WO2005056744A1

WO2005056744A1 - Hybrid enzymes with cationic binding domains

Info

Publication number: WO2005056744A1
Application number: PCT/EP2004/013671
Authority: WO
Inventors: Frank Janssen; Roland Breves
Original assignee: Henkel Kommanditgesellschaft Auf Aktien
Priority date: 2003-12-13
Filing date: 2004-12-02
Publication date: 2005-06-23
Also published as: DE10358535A1

Abstract

The invention relates to hybrid enzymes comprising a hydrolytically active unit and a cationic binding unit and to preparations containing said hybrid enzymes.

Description

Hybrid enzymes with a cationic binding domain

The present invention relates to hybrid enzymes, comprising a hydrolytically active unit and a cationic binding unit and preparations which contain these hybrid enzymes.

Biofilm is the term used to describe the growth of surfaces by microbes and, above all, the gelatinous protective layer which they collectively emit and envelop, which is also called the EPS matrix, where EPS stands for "extracellular polymeric substances". This protective layer is composed, among other things from proteins and polysaccharides, in which various dirt particles such as dead cells, skin particles and lime are embedded.This mucus is at the same time the reason why bacteria living under real conditions, as well as other microorganisms producing biofilms, are much more resistant to cleaning, including those containing biocides - and disinfectants are laboratory cultures that normally consist of single free-floating bacteria, so-called planktonic cells .. Biofilms lead to massive impairments in technical systems and can cause stubborn infections in medicine, which counteract are largely resistant to conventional antibiotics. In the household, the impairments caused by biofilms are both hygienic and aesthetic in nature.

Combating biofilms with biocides is only possible to a limited extent, since the mucilage matrix, which consists largely of polysaccharides, protects the cells from the effects of the biocides (so-called pseudo-resistance). In order to achieve an effect at all, the biocides would therefore have to be used in much higher doses than would be required for a comparable amount of unassociated bacteria. However, the use of biocides in the household is unfavorable from an ecological point of view, so that efforts are more likely to provide cleaning agents with only low concentrations or completely without biocides. However, this was not a problem So far not in line with the desire for the complete removal of bacterial biofilms - and thus optimal hygiene.

European patent EP 946 207 B1 (corresponding to WO 98/26807) teaches the enzymatic treatment of biofilms with combinations of hydrolases, which serve to detach and remove the biofilms from the surface, and oxidoreductases, which kill the bacteria contained. These systems are used to clean and disinfect hard surfaces made of a wide variety of materials in various industrial areas, such as cooling towers, dairies or chemical plants, but also soft surfaces such as skin, hair or textiles.

EP 388 115 deals with the destruction and removal of slime on industrial, water-washed surfaces. For this purpose, glucanases, cellulases, amylases and / or proteases are used which specifically decompose the polysaccharides of the slime matrix; then the now accessible microorganisms are to be exposed to the action of biocides.

WO 01/09295 claims enzymes with a β- (1,6) endoglucanase activity and corresponding DNA sequences, furthermore an enzyme preparation for the degradation of β-1,6-glucan-containing materials and their use. The ß- (1, 6) - endoglucanases also serve to remove biofilms from various surfaces. This Spanish document mainly deals with the degradation of the β-1,6-glucan-rich cell wall of certain fungi.

WO 96/36569 also describes an enzymatic method for removing biofilms. Here, a mannanase, optionally in combination with at least one further enzyme, is used in order to avoid the formation of slime in industrial water-carrying systems and to remove existing slime. According to WO 96/17632, this object can also be achieved with combinations of short-chain glycol components with at least one enzyme from the group of polysaccharidases, proteases, lipases and glycoproteases.

International application WO 01/53010 also teaches an enzymatic process for removing ^" biofilms from various with water or aqueous Solutions wash around surfaces in industrial systems as well as in the medical field, whereby the biofilms are located above the water surface, i.e. at solid / liquid / air interfaces, as well as under water, at solid / liquid interfaces. The enzymes used are carbohydrases or proteases, combinations of these two enzymes are also possible. If necessary, the cleaning solution can contain other active substances such as corrosion inhibitors, surfactants, biocides etc. in addition to the enzymes mentioned.

As was recently described (Whitchurch et al. (2000) Science 295, 1487ff), bacterial biofilms also consist of nucleic acids and are particularly affected by nucleic acid-degrading enzymes, e.g. hydrolysable by DNAsen.

However, the enzymatic hydrolysis of the biofilm by a cleaner containing hydrolases is often very inefficient because the exposure time is very short due to the cleaning process, the enzymes are washed out quickly and are therefore not in contact with the polymers for a sufficiently long time. As a result, only a low or incomplete hydrolysis performance is achieved.

The object of the present invention was therefore to provide a method for the effective removal of the biofilm, in particular one which is more effective than the methods previously described in the prior art.

Considerations were made that hydrolytic enzymes could be an efficient means of removing the biofilm if their residence time could be increased.

It was therefore an object of the present invention in particular to provide a process with which the residence time of hydrolases suitable for removing the biofilm on the surface is increased.

Another object of the present invention was, in particular, to provide cleaning agents which, without the use of biocides, are capable of Dissolve biofilms on hard surfaces in the home and remove the film-forming microorganisms.

The main task is solved by enzymes, which are able to remain on the surface longer and are therefore able to break down biofilm more effectively.

This task is solved in particular by those enzymes which have a modification in the form of a cationic binding domain.

Due to the negative charge of the biofilm, the enzymes modified in this way can adhere longer to the biofilm or to surfaces that have a biofilm and thus more effectively degrade the biofilm.

These hybrid enzymes are able to destroy the bacterial mucus matrix in biofilms on toilets and other surfaces, so that the bacteria are released from their dressing and converted into the planktonic form, which means that a simple rinse is enough to remove the microbes without that the use of biocides would also be necessary. An environmentally friendly method for cleaning and disinfection, especially of moist, water-washed surfaces, has therefore become accessible

Hybrid proteins that contain binding domains have already been described in the prior art.

For example, WO 95/31556 describes hybrid proteins from glucan-binding domains, to which antimicrobial substances are bound, for use as oral care products. WO 98/18437 describes mutan binding domains to which antimicrobial substances are bound, also for use as oral care products. WO 98/16190 describes hybrid proteins composed of starch-binding domains with antimicrobial substances, which are also used as oral care products. WO 99/33957 describes modified enzymes which comprise a polyanionic domain, which are also used in oral care products. WO 99/18999 also describes compositions which are used in oral care products, the composition comprising an enzyme and an anchor molecule which is bound to the enzyme and is capable of binding to a substrate which is close to a bacterial Colony located. In the exemplary embodiments, short-chain basic and acid molecules are mentioned as anchor molecules.

WO 01/93875 describes compositions for the treatment of biofilm structures, the composition comprising an enzyme which is able to degrade biofilm structures and comprises an anchor which is able to bind to the cellular colony or to other bioadhesive molecules. Examples of the anchor molecule are the binding domain of elastase, domains that bind to carbohydrates and polysaccharides, lectins, selectins, the binding domain of heparin, the binding domain of fibronectin and the CD44 protein.

US 2002022005 describes a composition for degradation of biofilm structures associated with cystic fibrosis, the composition comprising an enzyme capable of degrading biofilms and an anchor capable of being surface or to bind near the biofilm structure. Concanavalin, lectins, elastase, heparin and amylose binding domains are mentioned as anchor molecules.

WO 00/47174 and WO 00/47175 describe oral care products that contain fusion proteins that comprise an enzyme and an anchor molecule. The enzymes are those that can degrade polysaccharides, the anchor molecule is a molecule that is capable of binding “in the vicinity of a bacterial colony”. Examples of the anchor molecule are glutathione -S- transferase, glutathione, avidin, streptavidin, biotin and antibody. Furthermore, in these published publications the oligopeptide KKEKK is also mentioned as a possible cationic anchor molecule. However, this short-chain peptide is not capable of being coupled to a higher molecular hydrolytically active Unit to increase the pI value of the resulting protein sufficiently to enable effective binding to a biofilm. Hybrid proteins according to the invention and the use according to the invention of the hybrid proteins have not previously been described in the prior art.

A first subject of the present invention are therefore hybrid proteins, comprising a hydrolytically active unit and a cationic binding unit.

The hydrolytically active unit of the hybrid enzyme according to the invention is preferably a hydrolytic enzyme, especially from the group of polysaccharidases, in particular β-glucanases, cellulases, xylanases, amylases, dextranases, glucosidases, galactosidases, pectinases, chitinases or alginate lyases or lysozyme, and / or from the group of proteases and peptidases, in particular subtilisin, thermolysin, pepsin, carboxypeptidase or acid protease, and / or from the group of nucleases, in particular DNAsen or RNAsen and / or it is a functional one Fragment of it.

The cationic binding unit can be a naturally occurring or an artificially produced, naturally non-occurring binding domain. The binding domain is preferably a protein or a polypeptide, so that the hybrid enzyme is a fusion protein. Alternatively, however, other units which have a positive charge, for example organic molecules which carry amino groups, can also be used as the cationic binding unit or cationic binding domain. In the case of proteins or polypeptides, the cationic binding unit is preferably not more than 200, in particular not more than 150 amino acids long, particularly preferably it has a length between 10 and 200, in particular between 10 and 140, especially between 10 and 20 or between 30 and 140 amino acids. The average number of charges is preferably between 0.01 and 0.8, particularly preferably between 0.1 and 0.4 positive charges per amino acid residue at neutral pH. The cationic binding unit is preferably designed in terms of length or size and charge such that by adding the cationic binding unit to a hydrolytic unit with a neutral or slightly acidic p1 value (p1 <8), a hybrid enzyme is produced which is equal to a p1 value 8.5, particularly preferably greater than or equal to 9.0. Due to the increased pI value, the binding to facilitates the negatively charged biofilm. The suitable cationic binding unit can be selected in a simple manner by calculating the resulting pI value for the hybrid enzyme in silico, for example using the ExPASy Compute pl / Mw program (Bjellqvist, B., Hughes, GJ, Pasquali, Ch., Paquet, N., Ravier, F., Sanchez, J.-Ch., Frutiger, S. & Hochstrasser, DF The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 1993, 14, 1023-1031 , Bjellqvist, B., Basse, B., Olsen, E. and Celis, JE Reference points for comparisons of two-dimensional maps of proteins from different human cell types defined in a pH scale where isoelectric points correlate with polypeptide compositions. Electrophoresis 1994 , 15, 529-539).

In a preferred embodiment, the cationic binding unit comprises a binding domain of a naturally occurring surface protein, in particular a so-called cell envelope protein, a cell membrane-associated protein and / or a so-called surface layer protein (S-layer protein) and / or a fragment and / or or a derivative thereof, the length of the cationic binding unit preferably being between 10 and 200, in particular between 10 and 140, especially between 10 and 20 or between 30 and 140 amino acids, and the values given above being preferred for the charges. For example, this can be the binding domain of an sbs protein, in particular an sbs protein from Geobacillus, especially from Geobacillus stearothermophilus, or a fragment and / or derivative thereof. The binding domain can in particular comprise a polypeptide with an amino acid sequence according to SEQ ID NO: 19 or according to SEQ ID NO: 20 or derivatives of the polypeptides mentioned. Derivatives are to be understood here in particular: a) naturally occurring or artificially synthesized mutants of the polypeptides mentioned, in particular those which have up to ten, preferably up to five, especially exactly one, two or three, point mutations in relation to the polypeptides mentioned, b) polypeptides which have a sequence homology or identity of at least 50%, preferably at least 60% or 70%, very particularly preferably at least 80 or 90%, in particular at least 95% or 98%, in relation to the polypeptides mentioned, c) polypeptides consisting of at least 10 or 15, particularly preferably at least 20 or 30, consecutive amino acids of said polypeptides or a polypeptide according to (a) or (b), d) polypeptides with insertions and / or deletions of up to 10, 5 or 3 amino acids in relation to the polypeptides mentioned or in relation to a polypeptide according to (a), (b) or (c), e) polypeptides which contain at least one of the polypeptides according to (a), b), (c) or (d ) include.

With regard to further surface layer proteins which can be used according to the invention, reference is made above all to Sara and Sleytr (2000, Journal of Bacteriology 182 (4), 859-868), in particular to Table 1. The derivatives of these proteins which can be used according to the invention are in particular mutants , Homologs and fragments as defined above.

With regard to further surface proteins that can be used according to the invention, in addition to surface layer proteins, surface proteins are generally mentioned which are capable of binding to negatively charged polysaccharides, as are often found in cell walls, such as, for example, cell-walled proteins from plants which are able to bind to pectins ,

In a further preferred embodiment, the cationic binding unit is an artificially produced, naturally non-occurring polypeptide, in particular one with a length between 10 and 100, preferably between 20 and 50, particularly preferably between 25 and 40 amino acids, which preferably carries between 0.3 and 0.4 positive charges at neutral pH, the positively charged groups preferably being lysine or arginine residues, particularly preferably lysine residues. The cationic binding domain here preferably comprises a polypeptide with an amino acid sequence according to SEQ ID NO. 21 or a derivative thereof, whereby a derivative is to be understood in particular as a) naturally occurring or artificially synthesized mutants of a polypeptide with an amino acid sequence according to SEQ ID NO: 21, in particular those which contain up to ten, preferably up to five, especially precisely on, have two or three point mutations with respect to a polypeptide with an amino acid sequence according to SEQ ID NO: 21, b) polypeptides which have a sequence homology or identity of at least 50%, preferably at least 60% or 70%, very particularly preferably at least 80 or 90 %, in particular at least 95% or 98%, in relation to a polypeptide with an amino acid sequence according to SEQ ID NO: 21, c) polypeptides consisting of at least 10 or 15, particularly preferably at least 20 or 30, consecutive amino acids of a polypeptide with an amino acid sequence according to SEQ ID NO: 21 or a polypeptide according to (a) or (b), d) polypeptides with insertions and / or deletions of up to 10, 5 or 3 amino acids in relation to a polypeptide with an amino acid sequence according to SEQ ID NO: 21 or with respect to a polypeptide according to (a), (b) or (c), e) polypeptides which comprise at least one of the polypeptides according to (a), (b), (c) or (d).

The present invention also relates to a polypeptide according to SEQ ID NO: 21 or a derivative thereof in the sense given above.

The present invention furthermore relates to nucleic acids which code for one of the aforementioned polypeptides.

The present invention furthermore relates to aqueous preparations (enzyme preparations) which contain the hybrid proteins according to the invention in dissolved form.

The present invention furthermore relates to the use of the hybrid enzymes according to the invention and / or of enzyme preparations comprising hybrid enzymes, in particular in sterilization, disinfection, washing and cleaning agents, especially in cleaners for removing biofilms from hard surfaces, the use of which in this use Application is preferably carried out on abiotic surfaces, especially not on living beings. The use of the agents can in particular in the household or in the field of pharmaceutical, food, brewery, medical technology, paint, wood, textile, cosmetic, leather, Tobacco, fur, rope, paper, pulp, plastic, fuel, oil, rubber or machine industries or in dairies. The hybrid enzymes according to the invention can be used in particular for the removal of biofilms from household and / or sanitary objects, as well as in pulp and paper mills, in circulation cooling towers and in other systems which carry flowing and / or circulating water. In addition to the removal of biofilms, the hybrid enzymes according to the invention are, for example, also suitable for use in detergents for cleaning textiles, in particular for removing stains. The positively charged binding unit makes it easier to adhere to negatively charged textile surfaces.

The present invention furthermore relates to sterilization, disinfection, washing and cleaning agents which contain hybrid enzymes according to the invention and / or enzyme preparations containing hybrid enzymes. The agent can in principle be an agent for any type of surface. The surface can therefore be a biotic or abiotic, artificially synthesized or natural, soft or hard surface. However, in this use, application is preferably carried out on an abiotic surface, in particular not on living beings. The surface can be, for example, a textile, ceramic, metal and / or plastic surface. The item can be, for example, laundry, sanitary facilities, floor coverings, shoes, leather, utility articles made of rubber, ship's hulls, prostheses, teeth, dentures or catheters.

The cleaning agent can be, in particular, a household cleaner or a cleaner for industrial plants, in particular those mentioned above. In a preferred embodiment, the cleaner is one for cleaning hard surfaces, such as floors, tiles, tiles, plastics and other hard surfaces in the household, in industrial plants, in public sanitary facilities, in swimming pools, saunas, Sports facilities or in medical or massage practices.

Medically relevant biofilms that can be removed with hybrid enzymes according to the invention are, for example, biofilms caused by chronic lung infections eg in cystic fibrosis patients. Furthermore, it can be dental plaque or biofilms that have to be removed from contact lenses, implants or from medical devices, instruments or apparatus such as catheters or endoscopes.

The present invention therefore also relates to the use of the enzyme preparations according to the invention and / or enzyme preparations containing hybrid enzymes in cosmetic and / or pharmaceutical products, and to cosmetic and / or pharmaceutical products which contain the hybrid enzymes and / or enzyme preparations according to the invention and also the use of the hybrid enzymes according to the invention and / or enzyme preparations for the production of cosmetic and / or pharmaceutical products. The product may, for example, be a product for removing plaque from tooth surfaces or a product for removing biofilms caused by or associated with chronic lung infections, such as e.g. in the case of cystic fibrosis. The present invention therefore primarily relates to oral, dental or denture care products which contain the hybrid enzymes according to the invention.

The sterilization, disinfection, washing and cleaning agents can contain further components as are known to the person skilled in the art, in particular one or more components selected from the group consisting of surfactants, builders, acids, alkaline substances, hydrotropes, solvents, thickeners, dyes , Perfumes, corrosion inhibitors and skin protection agents. If the cleaning agent is to be sprayed, it may also contain a blowing agent. The cleaning agent is preferably a liquid aqueous agent, but it can also be, for example, a gel, a paste or a powder.

Another object of the invention is a product containing an enzyme preparation according to the invention or a cleaning agent according to the invention and a spray dispenser.

The spray dispenser is preferably a manually activated spray dispenser, in particular selected from the group comprising aerosol spray dispensers (pressurized gas containers; also referred to as a spray can), self-building spray dispensers, Pump spray dispenser and trigger spray dispenser, in particular pump spray dispenser and trigger spray dispenser with a container made of transparent polyethylene or polyethylene terephthalate. Spray dispensers are described in greater detail in WO 96/04940 (Procter & Gamble) and the US patents cited therein for spray dispensers, all of which are referred to in this regard and the contents of which are hereby incorporated into this application. Trigger spray dispensers and pump atomizers have the advantage over pressurized gas containers that no propellant has to be used.

In a further preferred embodiment, however, the agent containing the enzyme preparation is not atomized as an aerosol, since in this case small amounts of the enzyme preparation can get into the respiratory tract and under certain circumstances could trigger allergic reactions there. The enzyme can be added to the agent in a form immobilized on particles by suitable, particle-compatible attachments, nozzles etc. (so-called "nozzle valves") on the spray dispenser and metered as cleaning foam. When producing these compact foams, no respirable particles are formed, so that the danger of inhaling allergens is essentially eliminated.

Yet another object of the invention is a process for the hydrolysis of biofilms on hard surfaces, in which the vitality of the microbial cells is not damaged. For this purpose, the enzyme preparation according to the invention or the cleaning agent according to the invention, if appropriate using a product according to the invention, is applied to the surface covered with biofilm and, if necessary, rinsed with clear water after an exposure time of 1 to 30 minutes, in the case of more severe infection also for a few hours or overnight. The preparation or agent can also be blurred or rubbed on the surface infested with biofilm before rinsing with a cloth, sponge, brush or other utensil suitable for cleaning, e.g. improved cleaning performance in the presence of abrasive substances in the cleaning agent. Finally, the surface is dried with a dry cloth. If the surface is very heavily infested with biofilm, the cleaning process can then be repeated.

Substances that also serve as ingredients in cosmetic products are subsequently described according to the International Nomenclature Cosmetic Ingredient (INCI) nomenclature. records. Chemical compounds have an INCI name in English, herbal ingredients are only listed according to Linne in Latin, so-called trivial names such as "water", "honey" or "sea salt" are also given in Latin. The INCI names can be found in the International Cosmetic Ingredient Dictionary and Handbook - Seventh Edition (1997) by The Cosmetic, Toiletry, and Fragrance Association (CTFA), 1101 17th Street, NW, Suite 300, Washington, DC 20036, USA , is published and contains more than 9,000 INCI names as well as references to more than 37,000 trade names and technical names including the associated distributors from over 31 countries. The International Cosmetic Ingredient Dictionary and Handbook assigns the ingredients one or more chemical classes, such as polymer ethers, and one or more functions, such as surfactants - cleansing agents, which it in turn explains in more detail and to the following if necessary, reference is also made.

The statement CAS means that the following sequence of numbers is a designation of the Chemical Abstracts Service.

enzyme preparation

The enzyme preparation according to the invention is a system containing one or more of the hybrid enzymes according to the invention. If appropriate, further, unmodified enzymes, in particular selected from polysaccharidases, proteases and nucleases, can also be contained in the enzyme preparation. Unless explicitly differentiated, the following explanations refer both to the free enzymes and to the hydrolytic unit which is part of the hybrid enzymes.

Polysaccharidases are enzymes that catalyze the hydrolytic cleavage of polysaccharides. For example, cellulose is broken down by cellulase, while the glucosidase from the oligosaccharide or polysaccharide molecule cleaves individual glucose units from the end. The extracellular polysaccharide matrix of the biofilm consists of homo- and heteropolysaccharides, which are mainly made up of glucose, fucose, mannose, galactose, fructose, pyruvate, mannuronic acid and glucuronic acid. Accordingly, the polysaccharides for example levane, polymannane, dextrans, cellulose, amylopectin, glycogen or alginate.

For the purposes of this invention, all polysaccharidases can be used for the hydrolysis of biofilms. However, the enzyme preparation preferably contains at least one enzyme either as a free enzyme or as a hydrolytic unit of the hybrid enzyme from the group β-glucanase, cellulase, xylanase, amylase, dextranase, glucosidase, galactosidase, pectinase, chitinase, lysozyme, hemicellulase and alginate lyase , These enzymes can include several family members. For example, both an α-1,4-glucosidase, which was also referred to as maltase, and a β-1,4-glucosidase are known. For the purposes of this invention, all these subgroups are included. Commercially available mixtures of polysaccharidases can also be used. For example, Viscozyme, a liquid enzyme preparation from Aspergillus sp., Which is composed of various polysaccharidases, is suitable, among others. from arabanase, cellulase, β-glucanase, hemicellulase and xylanase, for use in the context of this invention.

Proteases are enzymes that catalyze the hydrolytic cleavage of the peptide bond of proteins and peptides. They can therefore also be used to break down biofilms, since these can contain polysaccharides as well as proteins secreted by the film-forming organisms. Proteases can be systematically divided into acidic, neutral and alkaline proteases based on the pH optimum of their activity, but also classified according to the catalytically active group in the active center. A distinction is made between serine, cysteine, aspartate and metal proteases.

For the purposes of this invention, all known proteases can be used to break down biofilms, but at least one protease selected from the group consisting of subtilisin, thermolysin, pepsin, carboxypeptidase and acid protease is preferably used.

The nucleases are enzymes that break down nucleic acids. Depending on the hydrolysis site, a distinction is made between endonucleases that cleave within the nucleic acid strand (eg DNAse I from pancreas) and exonucleases that Release nucleotides from the end (eg exonuclease III from E. col i). DNA single strands (S1 nuclease from Aspergillus oryzae) or double strands (exonuclease III) can serve as a substrate and can be broken down into unspecific strands or shorter nucleotides. Mixed specificities are also possible and occur depending on, for example, the enzyme concentration and the presence of certain ions. Analogously, the cleavage of RNA molecules is also possible. Highly specific endonucleases require certain nucleotide sequences (typically 4-8 base pairs) and are sometimes also referred to as restriction enzymes or restriction endonucleases. Since biofilms can also consist of nucleic acids, all nucleases are also suitable for use in biofilm-degrading agents according to the invention. However, non-specific DNAsen or RNAsen are preferably used.

The free enzymes which can be used in the context of this invention can be obtained from the corresponding organisms by customary biochemical methods. However, they are also commercially available, for example from Novozymes, Genencor International, Sigma, AB Enzymes or ASA Enzyme. The enzyme preparations can also be of technical quality and consist of several different enzyme activities. The presence of side activities, which are sometimes not characterized in more detail, can also have a favorable influence on the hydrolysis of the complex biofilm polymers.

If proteases are to be combined with other enzymes, for example polysaccharidases, it should be noted, regardless of whether it is hybrid enzymes according to the invention or free enzymes, that these are contained in liquid agents by components such as surfactants or organic acids or also in the cleaner could be attacked by the rather nonspecific proteases, which would reduce the effectiveness of the agents against non-protein biofilm components. In order to ensure the activity and stability of such cleaning agents over a longer period of time, it is therefore advisable to keep sensitive enzymes separate from denaturing components and in particular also proteases from other enzymes, so that these components only come into contact immediately before or during the cleaning process. The different enzymes can be separated in different ways. One possibility is to introduce the enzymes into microcapsules, which are only immediately before or during the cleaning process, for example by mechanical action during the cleaning process, by a sudden change in the osmotic conditions, for example when diluting with water or by cutting the capsules when dosing from the storage bottle. be opened and release their content. It should be noted, however, that the capsule wall itself must not be attacked by the enzymes. Capsule materials based on proteins or polysaccharides must therefore be excluded. Alternatively, the enzymes can also be immobilized in each case on a solid carrier which is suspended in the cleaning agent and can additionally serve as an abrasive when the agent is used. The immobilization takes place in a manner known to the person skilled in the art; In addition to inorganic substances, for example silicates or porous glass, polymers can also be used as carrier materials.

Another conceivable possibility could also be incorporation into a multi-phase agent, so that the protease would predominantly be located in one phase and the other enzymes would predominantly be in a further phase. Such an agent would be shaken up shortly before use and the resulting emulsion applied to the surface to be cleaned; the agent remaining in the storage bottle would then experience a rapid phase separation, so that the enzymes would only come into contact for a short time and possibly at the phase interface. The situation would be similar if an enzyme were incorporated into a phase which was stably dispersed in the form of droplets in the second phase containing the other enzyme; the agent would not be shaken, but dosed directly from the storage bottle, if necessary also sprayed. However, such a multiphase means would be a technically complex and difficult to implement solution. In addition, consumer acceptance would probably be low.

It therefore makes more sense to store the two enzymes or enzyme groups in spatially separate solutions. Storage in two completely separate bottles is the less preferred solution, since this means more effort for the consumer. It is therefore particularly preferred to provide it in a two-chamber bottle, from which both cleaning solutions can then be metered simultaneously. Such Two-chamber bottles are already known from the prior art. In addition to the possibility of separate storage of incompatible enzymes, a two- or multi-chamber bottle offers further advantages. It is possible, for example, to store an enzyme in a solution with an optimal pH in terms of storage stability in one chamber and to store a solution in another chamber, the pH of which leads to the result that a cleaning solution is formed when it is mixed with the enzyme storage solution. whose pH value ensures optimum enzyme activity. For example, many polysaccharidases are particularly stable at neutral pH, but display their highest activity at pH 4 to 5.

cleaning supplies

For the purposes of this invention, the hybrid enzyme and / or the enzyme preparation can also be used in a cleaning agent for hard surfaces. The cleaning agent can contain the enzyme preparation in particular in amounts of 0.1 to 10.0% by weight, preferably 0.5 to 3% by weight. The cleaning agent is preferably biocide-free, but can optionally also contain biocide, preferably in small amounts.

In addition to the enzyme preparation, a liquid, gel-like or pasty aqueous cleaning agent for hard surfaces can also contain customary cleaning agent components according to the invention. These ingredients include, for example, surfactants, but also builders, acids, alkalis, hydrotropes, solvents, thickeners, abrasives and other auxiliaries and additives such as dyes, perfumes, corrosion inhibitors or even skin care products.

The surfactants optionally used are preferably selected from the group consisting of anionic surfactants, nonionic surfactants and / or amphoteric surfactants. Anionic and / or nonionic surfactants are preferably used. If they are used, anionic surfactants preferably come in amounts of 0.1 to 15% by weight, nonionic surfactants preferably in amounts of 0.1 to 10% by weight and amphoteric surfactants preferably in amounts of 0.1 to 4% by weight .-% for use, each based on the total composition. In a less preferred embodiment, cationic surfactants can also be used in amounts of up to 2% by weight, based on the Total composition. Cationic surfactants can also be used. In a preferred embodiment, however, the cleaning agent is free of these due to the biocidal action emanating from cationic surfactants.

The anionic surfactants which can be used according to the invention include aliphatic sulfates such as fatty alcohol sulfates, fatty alcohol ether sulfates, dialkyl ether sulfates, monoglyceride sulfates and aliphatic sulfonates such as alkane sulfonates, α-olefin sulfonates, ether sulfonates, n-alkyl ether sulfonates, sulfonated fatty acids and lignin sulfonates. Also within the scope of the present invention are useful alkylbenzene sulfonates (ride Fettsäuretau, N-acyl taurides), fatty acid salts (soaps), fatty acid cyanamides, sulfosuccinates (sulfosuccinic acid mono- and dialkyl esters), sulfosuccinamates, sulfosuccinamides, Carbonsäureamidethersulfate, Alkylpolyglykolethercarboxylate, fatty acylaminoalkanesulfonates, fatty acid sarcosinates, ether carboxylic acids and Alkyl (ether) phosphates and α-sulfofatty acid salts, acylglutamates, monoglyceride disulfates and alkyl ethers of glycerol disulfate, and finally their mixtures.

In the context of the present invention, unless otherwise stated, fatty acids or fatty alcohols or their derivatives are representative of branched or unbranched carboxylic acids or alcohols or their derivatives having preferably 6 to 22 carbon atoms, in particular 8 to 20 carbon atoms, particularly preferably 10 to 18 carbon atoms, most preferably 12 to 16 carbon atoms, for example 12 to 14 carbon atoms. The fatty acids / alcohols or their derivatives with an even number of carbon atoms are preferred for ecological reasons, in particular because of their vegetable basis as based on renewable raw materials, but without restricting the teaching according to the invention to them. In particular, the oxo alcohols or their derivatives obtainable, for example, according to RoELEN's oxo synthesis, or their derivatives, having preferably 7 to 19 carbon atoms, in particular 9 to 19 carbon atoms, particularly preferably 9 to 17 carbon atoms, most preferably 11 to 15 carbon atoms, for example 9 to 11 , 12 to 15 or 13 to 15 carbon atoms, can be used accordingly.

They are in the form of their alkali metal and alkaline earth metal salts, in particular sodium, potassium and magnesium salts, as well as ammonium and mono-, di-, tri- or Tetraalkylammonium salts and, in the case of the sulfonates, also in the form of their corresponding acid, for example dodecylbenzenesulfonic acid. Due to the manufacturing process, the alkyl ether sulfates always contain residual contents of non-alkoxylated fatty alcohol sulfates, especially at low degrees of ethoxylation. Furthermore, the agents according to the invention can also contain soaps, ie alkali or ammonium salts of saturated or unsaturated C ₆ -C ₂₂ fatty acids.

The anionic surfactants are preferably selected from the group comprising fatty alcohol sulfates in amounts of up to 5% by weight, alkylbenzenesulfonates in amounts of up to 7.5% by weight and soaps in amounts of up to 2% by weight, in each case based on the overall composition, as well as mixtures thereof.

Suitable nonionic surfactants are, for example, Cβ-C-iβ-

Alkyl alcohol polyglycol ethers, alkyl polyglycosides and nitrogenous surfactants or mixtures thereof, especially the first two.

Cβ-Ciβ-alkyl alcohol polypropylene glycol / polyethylene glycol ether can by the formula R ¹ 0- (CH ₂ CH (CH ₃ ) 0) p (CH ₂ CH ₂ 0) eH

are described in which R ^{1 is} a linear or branched, aliphatic alkyl and / or alkenyl radical having 8 to 18 carbon atoms, p is 0 or numbers from 1 to 3 and e is numbers from 1 to 20. They are obtained by the addition of propylene oxide and / or ethylene oxide to alkyl alcohols, preferably to fatty alcohols. Furthermore, end-capped C ₈ -C ₈ -alkyl alcohol polyglycol ethers can also be used, ie alkyl alcohol polyalkylene glycol ethers according to the above formula in which the free OH group is etherified.

Cleaners according to the invention can contain alkyl alcohol polyglycol ethers in amounts of 0.1 to 4% by weight, based on the total composition.

Preferred nonionic surfactants are furthermore alkyl polyglycosides (APG) of the formula

R ² 0 [G] _x , in which R ^{2 is} a linear or branched, saturated or unsaturated alkyl radical having 8 to 22 carbon atoms, [G] is a glycosidically linked sugar radical and x is a number from 1 to 10. The index number x indicates the degree of oligomerization (DP Degree), ie the distribution of mono- and oligoglycosides. While x must always be an integer in a given compound and, above all, can assume the values x = 1 to 6, the value x for an alkylglycoside is an analytically determined arithmetic quantity, which usually represents a fractional number. Alkyl glycosides having an average degree of oligomerization x of

1.1 to 3.0 used. From an application point of view, those alkyl glycosides are preferred whose degree of oligomerization is less than 1.7, and in particular between

1.2 and 1, 6 lies. Xylose, but especially glucose, is preferably used as the glycosidic sugar. The alkyl or alkenyl radical R ² can be derived from primary alcohols having 8 to 18, preferably 8 to 14, carbon atoms. Typical examples are capronic alcohol, caprylic alcohol, capric alcohol and undecyl alcohol and their technical mixtures, such as those obtained in the course of the hydrogenation of technical fatty acid methyl esters or in the course of the hydrogenation of aldehydes from RoELEN's oxo synthesis. However, the alkyl or alkenyl radical R ² is preferably derived from lauryl alcohol, myristyl alcohol, cetyl alcohol, palmoleyl alcohol, stearyl alcohol, isostearyl alcohol or oleyl alcohol. Elaidyl alcohol, petroselinyl alcohol, arachidyl alcohol, gadoleyl alcohol, behenyl alcohol, erucyl alcohol and their technical mixtures are also to be mentioned.

Alkyl polyglycosides can be present in cleaners according to the invention in amounts of 0.1 to 6% by weight, based on the total composition.

Nitrogen-containing surfactants may be included as further nonionic surfactants, e.g. Fatty acid polyhydroxyamides, for example glucamides, and ethoxylates of alkylamines, vicinal diols and / or carboxamides which have alkyl groups with 10 to 22 C atoms, preferably 12 to 18 C atoms. The degree of ethoxylation of these compounds is generally between 1 and 20, preferably between 3 and 10. Ethanolamide derivatives of alkanoic acids having 8 to 22 carbon atoms, preferably 12 to 16 carbon atoms, are preferred. The particularly suitable compounds include lauric acid, myristic acid and palmitic acid monoethanolamides.

The amphoteric surfactants (amphoteric surfactants, zwitterionic surfactants) which can be used according to the invention include betaines, amine oxides, alkylamido alkylamines, alkyl substituted amino acids and acylated amino acids. Preferred amphoteric surfactants are, for example, betaines of the formula

(R ³ ) (R ⁴ ) (R ⁵ ) N ⁺ CH ₂ COO-,

in which R ^{3 is} an alkyl radical with 8 to 25, preferably 10 to 21 carbon atoms, which is optionally interrupted by heteroatoms or heteroatom groups, and R ⁴ and R ^{5 are} identical or different alkyl radicals with 1 to 3 carbon atoms, in particular Cio-Cis-alkyl-dimethylcarboxymethylbetaine and Cn- Cι ₇ - Alkyamidopropyl-dimethylcarboxymethylbetaine.

If cationic surfactants are present in the composition, these are preferably the quaternary ammonium compounds of the formula

(R ⁶ ) (R ⁷ ) (R ⁸ ) (R ⁹ ) N ⁺ X ^" ,

in which R ⁶ to R ⁹ stand for four identical or different types, in particular two long and two short chains, alkyl radicals and X ^" for an anion, in particular a halide ion, for example didecyl-dimethyl-ammonium chloride, alkyl-benzyl-didecyl-ammonium chloride and mixtures thereof, but the detergent composition is preferably free of cationic surfactants.

When choosing the suitable surfactants, care must be taken to ensure that they are compatible with the enzymes used. The enzyme activity is preferably reduced by no more than 50%, in particular by no more than 30%, during a typical average exposure time of 15 minutes. Experiments have shown that the sodium dodecyl sulfate (SDS), known as denaturing, reduces the activity of the corolase in a concentration of 1% within 15 minutes to below 30%, while the activity of the xylanase already with less than 0.1% SDS to less drops as 40%, so that this surfactant is not preferred for use in cleaning agents according to the invention. If this or a surfactant with a similar effect is nevertheless to be used, preference should be given to spatial separation during storage, for example by encapsulating the enzymes or by using a multi-chamber bottle, so that enzymes and surfactants only come into contact with one another immediately before or during use in Come in contact. In contrast, alkyl polyglycosides are well suited for use in enzyme-containing agents according to this invention. The activity of the Corolase remains clearly above 50% even with 3% APG 600, the xylanase even experiences an increase in activity through the addition of APG 600 (over 150% activity with 0.1% surfactant) and always shows with 3% APG still over 80% activity.

The agents according to the invention can also contain builders. Suitable builders are, for example, alkali metal gluconates, citrates, nitrilotriacetates, carbonates and bicarbonates, in particular sodium gluconate, citrate and nitrilotriacetate, and also sodium and potassium carbonate and bicarbonate, and also alkali metal and alkaline earth metal hydroxides, in particular sodium and potassium and ammonium hydroxides, in particular sodium and potassium and ammonium amides, and ammonium and potassium amides , in particular mono- and triethanolamine, or mixtures thereof. This also includes the salts of glutaric acid, succinic acid, adipic acid, tartaric acid and benzene hexacarboxylic acid as well as phosphonates and phosphates. The agents can contain builders in amounts, based on the composition, of 0.1 to 5% by weight.

The agents according to the invention can furthermore contain acids and / or alkalis. On the one hand, these serve as pH regulators, on the other hand, the acids can also help to remove limescale from the surfaces to be cleaned. In accordance with the invention can be used acids may be inorganic mineral acids, for example hydrochloric acid, and / or to C1.- ₆ - mono-, di-, tri- or polycarboxylic acids or hydroxy carboxylic acids such as formic acid, acetic acid, lactic acid, citric acid, gluconic acid, glutaric acid , Succinic acid, adipic acid, tartaric acid or malic acid as well as other organic acids such as salicylic acid or amidosulfonic acid. However, citric acid is particularly preferably used; Mixtures of several acids can also be used. Acids can be present in the cleaning agent according to the invention in amounts of up to 6% by weight, based on the total composition.

The bases which can optionally be used include alkanolamines, for example mono- or diethanolamine, and also ammonium or alkali metal hydroxides, especially sodium hydroxide. The cleaning agent according to the invention can contain bases in amounts of up to 2.5% by weight, based on the total composition. The agent according to the invention can furthermore contain one or more thickeners for viscosity regulation. Natural and synthetic polymers and inorganic thickeners are suitable as thickeners. The polymers that can be used include polysaccharides or heteropolysaccharides and other organic natural thickeners, including the polysaccharide gums such as acacia, agar, alginates, carrageenan and their salts, guar, guarane, tragacanth, gellan, ramsan, dextran or xanthan and their derivatives, for example propoxylated Guar, as well as their mixtures, also pectins, polyoses, locust bean gum, starch, dextrins, gelatin, casein. Organic modified natural substances such as carboxymethyl cellulose and cellulose ether, hydroxyethyl and propyl cellulose and the like, or cellulose acetate and gum flour ether can also be used. Homo- and copolymeric polycarboxylates, especially polyacrylic and polymethacrylic compounds, as well as vinyl polymers, polycarboxylic acids, polyethers, polyimines or polyamides can be used as fully synthetic synthetic thickeners. The inorganic thickeners that can be used include polysilicic acids, clay minerals such as montmorillonites, zeolites, silica, and various nanoparticulate inorganic compounds such as nanoparticulate metal oxides, oxide hydrates, hydroxides, carbonates and phosphates, and silicates with an average particle size of 1 to 200 nm, based on the Particle diameter in the longitudinal direction, ie in the direction of the greatest expansion of the particles. In a further embodiment of the invention, these nanoparticulate substances can optionally be treated with one or more surface modification agents. The surface modification is carried out in a manner known to the person skilled in the art using mono- and polybasic C ₂ . _8- carboxylic acids or hydroxycarboxylic acids, functional silanes of the type (OR) _4-n SiR _n (R = organic residues with functional groups such as hydroxy, carboxy, ester, amine, epoxy, etc.), quaternary ammonium compounds or amino acids and others therefor usable substances.

In addition to the thickeners mentioned above, the cleaning agent according to the invention can contain electrolyte salts. These can also contribute to an increase in viscosity. For the purposes of the present invention, electrolyte salts are salts which break down into their ionic constituents in the aqueous composition according to the invention. The salts, in particular alkali metal and / or alkaline earth metal salts, are preferred, an inorganic acid, preferably an inorganic acid from the group comprising the hydrohalic acids, nitric acid and sulfuric acid, in particular the chlorides and sulfates. Within the framework of the teaching according to the invention, an electrolyte salt can also be used in the form of its corresponding acid / base pair, for example hydrochloric acid and sodium hydroxide instead of sodium chloride.

Organic and / or inorganic thickeners in amounts of up to 2% by weight, based on the total composition, can be used in the agent according to the invention.

The agent according to the invention can advantageously additionally contain one or more water-soluble organic solvents, usually in an amount of up to 6% by weight, based on the total composition. Within the framework of the teaching according to the invention, the solvent is used, in particular, as a hydrotrope, viscosity regulator and / or cold stabilizer. It has a solubilizing effect, particularly for surfactants and electrolytes, as well as perfume and dye, and thus contributes to their incorporation, prevents the formation of liquid-crystalline phases and is involved in the formation of clear products. The viscosity of the agent according to the invention decreases with increasing amount of solvent. However, too much solvent can cause an excessive drop in viscosity. Finally, the cold cloud and clear point of the agent according to the invention decrease with increasing amount of solvent.

Suitable solvents are, for example, saturated or unsaturated, preferably saturated, branched or unbranched C _1-2 o-hydrocarbons, preferably C ₂ -i ₅ hydrocarbons, with at least one hydroxyl group and optionally one or more ether functions COC, ie oxygen atoms interrupting the carbon atom chain. Preferred solvents are, however, - if appropriate on one side with a Cι etherified _-6 alkanol - C. ₂ ₆ - alkylene glycols and poly-C ₂ . _3- alkylene glycol ethers with an average of 1 to 9 identical or different, preferably identical, alkylene glycol groups per molecule, for example ethylene glycol, propylene glycol, butylene glycol, diethylene glycol, dimethoxy diglycol, dipropylene glycol, propylene glycol butyl ether, propylene glycol propyl ether, Dipropylene glycol monomethyl ether and PEG. Other preferred solvents are the Cι _-6 alcohols such as methanol, ethanol, n-propanol, isopropanol, n-butanol, t-butanol etc., ethanol and / or isopropanol is particularly preferably used.

In addition to the solvents described above, alkanolamines and alkylbenzenesulfonates having 1 to 3 carbon atoms in the alkyl radical, e.g. Xylene or cumene sulfonate can be used. Other usable hydrotropes are e.g. Octyl sulfate or butyl glucoside. The agent according to the invention can contain these hydrotropes in amounts of up to 4% by weight, based on the total composition.

In one embodiment, the agents according to the invention can contain abrasives. Solid water-soluble and water-insoluble, preferably inorganic compounds and mixtures thereof can serve as the abrasive component. These include, for example, alkali carbonates, alkali bicarbonates and alkali sulfates, alkali borates, alkali phosphates, silicon dioxide, crystalline or amorphous alkali silicates and layered silicates, finely crystalline sodium aluminum silicates and calcium carbonate. The advantage of water-soluble abrasive components is that the agent can be rinsed off practically without residue. In addition to these inorganic substances, abrasives obtained from living nature, for example crushed nut shells or woods, and abrasion-resistant plastics, for example polyethylene beads, or ceramic or glass beads can also be used. The cleaning agent according to the invention can contain abrasives in amounts of up to 2% by weight, based on the total composition.

In addition to the components mentioned, the agents according to the invention can contain one or more further auxiliaries and additives, as are customary above all in cleaning agents for hard surfaces. These include in particular UV stabilizers, corrosion inhibitors, cleaning enhancers, antistatic agents, preservatives (for example 2-bromo-2-nitropropane-1, 3-diol or an isothiazolinone-bromonitropropanediol preparation), perfume, dyes, pearlescent agents (for example glycol distearate) and opacifiers or also skin protection agents, as described for example in EP 522 506. The amount of such additives is usually not more than 12% by weight in the cleaning agent. The lower limit of the Use depends on the type of additive and can, for example, be up to 0.001% by weight and below for dyes. The amount of auxiliaries is preferably between 0.01 and 7% by weight, in particular 0.1 and 4% by weight.

All dyes usually used in household cleaning agents can be used as dyes. All common perfumes can also be used for the fragrances. Fruity fragrances, for example citrus, pine (spruce) and mint, and floral fragrances are preferred. Preservatives have a biocidal effect, so that it is desirable to use only low concentrations, but preferably no preservatives at all, in cleaning agents according to the invention.

It is advantageous if the agent contains no complexing agents; the addition of a bleaching agent to the cleaning agent according to the invention is not necessary.

The pH of the agents according to the invention is preferably between 1 and 7.5, particularly preferably between 2 and 5, in particular between 2.5 and 4.5. In the case of multiphase agents, the pH of the agent is to be understood as the pH of the temporary emulsion formed after shaking, in the case of agents that are offered in multi-chamber bottles, the pH of the agent is the pH of the common Intended dosing of the solution obtained in the various chambers. It means the pH value of the ready-to-use cleaning solution.

If it is a liquid agent, it preferably has a viscosity of up to 1000 mPas. In contrast, gel-like or pasty cleaning agents can have viscosities of up to 150,000 mPas. The viscosity measurements are carried out at 20 ° C in a Brookfield LVDV II viscometer with a rotor frequency of 20 rpm (spindle no. 31, conc. 100%).

The cleaning agent can contain one or more propellants (INCI propellants), usually in an amount of 1 to 80% by weight, preferably 1.5 to 30% by weight, in particular 2 to 10% by weight, particularly preferably 2.5 up to 8% by weight, most preferably 3 to 6% by weight. According to the invention, blowing agents are usually blowing gases, in particular liquefied or compressed gases. The choice depends on the product to be sprayed and the area of application. When using compressed gases such as nitrogen, carbon dioxide or nitrous oxide, which are generally insoluble in the liquid cleaning agent, the operating pressure decreases with each valve actuation. Liquefied gases (liquefied gases) as propellants, which are soluble in the detergent or even act as a solvent, offer the advantage of constant operating pressure and even distribution, because the propellant evaporates in air and takes up several hundred times its volume.

Accordingly, the following blowing agents designated according to INCI are suitable: butanes, carbon dioxides, dimethyl carbonates, dimethyl ethers, ethanes, hydrochlorofluorocarbon 22, hydrochlorofluorocarbon 142b, hydrofluorocarbon 152a, hydrofluorocarbon 134a, hydrofluorocarbon 227ea, isobutanes, isopentanes, nitrogenous, nitrous oxides.

However, chlorofluorocarbons (chlorofluorocarbons, CFCs) as blowing agents are preferably largely and in particular completely dispensed with because of their harmful effect on the ozone shield of the atmosphere, which protects against hard UV radiation, the so-called ozone layer.

Preferred blowing agents are liquid gases. Liquid gases are gases that can be converted from gaseous to liquid at mostly low pressures and 20 ° C. In particular, liquid gases include the hydrocarbons that are produced in oil refineries as by-products in the distillation and cracking of petroleum and in gas processing for gasoline separation - propane, propene, butane, butene, isobutane (2-methyl propane), isobutene (2-methyl propene, Isobutylene) and their mixtures understood.

The cleaning agent particularly preferably contains propane, butane and / or isobutane, in particular propane and butane, most preferably propane, butane and isobutane, as one or more blowing agents. Oral, dental and / or denture care products

The mouth, tooth and / or denture care products according to the invention can be present, for example, as mouthwash, gel, liquid toothbrush lotion, stiff toothpaste, chewing gum, denture cleaner or denture adhesive cream.

For this it is necessary to incorporate the hybrid enzymes according to the invention into a suitable carrier.

As carriers e.g. Powdery preparations or aqueous-alcoholic solutions are also used which, as mouthwashes, contain 0 to 15% by weight of ethanol, 1 to 1.5% by weight of aromatic oils and 0.01 to 0.5% by weight of sweeteners or as mouthwash concentrates 15 to 60% by weight of ethanol, 0.05 to 5% by weight of aromatic oils, 0.1 to 3% by weight of sweeteners and, if appropriate, further auxiliaries, and may be diluted with water before use. The concentration of the components must be chosen so high that the dilution does not fall below the specified concentration limits after use.

However, gels and more or less flowable pastes can also serve as carriers, which are expressed from flexible plastic containers or tubes and applied to the teeth with the aid of a toothbrush. Such products contain higher amounts of humectants and binders or consistency regulators and polishing components. In addition, these preparations also contain aromatic oils, sweeteners and water.

As humectants, e.g. Glycerin, sorbitol, xylitol, propylene glycols, polyethylene glycols or mixtures of these polyols, in particular those polyethylene glycols with molecular weights from 200 to 800 (from 400 to 2000) can be used. Sorbitol is preferably present as a humectant in an amount of 25-40% by weight.

Condensed phosphates in the form of their alkali metal salts, preferably in the form of their sodium or potassium salts, can be present as anti-tartar active ingredients and as demineralization inhibitors. The aqueous solutions of these phosphates are alkaline due to hydrolytic effects. By adding acid, the pH of the Oral, dental and / or denture care agents according to the invention are set to the preferred values of 7.5-9.

Mixtures of different condensed phosphates or hydrated salts of the condensed phosphates can also be used. However, the specified amounts of 2-12% by weight refer to the anhydrous salts. A sodium or potassium tripolyphosphate is preferably present in a quantity of 5-10% by weight of the composition as the condensed phosphate.

A preferably contained active ingredient is a caries-inhibiting fluorine compound, preferably from the group of fluorides or monofluorophosphates in an amount of 0.1-0.5% by weight of fluorine. Suitable fluorine compounds are, for example, sodium monofluorophosphate (Na ₂ P0 ₃ F), potassium monofluorophosphate, sodium or potassium fluoride, tin fluoride or the fluoride of an organic amino compound.

Natural and synthetic water-soluble polymers such as carrageenan, tragacanth, guar, starch and their non-ionic derivatives such as hydroxypropyl guar, hydroxyethyl starch, cellulose ethers such as hydroxyethyl cellulose or methyl hydroxypropyl cellulose are used as binders and consistency regulators. Also agar-agar, xanthan gum, pectins, water-soluble carboxyvinyl polymers (eg Carbopol ^® types), polyvinyl alcohol, polyvinyl pyrrolidone, higher molecular weight polyethylene glycols (molecular weight 10 ³ to 10 ⁶ D). Other substances that are suitable for viscosity control are layered silicates such as, for example, montmorillonite clays, colloidal thickening silicas, for example airgel silica or pyrogenic silicas.

As polishing components may all heretofore known polishing agent, but preferably precipitated and gel silicas, aluminum hydroxide, aluminum silicate, alumina, alumina trihydrate, insoluble sodium metaphosphate, calcium pyrophosphate, calcium hydrogen phosphate, dicalcium phosphate, chalk, hydroxyapatite, hydrotalcites, talc, magnesium aluminum silicate (Veegum ^®), Calciumsuifat, magnesium carbonate, Magnesium oxide, sodium aluminum silicates, for example zeolite A or organic polymers, for example polymethacrylate, can be used. The polishing agents are preferably used in smaller amounts, for example 1-10% by weight. The dental and / or oral care products according to the invention can be improved in their organoleptic properties by adding aromatic oils and sweeteners. All natural and synthetic aromas customary for mouth, tooth and / or denture care products are suitable as aroma oils. Natural flavors can be used both in the form of the essential oils isolated from the drugs and in the individual components isolated from them. At least one aromatic oil from the group peppermint oil, spearmint oil, anise oil, caraway oil, eucalyptus oil, fennel oil, cinnamon oil, geranium oil, sage oil, thyme oil, marjoram oil, basil oil, citrus oil, Gaultheria oil or one or more synthetically produced components of these oils isolated therefrom should be contained. The most important components of the oils mentioned are, for example, menthol, carvone, anethole, cineol, eugenol, cinnamaldehyde, geraniol, citronellol, linalool, salves, thymol, terpinene, terpinol, methylchavicol and methyl salicylate. Other suitable flavors are, for example, menthyl acetate, vanillin, jonone, linalyl acetate, rhodinol and piperiton. Suitable sweeteners are either natural sugars such as sucrose, maltose, lactose and fructose or synthetic sweeteners such as saccharin sodium salt, sodium cyclamate or aspartame.

In particular, alkyl and / or alkenyl (oligo) glycosides can be used as surfactants. Their preparation and use as surface-active substances are, for example, from US-A-3 839 318, US-A-3 707 535, US-A-3 547 828 DE-A-19 43 689, DE-A-20 36 472 and DE -A-30 01 064 and EP-A-77 167 known. Regarding the glycoside residue, both monoglycosides (x = 1) in which a pentose or hexose residue is glycosidically bonded to a primary alcohol having 4 to 16 carbon atoms, and oligomeric glycosides with a degree of oligomerization x to 10 are suitable. The degree of oligomerization is a statistical mean value which is based on a homolog distribution customary for such technical products.

An alkyl and / or alkenyl (oligo) glycoside is preferably an alkyl and / or alkenyl (oligo) glucoside of the formula RO (C ₆ HιoO) _x -H, in which R is an alkyl and / or Alkenyl group with 8 to 14 carbon atoms and x has an average of 1 to 4. Alkyl oligoglucosides based on hardened C _{2 /} i ₄ coconut alcohol with a DP of 1 to 3 are particularly preferred. The alkyl and / or alkenyl glycoside surfactant can be very good be used sparingly, with quantities of 0.005 to 1% by weight already being sufficient.

In addition to the alkyl glucoside surfactants mentioned, other non-ionic, ampholytic and cationic surfactants may also be present, such as: fatty alcohol polyglycol ether sulfates, monoglyceride sulfates, monoglyceride ether sulfates, mono- and / or dialkyl sulfosuccinates, fatty acid isethionates, fatty acid seguric acid amides, fatty acid seguric acid amides, fatty acid segaric acid amides, fatty acid seguric acid amides, fatty acid segaric acid amides, fatty acid seguric acid amides, fatty acid segaric acid amides, fatty acid segaric acid amides, fatty acid segasucurate fatty acids, fatty acid sarcosinate fatty acids, kylamido-betaine and / or protein fatty acid condensates, the latter preferably based on wheat proteins. In particular for the solubilization of the mostly water-insoluble aromatic oils, a nonionic solubilizer from the group of surface-active compounds may be required. Particularly suitable for this purpose are e.g. ethoxylated fatty acid glycerides, ethoxylated

Fatty acid sorbitan partial esters or fatty acid partial esters of glycerol or sorbitan oxethylates. Solubilizers from the group of the ethoxylated fatty acid glycerides primarily comprise addition products of 20 to 60 mol ethylene oxide with mono- and diglycerides of linear fatty acids with 12 to 18 carbon atoms or with triglycerides of hydroxy fatty acids such as oxystearic acid or ricinoleic acid. Other suitable solubilizers are ethoxylated fatty acid sorbitan partial esters; these are preferably addition products of 20 to 60 mol of ethylene oxide with sorbitan monoesters and sorbitan diesters of fatty acids with 12 to 18 carbon atoms. Also suitable solubilizers are fatty acid partial esters of glycerol or sorbitan oxyethylates; these are preferably mono- and diesters of -C ₂ -C ₈ fatty acids and addition products of 20 to 60 moles of ethylene oxide with 1 mole of glycerol or with 1 mole of sorbitol.

The oral, dental and / or denture care agents according to the invention preferably contain adducts of 20 to 60 mol ethylene oxide with hardened or unhardened castor oil (ie with oxystearic acid or ricinoleic acid triglyceride), with glycerol mono- and / or as a solubilizer for aromatic oils which may be present -distearate or sorbitan mono- and / or -distearate.

Other common additives for mouth, tooth and / or denture care agents are, for example Pigments, e.g. titanium dioxide, and / or dyes, pH-adjusting agents and buffer substances such as sodium bicarbonate, sodium citrate, sodium benzoate, citric acid, phosphoric acid or acid salts, e.g. NaH ₂ P0 ₄ wound healing and anti-inflammatory substances such as allantoin, urea, panthenol, azulene or chamomile extract other substances effective against calculus such as organophosphonates, for example hydroxyethane diphosphonates or azacycloheptane diphosphonate, preservatives such as sorbic acid salts, p-hydroxybenzoic acid esters. Plaque inhibitors such as hexachlorophene, chlorhexidine, hexetidine, triclosan, bromochlorophene, phenylsalicylic acid ester.

In a particular embodiment, the composition is a mouthwash, a mouthwash, a denture cleaner or a denture adhesive.

For denture cleaners preferred according to the invention, in particular

Denture cleaning tablets and powders, in addition to the ingredients already mentioned for oral, dental and / or dental prosthesis care, are also suitable for per-compounds such as peroxoborate, peroxomonosulfate or percarbonate. They have the advantage that they have a deodorising and / or disinfecting effect in addition to the bleaching effect. The use of such per compounds in prosthesis cleaners is between 0.01 and 10% by weight, in particular between 0.5 and 5% by weight.

Enzymes such as e.g. Proteases and carbohydrase, suitable for breaking down proteins and carbohydrates. The pH can be between pH 4 and pH 12, in particular between pH 5 and pH 11.

In addition, further auxiliaries necessary for the denture cleaning tablets, such as agents that produce a bubbling effect, such as C0 ₂ releasing substances such as sodium bicarbonate, fillers such as sodium sulfate or dextrose, lubricants, for example magnesium stearate, glidants such as colloidal silicon dioxide and granulating, like the already mentioned high molecular weight polyethylene glycols or polyvinyl pyrrolidone. Denture adhesives can be offered as powders, creams, foils or liquids and support the adhesion of the dentures.

Natural and synthetic swelling agents are suitable as active ingredients. In addition to alginates, plant gums such as e.g. Gum arabic, tragacanth and karaya gum as well as natural rubber. In particular, alginates and synthetic swelling agents, e.g. Sodium carboxymethyl cellulose, high molecular weight ethylene oxide copolymers, salts of poly (vinyl ether-co-maleic acid) and polyacrylamides.

Particularly suitable auxiliaries for pasty and liquid products are hydrophobic bases, in particular hydrocarbons, such as white petroleum jelly (DAB) or paraffin oil.

pictures

Fig. 1 shows schematically the DNA fragment of glucanase (Glu), Fig. 5 shows the associated DNA and protein sequences (SEQ ID NO: 3 and 4) (see Example 1).

Fig. 2 shows schematically the DNA fragment of the hybrid enzyme from glucanase and small binding domain (KBD), Fig. 6 shows the associated DNA and protein sequences (SEQ ID NO: 7 and 8) (see Example 2).

Fig. 3 shows schematically the DNA fragment of the hybrid enzyme from glucanase and large binding domain (GBD), Fig. 7 shows the associated DNA and protein sequences (SEQ ID NO: 12 and 13) (see Example 3).

Fig. 4 shows schematically the DNA fragment of the hybrid enzyme from glucanase and medium binding domain (MBD), Fig. 8 shows the associated DNA and protein sequences (SEQ ID NO: 17 and 18) (see Example 4).

embodiments

Example 1 :

Isolation of the β-glucanase gene (EC 3.2.1.6, X00754) from B. subtilis DNA was isolated from B. subtilis using the DNeasy Kit (Qiagen) using standard methods. The gene was in a PCR reaction (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1, 5 mM MgCl ₂ , Gibco; 2.5 U Taq polymerase, Gibco) with the primers GluBcl (5TGATCATGCCTTATCTGAAACGAG3 ') (SEQ ID NO: 1) and GluSac (5OAGCTCTTATTTTTTTGTATAGCGC3') (SEQ ID NO: 2) (both 0.6 μM each) were amplified in a thermal cycler (Eppendorf) under the following conditions:

94 ° C for 5 minutes

30 cycles:

94 ° C for 30 seconds

55 ° C 30 seconds

72 ° C 1 minute 30 seconds final elongation:

72 ° C for 7 minutes

The amplificate was cloned into the TA cloning vector (pGEM-Teasy, Promega) and transformed into XLIBIue MRF 'E. coli cells (Stratagene) (according to the manufacturer's instructions).

For expression, the isolated gene had to be transferred to a Bacillus expression system. The plasmid was isolated from an overnight culture of the transformed E. coli cells using the QIAprep Spin Miniprep Kit (Qiagen). The gene was then cut from the pGEM-Teasy vector with the restriction enzymes Bell and Sacl and integrated into the corresponding cleavage sites of the Henkel Bacillus expression vector pAWA31. The transformed Bacillus subtilis cells were deficient before the transformation with glucanase (strain MW10, Bacillus Genetic Stock Center, Columbus, USA).

Example 2:

Isolation of the β-glucanase (EC 3.2.1.6, X00754) from B. subtilis with incorporation of the small positive binding domain (KBD):

The small binding domain corresponds to the DNA range 238-276 base pairs from the sbsA gene (X71092) from Geobacillus stearothermophilus. The gene codes for a Surface protein. The sequence was added by extending the glucanase primer (without stop codon). The stop codon was placed behind the region of the sbsA gene.

DNA was isolated from B. subtilis using the DNeasy Kit (Qiagen) using standard methods. The gene was in a PCR reaction (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1, 5 mM MgCl ₂ , Gibco; 2.5 U Taq polymerase, Gibco) with the primers GluBcl (5TGATCATGCCTTATCTGAAACGAG3 ') (SEQ ID NO: 5) and GluKyrSac (5'GAGCTCCTAACGGTATCGTTTTTTCGCTTTGTTGTATTCAGCATATACTTTTTTTG TAT AGCGC3 ") (SEQ ID NO: 6) (both 0.6 μM) in a thermal cycler (Eppendorf) under the following conditions

94 ° C for 5 minutes

30 cycles:

94 ° C for 30 seconds

55 ° C 30 seconds

72 ° C 50 seconds final elongation:

72 ° C for 7 minutes

The amplificate was cloned into the TA cloning vector (pGEM-Teasy, Promega) and transformed into XLI BIue MRF 'E. coli cells (Stratagene) (according to the manufacturer's instructions).

Example 3: Isolation of the β-glucanase (EC 3.2.1.6, X00754) from B. subtilis with incorporation of the large positive binding domain (GBD):

The large positive binding domain corresponds to the DNA region 276-686 base pairs from the sbsC gene (AF055578) from Geobacilus stearothermophilus (DSM22). The gene codes for a surface protein. The sequence was isolated by PCR and ligated molecularly to the C-terminus of the glucanase. The ligation was carried out through a Kas interface, which functions as a linker between the two domains.

DNA was isolated from B. subtilis and G. stearothermophilus using the DNeasy Kit (Qiagen) using standard methods.

The glucanse gene without a stop codon was obtained in a PCR reaction from B. subtilis DNA (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1, 5 mM MgCl ₂₎ Gibco; 2.5 U Taq polymerase, Gibco) with the primers GluBcl (5TGATCATGCCTTATCTGAAACGAG3 ') and GluKas (5'GGCGCCTTTTTTTGTATAG CGCACCC3') (SEQ ID NO: 9) (both 0.6 μM) in a Thermocyeler (Eppendorf) under the following Conditions amplified:

94 ° C for 5 minutes

30 cycles:

94 ° C for 30 seconds

60 ° C for 30 seconds

72 ° C 50 seconds final elongation:

72 ° C for 7 minutes

The gene segment from the sbsC gene from G. stearothermophilus DNA was analyzed in a PCR reaction (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1.5 mM MgCl ₂ , Gibco; 2.5 U Taq polymerase , Gibco) with the primers KassbsC (5'GGCGCCGACAAAAAGAAAGCAGTCAAA3 ') (SEQ ID NO: 10) and SacsbsC (5OAGCTCTTAGCGCATTTTGTCTMTTTTG3 ¹ ) (SEQ ID NO: 11) (both 0.1 μM each) in a thermocyeler under the following conditions (Eppendorf amplified: 94 ° C 10 minutes 30 cycles:

94 ° C 30 seconds 60 ° C 30 seconds 72 ° C 45 seconds final elongation: 72 ° C 10 minutes

A stop codon was inserted at the end of the sbsC section by the primer SacsbsC.

According to the manufacturer's instructions, the fragments were cloned into the pGEM-Teasy vector (Promega) and transformed into JM110 cells (Stratagene).

Plasmids were isolated using the QiaPrep Spin Kit (Qiagen).

Fragment Isolation

Glucanase: The glucanase was isolated from the vector in two steps. plasmid

DNA was mixed with buffer A (final conc. 1x) and 50 units of Narl (both tubes) for 6 h at 37

° C split. The DNA was concentrated using the PCR purification kit (Qiagen) and then cleaved with 1x buffer M and 50 units Bell (Röche) at 37 ° C. for 3 h.

SbsC: gene fragment: The sbsC gene fragment was isolated from the vector in two steps. Plasmid DNA was mixed with buffer A (final conc. 1x) and 50 units of Narl (both

Röche) for 3 h at 37 ° C and then with an additional 25 units of Sacl

(Röche) split at 37 ° C for 3 h.

Both fragments were separated from the vector on a preparative, 2% agarose gel, cut out under UV light and purified from the gel using the QIAquick Gel Extraction Kit (Qiagen).

Approximately 20 ng of the glucanase were ligated with approx. 60 ng GBD in the presence of 1x ligation buffer and 0.5 U T4 ligase (Röche) at 4 ° C. overnight.

The ligation product was combined with the primers GluBcl and SacsbsC (both 0.6 μM each) in the presence of (1x PCR buffer, Qiagen; 0.3 mM each dNTP, Gibco; 2.5 U ProofStart DNA polymerase, Qiagen) in one Thermocyeler (Eppendorf) amplified under the following conditions:

94 ° C for 5 minutes

30 cycles:

94 ° C for 30 seconds

60 ° C for 30 seconds

72 ° C 1 minute 10 seconds final elongation:

72 ° C for 7 minutes

The amplificate was integrated into the Henkel Bacillus expression vector pAWA31 via the built-in interfaces Bell and Sacl. The transformed Bacillus subtilis Cells were deficient before transformation to glucanase (strain MW10, Bacillus Genetic Stock Center, Columbus, USA).

Example 4:

Isolation of the β-glucanase (EC 3.2.1.6, X00754) from B. subtilis with incorporation of the medium, positive binding domain (MBD):

The middle positive binding domain is an artificially synthesized DNA segment, which is characterized in that it contains regions with positive charges. The MBD was synthesized using two successive PCR reactions. The sequence is determined by the choice of the primers used. The primers themselves served as template DNA.

DNA was isolated from B. subtilis using the DNeasy Kit (Qiagen) using standard methods.

The glucanse gene without a stop codon was isolated in a PCR reaction from B. subtilis DNA (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1.5 mM MgCl ₂ , Gibco; 2.5 U Taq - Polymerase, Gibco) with the primers GluBcl (5TGATCATGCCTTATCTGAAACGAG3 ') and GluKas (5'GGCGCCTTTTTTTGTATAG CGCACCC3') (both 0.6 μM each) amplified in a Thermocyeler (Eppendorf) under the following conditions:

94 ° C for 5 minutes

30 cycles:

94 ° C for 30 seconds

60 ° C for 30 seconds

72 ° C 50 seconds final elongation:

72 ° C for 7 minutes

The MBD was synthesized in two successive PCR reactions. In the first reaction, an 81 bp fragment was amplified in a Thermocyeler (Eppendorf) under the following conditions: 1x PCR buffer, Gibco; 0.2 mM per dNTP, Gibco; 1.5 mM MgCl ₂₎ Gibco; 2.5 U Taq polymerase, Gibco Primer: PBD front

(5'GGCGCCCAGCTGAAGAAGAAGCTGCAGGCACTCAAGAAGAAGAATGCGCAGCT A3 ') (SEQ ID NO: 14) PBDmitte (5OTTCTTAAGTGCCTGCAGCTTCCACTTTAGCTGCGCATTCTTCTTCTTGA3') (SEQ

ID NO: 15) (both 0.1 μM each)

PCR scheme: 94 ° C 5 minutes 10 cycles:

94 ° C 30 seconds 60 ° C 30 seconds 72 ° C 10 seconds final elongation: 72 ° C 7 minutes

The 81 bp fragment was placed in a new PCR reaction (1x PCR buffer, Gibco; 0.2 mM each dNTP, Gibco; 1.5 mM MgCl ₂ , Gibco; 2.5 U Taq polymerase, Gibco) with the primers PBDvorne

(5'GGCGCCCAGCTGAAGAAGAAGCTGCAGGCACTCAAGAAGAAGAATGCGCAGCT A3 ') and PBD rear

(5'GAGCTCTCAACAACCGCCCTGCGCCAGCTTCTTCTTAAGTGCCTGCAGCT3 ^! ) (SEQ ID NO: 16) (both 0.1 μM each). The amplification scheme was as follows:

94 ° C for 5 minutes

10 cycles:

94 ° C for 30 seconds

60 ° C for 30 seconds

72 ° C 10 seconds final elongation:

72 ° C for 7 minutes A stop codon was inserted at the end of the PBD section by the primer PBD rear.

The fragments were cloned according to the manufacturer's instructions into the pGEM-Teasy vector (Promega) and transformed into XL1-Blue MRF 'cells (Stratagene).

Plasmids were isolated using the QiaPrep Spin Kit (Qiagen).

Fragment isolation glucanase: The glucanase was isolated from the vector in two steps. Plasmid DNA was cleaved with buffer A (final conc. 1x) and 50 units of Narl (both tubes) for 6 h at 37 ° C. The DNA was concentrated using the PCR purification kit (Qiagen) and then cleaved with 1x buffer M and 50 units Bell (Röche) at 37 ° C. for 3 h.

MBD: The MBD fragment was isolated from the vector in two steps. Plasmid DNA was digested with buffer A (final conc. 1x) and 50 units of Narl (both tubes) for 3 hours at 37 ° C. and then split with an additional 25 units of Sacl (tubes) at 37 ° C. for 3 hours.

Approximately 20 ng of the glucanase were ligated with approx. 60 ng MBD in the presence of 1x ligation buffer and 0.5 U T4 ligase (Röche) at 4 ° C. overnight.

The ligation product was combined with the primers GluBcl and PBDhinten (both 0.6 μM each) in the presence of (1x PCR buffer, Qiagen; 0.3 mM each dNTP, Gibco; 2.5 U ProofStart DNA polymerase, Qiagen) in one Thermocyeler (Eppendorf) amplified under the following conditions:

94 ° C 5 minutes 30 cycles: 94 ° C for 30 seconds

60 ° C for 30 seconds

72 ° C 1 minute 10 seconds final elongation:

72 ° C for 7 minutes

The amplificate was integrated into the Henkel Bacillus expression vector pAWA31 via the built-in interfaces Bell and Sacl. The transformed Bacillus subtilis cells were deficient before the transformation with glucanase (strain MW10, Bacillus Genetic Stock Center, Columbus, USA).

Example 5:

A B. subtilis glucanase was cloned. This enzyme has been genetically engineered with three different, positively charged binding domains:

GluMBD: glucanase + linker + artificial binding domain

GluKBD: glucanase + small positively charged area from surface protein from G. stearothermophilus GluGBB: glucanase + linker + large positively charged area from surface protein from G. stearothermophilus. Fig. 1).

The binding and hydrolysis ability of these cloned enzymes was tested in comparison to the unmodified glucanase on pectin agar (negatively charged polysaccharide). Insoluble glucan was added to the agar. The cloned enzymes were used with the same activity. Each cloned enzyme was pipetted onto the agar for 5 minutes at 4 ° C., removed and washed twice with buffer. The agar was then overlayed with buffer and incubated at 37 ° C. A blue coloration showed that only where hybrid enzymes (GluMBD, GluKBD, GluGBD) were pipetted onto the agar, the insoluble glucan was hydrolyzed.

Example 6:

Sample recipes for household cleaners

Example 7: p1 values of β-glucanase with different cationic binding units

The pl values were calculated in silico using the ExPASy Compute pl / Mw program (Bjellqvist, B., Hughes, GJ, Pasquali, Ch., Paquet, N., Ravier, F., Sanchez, J.-Ch., Frutiger, S. & Hochstrasser, DF The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 1993, 14, 1023-1031, Bjellqvist, B., Basse, B., Olsen, E. and Celis, JE Reference points for comparisons of two-dimensional maps of proteins from different human cell types defined in a pH scale where isoelectric points correlate with polypeptide compositions. Electrophoresis 1994, 15, 529-539).

Table 1: β-glucanase with small (KBD, VYAEYNKAKKRYR), medium (MBD, GAQL-KKKLQALKKKNAQLKWKLQALKKKLAQGGC) and large binding domain (GBD, GA-sbsC2-i3 _δ ) compared to the enzyme with KKEKK-binding

Claims

claims

1. Hybrid enzyme comprising a hydrolytically active unit and a cationic binding unit.

2. Hybrid enzyme according to claim 1, characterized in that it is a fusion protein.

3. Hybrid enzyme according to claim 1 or 2, characterized in that the hydrolytically active unit is a peptide or protein which is able to degrade oligosaccharides or polysaccharides.

4. Hybrid enzyme according to claim 1 or 2, characterized in that the hydrolytically active unit is a peptide or protein which is able to degrade oligo- or polypeptides.

5. Hybrid enzyme according to claim 1 or 2, characterized in that the hydrolytically active unit is a peptide or protein which is able to degrade oligo- or polynucleotides.

6. Hybrid enzyme according to one of claims 1 to 5, characterized in that the cationic binding unit comprises a polypeptide with between 10 and 140 amino acids.

7. Hybrid enzyme according to one of claims 1 to 6, characterized in that the cationic binding unit has on average between 0.01 and 0.8 positive charges per amino acid residue at neutral pH.

8. Hybrid enzyme according to one of claims 1 to 7, characterized in that the cationic binding unit is an artificially produced, naturally non-occurring sequence.

9. Hybrid enzyme according to claim 8, characterized in that the cationic binding unit is a polypeptide with an amino acid sequence according to SEQ ID NO: 21 or a derivative thereof.

10. Hybrid enzyme according to one of claims 1 to 7, characterized in that the cationic binding unit is a polypeptide fragment of a naturally occurring surface protein.

11. Hybrid enzyme according to claim 10, characterized in that the naturally occurring surface protein is a surface layer protein or a derivative thereof.

12. Hybrid enzyme according to claim 11, characterized in that the cationic binding unit is a polypeptide with an amino acid sequence according to SEQ ID NO: 19 or according to SEQ ID NO: 20 or a derivative of said polypeptides.

13. Enzyme preparation comprising a hybrid enzyme according to any one of claims 1 to 12.

14. Enzyme preparation according to claim 13, characterized in that it additionally contains non-modified enzymes selected from polysaccharidases, proteases and nucleases.

15. Preparation selected from the group consisting of sterilizing, disinfecting, washing and cleaning agents, characterized in that it contains a hybrid enzyme according to one of claims 1 to 12 or an enzyme preparation according to claim 13 or 14.

16. Preparation according to claim 15, characterized in that the hybrid enzyme and / or the enzyme preparation are contained in the preparation in amounts of up to 10% by weight.

17. Preparation according to claim 15 or 16, characterized in that it contains at least one further component selected from the group consisting of surfactants, builders, co-builders, acids, alkalis, thickeners, solvents, solubilizers and abrasives.

18. Preparation according to one of claims 15 to 17, characterized in that it contains at least one further auxiliary or additive selected from the group consisting of UV stabilizers, corrosion inhibitors, cleaning enhancers, antistatic agents, perfumes, dyes, pearlescent agents, opacifiers and skin protection agents.

19. Product containing an enzyme preparation or a cleaning agent according to one of the preceding claims and a spray dispenser for metering the enzyme preparation or cleaning agent as an aerosol and / or as a foam.

20. A method for the hydrolysis of biofilms on surfaces by incubation with a hybrid enzyme, an enzyme preparation or a cleaning agent according to any one of the preceding claims, optionally using a product according to the preceding claim, characterized in that the vitality of the microbial cells is not sustainably damaged.

21st Process for the hydrolysis of biofilms on surfaces, characterized in that the hybrid enzyme, the enzyme preparation or the cleaning agent according to one of the preceding claims, optionally using a product according to the invention according to claim 18, is applied to the surface covered with biofilm, optionally with a cloth, a sponge, brush or other utensil suitable for cleaning is blurred or rubbed on the surface affected by biofilm and, if necessary after an exposure time of 1 to 30 minutes, a few hours or overnight, rinsed with clear water, after which the surface wiped with a dry cloth.

22. Use of hybrid enzymes, enzyme preparations or cleaning agents according to one of the preceding claims for the destruction and removal of biofilms on surfaces.

23. Use according to claim 22, characterized in that the surface is a hard surface.

24. Use of hybrid enzymes, enzyme preparations or cleaning agents according to one of the preceding claims for cleaning textiles.

25. Product from an enzyme preparation or a cleaning agent according to one of the preceding claims and a multi-chamber bottle.

26. Cosmetic and / or pharmaceutical preparation containing hybrid enzymes according to one of claims 1 to 12.

27. Cosmetic and / or pharmaceutical preparation according to the preceding claim, characterized in that the preparation is oral, dental or denture care products.

28. Use of hybrid enzymes according to one of claims 1 to 12 for the production of a cosmetic preparation.

29. Use of hybrid enzymes according to one of claims 1 to 12 for the manufacture of a medicament.

30. Polypeptide with an amino acid sequence as shown in SEQ ID NO: 21 or a derivative thereof.

31. Nucleic acids coding for a hybrid enzyme according to one of claims 1 to 12 or for polypeptide according to claim 30.