease that can transition to severe encephalomyopathy though the shutdown of mtDNA gene expression. EXAMPLES [0038] The invention will be further understood by the following non-limiting examples.

[0039] To assess the effect of changing physiological condition on the mitochondrial gene expression profile, a custom cDNA-based mitochondrial microarray was developed, referred to herein as a MITOCHIP (see Table 1 and PCT Patent Publication No. WO 03/020220, "Mitochondrial Biology Expression Arrays," Wallace, Douglas C. et al., inventors, published March 13, 2003, incorporated herein by reference.) This chip encompasses approximately 646 genes including most of the known mtDNA and nDNA genes involved in mitochondrial biogenesis, bioenergetics, oxidative stress biology and apoptosis.

TABLE 1

MITOCHIP FOR DETECTION OF EXPRESSED GENES

Unless otherwise specified, the Clone IDs are for IMAGE clones, publicly available through Open Biosystems, www.openbiosystems.com.

² The CNT-b-actin clone was PCR-amplified from human mtDNA Using 5' and 3' sequences from either end of the gene. ³ Clones with "mt" identifiers identify genes encoded by mitochondrial DNA. There are 15 in all, 13 protein-encoding genes and 2 rRNA-encoding genes. These were PCR-amplified from human mtDNA using 5' and 3' sequences from either end of the gene. See Seq ID Nos. 18-32.

[0040] This MITOCHIP was used to monitor changes in mitochondrial gene expression in transmitochondrial cybrid cell lines having different percentages of the A3243G mutation. This analysis revealed that 129 genes were differentially expressed and that the mitochondrial gene expression profile had three distinct states: normal seen in the 0% A3243G cell line, partial downregulation or upregulation of several groups of nDNA-encoded mitochondrial genes between 25 and 55% A3243G, and the virtual shut down of all mtDNA-encoded genes in cells with 70% A3243G mtDNAs. Hence, it appears that the striking difference in the phenotype of patients harboring differences in the level of the A3243G mutation is the product of specific, semi-stable, transitions in the expression of an array of mitochondrial genes in response to increasing metabolic impairment in the cell.

MATERIALS AND METHODS

Cell Lines, Fusions and Conditions

[0041] The 143B TK^" cells were passaged in Dulbecco's modified Eagle's medium (DMEM) with high glucose (4.5 mg/ml) supplemented with 10% fetal bovine serum (FBS). Media for the p° cell line was supplemented with 50 μg/ml uridine and 1mM pyruvate. The heteroplasmic A3243A/G patient's (Heddi, A., Stepien, G., Benke, P.J. and Wallace, D.C, "Coordinate induction of energy gene expression in tissues of mitochondrial disease patients," Journal of Biological Chemistry 274, 22968-22976 (1999)) Epstein-Barr Virus transformed lymphoblastoid cell line was passaged in RPMI 1640 medium supplemented with 15% heat-inactivated FBS, 0.2% (w/v) glucose, 50 μg/ml uridine and 1mM pyruvate. Mitochondrial donor cell lines were enucleated using a Percoll gradient with 20 ug/ml cytochalasin B and the heteroplasmic cytoplasts fused to 143B TK^" p° cell lines by electric shock (Trounce, I., Neill, S. and Wallace, D.C, "Cytoplasmic transfer of the mtDNA nt 8993 TG (ATP6) point mutation associated with Leigh syndrome into mtDNA-less cells demonstrates cosegregation with a decrease in state III respiration and ADP/O ratio," Proceedings of the National Academy of Sciences of the United States of America 91 , 8334-8338 (1994)). Cybrid clones were isolated and the DNA extracted using a Puregene DNA isolation reagents (Gentra, Minneapolis, MN). The 143B TK^" nDNA origin was confirmed by using the short tandem repeat loci DS13S317, DS16S539, D5S818, D7S820 and the patient origin of the mtDNA was confirmed using the 143B TK^" Mbo I polymorphisms at np A15397G (Trounce, I. et al., "Cloning of neuronal mtDNA variants in cultured cells by synaptosome fusion with mtDNA- less cells," Nucleic Acids Research 28, 2164-2170 (2000)).

Analysis of 3243 tRNA^leu(UUR) Heteroplasmy

[0042] Cybrid clones were assayed for their percentage A3243A/G mtDNAs by pyrosequencing and by FRET RT-PCR. Genomic DNA was isolated using Puregene extraction kit (Gentra, Minneapolis, MN). Standard curves were prepared in both methods by mixing A3243A and A3243G DNA PCR fragments amplified from cloned DNA using primers 5'-CCCGATGGTGCAGCCGC-3' [SEQ ID NO:1] and 5'- GCGTTACCGTAAGGATTACG-3' [SEQ ID NO:2]. The concentration of purified fragments (Qiagen, Valencia, CA) was determined using PicoGreen according to the manufacturer (Molecular Probes, Eugene Oregon).

[0043] To determine the level of A3243A/G heteroplasmy by pyrosequencing, DNAs were PCR amplified with a 5' primer (5'- CCCACACCCACCCAAGAAC - 3' [SEQ ID NO:3]) and the 3' primer biotinylated

(AGATTAGCGTTACCGTAAGGATTA/5Bio - 5' [SEQ ID NO:4]) using 30 cycles of 94° C for 30 sec, 55° C for 30 sec and 72° C for 60 sec. PCR products were purified using streptavid in-conjugated magnetic beads (Pyrosequencing, Inc., Uppsala, Sweden). The primer (5' - GGTTTGTTAAGATGGCAG - 3' [SEQ ID NO:5]) was then annealed at 95°C for 10 minutes and the A3243A/G nucleotide base determined by primer extension and allele quantification using Pyrosequencing, Inc. (Uppsala, Sweden) software.

[0044] To determine the level of heteroplasmy by the FRET RT-PCR procedure, the region encompassing PCR fragments were annealed to the fluorescein isothiocyanate (FITC) bound probe (5'-

TCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGG - FITC - 3' [SEQ ID NO:6]) and the LCRed 640 quenching probe (3' -

GCTAATGGCCCGAGACGGTAGAATTGTTT - LCRed 640-5' [SEQ ID NO:7]) (Roche Hybridization Probe Kit, Roche, Manheim, Germany). Depending on the assay, either A3243G (mutant) or A3243A (wild type) (underlined base) quenching probes were used. The amplification cycle included one denaturation cycle of 95°C for 30 sec and 35 amplification cycles of 0 sec at 95°C, 7 sec at 55°C, and 10 sec at 72°C The resulting homoduplexes and heteroduplexes were then melted using a cycle of 0 sec at 95°C, 180 sec at 57°C, and 95°C with a 0.2 C°/sec slope and step acquisition. The peak heights of released fluorescence for the heteroduplexes (left) and homoduplexes (right) were measured and the ratios compared to those obtained from standard curves.

Microarray Cell Culture and RNA extraction

[0045] Cybrid cell lines were grown at 37°C until approximately 80% confluency and 1 x 10⁶ cells used for heteroplasmy determination. The remaining cells were lysed for RNA extraction by Trizol reagent (Invitrogen, Carlsbad, CA), and purified after DNase RNAse free (Roche, Mannheim, Germany) treatment with RNeasy columns (Qiagen, Valencia, CA). cDNA was synthesized from total RNA using the SuperScriptTM first-strand cDNA synthesis (Life Technologies, Inc.).

MITOCHIP Microarray Construction

[0046] Sequence-verified cloned human cDNAs/genes (Table 1) were selected from IMAGE clone sets, based on their relevance to mitochondrial function, reactive oxygen species biology, and apoptosis (Supplemental material). The 15 mtDNA transcripts (rRNAs 12S and 16S and 13 mRNAs) were included after PCR amplification from human mtDNA templates. The PCR products were resuspended in 40 μl VMSR buffer A (Vanderbilt Microarray Shared Resource, Nashville, TN) to 400 to 700 μg/ml and the PCR products quality verified by gel electrophoresis (Hegde, P. et al., "A concise guide to cDNA microarray analysis," Biotechniques 29, 548-50, 552-4, 556 passim (2000)) and spotted from 384 well plates onto polylysine- coated glass slides (Cell Associates, Pearland, TX) using a BioRobotics MicroGrid II microarray printing robot (Apogent Discoveries, Hudson, NH). DNAs were crosslinked to the slides using 80 joules of ultraviolet energy (Stratagene Stratalinker, La Jolla, CA), followed by baking for two hours at 70°C

RNA Labeling and MitoChip Hybridization

[0047] Hybridization probes were prepared from 10 μg of total RNA by annealing 6 μg of anchored oligo-dT primers, 70° C for 10 minutes followed by 10 minutes at 4°C Reverse transcription was then run at 42°C for 2 hours in a 30 μl reaction mix of 50 mM Tris-HCI (pH 8.3), 75 mM KCI, 3 mM MgCI₂, 10 mM dithio-threatol, 200 μM each of dATP, dGTP, dCTP and 51 μM dTTP, 149 μM amino-allyl-UTP (Sigma, St. Louis, MO) and 200U Superscript II reverse transcriptase (Life Technologies, Gaithersburg, MD). The RNA was hydrolyzed by adding 10 μl of 1 M NaOH and 10 μl of 0.5M EDTA, incubated at 70° C for 10 minutes, and neutralization with 10 μl of 1 M HCI. The cDNAs were purified using Qiagen PCR cleanup kit (PCR Cleanup kit, Qiagen, Valencia, CA) substituting of 80% ethanol for the Qiagen PE buffer and water for Qiagen's EB buffer. Probe cDNAs were desiccated, resuspended in 7 μl 0.1 M sodium bicarbonate buffer, chemically coupled to reactive cyanine dyes (Amersham Biosciences, Buckinghamshire England) and unbound cyanine dyes were removed using Qiagen PCR cleanup kits. Equal amounts of Cy3-Cy5 probes were mixed, desiccated and resuspended in 30 μl hybridization buffer (25% formamide, 5x SSC, 0.1 % SDS, 10 μg yeast tRNA, 10 μg poly A RNA, 1 μg human COT-1 DNA).

[0048] MITOCHIP arrays were prehybridized in 5x SSC, 1% SDS, and 1% BSA at 55°C for 45 minutes, washed in distilled H₂0, rinsed in isopropanol, and dried with a brief centrifugation. The Cy3-Cy5 labeled cDNA probes were denatured at 95°C for two minutes, spread over the cDNA array, and the slides incubated in a hybridization chamber (Corning, Acton, MA) at 42°C for 16 hours. After hybridization, the arrays were rinsed in 2X SSC, washed in 2X SSC/0.1% SDS at 55°C with agitation for 5 minutes, followed by two successive 5 minutes 1X SSC and 0.1X SSC washes at room temperature. The arrays were dried by centrifugation at 50 g for 5 minutes and scanned using a GenePix 4000B microarray scanner (Axon Instruments, Union City, CA).

[0049] The GenePix data were imported into Genespring 5.0.2 (Silicon Genetics, Redwood City, CA), the results from the three independent arrays for each cell line were combined, and a lowest normalization utilized for all samples. A value of twice background was established as being usable data.

qRT-PCR Verification of Microarray Results

[0050] The same RNA pools used for microarray analysis were used to quantify mtDNA transcript level by qRT-PCR. First strand cDNA synthesis was then performed using the SuperScriptTM kit (Life Technologies, Inc.), and qRT-PCR performed using the LightCycler DNA Master SYBR Green kit in a Light Cycler (Roche Molecular Biochemicals). Real-time mtDNA mRNA levels were normalized to a GAPDH amplicon and the results compared to a standard curve. Oligonucleotide forward and reverse primers used for ND2 were (5'-gccctagaaataaacatgcta-3' [SEQ ID NO:8], 5'-gggctattcctagttttatt-3' [SEQ ID NO:9]), ND5 (5'-tcatcgaaaccgcaaacata-3' [SEQ ID NO:10], 5'-tgctagggtagaatccgagt-3' [SEQ ID NO:11]), ND4L (5'- cgactcattaaattatg-3 [SEQ ID NO:12]', 5'-ctccaacacatatggcc-3' [SEQ ID NO:13]), ND6 (5'-gattgttagcggtgtggtcg-3 [SEQ ID NO:14]', 5'-atcctcccgaatgaaccctg-3' [SEQ ID NO: 15]) and GAPDH (5'-atgtgggccatgaggtccac-3' [SEQ ID NO: 16], 5'- agaaggtggtgaagcaggcgtc-3' [SEQ ID NO:17]). The results from four independent amplifications for each sample were combined for statistical analysis.

RESULTS

Heteroplasmic tRNA^Leu(UUR) A3243G Cybrids

[0051] A series of transmitochondrial cybrid clones were prepared harboring different percentages of the A3243G mutation. Lymphocytes of a patient that was heteroplasmic for the A3243G mutation (Heddi, A., Stepien, G., Benke, P.J. and Wallace, D.C, "Coordinate induction of energy gene expression in tissues of mitochondrial disease patients," Journal of Biological Chemistry 274, 22968-22976 (1999)) were enucleated and the cytoplasts fused to the mtDNA-deficient (ρ°) osteoblastoma cell line, 143B TK (Trounce, I.A., Kim, Y.L., Jun, A.S. and Wallace, D.C, "Assessment of mitochondrial oxidative phosphorylation in patient muscle biopsies, lymphoblasts, and transmitochondrial cell lines," Methods in Enzymology 264, 484-509 (1996)). Individual cybrid clones were selected in bromodeoxyuridine and in medium lacking uridine, and the 143B TK^" origin of the nDNA and the patient origin of the mtDNA were confirmed by screening for the appropriate molecular genetic markers. Since the resulting cybrids all have the same 143B TK^" nuclear background as well as patient mtDNA background, all observed gene expression differences can be attributed solely to changes in the percentage of the mtDNAs with the wild type (A3243A) versus mutant A3243G tRNA^Leu(UUR).

[0052] The percentage of mutant mtDNAs was assayed in each cybrid clone by two independent methods: pyrosequencing and FRET Real-Time Polymerase Chain Reaction (FRET RT-PCR). Pyrosequencing measures the amount of pyrophosphate released by the incorporation of successive bases into DNA during primer extension. Using a primer ending 3' to the A3243G base, each of the four bases (dCTP, dGTP, dATP, and dTTP) was added sequentially and the amount of pyrophosphate released after each addition quantified. Using the two mutant cybrid cell lines DW5 and DW7 as examples (Figures A1 and A2), no incorporation was detected when dCTP or dTTP were added to the reactions. However, different levels of incorporation were seen when dGTP or dATP were added. Hence, the mtDNAs of these cell lines must have different percentages of the A3243A and A3243G bases. The proportion of these two mtDNA bases was then determined for each cell line by comparison with a standard curve. The data in Figure 1A revealed that DW5 harbored 25% and DW7 55% of the A3243G mtDNA.

[0053] FRET RT-PCR was also used to quantify the percentage of heteroplasmy. Two tagged probes were annealed at low stringency to PCR products encompassing the 3243A/G base position. The first probe, whose central base was equivalent to either the wildtype (A3243A) or mutant (A3243G) base, depending on experiment, bore the sensor fluor LCRed 640 bound to the 5' end. The second probe, which is homologous to the DNA sequence immediately adjacent to the 5' end of the sensor probe, bore a fluorescein isothiocyanate (FITC) attached to its 3' end. When the two probes annealed to the PCR product surrounding the 3243 base, the FITC and the LCRed 640 were brought into juxtaposition and the LCRed 640 suppressed the fluorescence of the FITC.

[0054] When using the wild type sensor probe (LCRed 640) and annealing under low stringency conditions, the probe would bind both to the wild type sequence to give a perfect homoduplex and to the mutant sequence to give a one base mismatch heteroduplex. In this situation, most of the FITC fluorescence would be suppressed. As the temperature was increase the sensor probes would melt off the templates and the FITC fluorescence would increase. Since a heteroduplex is less thermally stable than a homoduplex, the wild type mismatched sensor (LCRed 640) probe would melt off the mutant molecules first and the wild type second. This would generate two peaks of fluorescence, the first proportional to the number of mutant (A3243G) molecules and the second proportional to the number of wild type molecules (A3243A). By comparing the height of these fluorescent peaks to those generated from a standard curve, the percentage of normal and mutant mtDNAs could be determined. With this procedure, DW5 was determined to contain 30% mutant mtDNAs while DW7 contained 50% (Figure 1B).

[0055] Both pyrosequencing and the FRET RT-PCR gave reproducible values and similar results for each of the cell lines. Hence, we were able to reliably determine that B1 was 0% A3243G mutant, DW5 25% mutant, DW7 55% mutant and DW10 70% mutant.

MITOCHIP Expression Profiles on A3243A/G Cybrids

[0056] The mitochondrial gene expression profiles of the four (0, 25, 55, and 70% A3243G) cybrid lines plus the 143B(TK^") mtDNA-deficient (ρ°) cell line were surveyed using two-color hybridizations to the MITOCHIP using as a common reference the 143B(TK^") cell line with its endogenous mtDNA (p⁺). RNAs from all six cell lines were isolated and converted to cDNAs using reverse transcriptase and amino-allyl UTP. The amino-allyl UTP cDNAs of the 143B TK^" p⁺ reference cell line were then labeled with either Cy3 or Cy5 fluorescent dye, and the amino-allyl UTP cDNAs of one of the experimental cell lines (0, 25, 55, or 70% A3243G cybrids or 143B TK^" p° cell line) were labeled with the opposite fluorescent probe, Cy5 or Cy3. Equal amounts of the 143BTK^" p⁺ reference cDNA and the cybrid or p° cDNA were then combined and the mixture hybridized to the MITOCHIP. After washing, the MITOCHIPs were scanned to determine the ratio of the fluorescence bound to each cDNA spot from the experimental and reference cDNA preparations.

[0057] Three independent RNA extractions were prepared from each cell line and each RNA preparation was assayed on the MITOCHIP three times. For brevity, only those genes that were increased or decreased at least two-fold are shown in Tables 2 and 3 in bold face and underlined.

[0058] Co-hybridization of the 0% A3243G cybrid cDNA with the 143B (TK^") p⁺ reference cDNA revealed only nine genes that differed in expression level by twofold or more. This demonstrates that the patient's normal (3243A) mtDNA was not markedly different from the endogenous 143B (TK^") mtDNA, making the 143B (TK^") cell line an acceptable reference for this group of experiments.

[0059] The mRNAs of the 143B (TK^") p⁺ reference cell line were then compared to those of the 0, 25, 55, and 70% A3243G cybrids and the ρ° cell line. These results are presented graphically in a hierarchical clustering in Figure 2. The mtDNA genotype for each cell line is provided at the bottom of the column. Each column of colored bars represents the averaged results for the three determinations (nine experiments) for each cell line. Within each column, the blue bars indicate downregulated genes while the red bars indicate upregulated genes relative to 143B TK^" p⁺. The dendrogram on the left of the gene bars indicates the relative similarity in the hybridization results of the various genes for the different experimental cell lines. Fewer branches indicate more similar patterns of expression. The dendrogram above indicates the relative similarity of the MITOCHIP expression profiles for the different cybrid and p° cell lines.

[0060] The top dendrogram separates the experimental cell lines, into three classes: (1) the 0% A3243G cybrid, (2) the 25% and 55% A3243G cybrids, (3) and the 70% A3243G cybrid and p° cells. Comparing the 0% A3243G cybrid with the 25% plus 55% A3243G cybrids revealed that 12 genes were upregulated at least two-fold (Table 2A), the red bands in the middle to lower regions of the 25% and 55% columns (Figure 2B). These included the OXPHOS genes for cytochrome c, adenine nucleotide translocator (ANT), complex I subunit B12 (NDUFB3), complex V subunit b (ATP5F1), and the ubiquinone-binding protein (9.5 kD) (QP-C). Additional upregulated genes included the RNA metabolism gene for FMR1 (fragile X syndrome), mitochondrial phenylalanine tRNA synthase, the genes for the antioxidant enzymes thioredoxin reductase and glutathione S transferase, and the chaperone protein genes for HSP70 and homologues for GroES and HSP60.

[0061] Table 2 shows Upregulated Genes from the 3243G cybrids and 143B TK- p° microarray experiments. Table 1A shows upregulated genes at 25 and 55% 3243G mutant cybrids. Table 2B shows upregulated genes at 70% 3243G mutant cybrid and 143B TK- p°. The expression ratios of the different percentages of 3243⁺ heteroplasmy have been included. All genes that expressed more than 2-fold changes compared to the parental 143B cell line are in boldface italics and underlined indicating downregulated genes and in boldface and underlined indicating upregulated genes. All genes that expressed between 1.7- and 2-fold changes compared to the parental 143B cell line are in boldface italics indicating downregulated genes and in boldface indicating upregulated genes.

Table 2A Upregulated Genes 25-55% 3243G mutant cybrids

Table 2B Upregulated Genes 70% 3243G mutant cybrid and 143B TK^" ρ° cell line

[0062] Table 3 shows downregulated Genes from the 3243G mutant cybrids and 143B TK- p° microarray experiments. Table 3A shows downregulated genes at 25% and 55% 3243G mutant cybrids. Table 3B shows downregulated genes at 70% 3243G mutant cybrid and 143B TK- p°.

[0063] A group of 42 genes were downregulated between two- and six-fold in the 25% and 55% A3243G cybrid (Table 3A). These are represented by the two adjacent clusters of blue bars in the upper 1/3 of the 25% and 55% A3243G cybrid columns (Figure 2A). The four most strongly downregulated genes were acetyl-CoA acetlytransferase, acyl-coenzymeA acetyltransferase, carnitine/acycarnitine translocase, and malic enzyme, all genes involved in mitochondria energy metabolism. Additional downregulated genes for mitochondrial energy metabolism and protein processing included mtDNA ND3, complex I 24 kDa (NDUFV2) subunit, glutamate dehydrogenase, uncoupling protein 3, short branched chain-CoA dehydrogenase, L3-hydroxyl acetylCoA dehydrogenase, pyrophosphatase, TOMM70A (transport through the outer mitochondrial membrane polypeptide 70A) and the mitochondrial processing peptidase B. Downregulated genes for glycolysis included glycogen synthetase (GYS1) and glucose 6 phosphatase (G6PC); those for mitochondrial protein synthesis included mitochondrial ribosomal proteins S14 and L33, mitochondrial translation releasing factor 1 , and mitochondrial isoleucine tRNA synthetase; those involved in RNA and DNA processing included splicing factor 3b and the ataxia telangiectasia gene; and those involved in general metabolism included dihydroorotate dehydrogenase, methylene tetrahydrofolate reductase, coproporphorinogen oxidase, a chloride channel, hexosaminidase B and tropomyosin 4. Key downregulated genes for antioxidant defenses and stress responses included glutathione peroxidase 2, ferredoxin reductase, and cytochrome P450s 24 and 2A7. Downregulated genes involved in apoptosis included caspase 6 (CASP6) and apoptotic protease activating factor (APAF1). Finally, the transcription factors JunB and HERC1 were downregulated.

[0064] The expression ratios of the increasing percentages of 3243⁺ heteroplasmy have been included. All genes that expressed more than 2-fold changes compared to the parental 143B cell line are in boldface, italics and underlined, indicating downregulated genes and are in boldface and underlined indicating upregulated genes. All genes that expressed between 1.7- and 2-fold changes compared to the parental143B cell line are in boldface italics to indicate downregulated genes and in boldface to indicate upregulated genes.

[0065] The MITOCHIP expression profile of the 70% A3243G cybrid cell line was quite different from that of the 0% and the 25 and 55% A3243G cybrids. In fact, the 70% A3243G cybrid expression profile had a number of features that were strikingly similar to those seen for the mtDNA-deficient 143B TK^" p° cell line. Over 20 of the nDNA genes that were downregulated in the 25% and 55% A3243G cybrids, showed a partial restitution toward their normal expression level in the 70% cybrid and complete restitution in the p° cell line (Table 3A).

[0066] An additional 21 nDNA genes were significantly upregulated in the 70% A3243G cybrid (Table 2B and Figure 2C). The most dramatically upregulated gene was interferon β which was elevated over seven-fold. Other upregulated genes in the 70% A3243G cybrid included the mitochondrial bioenergetic genes for pyruvate dehydrogenase α2, the complex I subunit B22 (NDUFB9), the complex IV subunits Vila and Vile, succinate CoA ligase, mitochondrial creatine kinase, mitochondrial carbonic anhydrase VA, fatty acid-CoA ligase long chain 2, and the putative Graves disease antigen. Upregulated mitochondrial protein synthesis and metabolic genes included phenylalanine tRNA synthetase, sterol carrier 2, dimethylarginine dimethylaminohydrolase, and the myosin light chain 6. Upregulated stress response genes included glutathione peroxidase 3, thioredoxin reductase, HSP60-like protein; and upregulated transcription factor genes included the Zn finger protein BAZ1 B and HUEL.

[0067] The expression of virtually all of the nDNA genes that were downregulated in the 25 and 55% A3243G cell lines was restored to normal levels in the 143B TK^" p° cell line, thus completing the trend seen in the 70% A3243G cybrid (Table 3A and 3B). Genes showing the most striking reversal in expression included the malic enzyme, hexosaminidase B, mitochondrial translation release factor 1 , glucose 6 phosphatase, methylene tetrahydrofolate dehydrogenase and the complex I 24 kd nDNA subunit (NDUFV2) (Table 3A). Moreover, an additional 46 nDNA genes were upregulated at least two-fold in the 143B TK^" p° cells (Table 3B, Figure 3C). [0068] One of the most strongly upregulated genes in the p° cells was hexokinase 1 , demonstrating an increased reliance on glycolytic energy production. Fifteen of the upregulated genes were nDNA mitochondrial energy metabolism genes. These included the complex I 75 kDa (NDUFS1) and B22 (NDUFB9) subunits; the complex III Rieske iron sulfur protein and core proteins I and II; the complex IV subunits Va, Via and Vile plus the SURF1 assembly factor; the complex V subunits F6, β, ε, b and d; the ANT isoforms 2 and 3; the long chain fatty acid-CoA ligase; and TOMM20. Upregulated mitochondrial metabolic genes include the sterol carrier protein 2, alanine-glyoxylate aminotransferase, dimethylarginine dimethylaminohydrolase 1 , and aldehyde oxidase. Upregulated genes for mitochondrial protein synthesis included ribosomal protein L10, histidyl tRNA synthetase, phenylalanine tRNA synthetase, mitochondrial translational release factor, and heme regulated initiation factor 2α kinase. Upregulated antioxidant and stress response genes included glutathione peroxidase 3, mitochondrial seleno protein, Bcl2-A1 , cytochrome P450 IIC-8 and HSPC192. A number of regulatory factors were also upregulated including liver growth regulatory factor, Zn finger protein BA21 B, basic transcription factor 3 (BTF3), nuclear factor of activated T cell (NFATC3), FLJ20420, and heat shock transcription factor 4.

Table 3A Downregulated Genes 25-55% 3243G mutant cybrids

069] Table 4 summarizes upregulation and downregulation of selected genes.

Table 4

[0070] The most striking feature of the MITOCHIP expression profile for the 70% A3243G cybrid was the downregulation of all mtDNA transcripts (Table 3B, Figure 2D, lower right blue cluster, Table 4), in association with the downregulation of selected nDNA OXPHOS genes (Table 3B, Table 4). Two nDNA complex I genes, NDUFA10 (42 kD) and NDUFS5 (15 kD), were strongly downregulated in 70% A3243G cybrid (-2.1 to -3.5) and were shut down in the 143B TK^" p° cell line (-5.8 and -17.8, respectively). In addition, the complex V (ATP synthase) α subunit gene was shut down (-15.6) in the 143B (TK^") p° cell line. All the mtDNA transcripts were strongly downregulated in the 70% A3243G cybrid (-1.5 to -4.4), a trend which went to completion in the 143B TK^" p° cell line (-5.0 to -18.0).

[0071] To confirm this downregulation of the mtDNA mRNAs, qRT-PCR was used to quantify the levels of the ND2, ND4L, ND5 and ND6 mRNAs of the 0, 25, 55, and 70% A3243G cybrids, relative to the 143B TK^' p⁺ cell line (Figure 3). The mRNA levels of the 0% cybrid were comparable to the 143B TK^" p⁺ control. Those of the 25% and 55% cybrids were reduced at most 15%. However, the mtDNA mRNA levels for the 70% A3243G cybrid were reduced from 62 to 75% below the p⁺ level. Moreover, the steady-state level of the L-strand transcript ND6 was approximately five-fold less than that of the H-strand ND transcripts for all of the A3243A G cybrids, consistent with a previous report (Duborjal, H., Beugnot, R., De Camaret, B.M. and Issartel, J.P., "Large functional range of steady-state levels of nuclear and mitochondrial transcripts coding for the subunits of the human mitochondrial OXPHOS system," Genome Res 12, 1901-9 (2002)). This indicates that the ND6 protein appears to be the limiting factor in complex I.

DISCUSSION

[0072] The MITOCHIP expression profile studies of somatic cell cybrids harboring increasing percentages of the tRNA^Leu(UUR) np A3243G mtDNA mutation indicate that the reason that low levels of the A3243G mutant (10-30% in blood) caused Type II diabetes while high levels of mutant (≥ 70%) caused encephalomyopathy is that there are two abrupt shifts in the mitochondrial gene expression profile: the first when the percentage of the A3243G mutation increases from 0% to 25% and the second from 55% to 70%. Cells with 25% to 55% A3243G mutant mtDNAs exhibited a partial downregulation of a number of nDNA-encoded mitochondrial genes, while cells with 70% A3243G mtDNA exhibited a restitution of expression of many of these downregulated nDNA-encoded mitochondrial genes but experienced a precipitous drop in the mRNA levels of two key nDNA complex I nDNA subunits together with the shut down of all of the mtDNA gene transcripts. As the levels of the A3243G mutant increase, the stress on mitochondrial biogenesis and thus bioenergetics increases until specific thresholds are reached which precipitate abrupt changes in gene expression profile from one state to another. These observations explain why continuous changes in mtDNA genotype can result in discontinuous changes in phenotype.

Type II Diabetes, a mitochondrial disease.

[0073] In cells harboring 25% to 55% A3243G mtDNAs, the MITOCHIP revealed a downregulation of 42 nDNA-encoded mitochondrial genes, a slight (≤ 15%) downregulation of selected mtDNA-encoded genes, and an upregulation of 12 nDNA genes. The partial downregulation of the expression of nDNA-encoded mitochondrial genes at levels of the mtDNA A3243G mutation that are associated with Type II diabetes is consistent with two other microarray studies that have reported the downregulation of mitochondrial genes in Type II diabetic patients (Mootha, V.K. et al., "PGC-1 alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes," Nat Genet 34, 267-73 (2003); and Patti, M.E. et al., "Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1 ," Proc Natl Acad Sci U S A 100, 8466-71 (2003)). However, since the present studies analyzed cell lines harboring a mtDNA mutation that is known to inhibit mitochondrial protein synthesis and also known to cause diabetes, the present data provide the first direct evidence that an underlying defect in mitochondrial energy metabolism causes the partial downregulation of nDNA-encoded mitochondrial genes seen in diabetics. Therefore, the present data permit the extrapolation that all diabetic patients who show a partial downregulation of nDNA mitochondrial genes have an underlying defect in mitochondria.

[0074] The initiating events that result in partial mitochondrial OXPHOS dysfunction in Type II diabetes patients might be many and varied, but the present and others' microarray studies (Mootha, V.K. et al., "PGC-1 alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes," Nat Genet 34, 267-73 (2003); Patti, M.E. et al., "Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1 ," Proc Natl Acad Sci U S A 100, 8466-71 (2003)) indicate that the nuclear response is common to all the downregulation of mitochondrial gene expression. The reason for this common response to chronic OXPHOS deficiency is unclear, but its characteristics can be deduced from the present studies of the cybrids harboring 25% and 55% A3243G mutant mtDNAs. Since the tRNA^Leu(UUR) np A3243G mutation is known to inhibit mitochondrial protein synthesis, a low level of the A3243G mutation would partially reduce the synthesis of all of the mtDNA-encoded OXPHOS subunits. If the synthesis of nDNA-encoded OXPHOS subunits continued at normal rates, this could generate partially assembled OXPHOS enzyme complexes. These would inhibit OXPHOS and increase ROS production. Therefore the nucleus would have some mechanism to downregulate nuclear mitochondrial gene expression to balance the polypeptide output from the mtDNA.

[0075] As a consequence of this overall reduction in OXPHOS activity in diabetic patients, electron flux through OXPHOS would be inhibited. The resulting increased electron density in the ETC carriers would increase mitochondrial ROS production, and the increased ROS would need to be countered by the upregulation of nDNA anti-oxidant and stress response genes. This was seen in the upregulation of thioredoxin reductase, glutathione S transferase and as various chaperone protein transcripts in the 25-55% A3243G mutant cybrids.

[0076] Chronic mitochondrial energy deficiency as the cause of diabetes explains the insulin resistance seen in the early stages of the disease (Gebhart, S.S., Shoffner, J.M., Koontz, D., Kaufman, A. and Wallace, D., "Insulin resistance associated with maternally inherited diabetes and deafness," Metabolism 45, 526- 531 (1996)). Partial inhibition of OXPHOS in all tissues of the body and particularly in skeletal muscle would reduce their capacity to utilize glucose as a fuel (Stump, C.S., Short, K.R., Bigelow, M.L., Schimke, J.M. and Nair, K.S., "Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts," Proc Natl Acad Sci U S A 100, 7996-8001 (2003)). Therefore, insulin- stimulated glucose uptake would not result in increased energy production, thus blunting the tissue's response to insulin signaling resulting in insulin resistance.

[0077] Chronic mitochondrial ATP deficiency also results in the loss of regulation of insulin levels in response to glucose loading. Mitochondrial ATP production in the pancreatic β-cells is required for the sensing of the serum levels of glucose. The glucose sensor is glucokinase, a hexokinase with a high Km for glucose. Glucokinase is thought to bind to VDAC in the mitochondrial outer membrane, bringing glucokinase into close proximity to mitochondrial ATP which is transported out across the mitochondrial inner membrane by the ANTs. As a result, the ATP binding site on glucokinase should always be occupied. This primes the glucokinase for when the glucose concentration in the blood and cell exceeds the enzyme's Km, the glucose binds, and glucose-6-phosphate is generated to drive β-cell energy metabolism. As a result, an OXPHOS defect would diminish mitochondrial ATP leaving the ATP binding site open in glucokinase. Hence increase glucose would not generate glucose-6-phosphate thus blocking the β-cell response to increase blood glucose (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)).

[0078] Mitochondrial ATP is also required for insulin secretion though its interaction with the β-cell plasma membrane ATP-gated K⁺ channel. Increased ATP binds the transporter and closes the K⁺ channel. This depolarizes the plasma membrane, activating the voltage-sensitive calcium channel, which allows calcium to flow into the cytoplasm. The increased calcium activates the fusion of the insulin- containing vesicles to the plasma membrane releasing insulin. An OXPHOS defect would reduce ATP generation and thus stops the activation of the K⁺ channel, blocking insulin secretion. Thus, chronic partial inhibition of mitochondrial energy metabolism can also account for the non-insulin dependent diabetes mellitus (NIDDM) seen in Type II diabetics.

[0079] Finally, inhibition of OXPHOS also causes a chronic increase in mitochondrial ROS production within the β-cellmitochondria, primarily generated from complex I. This damages the mitochondria and mtDNA, ultimately leading to the activation of the mtPTP and destruction of the β-cells by apoptosis. To block this toxic effect, the β-cells would need to block electron flow into complex I by downregulation of the expression of key complex I genes. Indeed, complex I and citrate synthase activities have been found to be reduced in Type II diabetes (Kelley, D.E., He, J., Menshikova, E.V. and Ritov, V.B., "Dysfunction of mitochondria in human skeletal muscle in Type II diabetes," Diabetes 51, 2944-50 (2002)). Ultimately, however the increased ROS and decreased ATP would activate the mtPTP resulting in β-cell death and insulin-dependent diabetes mellitus (IDDM) (Wallace, D.C. and Lott, M.T., "Mitochondrial Defects in Common diseases," in The Genetic Basis of Common Diseases (eds. King, R.A., Rotter, J.I. and Motulsky, A.G.) 975-988 (Oxford University Press, New York, 2002)). Therefore, chronic mitochondrial OXPHOS deficiency can account for all of the clinical features seen in Type II diabetes, further supporting the conclusion that diabetes mellitus is a mitochondrial disease.

Abrupt shifts in phenotype result from abrupt changes in expression profile

[0080] When the percentage of the tRNA^Leu(UUR) A3243G mutation increased from 55% to 70%, the gene expression profile underwent a dramatic shift. Since high percentages of A3243G heteroplasmy in patients result in encephalomyopathy while low percentages result in diabetes, the present results show that the shift in phenotype is due to a switch in gene expression state. [0081] In the 70% A3243G mutant cybrids the expression of the mitochondrial genes that were downregulated in the 25% and 55% A3243G cybrids was partially restored and this restitution was greatly enhanced in the 143B TK^" p° cells. Moreover, an additional 46 genes were coordinately upregulated between 2- and 6.6-fold in the p° cells.

[0082] In addition to the upregulation of nDNA-encoded mitochondrial genes in the 70% A3243G cells, there was also a sharp downregulation of the nDNA-encoded complex I subunit genes NDUFA10 (42 kD) and NDUFS5 (15 kD) and a striking reduction in all mtDNA transcripts.

[0083] The upregulation of the nDNA-encoded mitochondrial genes is a strategy for the nucleus to address a severe mitochondrial energy deficiency by attempting to make additional mitochondria. For example, the 143B TK^" p° cell line upregulated the transcripts for the adenine nucleotide translocator (ANT), and the ANTs mediated the exchange of mitochondrial ATP for cytosolic ADP (Table 2B). The induction of ANT2 and ANT3 has also been seen in an independent study of p° cells (Lunardi, J. and Attardi, G., "Differential regulation of expression of the multiple ADP/ATP translocase genes in human cells," J Biol Chem 266, 16534-40 (1991)). In addition to the upregulation of mitochondrial genes, the p° cells were found to also upregulate hexokinase #1 3.6-fold. This indicates a strong reliance of the p° cells on glycolysis for energy production.

[0084] The coordinate upregulation of mitochondrial gene expression in response to defects in mitochondrial energy metabolism has been particularly well documented in mice in which the heart muscle-ANT isoform gene (Ant1) was genetically inactivated. The resulting starvation of the cytosol for mitochondrial ATP resulted in a massive upregulation of mitochondrial transcripts leading to the skeletal muscle fibers becoming engorged with defective mitochondria (Murdock, D., Boone, B.E., Esposito, L. and Wallace, D.C. Upregulation of nuclear and mitochondrial genes in the skeletal muscle of mice lacking the heart/muscle isoform of the adenine nucleotide translocator. Journal of Biological Chemistry 274, 14429-14433 (1999); Graham, B. et al., "A mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/skeletal muscle isoform of the adenine nucleotide translocator," Nature Genetics 16, 226-234 (1997)). Mitochondrial gene expression has also been found to be upregulated in the skeletal muscle of a variety of patients with mitochondrial myopathy (Heddi, A., Stepien, G., Benke, P.J. and Wallace, D.C, "Coordinate induction of energy gene expression in tissues of mitochondrial disease patients," Journal of Biological Chemistry 274, 22968-22976 (1999)). However, mtDNA genes are downregulated in the cultured cells from the present study as well as in a previous study (van der Westhuizen, F.H. et al., "Human mitochondrial complex I deficiency: investigating transcriptional responses by microarray," Neuropediatrics 34, 14-22 (2003)). Different cell types appear to have somewhat different responses to the same metabolic stimuli.

[0085] The elimination of ANT in the Ant1 knockout mouse inhibited OXPHOS, which in turn greatly increased mitochondrial ROS production (Esposito, L.A., Melov, S., Panov, A., Cottrell, B.A. and Wallace, D.C, "Mitochondrial disease in mouse results in increased oxidative stress," Proceedings of the National Academy of Sciences of the United States of America 96, 4820-4825 (1999)). A comparable increase in mitochondrial ROS production would be expected for the A3243G mutant, since a high percentage of the tRNA^Leu(UUR) np A3243G mutant would also strongly inhibit the synthesis of the mitochondrial OXPHOS complexes. Chronically high levels of ROS would activate the mtPTP, resulting in the turn on of the cellular caspases. The activated caspases would then degrade the proteins of the cell, including specifically cleaving the 75 kDa subunit (NDUFS1) of complex I (Ricci, J.E. et al., "Disruption of mitochondrial function during apoptosis is mediated by caspase cleavage of the p75 subunit of complex I of the electron transport chain," Cell 117, 773-86 (2004)). Indeed, in the 143B TK^" p° cells, the 75 kDa complex I subunit and Bcl2A were induced in parallel, suggesting an effort to compensate for increased mtPTP and caspase activation.

[0086] Therefore, it follows that when mitochondrial ROS production reaches a sufficient level in activity dividing cells like the A3243G cybrids, the cells must take action to reduce the ROS production or they will be destroyed by apoptosis. Since mitochondrial ROS is thought to be generated primarily from complex I and secondarily from complex III, than the best initial strategy for reducing ROS would be to downregulate complex I. If this is proves insufficient, then the second level strategy would be to shut down all of mitochondrial OXPHOS. [0087] The 70% A3243G cybrids reduced complex I by removing the transcripts for two nDNA-encoded subunits of complex I, NDUFA10 and NDUFS5. This was combined with the shut down of mtDNA transcription, with the downregulation of ND6 being of the most significance. ND6 is the only mtDNA gene that is transcribed from the L-strand promoter (PL) and it is also the lowest abundance mDNA transcript (Duborjal, H., Beugnot, R., De Camaret, B.M. and Issartel, J.P., "Large functional range of steady-state levels of nuclear and mitochondrial transcripts coding for the subunits of the human mitochondrial OXPHOS system," Genome Res 12, 1901-9 (2002)). Since ND6 is pivotal for the assembly of complex I (Bai, Y. and Attardi, G., "The mtDNA-encoded ND6 subunit of mitochondrial NADH dehydrogenase is essential for the assembly of the membrane arm and the respiratory function of the enzyme," EMBO Journal 17, 4848-4858 (1998), P_L regulation would control the level of ND6 and thus of complex I. Subsequent inhibition of transcription from the other H-strand promoter (PH) would then block the assembly of all of the OXPHOS enzymes.

[0088] Shut-down of complex I and reduction of ROS production in the entire OXPHOS system would also eliminate mitochondrial energy production. This would have a severe adverse affect on the most oxidative tissues, particularly the brain. Hence, the encephalomyopathy associated with high levels of the mtDNA tRNA^Leu(UUR) np A3243G mutation appears to be the unfortunate side effect of the cell's attempt to reduce excessive ROS production. Since several fibroblast cell lines from patients with mutations in nDNA-encoded complex I genes were also found to have reduced mtDNA transcripts (van der Westhuizen, F.H. et al. "Human mitochondrial complex I deficiency: investigating transcriptional responses by microarray." Neuropediatrics 34, 14-22 (2003)), this mechanism explains why many severe mitochondrial OXPHOS diseases such as Leigh's Syndrome, with different molecular defects, have similar clinical presentations.

[0089] But why would biology impose such draconian measures to inhibit ROS production, when the result would consistently lead to lethal neuromuscular disease? Shutting down of complex I and then of OXPHOS in the face of high ROS production did not evolve to deal with rare lethal mitochondrial diseases. Rather, it evolved to cope with the excessive ROS production that results from the much more common tissue ischemia-reperfusion which can accompany a wide range of injuries. Restriction of blood flow to a tissue (ischemia) causes hypoxia, which stalls OXPHOS and completely saturates the electron carriers with electrons. Subsequent resumption of blood flow (reperfusion) floods the ischemic tissue with 0₂, which strips the electrons from the OXPHOS to generate 0₂ ^". The resulting burst of toxic ROS then inactives the mitochondrial iron-sulfur containing enzymes and thus mitochondrial energy production (Melov, S. et al., "A novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase," Nature Genetics 18, 159-163 (1998); Li, Y. et al., "Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase," Nat Genet 11 , 376-81 (1995)).

[0090] At the local level, this destructive sequence could be blocked by the rapid inactivation complex I through caspase digestion of the 75 kDa protein and downregulation of the NDUFAS10, NDUFS5, and ND6 mRNAs. To further inhibit mitochondrial ROS production, all mtDNA transcripts could be eliminated. This transient protective strategy would be good for acute injury but it would lead to systemic, chronic deficiency in mitochondrial energy production for inherited mitochondrial diseases thus resulting in life-threatening encephalomyopathy.

[0091] In conclusion, it appears that the striking changes in clinical phenotype that are observed with increasing percentages of the tRNA^Leu(UUR) A3243G mutation are the result of switches in the transcriptional strategy of cells from normal to one for coping with a low chronic mitochondrial energy deficiency to one dominated by an effort to mitigate the most deleterious effects of reduced energy output and increased oxidative stress. Thus the most severe symptoms of mitochondrial disease can be ameliorated by simply removing the mitochondrial generated ROS using mitochondrially-targeted anti-oxidants (Melov, S. et al., "A novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase," Nature Genetics 18, 159-163 (1998); (Melov, S. et al., "Lifespan extension and rescue of spongiform encephalopathy in superoxide dismutase 2 nullizygous mice treated with superoxide dismutase-catalase mimetics," Journal of Neuroscience 21 , 8348-8353 (2001); Melov, S., "Therapeutics against mitochondrial oxidative stress in animal models of aging," Ann N Y Acad Sci 959, 330-40 (2002)). This would partially restore the expression of the NDUFA10, NDUFS5, and ND6 genes as well as the rest of the mtDNA transcripts, thus ameliorating the symptoms.

[0092] Although the description herein contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of the invention. For example, thus the scope of the invention should be determined by the appended claims and their equivalents, rather than by the examples given.

[0093] Following are the sequences of the mitochondrial DNA clones listed on Table 1 :

Clone mtDNA_ND1 , Nucleotides 3200-4351

[0094] c cacacccacc caagaacagg gtttgttaag atggcagagc ccggtaatcg cataaaactt aaaactttac agtcagaggt tcaattcctc ttcttaacaa catacccatg gccaacctcc tactcctcat tgtacccatt ctaatcgcaa tggcattcct aatgcttacc gaacgaaaaa ttctaggcta tatacaacta cgcaaaggcc ccaacgttgt aggcccctac gggctactac aacccttcgc tgacgccata aaactcttca ccaaagagcc cctaaaaccc gccacatcta ccatcaccct ctacatcacc gccccgacct tagctctcac catcgctctt ctactatgaa cccccctccc catacccaac cccctggtca acctcaacct aggcctccta tttattctag ccacctctag cctagccgtt tactcaatcc tctgatcagg gtgagcatca aactcaaact acgccctgat cggcgcactg cgagcagtag cccaaacaat ctcatatgaa gtcaccctag ccatcattct actatcaaca ttactaataa gtggctcctt taacctctcc acccttatca caacacaaga acacctctga ttactcctgc catcatgacc cttggccata atatgattta tctccacact agcagagacc aaccgaaccc ccttcgacct tgccgaaggg gagtccgaac tagtctcagg cttcaacatc gaatacgccg caggcccctt cgccctattc ttcatagccg aatacacaaa cattattata ataaacaccc tcaccactac aatcttccta ggaacaacat atgacgcact ctcccctgaa ctctacacaa catattttgt caccaagacc ctacttctaa cctccctgtt cttatgaatt cgaacagcat acccccgatt ccgctacgac caactcatac acctcctatg aaaaaacttc ctaccactca ccctagcatt acttatatga tatgtctcca tacccattac aatctccagc attccccctc aaacctaaga aatatgtctg ataaaagagt tactttgata gagtaaataa taggagctta aaccccctta tttctaggac tatgagaatc gaacccatcc c [SEQ ID NO:18]

Clone mtDNA_ND2, Nucleotides 4308-5629

[0095] tta aaccccctta tttctaggac tatgagaatc gaacccatcc ctgagaatcc aaaattctcc gtgccaccta tcacacccca tcctaaagta aggtcagcta aataagctat cgggcccata ccccgaaaat gttggttata cccttcccgt actaattaat cccctggccc aacccgtcat ctactctacc atctttgcag gcacactcat cacagcgcta agctcgcact gattttttac ctgagtaggc ctagaaataa acatgctagc ttttattcca gttctaacca aaaaaataaa ccctcgttcc acagaagctg ccatcaagta tttcctcacg caagcaaccg catccataat ccttctaata gctatcctct tcaacaatat actctccgga caatgaacca taaccaatac taccaatcaa tactcatcat taataatcat aatggctata gcaataaaac taggaatagc cccctttcac ttctgagtcc cagaggttac ccaaggcacc cctctgacat ccggcctgct tcttctcaca tgacaaaaac tagcccccat ctcaatcata taccaaatct ctccctcact aaacgtaagc cttctcctca ctctctcaat cttatccatc atagcaggca gttgaggtgg attaaaccaa acccagctac gcaaaatctt agcatactcc tcaattaccc acataggatg aataatagca gttctaccgt acaaccctaa cataaccatt cttaatttaa ctatttatat tatcctaact actaccgcat tcctactact caacttaaac tccagcacca cgaccctact actatctcgc acctgaaaca agctaacatg actaacaccc ttaattccat ccaccctcct ctccctagga ggcctgcccc cgctaaccgg ctttttgccc aaatgggcca ttatcgaaga attcacaaaa aacaatagcc tcatcatccc caccatcata gccaccatca ccctccttaa cctctacttc tacctacgcc taatctactc cacctcaatc acactactcc ccatatctaa caacgtaaaa ataaaatgac agtttgaaca tacaaaaccc accccattcc tccccacact catcgccctt accacgctac tcctacctat ctcccctttt atactaataa tcttatagaa atttaggtta aatacagacc aagagccttc aaagccctca gtaagttgca atacttaatt tctgtaacag ctaaggactg caaaacccca ctctgcatca actgaacgca aatcagcca [SEQ ID N0:19]

Clone mtDNA_ND3, Nucleotides 10235 -10356

[0096] atttga tctagaaatt gccctccttt tacccctacc atgagcccta caaacaacta acctgccact aatagttatg tcatccctct tattaatcat catcctagcc ctaagtctgg cctatg [SEQ ID NO:20]

Clone mtDNA_ND4, Nucleotides 10985- 12309

[0097] caacgc cacttatcca gtgaaccact atcacgaaaa aaactctacc tctctatact aatctcccta caaatctcct taattataac attcacagcc acagaactaa tcatatttta tatcttcttc gaaaccacac ttatccccac tttggctatc atcacccgat gaggcaacca gccagaacgc ctgaacgcag gcacatactt cctattctac accctagtag gctcccttcc cctactcatc gcactaattt acactcacaa caccctaggc tcactaaaca ttctactact cactctcact gcccaagaac tatcaaactc ctgagccaac aacttaatat gactagctta cacaatagct tttatagtaa agatacctct ttacggactc cacttatgac tccctaaagc ccatgtcgaa gcccccatcg ctgggtcaat agtacttgcc gcagtactct taaaactagg cggctatggt ataatacgcc tcacactcat tctcaacccc ctgacaaaac acatagccta ccccttcctt gtactatccc tatgaggcat aattataaca agctccatct gcctacgaca aacagaccta aaatcgctca ttgcatactc ttcaatcagc cacatagccc tcgtagtaac agccattctc atccaaaccc cctgaagctt caccggcgca gtcattctca taatcgccca cggacttaca tcctcattac tattctgcct agcaaactca aactacgaac gcactcacag tcgcatcata atcctctctc aaggacttca aactctactc ccactaatag ctttttgatg acttctagca agcctcgcta acctcgcctt accccccact attaacctac tgggagaact ctctgtgcta gtaaccacat tctcctgatc aaatatcact ctcctactta caggactcaa catactagtc acagccctat actccctcta catatttacc acaacacaat ggggctcact cacccaccac attaacaaca taaaaccctc attcacacga gaaaacaccc tcatgttcat acacctatcc cccattctcc tcctatccct caaccccgac atcattaccg ggttttcctc ttgtaaatat agtttaacca aaacatcaga ttgtgaatct gacaacagag gcttacaacc ccttatttac cgagaaagct cacaagaact gctaactcat gcccccatgt ctaacaacat ggctttctca acttttaaag gataacagct atccattggt cttaggcccc aaaaattttg gtgcaactc [SEQ ID N0:21]

Clone mtDNA_ND4L, Nucleotides 10436-10712

[0098] gata atcatattta ccaaatgccc ctcatttaca taaatattat actagcattt accatctcac ttctaggaat actagtatat cgctcacacc tcatatcctc cctactatgc ctagaaggaa taatactatc gctgttcatt atagctactc tcataaccct caacacccac tccctcttag ccaatattgt gcctattgcc atactagtct ttgccgcctg cgaagcagcg gtgggcctag ccctactagt ctcaatctcc aacacatatg gc [SEQ ID NO:22]

Clone mtDNA_ND5, Nucleotides 12376-14128

[0099] atcct taccaccctc gttaacccta acaaaaaaaa ctcatacccc cattatgtaa aatccattgt cgcatccacc tttattatca gtctcttccc cacaacaata ttcatgtgcc tagaccaaga agttattatc tcgaactgac actgagccac aacccaaaca acccagctct ccctaagctt caaactagac tacttctcca taatattcat ccctgtagca ttgttcgtta catggtccat catagaattc tcactgtgat atataaactc agacccaaac attaatcagt tcttcaaata tctactcatc ttcctaatta ccatactaat cttagttacc gctaacaacc tattccaact gttcatcggc tgagagggcg taggaattat atccttcttg ctcatcagtt gatgatacgc ccgagcagat gccaacacag cagccattca agcaatccta tacaaccgta tcggcgatat cggtttcatc ctcgccttag catgatttat cctacactcc aactcatgag acccacaaca aatagccctt ctaaacgcta atccaagcct caccccacta ctaggcctcc tcctagcagc agcaggcaaa tcagcccaat taggtctcca cccctgactc ccctcagcca tagaaggccc caccccagtc tcagccctac tccactcaag cactatagtt gtagcaggaa tcttcttact catccgcttc caccccctag cagaaaatag cccactaatc caaactctaa cactatgctt aggcgctatc accactctgt tcgcagcagt ctgcgccctt acacaaaatg acatcaaaaa aatcgtagcc ttctccactt caagtcaact aggactcata atagttacaa tcggcatcaa ccaaccacac ctagcattcc tgcacatctg tacccacgcc ttcttcaaag ccatactatt tatgtgctcc gggtccatca tccacaacct taacaatgaa caagatattc gaaaaatagg aggactactc aaaaccatac ctctcacttc aacctccctc accattggca gcctagcatt agcaggaata cctttcctca caggtttcta ctccaaagac cacatcatcg aaaccgcaaa catatcatac acaaacgcct gagccctatc tattactctc atcgctacct ccctgacaag cgcctatagc actcgaataa ttcttctcac cctaacaggt caacctcgct tccccaccct tactaacatt aacgaaaata accccaccct actaaacccc attaaacgcc tggcagccgg aagcctattc gcaggatttc tcattactaa caacatttcc cccgcatccc ccttccaaac aacaatcccc ctctacctaa aactcacagc cctcgctgtc actttcctag gacttctaac agccctagac ctcaactacc taaccaacaa acttaaaata aaatccccac tatgcacatt ttatttctcc aacatactcg gattctaccc tagcatcaca caccgcacaa tcccctatct aggccttctt acgagccaaa acctgcccct actcctccta gacctaacct gactagaaaa gctattacct aaaacaattt cacagcacca aatctccacc tccatcatca cctcaaccca aaaaggcata attaaacttt acttcctctc tttcttcttc ccactcatcc taaccctact cctaatca [SEQ ID NO:23]

Clone mtDNA_ND6, Nucleotides 14191-14558

[00100] agtaactact actaatcaac gcccataatc atacaaagcc cccgcaccaa taggatcctc ccgaatcaac cctgacccct ctccttcata aattattcag cttcctacac tattaaagtt taccacaacc accaccccat catactcttt cacccacagc accaatccta cctccatcgc taaccccact aaaacactca ccaagacctc aacccctgac ccccatgcct caggatactc ctcaatagcc atcgctgtag tatacccaaa gacaaccatc attcccccta aataaattaa aaaaactatt aaacccatat aacctccccc aaaattcaga ataataacac acccgaccac accgctaa [SEQ ID NO:24]

Clone mtDNA_C01 , Nucleotides 5591-7115

[00101] caaaacccca ctctgcatca actgaacgca aatcagccac tttaattaag ctaagccctt actagaccaa tgggacttaa acccacaaac acttagttaa cagctaagca ccctaatcaa ctggcttcaa tctacttctc ccgccgccgg gaaaaaaggc gggagaagcc ccggcaggtt tgaagctgct tcttcgaatt tgcaattcaa tatgaaaatc acctcggagc tggtaaaaag aggcctaacc cctgtcttta gatttacagt ccaatgcttc actcagccat tttacctcac ccccactgat gttcgccgac cgttgactat tctctacaaa ccacaaagac attggaacac tatacctatt attcggcgca tgagctggag tcctaggcac agctctaagc ctccttattc gagccgagct gggccagcca ggcaaccttc taggtaacga ccacatctac aacgttatcg tcacagccca tgcatttgta ataatcttct tcatagtaat acccatcata atcggaggct ttggcaactg actagttccc ctaataatcg gtgcccccga tatggcgttt ccccgcataa acaacataag cttctgactc ttacctccct ctctcctact cctgctcgca tctgctatag tggaggccgg agcaggaaca ggttgaacag tctaccctcc cttagcaggg aactactccc accctggagc ctccgtagac ctaaccatct tctccttaca cctagcaggt gtctcctcta tcttaggggc catcaatttc atcacaacaa ttatcaatat aaaaccccct gccataaccc aataccaaac gcccctcttc gtctgatccg tcctaatcac agcagtccta cttctcctat ctctcccagt cctagctgct ggcatcacta tactactaac agaccgcaac ctcaacacca ccttcttcga ccccgccgga gaggagaccc cattctatac caacacctat tctgattttt cggtcaccct gaagtttata ttcttatcct accaggcttc ggaataatct cccatattgt aacttactac tccggaaaaa aagaaccatt tggatacata ggtatggtct gagctatgat atcaattggc ttcctagggt ttatcgtgtg agcacaccat atatttacag taggaataga cgtagacaca cgagcatatt tcacctccgc taccataatc atcgctatcc ccaccggcgt caaagtattt agctgactcg ccacactcca cggaagcaat atgaaatgat ctgctgcagt gctctgagcc ctaggattca tctttctttt caccgtaggt ggcctgactg gcattgtatt agcaaactca tcactagaca tcgtactaca cgacacgtac tacgttgtag ctcacttcca ctatgtccta tcaataggag ctgtatttgc catcatagga ggcttcattc actgatttcc cctattctca ggctacaccc tagac [SEQ ID NO:25]

Clone mtDNA_C02, Nucleotides 7646-8345

[00102] tttca tgatcacgcc ctcataatca ttttccttat ctgcttccta gtcctgtatg cccttttcct aacactcaca acaaaactaa ctaatactaa catctcagac gctcaggaaa tagaaaccgt ctgaactatc ctgcccgcca tcatcctagt cctcatcgcc ctcccatccc tacgcatcct ttacataaca gacgaggtca acgatccctc ccttaccatc aaatcaattg gccaccaatg gtactgaacc tacgagtaca ccgactacgg cggactaatc ttcaactcct acatacttcc cccattattc ctagaaccag gcgacctgcg actccttgac gttgacaatc gagtagtact cccgattgaa gcccccattc gtataataat tacatcacaa gacgtcttgc actcatgagc tgtccccaca ttaggcttaa aaacagatgc aattcccgga cgtctaaacc aaaccacttt caccgctaca cgaccggggg tatactacgg tcaatgctct gaaatctgtg gagcaaacca cagtttcatg cccatcgtcc tagaattaat tcccctaaaa atctttgaaa tagggcccgt atttacccta tagcaccccc tctagagccc actgtaaagc taacttagca ttaacctttt aagttaaaga ttaagagaac caacacctct ttaca [SEQ ID NO:26]

Clone mtDNA_C03, Nucleotides 9265-9840

[00103] tcctaa tgacctccgg cctagccatg tgatttcact tccactccat aacgctcctc atactaggcc tactaaccaa cacactaacc atataccaat gatggcgcga tgtaacacga gaaagcacat accaaggcca ccacacacca cctgtccaaa aaggccttcg atacgggata atcctattta ttacctcaga agtttttttc ttcgcaggat ttttctgagc cttttaccac tccagcctag cccctacccc ccaactagga gggcactggc ccccaacagg catcaccccg ctaaatcccc tagaagtccc actcctaaac acatccgtat tactcgcatc aggagtatca atcacctgag ctcaccatag tctaatagaa aacaaccgaa accaaataat tcaagcactg cttattacaa ttttactggg tctctatttt accctcctac aagcctcaga gtacttcgag tctcccttca ccatttccga cggcatctac ggctcaacat tttttgtagc cacaggcttc cacggacttc acgtcattat tggctcaact ttcctcacta [SEQ ID NO:27]

Clone mtDNA_ATP6, Nucleotides 8557-9081

[00104] ggcc tacccgccac agtactgatc attctatttc cccctctatt gatccccacc tccaaatatc tcatcaacaa ccgactaatc accacccaac aatgactaat caaactaacc tcaaaacaaa tgataaccat acacaacact aaaggacgaa cctgatctct tatactagta tccttaatca tttttattgc cacaactaac ctcctcgggc tcctgcctca ctcatttaca ccaaccaccc aactatctat aaatctagcc atggccatcc ccttatgagc gggcgcagtg attataggct ttcgctctaa gattaaaaat gccctagccc acttcttacc acaaggcaca cctacacccc ttatccccat actagttatt atcgaaacca tcagcctact cattcaacca atagccctgg ccgtacgcct aaccgctaac attactgcag gccacctact catgcaccta attggaagcg ccaccctagc aatatcaacc attaaccttc cctctacact t [SEQ ID NO:28]

Clone mtDNA_ATP8, Nucleotides 8374-8455

[00105] atggccc accataatta cccccatact ccttacacta ttcctcatca cccaactaaa aatattaaac acaaactacc accta [SEQ ID NO:29]

Clone mtDNA_CYTb, Nucleotides 15409-15709

[00106] ca aagacgccct cggcttactt ctcttccttc tctccttaat gacattaaca ctattctcac cagacctcct aggcgaccca gataattata ccctagccaa ccccttaaac acccctcccc acatcaagcc cgaatgatat ttcctattcg cctacacaat tctccgatcc gtccctaaca aactaggagg cgtccttgcc ctattactat ccatcctcat cctagcaata atccccgtcc tccatatatc caaacaacaa agcataatat ttcgcccact aagccaatca ctttattga [SEQ ID NO:30]

Clone mtDNA_12S rRNA, Nucleotides 664-1467

[00107] tttctat tagctcttag taagattaca catgcaagca tccccattcc agtgagttca ccctctaaat caccacgatc aaaagggaca agcatcaagc acgcagcaat gcagctcaaa acgcttagcc tagccacacc cccacgggaa acagcagtga ttaaccttta gcaataaacg aaagtttaac taagctatac taaccccagg gttggtcaat ttcgtgccag ccaccgcggt cacacgatta acccaagtca atagaagccg gcgtaaagag tgttttagat cccccctccc caataaagct aaaactcacc tgagttgtaa aaaactccag ttgacacaaa atagactacg aaagtggctt taacatatct gaacacacaa tagctaagac ccaaactggg attagatacc ccactatgct tagccctaaa cctcaacagt taaatcaaca aaactgctcg ccagaacact acgagccaca gcttaaaact caaaggacct ggcggtgctt catatccctc tagaggagcc tgttctgtaa tcgataaacc ccgatcaacc tcaccacctc ttgctcagcc tatataccgc catcttcagc aaaccctgat gaaggctaca aagtaagcgc aagtacccac gtaaagacgt taggtcaagg tgtagcccat gaggtggcaa gaaatgggct acattttcta ccccagaaaa ctacgatagc ccttatgaaa cttaagggtc gaaggtggat ttagcagtaa actgagagta gagtgcttag ttgaacaggg ccctgaa [SEQ ID N0:31]

Clone mtDNA_16S rRNA, Nucleotides 1671-3229

[00108] aacctagccc caaacccact ccaccttact accagacaac cttagccaaa ccatttaccc aaataaagta taggcgatag aaattgaaac ctggcgcaat agatatagta ccgcaaggga aagatgaaaa attataacca agcataatat agcaaggact aacccctata ccttctgcat aatgaattaa ctagaaataa ctttgcaagg agagccaaag ctaagacccc cgaaaccaga cgagctacct aagaacagct aaaagagcac acccgtctat gtagcaaaat agtgggaaga tttataggta gaggcgacaa acctaccgag cctggtgata gctggttgtc caagatagaa tcttagttca actttaaatt tgcccacaga accctctaaa tccccttgta aatttaactg ttagtccaaa gaggaacagc tctttggaca ctaggaaaaa accttgtaga gagagtaaaa aatttaacac ccatagtagg cctaaaagca gccaccaatt aagaaagcgt tcaagctcaa cacccactac ctaaaaaatc ccaaacatat aactgaactc ctcacaccca attggaccaa tctatcaccc tatagaagaa ctaatgttag tataagtaac atgaaaacat tctcctccgc ataagcctgc gtcagattaa aacactgaac tgacaattaa cagcccaata tctacaatca accaacaagt cattattacc ctcactgtca acccaacaca ggcatgctca taaggaaagg ttaaaaaaag taaaaggaac tcggcaaatc ttaccccgcc tgtttaccaa aaacatcacc tctagcatca ccagtattag aggcaccgcc tgcccagtga cacatgttta acggccgcgg taccctaacc gtgcaaaggt agcataatca cttgttcctt aaatagggac ctgtatgaat ggctccacga gggttcagct gtctcttact tttaaccagt gaaattgacc tgcccgtgaa gaggcgggca tgacacagca agacgagaag accctatgga gctttaattt attaatgcaa acagtaccta acaaacccac aggtcctaaa ctaccaaacc tgcattaaaa atttcggttg gggcgacctc ggagcagaac ccaacctccg agcagtacat gctaagactt caccagtcaa agcgaactac tatactcaat tgatccaata acttgaccaa cggaacaagt taccctaggg ataacagcgc aatcctattc tagagtccat atcaacaata gggtttacga cctcgatgtt ggatcaggac atcccgatgg tgcagccgct attaaaggtt cgtttgttca acgattaaag tcctacgtga tctgagttca gaccggagta atccaggtcg gtttctatct acttcaaatt cctccctgta cgaaaggaca agagaaataa ggcctacttc acaaagcgcc ttcccccgta aatgatatca tctcaactta gtattatacc cacacccacc caagaacagg gtttgttaa [SEQ ID NO:32]

Claims

1. A method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance, said method comprising: identifying, in a sample derived from said patient, upregulation of expression of at least three genes selected from the group consisting of NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs and EST similar to CH60 60 kD HSP; or identifying in a sample derived from said patient, downregulation of expression of at least three genes selected from the group consisting of ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4; wherein said upregulation or downregulation respectively, indicates that said patient is likely to have, or is at risk of developing, Type II diabetes or insulin resistance.

2. The method of claim 1 comprising identifying upregulation.

3. The method of claim 1 comprising identifying downregulation.

4. The method of claim 1 comprising identifying both upregulation and downregulation.

5. The method of claim 1 wherein said upregulation represents an expression level at least two times higher than normal.

6. The method of claim 1 wherein said three genes, for which upregulation of expression is identified, are selected from the group consisting of: NDUFB3, ATP5F1 , ANT2, CYC, TXNRD1 and HSPA9B.

7. The method of claim 1 wherein said three genes, for which upregulation of expression is identified, are TXNRD1 , NDUFB3, and CYC.

8. The method of claim 1 wherein said three genes, for which downregulation of expression is identified, are selected from the group consisting of: NDUFV2, GSPC, MTHFD2, GYS1 , HYAL3, APAF1 and CASP6.

9. The method of claim 1 wherein said three genes, for which downregulation of expression is identified, are GSPC, APAF1 , and MTHFD2.

10. The method of claim 1 wherein said upregulation or downregulation is determined by contacting said sample with an array comprising nucleic acid sequences identifying the genes selected for identifying said upregulation and/or the genes for identifying said downregulation.

10. The method of claim 9 wherein said array comprises nucleic acid sequences identifying the following genes: NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs, EST similar to CH60 60 kD HSP, ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4.

11. The method of claim 1 also comprising counseling said patient on diabetes prevention and management.

12. A nucleotide array consisting essentially of nucleotide sequences identifying at least three genes selected from the group consisting of NDUFB3, ATP5F1 , ANT2, MGST1 , FARS1 , TXNRD1 , HCS, QP-C, GW128, FMR1 , HSPA9B, EST similar to S47532 chaperonin groEs, EST similar to CH60 60 kD HSP, and/or at least three genes selected from the group consisting of ND3, NDUFV2, ME3, G6PC, HEXB, MTHFD2, EST highly similar to dihydroorotate dehydrogenase, GYS1 , HYAL3, ACAT2, EST highly similar to carnitine/acylcarnitine translocase, ACADSB, CPO, GLUD1 , UCP3, HADHSC, IARS, APAF1 , BIRC3, CASP6, FDXR, GPX2, MTRF1 , JUNB, HERC1 , CYP2A7, CYP24, HOXA1 , CL640, ATM, PP, LOC51312, EST clone IMAGE:4212883, EST clone IMAGE:4711494, SF3B3, TOMM70A, PMPCB, MRPS14, MRPL33, FLJ10719, CLCN3, and TPM4,

13. A nucleotide array of claim 12 consisting essentially of sequences identifying all of said genes.

14. A nucleotide array of claim 12 comprising sequences for identifying upregulation.

15. A nucleotide array of claim 12 comprising sequences for identifying downregulation.

16. A nucleotide array of claim 12 comprising sequences for identifying both upregulation and downregulation.

17. A method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance, said method comprising: testing a sample derived from said patient for percent A3243G mutations present in said sample by identifying an expression profile of genes in said sample associated with Type II diabetes.

18. The method of claim 17 wherein said expression profile is associated with about 10% to about 55% A3243G mutations.

19. The method of claim 17 wherein said expression profile is associated with about 25% to about 55% A3243G mutations.

20. The method of claim 17 wherein said expression profile is associated with 31 % to about 55% A3243G mutations.

21. A method for identifying a patient likely to have, or at risk of developing, Type II diabetes or insulin resistance, said method comprising identifying in a sample derived from said patient an A3243G mutation level of 31 % to about 55%.

22. The method of claim 21 comprising identifying an A3243G mutation level of about 35% to about 50% A3243G mutations.

23. The method of claim 21 wherein said percent A3243G mutations is determined by identifying in a sample derived from said patient a gene expression profile characteristic of said mutation level.

24. The method of claim 21 wherein said A3243G mutation level is determined by the method of pyrosequencing nucleic acid derived from said sample.

25. The method of claim 20 wherein said percent A3243G mutation is determined by the method of performing FRET RT-PCR on nucleic acid derived from said sample.