WO2005045071A1 - Procedes d'identification de genes actifs - Google Patents

Procedes d'identification de genes actifs Download PDF

Info

Publication number
WO2005045071A1
WO2005045071A1 PCT/GB2004/004577 GB2004004577W WO2005045071A1 WO 2005045071 A1 WO2005045071 A1 WO 2005045071A1 GB 2004004577 W GB2004004577 W GB 2004004577W WO 2005045071 A1 WO2005045071 A1 WO 2005045071A1
Authority
WO
WIPO (PCT)
Prior art keywords
organism
gene
promoter
vector
retroviral vector
Prior art date
Application number
PCT/GB2004/004577
Other languages
English (en)
Inventor
Thomas Becker
Staale Ellingsen
Original Assignee
Forinnova As
Owen, Deborah
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forinnova As, Owen, Deborah filed Critical Forinnova As
Publication of WO2005045071A1 publication Critical patent/WO2005045071A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • This invention relates to methods of identifying genes that are active in a particular cell or tissue at a defined time in the lifespan of an organism.
  • the invention also relates to new vectors for use in these methods.
  • Large scale sequencing projects such as the sequencing of the human genome, the mouse genome, the Drosophila genome and the zebrafish genome amongst others, are producing a vast amount of sequence data. Whilst this sequence data is very useful, the data is currently being produced at a rate which far exceeds the rate at which the function of the new genes that are identified within these sequences can be determined.
  • information about the function of genes has been derived from the analysis of genetic mutations in whole organisms, and the effects of the mutations on the phenotypes of the animals.
  • genes affecting various diseases have been identified in humans through studying family histories of diseases, and the collection and annotation of spontaneous mutations in mice has been ongoing for many years. These mutations are however identified by virtue of their disease association or by the association of the mutations with a striking visual phenotype, and the vast majority of genes and their functions cannot be identified in this manner. Furthermore, spontaneous mutations occur with relatively low frequency and thus it would be an immense task to elucidate even a single genetic pathway by relying on the appearance of spontaneous mutations. The frequency of spontaneous mutations is around 5xl0 "6 per locus. These spontaneous mutations may arise in the coding sequence of the gene or alternatively may affect regulatory sequences, and may range from single base changes to the insertion of large retroviral sequences.
  • Ethylnitrosourea is a chemical mutagen which is easy to apply and which generates point mutations i.e. single base or nucleotide changes in the genetic sequence of animals. This chemical has therefore been widely used to generate mutations and hence mutant animals in vivo.
  • DNA into the genome of the animal which takes place in the cell of these animals may occur in a location that disrupts normal endogenous gene function and may in turn lead to a visually identifiable phenotype.
  • the locus of insertion may -be identified and cloned using the exogenous sequence as a tag, and the gene identified in this way may be correlated with and related to the phenotype.
  • Transgenic insertional mutagenesis is however labour intensive, particularly in mice, requiring many rounds of screening and breeding.
  • a further technique that has been used to generate mutants is that of homologous recombination in ES cells.
  • regions of homology between an artificial construct and a known endogenous nucleic acid sequence allow recombination between these two nucleic acid molecules to occur.
  • the ability to introduce mutations or deletions into the sequence of the artificial construct means that, should homologous recombination occur, the mutation or deletion appears in the gene of interest.
  • a selectable marker is often also included in this region, to aid the identification of cells in which homologous recombination has occurred.
  • the ES cells are then implanted into the uterus of surrogate females and the individual animals that are derived from this are identified, bred and characterised. This is a highly targeted approach that is particularly labour intensive as the frequency of homologous recombination is low and many ES cells have to be screened. Then, mice have to be generated from the ES cells and these have to be bred and screened. Furthermore, the amount of useful information that may be derived from these studies is difficult to predict in view of genetic redundancy (i.e. the absence of a functional copy of one gene may be compensated for by the presence of another different gene) and the potential occurrence of embryonic lethal phenotypes.
  • Trapping is a further mutagenesis and screening system that has been used in mice and Drosophila and which is considered to be more efficient than the above methods with respect to the ability to characterise gene function and expression. Trapping methods are useful with respect to both the identification of active genes and in the mutagenesis of these genes. These systems depend on the use of genetic vectors that contain reporter genes (whose presence may be readily detected) and, following insertion of vector DNA into the host genome, utilise the host's transcription system to direct expression of the reporter gene. There are three types of strategy that have been developed for this kind of mutagenesis and screening.
  • the enhancer-trap utilises a vector that contains a minimal (or basal) promoter sequence and a reporter gene such as lacz. Insertion of vector nucleotide sequences near to an active cw-acting enhancer element will cause expression of the reporter gene. This expression does not occur if the vector nucleotide sequences insert in other locations. This expression of the reporter gene is then detected and the gene associated with this expression can be cloned based on the presence of the nucleotide sequence of the trap vector. If the insertion has occurred in a gene, any phenotype (or change in phenotype) of the organism can be studied in relation to the newly identified gene.
  • Promoter trap vectors lack a promoter and contain a reporter gene (which may also act as a selectable marker). If the reporter gene does not act as a selectable marker then a further selectable marker is also required. If the vector inserts into a transcribed region of a gene downstream of the first exon, then a fusion is generated which is made up of the upstream endogenous transcribed sequence fused to the reporter (and marker) gene. Transcribed genes are identified by detection of the reporter gene, however the frequency of insertion is low. The selectable marker gene is therefore used to identify cells that contain vector insertions.
  • the third type of vector is the gene trap vector. This contains a splice acceptor site upstream of a promoterless reporter gene.
  • a fusion transcript results from the upstream coding sequence and the reporter gene.
  • the trapped gene is thus mutated and its gene expression pattern can be mapped.
  • the trap vectors used to date have been either injected into the pronucleus of fertilised mouse oocytes or transfected into ES cells of various organisms. The disadvantage of this technique is the need for preselection in ES cells. For a gene to be identified, it must be active both in ES cells and in the cells of interest within the organism, and the fusion must occur so that the correct reading frame is maintained. Alternatively, gene trap vectors have been introduced using retroviral infection methods.
  • Enhancer trapping in Drosophila is generally carried out using transposon-mediated enhancer traps i.e. a transposable element carrying a reporter gene under the control of an internal basal promoter (O'Kane and Gehring (1987) P.N.A.S. USA 84(24): 245-253, Bier etal. (1989) Genes Dev 3: 1273-1287), Bellen et al. (1989) Genes Dev 3(9): 1301-1313). These allow flanking genomic sequences to be identified rapidly, when the element inserts near to a gene enhancer. In addition, 10 to 15% of the insertions are mutagenic (Bellen et al., supra).
  • Transposon based systems have also been used in zebrafish in order to generate transgenic animals.
  • Transposon systems derived from Tc3 of C.elegans (Raz et al. (1997) Current Biology 8 : 82-88), and mariner of Drosophila (Fadool et al. (1998), P.N.A.S. USA, 95: 5182-5186) have been used and a Tcl2 transposon system has been identified in the medaka fish which has been considered to be useful to develop transgenesis and mutagenesis methods (Kawakami et al. (2000) P.N.A.S. USA, 97(21): 11403-11408).
  • the significant drawback of the use of a transposon based technique is the rate of insertion.
  • the prior art techniques thus all have disadvantages, which are overcome by the method of the invention.
  • the enhancer trap system using transposons is very inefficient with respect to the number of insertions.
  • the gene trap technique of Chen et al. ((2002) supra) has not itself identified any mutations and the standard retroviral based insertional mutagenesis technique of Gaiano et al. is very labour intensive, and the used vector is non-expressing and therefore does not identify active genes. Thus what is required is an efficient method of identifying active genes that overcomes these disadvantages.
  • the Gaiano et al. technique relies on the generation of an F 0 generation, containing insertions. These are pair-mated to grow F x families.
  • This Fj generation is tail clipped to isolate DNA, on which quantitative PCR is performed to identify fish with multiple insertions, and those with 8 or more insertions are pair-mated. Around 50 fish per pair-mating are raised and 6 matings per family are then performed. The resulting embryos are then examined. The techniques of identifying fish that contain the mutation are thus time consuming. It can be seen from this that if it were possible to preselect insertions that have occurred within genes before the zebrafish undergo breeding to homozygosity, it would be possible to identify ten times as many unique mutations.
  • the detected active genes can be cloned from these heterozygous Fj, animals and the nature of the insertion inspected for mutagenicity before inbreeding is attempted.
  • the inventors have therefore designed an improved method of enhancer trapping, which preferably generates insertional mutants.
  • This new method using retroviral vectors, increases the efficiency and sensitivity of such screens in identifying active genes (and also mutagenesis of said genes) in a wide variety of developmental processes and hence improves the ability to clone these genes.
  • the method has the further advantage in that it is possible to affect the types of genes which are detected in such a screen (with respect to the normal temporal or spatial expression pattern of the gene) by selecting various components of the retroviral vector.
  • the new method of the invention may be applied to other organisms, particularly other animals and especially vertebrate animals, particularly those useful as model animals or in genomic studies, e.g. rodents, fish, reptiles, frogs (e.g. Xenopus or other amphibians).
  • the new method may also be applied to invertebrate organisms, e.g. Drosophila and C. elegans, chordates, crustaceans and mollusks.
  • the new technique has numerous advantages including the following; it can allow the selection of live embryos of interest (i.e. containing the insertion at a site which is being transcribed) at an early stage of the screen, thus reducing the number of animals required.
  • the technique identifies cells in which the identified gene would be active in a wild type organism.
  • the embryos that are selected may then be bred, and only those that are expressing proviral insertions are used to identify and isolate the genes of interest.
  • the sensitivity of the screen can be enhanced significantly using new indirect methods of detecting the expression of a reporter gene.
  • the enhancer trap technique designed by the inventors has the further advantage that insertions tend to occur towards the 5' end of genes, in view of the fact that the vectors are based on retroviral sequences. This further increases the efficiency of the screen as the chances of the basal promoter being activated are increased (Wu et al. (2003) Science 300 (5626): 1749-51).
  • a very low percentage of insertions are also seen in housekeeping genes (i.e. genes which are constitutively expressed and encode proteins which are required for the normal function of the cell) in contrast to standard insertional mutagenesis, in which the majority of insertions detected are insertions into housekeeping genes.
  • housekeeping genes i.e. genes which are constitutively expressed and encode proteins which are required for the normal function of the cell
  • standard insertional mutagenesis in which the majority of insertions detected are insertions into housekeeping genes.
  • the invention provides a method of enhancer trapping in an organism, comprising introducing a retroviral vector into said organism (e.g. into a cell of said organism), wherein said vector comprises a basal promoter and a detectably expressible gene.
  • a retroviral system for performing enhancer trapping has not been used before. The reason for this is that retroviral LTRs contain strong promoters.
  • the presence of such a promoter in the construct would be expected to override the presence of the basal promoter in the enhancer trap vector and cause expression of the detectably expressible gene in any cells in which the retroviral sequences have integrated.
  • the method would thus lack the crucial feature of enhancer trapping techniques, i.e. being able to distinguish between active and inactive genes by virtue of the fact that expression of the exogenous gene only occurs when insertion near an active cis-acing host enhancer occurs. It should be noted that the problem with the LTR of a retroviral vector overriding a basal promoter would not be problematic in other trap systems, e.g.
  • the vectors used do not contain or require any promoter sequences but instead use the promoter sequences from the host organism as the reporter gene is spliced into the transcript generated from the gene that the vector has integrated into.
  • the promoters found in retroviral LTRs are not generally active.
  • an LTR from a retrovirus that infects one species is surprisingly inactive as a promoter when integrated into the genome of a different species, and thus does not cause the exogenous expression of the detectably expressible gene irrespective of the locus of integration, as would have been expected.
  • the LTR from a murine retrovirus e.g.
  • the mouse retrovirus MLV is inactive as a promoter in lower vertebrates such as fish, and in particular zebrafish and medaka fish. It is thus possible to use retroviral vectors in methods to detect expression of active genes and thereby study expression patterns of these genes.
  • the LTR of the retroviral vector is substantially or essentially inactive or non-functional or not recognised or not utilised as a promoter when integrated into the genome of the organism being studied.
  • the LTR of the retroviral vector should however be active as a promoter in the packaging cells that are used to produce vector for infection. The generation of retroviral particles for infection depends on this activity.
  • the retroviral LTR functions as a promoter i.e.
  • the LTR is an active promoter, preferably a strong promoter, in the packaging cell line (which is generally a mammalian cell line), and is inactive or non-functional or not recognised or not utilised as a promoter when integrated into the genome of the host organism being studied.
  • the LTR is capable of driving transcription, or contains sequences capable of driving transcription in the packaging cell line, but does not drive transcription in the host organism.
  • transcription of the detectably expressible gene directly or indirectly causes expression of a marker protein that can be detected in a live said organism.
  • the present invention provides a retroviral vector for use in enhancer trapping in an organism, said vector comprising a basal promoter and a detectably expressible gene and preferably wherein transcription of said detectably expressible gene directly or indirectly causes expression of a marker protein or polypeptide that can be detected in a live said organism.
  • Said retroviral vector is preferably for use in a method of enhancer trapping of the invention, as described herein.
  • Kits comprising said retroviral vectors as described herein form yet further aspects of the invention.
  • Kits according to the invention may comprise one or more retroviral vectors as described herein and other components as described elsewhere herein.
  • kits according to the invention may be used for methods of enhancer trapping and/or methods of identifying an active gene, and in particular can be used for carrying out the methods of the invention as described herein.
  • the detectably expressible gene may thus cause expression of (e.g. it may encode or it may control the expression of) a marker protein, which may be directly or indirectly detected.
  • the marker protein may be a polypeptide e.g. may be any polypeptide, including also shorter peptide sequences, proteins and RNA.
  • a polypeptide may be detected by the effect it has on the host or the host cell in which it is expressed.
  • the detectably expressible gene may thus be viewed as a marker gene, which may include not only conventional marker genes such as reporter genes but also a therapeutic gene.
  • the detectably expressible gene may be a reporter gene which may be directly detectable, i.e. it may itself be directly signal-giving or it may itself directly be detected by a signal-giving mechanism or process, or it may be indirectly detected by taking part in a further, or secondary process or mechanism, which may then itself be directly or indirectly signal-giving, for example by activating, inactivating or causing the expression of a further gene.
  • the invention provides a method of enhancer trapping in an organism, comprising introducing a retroviral vector into said organism (e.g. into a cell of said organism), wherein said vector comprises a basal promoter and a reporter gene.
  • the LTR of said retroviral vector preferably has the properties discussed above.
  • the LTR is preferably a strong promoter or contains a strong promoter which acts in the packaging cell line, and is inactive as a promoter when integrated into the genome of the organism being studied.
  • transcription of said reporter gene directly or indirectly causes expression of a marker protein that can be detected in a live said organism.
  • the organism is assayed to determine whether expression of the detectably expressible gene, e.g. expression of the marker protein, has occurred.
  • the cells in which the detectably expressible gene/marker protein is expressed are identified.
  • a retroviral vector for use in enhancer trapping in a vertebrate or invertebrate said vector comprising a basal promoter and a reporter gene.
  • transcription of said reporter gene directly or indirectly causes expression of a marker protein that can be detected in a live said vertebrate or invertebrate.
  • the retroviral vectors contain an LTR sequence which has the properties discussed above.
  • the LTR sequence is a strong promoter in the packaging cell line, and is inactive as a promoter when integrated into the genome of the organism being studied.
  • the invention can be seen to provide a method of identifying an active gene in an organism, said method comprising (a) introducing a retroviral vector into said organism, wherein said vector is an enhancer trap vector comprising a basal promoter and a detectably expressible gene, and (b) detecting the expression of said detectably expressible gene whereby said expression is indicative of said active gene.
  • Also provided is a method of identifying an active gene in an organism comprising (a) introducing a retroviral vector into said organism, wherein said vector is an enhancer trap vector which comprises (i) a basal promoter which is inactive in said organism in the absence of an enhancer, but which may become active when inserted into the genome of said organism in a position which may trap (e.g. near to) an enhancer of said active gene; and (ii) a detectably expressible gene, e.g. a reporter gene, wherein transcription of said detectably expressible gene/reporter gene directly or indirectly causes expression of a marker protein; and (b) detecting the expression of said marker protein, whereby said expression is indicative of said active gene.
  • an enhancer trap vector which comprises (i) a basal promoter which is inactive in said organism in the absence of an enhancer, but which may become active when inserted into the genome of said organism in a position which may trap (e.g. near to) an enhancer of said active gene; and (ii)
  • an enhancer trap retroviral vector as defined in step (a) above, for use in a method of identifying an active gene in an organism.
  • the retroviral vector contains an LTR sequence having the properties discussed elsewhere herein.
  • the basal promoter of the enhancer trap vector is insufficient in itself to direct or drive the detectable expression of the detectably expressible gene/reporter gene in the organism.
  • the vector inserts into the genome of the organism in a position where the promoter may be "activated" by an enhancer of an active gene (i.e. a gene which is actively being expressed or transcribed) (e.g.
  • the basal promoter may be activated.
  • the enhancer must be near to a gene which is active.
  • the detectably expressible gene/reporter gene may be expressed, leading to expression of the marker protein. Detection of the marker protein may thus lead to, or achieve, identification of the active enhancer which drives expression of a particular active gene.
  • the locus or position of the active gene and enhancer may be detected, and/or they may be identified by other means, for example by sequencing or other genetic analysis techniques.
  • the marker protein thus acts as a "tag" or marker for the active gene or enhancer, through which it may be identified. It will be appreciated that such a method has many uses in genetic studies, e.g. in genomic studies, functional analysis of gene expression, in diagnostics or prognostics, drug discovery, genome annotation etc. It may be used to determine which genes are active at particular times (e.g. the life stages or cell cycle stages), in particular conditions, e.g. environmental conditions, disease states etc, or spatially within a given organism, for example in different cells or tissues. The expression of the marker protein may thus also be used to identify, isolate or observe these different cells or tissues for the purpose of cell culture, RNA expression profiling or developmental studies or mapping of these cells. Comparative studies may thus be carried out.
  • the methods may also be used as a very efficient means for quickly generating large numbers of transgenic lines that express marker genes in specific subsets of cells. These in turn are important to isolate expressing cells.
  • the isolated expressing cells may be used to make tissue specific expression libraries for microchip expression profiling. They may also be used for growth in culture, or may be observed in vivo, to observe their fate in the organism as in organogenesis or circuitry of the central nervous system for the purpose of neuron subtype identification or mapping different neuronal populations.
  • active in the context above and as used elsewhere herein, it is meant that the basal promoter on its own is unable to direct the expression of the detectably expressible gene/ reporter gene (i.e. it has no activity in the host organism) or has low activity, i.e.
  • the promoter is active at low levels only, for example such as to cause negligible, insignificant or undetectable expression of the detectably expressible gene/reporter gene, e.g. the promoter is substantially or essentially inactive.
  • the basal promoter When the basal promoter is “activated” by trapping an enhancer in the host organism, it becomes “active” in the sense of being able to direct detectable or significant expression of the detectably expressible gene/reporter gene.
  • active and “inactive” (together with the alternative terms “nonfunctional”, “not recognised” or “not utilised”) are also used in this way herein to refer to the differential promoter activity of the LTR sequence in different organisms.
  • the transcription of said reporter gene causes expression of the marker protein indirectly.
  • the present invention provides a method of enhancer trapping in an organism, comprising introducing a retroviral vector into said organism (e.g. into a cell of said organism) wherein said vector comprises a basal promoter and a reporter gene and wherein transcription of said reporter gene indirectly causes expression of a marker protein that can be detected in a live said organism.
  • the organism is assayed to determine whether expression of the marker protein has occurred.
  • the cells in which the marker protein is expressed are identified.
  • method of enhancer trapping may also be alternatively viewed as a method of identifying an active gene in an organism, said method comprising (a) introducing a retroviral vector into said organism, wherein said vector is an enhancer trap vector which comprises (i) a basal promoter which is inactive in said organism in the absence of an enhancer, but which may become active when inserted into the genome of said organism in a position which may trap (e.g. near to) an enhancer of said active gene; and (ii) a reporter gene, wherein transcription of said reporter gene indirectly causes expression of a marker protein; and (b) detecting the expression of said marker protein, whereby said expression is indicative of said active gene.
  • enhancer trap vector which comprises (i) a basal promoter which is inactive in said organism in the absence of an enhancer, but which may become active when inserted into the genome of said organism in a position which may trap (e.g. near to) an enhancer of said active gene; and (ii) a reporter gene, wherein transcription of said reporter
  • an enhancer trap vector as defined in step (a) above, for use in identifying an active gene in an organism.
  • the retroviral vector contains an LTR sequence having the properties discussed elsewhere herein.
  • enhancer trapping is meant the process by which an exogenous gene, such as a reporter gene or other detectably expressible gene, under the control of a basal promoter is inserted into the genome of a cell and expressed by virtue of an endogenous enhancer present in said host cell, which allows the basal promoter to direct the expression of the exogenous gene.
  • the exogenous gene e.g. reporter gene
  • the basal promoter are functionally linked, i.e. present on the same molecule and the basal promoter controls transcription of the gene.
  • the basal promoter alone is however not sufficient to drive transcription of the exogenous gene and therefore in the absence of insertion into a location that is close to an enhancer sequence no or negligible transcription occurs. If the insertion occurs sufficiently close to an enhancer sequence, then transcription and translation of the exogenous gene can take place, leading to the production of the product of the exogenous gene, e.g. an exogenous protein.
  • the detection of the exogenous peptide or protein encoded by the exogenous gene (e.g. the reporter gene), or its transcript, by any means, indicates that the insertion of the exogenous DNA has occurred in or near an active gene, i.e. a gene which is being actively transcribed.
  • an active gene i.e. a gene which is being actively transcribed.
  • the retroviral vector is introduced into said organism in any convenient or desired way, usually by infection.
  • the cell may be any cell of said organism, for example a mature, developed or differentiated cell, a stem cell or progenitor or precursor cell or a germ cell e.g.
  • an oocyte or egg cell or sperm cell The organism may be at any life stage.
  • appropriate life stages include ante-, post- and neonatal, infant, adult, juvenile etc.
  • Particularly included are vertebrate embryos, including also embryonic stem cells (although preferably human embryos or cells derived therefrom, e.g. human embryonic stem cells are not used unless this is necessary for the particular application), particularly where the reporter gene/gene identification aspects of the invention are concerned.
  • introduction into a vertebrate germ cell, embryonic cell or embryo is preferred.
  • Similar life stages are also appropriate if an invertebrate organism is used.
  • the insertion of the exogenous nucleic acid sequence occurs within a gene i.e. within the nucleic acid sequences that make up the introns, exons and regulatory sequences of the gene and therefore preferably interrupts the normal or wild type function or activity of said gene and/or the normal or wild type function or activity of the protein or peptide or RNA encoded by said gene.
  • the insertion thus causes a mutation or change in the sequence of the endogenous nucleic acid, e.g. DNA, by the addition of a nucleic acid sequence that is not found in the normal or wild-type nucleic acid sequence.
  • the protein encoded by said exogenous nucleic acid therefore does not contain the same sequence as the normal or wild-type sequence.
  • a particular advantage of this method is that insertions are detected in non-housekeeping genes at much higher frequencies than the previously used methods of insertional mutagenesis. In fact, insertions into housekeeping genes are rarely detected when this method is used. This means that each time the method is performed, proportionally more developmentally regulated genes are likely to be identified, and the method is therefore more efficient than previously used methods of insertional mutagenesis at identifying developmentally regulated (i.e. non-housekeeping) genes. This is surprising as there will be many housekeeping or ubiquitously expressed genes that are expressed at any time. Various different mutations may occur; nonsense mutations i.e.
  • Truncated proteins may not function correctly, depending on the location of the truncation.
  • the insertion of exogenous DNA may also lead to a protein with additional or incorrect sequences.
  • a protein that does not have the correct normal or wild-type sequence may also not function correctly.
  • Insertion into non-coding parts of the gene may also occur and may affect the normal or wild type function or activity of the protein or peptide. The insertion generated by this method may thus also disrupt non-coding portions of the gene, such as intronic sequences, promoter sequences or the sequences encoding the polyA tract of mRNA.
  • insertional mutagenesis As it is caused by the insertion of exogenous nucleic acid.
  • mutation it is meant any change in nucleotide sequence of the genetic material i.e. DNA or RNA of the cell. It is thus preferred, particularly in the context of the use of a reporter gene, (e.g.
  • insertional mutation or "insertional mutagenesis” therefore means that a nucleotide sequence is present in a gene, preferably an exon, which is not found in the normal, or wild-type nucleotide sequence, i.e. it is present in addition to the wild-type or endogenous sequence and does not replace an endogenous nucleic acid sequence.
  • the extra or additional nucleotide sequence is derived from the exogenous vector, and results from the integration of the vector nucleotide sequence into the gene in question.
  • exogenous nucleotide sequence When the exogenous nucleotide sequence is inserted in an exon of a gene, the presence of this new, or exogenous sequence disrupts the normal sequence of the expressed gene and the resulting protein produced by transcription and translation of the gene, and a truncated or non-functional product or protein may be generated, as described above.
  • the additional sequence may be transcribed and translated and a protein that is not expressed in the non-mutated cell may be expressed, which may interfere with normal gene or protein function.
  • endogenous refers to something that is naturally occurring in a wild-type cell, tissue organ or animal, and in enhancer traps is not part of the inserted vector itself.
  • exogenous refers to something which is introduced by the technique.
  • any retroviral vector nucleic acid sequence or product thereof would be exogenous.
  • exogenous nucleic acid sequences or proteins are not usually found in the wild-type cell, tissue, organ or animal which has not been subjected to enhancer trapping and they are thus foreign or alien to the wild-type cell, tissue, organ or animal.
  • the nucleotide sequence that is inserted is that which is flanked, i.e. surrounded by the long terminal repeat (LTR) sequences.
  • the LTR sequences are also inserted into the organism's genomic sequence.
  • the additional sequence which serves to disrupt the normal expression of the gene, should also be expressed. If the additional sequence is selected such that it encodes a peptide or protein or other product that can be detected, directly or indirectly, without interfering with the normal function of the cell, then it will be possible to select and/or identify the cell or cells into which the vector has inserted (i.e. the "positive" cells) on the basis of the expression of the exogenous gene (i.e. the detectably expressible gene) in the "positive cells". If the method is being used in a screen to generate mutant organisms, only those organisms (e.g.
  • the vector may be introduced into an embryo, or a cell of an embryo, an ES cell, or indeed any suitable cell of an organism.
  • the cell is a cell of an embryo. Infection of cells is a routine undertaking in the art, and generation of retroviral particles pseudotyped with the VSVG glycoprotein as well as the infection are described in Burns, J.C. et al. (1993), Proc. Natl. Acad. Sci. US A 90, 8033-8037.
  • the organism for use in the methods of the invention described herein may be any organism for example any vertebrate or non-vertebrate organism.
  • the organism is preferably a lower vertebrate, for example a fish, reptile or amphibian, more preferably a fish or amphibian.
  • the organism is an avian vertebrate, for example a chick or chicken, or a rodent (e.g. mouse, rat, guinea pig, hamster etc) or other laboratory animal.
  • the organism may thus be mammalian or non-mammalian.
  • Preferred non- vertebrate organisms for use in the invention include insects, molluscs, chordates and crustaceans.
  • the vertebrate is an organism or species that has been genetically well-studied and/or documented, e.g. an animal commonly used in genomic studies, or for which animal models are desired.
  • the organism is preferably a zebrafish (Danio rerio), Japanese Medaka fish, Xenopus or a mouse.
  • the zebrafish and Medaka fish are particularly preferred as the sequencing of their genome is almost complete, and a large number of phenotypic changes induced by mutation have already been identified.
  • the embryos are transparent and it is thus easy to detect phenotypic changes and to observe reporter gene expression.
  • the similarity of developmental programs in all vertebrates means that the study of zebrafish also provides a good model for other vertebrates, such as mammals, including humans.
  • the retroviral vector may be any retroviral vector known in the art, or may be based on any retrovirus according to choice, and the precise system involved (e.g.
  • any desired or appropriate retroviral vector may be used, and may differ according to the host species or organism.
  • the various components of the retroviral vectors to be used will thus generally be selected using functional criteria as described elsewhere herein.
  • the basal promoter of the retroviral vector used in the enhancer trapping methods of the invention described herein will generally be selected so that it functions as a basal promoter in the host organism concerned, i.e. a promoter will be selected which alone is unable to direct expression of an exogenous gene in the host organism but can direct expression of an exogenous gene when it becomes integrated into the host organism in a position such that it can be acted on by a host enhancer sequence.
  • the choice of basal promoter also has an influence on the types of gene in which insertion is detected, and hence on the genes which are identified by the method.
  • the Gata2 basal promoter functions with (i.e. is driven by) enhancers that are active at one developmental stage
  • the keratin 8 basal promoter functions with (i.e. is driven by) enhancers that are active at a different developmental stage
  • a non-overlapping spectrum of genes was identified in screens performed with these two different promoters. This probably reflects the fact that promoters function by virtue of binding of proteins to sequences within the promoter.
  • the nucleotide sequence of a promoter thus determines whether it will be activated by a particular protein, and whether it will function with a certain enhancer.
  • the skilled person can therefore select a basal promoter to use in the retroviral construct that is likely to allow the detection of the genes which are expressed at a particular developmental stage, or tissue or cell type. This choice can be made based on the usual expression pattern of genes under the control of a particular basal promoter.
  • the basal promoter is preferably selected such that it is capable of functioning i.e. directs expression in a particular developmental pattern, either spatially or temporally.
  • the methods of the invention are therefore particularly suited to identify developmentally expressed genes e.g. early genes or late genes.
  • Promoters from structural proteins or other proteins expressed in differentiated cells are particularly preferred to identify late genes (e.g. genes expressed after day 2 of zebrafish embryogenesis) and promoters from early developmentally regulated genes e.g. early transcription factors are particularly preferred to identify early genes (e.g. genes expressed in the first day e.g. in the first 24 hours of zebrafish embryogenesis.
  • the LTR of the retroviral vector used is generally selected such that it is inactive or non-functional or not recognised or not utilised as a promoter when integrated into the genome of the host organism.
  • the LTR will be active as a promoter in the packaging cells, e.g. a mammalian cell line, used to produce the retroviral vector for infection.
  • retroviral vectors upon which retroviral vectors may be based include lentiviruses and oncoretroviruses.
  • Preferred retroviruses are those which infect mammalian cells, i.e. are mammalian retroviruses, preferably human or murine retroviruses.
  • Exemplary vectors include those based on or derived from murine leukaemia virus (MLV), particularly murine Moloney leukaemia virus (M- MLV) for example the vector pCL (Naviaux et al, 1996, J.
  • retroviral vectors for use in the present invention are those based on or derived from MLV and in particular M-MLV (e.g. those based on the pCL vector described by Naviaux, supra).
  • the retroviral vector may be introduced into the host organism in any convenient or desired way. For example, it may be injected into the organism, e.g. into an embryo or cell of said organism. Preferably the vector is introduced in the form of a retroviral particle which contains the vector nucleic acid.
  • retroviral vectors are generally used which are replication incompetent, i.e. they do not possess all of the viral genes that are required to form a fully replicating vector. These vectors are transfected into "packaging cell lines". Packaging cell lines are capable of producing all of the necessary packaging trans proteins e.g.
  • gag, pol and env that are needed for the virus to be packaged, processed, reverse transcribed and integrated.
  • These viruses are collected from the supernatant of the packaging cells and assessed for their infectivity by performing standard titre experiments.
  • Various means are known in the art to modulate the infectivity of the produced viruses or the number of colony forming units, and to manipulate the ability of the produced virus to infect certain cell types and host organisms. For example it has been shown by Burns et al. ((1993) P.N.A.S.
  • VSVG glycoprotein allows zebrafish cells to be infected as they generate an active MLV core with the host specificity of VSV.
  • retroviral modification is also appropriate to enable the infection of other non-mammalian cells, e.g. other fish cells such as medaka fish.
  • Any packaging cell line may be used to generate the virus with which the cells are infected.
  • Preferred packaging cell lines are those in which the LTR of the retroviral vector is an active promoter.
  • such packaging cell lines are mammalian cell lines, preferably human cell lines e.g. N1H3T3 (Markowitz et al.
  • Preferred examples include the human cell line 293, more preferably 293gp sr (Miyoshi et al 1998, supra).
  • the packaging cell lines are preferably easy to transfect using standard techniques. The titre of the virus may be detected by standard techniques, such as those described in Burgess & Hopkins ((2000) Methods Enzymol; 327: 145-61).
  • the retroviral vector contains sequences from the long terminal repeats (LTRs) of the virus. These LTRs flank the nucleic acid sequence which is to be integrated into the genome of the cell.
  • LTR sequences are essential for reverse transcription and insertion of the sequences into the host genome. LTRs are found at the ends of the viral genome and can be divided into three elements. U3 is derived from the sequence unique to the 3' end of the RNA. R is derived from the sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5' end of the RNA.
  • LTR sequences used in the vector may be derived from any retrovirus or may be synthetic, or may be modified versions of LTR sequences from any retrovirus, so long as they act to cause the reverse transcription of the retroviral RNA and integration of the nucleotide sequences that they flank. In addition they should preferably be active as promoters in the packaging cell line and inactive as promoters in the organism into which they are introduced. LTRs also act to control gene expression in integrated proviruses and therefore LTR sequences may also contain regulatory elements that act to control transcription, such as promoters and enhancers. These regulatory elements may be responsive to cellular trans activating factors. Preferred LTRs are the MLV LTR or the HTV LTR.
  • the two LTR sequences may have identical sequences, this is not necessary.
  • the LTR sequences may also be generated by filling in one or more LTR sequence or fragment thereof.
  • the 5 LTR is from pCL (Naviaux et al, supra) and contains a CMV promoter.
  • the CMV promoter promotes strong transcription of the viral genome in the packaging cell line after transient transfection. As the 5 'LTR is replaced with a copy of the 3 'LTR during viral replication, the CMV promoter is not included in the viral RNA.
  • the retroviral vector preferably comprises an optimised packaging signal.
  • the packaging signal functions to aid the assembly of the viral particles in the packaging cell line.
  • the packaging signal is from pCL (Naviaux et al., supra).
  • the vector may be a lentiviral vector.
  • Lentiviruses are a subgroup of retroviruses.
  • the use of lentiviral vectors presents an advantage in that, unlike retroviral vectors in general, they are capable of infecting non-proliferating cells, making them useful in situations where other retroviral vectors are not.
  • both systems are of use as the majority of cells are dividing in the embryo.
  • lentiviral vectors are suitable for germline transmission in mice and rats (Lois et al (2002) Science 295 (5556): 868-72).
  • the LTR acts as a promoter in the packaging cell line and is inactive as a promoter in the organism into which the vector is being introduced.
  • a preferred combination is a mammalian retroviral LTR sequence i.e. an LTR from a retrovirus which infects mammals and a non-mammalian test organism.
  • a rodent retroviral LTR sequence i.e. an LTR from a retrovirus which infects rodents is used with a non-mammalian test organism.
  • the non-mammalian test organism is preferably a lower invertebrate e.g. a frog or other amphibian, or reptile, or fish or invertebrate.
  • Any combination of retroviral LTR may be made with the test organism so long as the retroviral LTR sequence does not function or is inactive as a promoter in the organism, and does function as a promoter in the packaging cells.
  • the LTR may also be synthetic.
  • Preferred mammalian LTRs for use in the invention are murine LTRs, in particular LTRs from MLV, particularly M-MLV, for example the LTR as used in the vector pCL.
  • Preferred non-mammalian test organisms are lower invertebrates such as fish, and in particular zebrafish or medaka fish, or amphibians.
  • the LTR of the retroviral vector is active in mammalian cells (such as those described above) and is inactive in lower vertebrates or invertebrates (such as those described above).
  • promoter refers to a nucleic acid sequence that acts as a recognition signal for one or more transcription factors. Once the necessary transcription factors have bound to the nucleic acid, RNA polymerase binds to the nucleic acid-transcription factor complex to initiate RNA synthesis and transcription.
  • the promoter sequence is usually found adjacent to, next to, or functionally linked to the gene under its control and whose transcription it drives. Promoters may comprise one or more transcription factor binding elements and the particular combination of these elements determines the spatial and temporal transcription of the gene under its control. Thus, it can be seen that promoters may be of different strengths under different conditions. A strong promoter is one that activates transcription at high levels, whereas a weak one will activate transcription at low levels or not at all. As mentioned above, promoters may also be dependent on "enhancer sequences". These are nucleotide sequences that are czs-acting (i.e.
  • Enhancers are also activated by binding of regulatory proteins. The binding of the relevant gene regulatory protein is thought to interact with the transcription factors bound to the promoter sequences, by looping out the intervening nucleotide sequences.
  • the strength of a promoter may also be affected by its dependency or proximity to enhancer sequences.
  • the term "basal promoter” refers to a promoter that has no associated enhancer sequences and which exhibits no promoter activity or only low activity. Particularly, the promoter exhibits no or low promoter activity in the organism (e.g. cell) into which the vector is introduced.
  • low activity is meant that no RNA is transcribed, or only low levels or negligible or insignificant levels of RNA are transcribed.
  • the basal promoter may thus be viewed as "inactive" in the absence of an enhancer.
  • basal promoters are believed to function differentially with different enhancers and therefore it is possible to influence the nature of the genes in which insertion is detected by selecting the basal promoter according to the type of genes (e.g. with a particular spatial or temporal expression pattern) which are under investigation.
  • a basal promoter can be selected which functions with enhancers which are present in particular cell types or particular developmental stages which are under investigation. Examples of such promoters will also depend on the system into which the vector is to be introduced.
  • the promoter sequence is made up of a number of different elements. The presence or absence of the particular combination of transcriptions factors required to drive transcription in a particular cell, organ, tissue or animal will determine whether transcription occurs.
  • a basal promoter for zebrafish may be different with respect to its nucleotide sequence to a basal promoter for mice and the basal promoter should be chosen in line with the host or target system in which the method of the invention is to be performed.
  • the promoter must be capable of driving transcription when sufficiently close to an active enhancer in the cell, organ, tissue or animal of interest, yet is inactive (i.e. does not cause transcription, or only causes low, negligible or insignificant levels of transcription) when inserted into other locations.
  • basal promoters suitable for use in a zebrafish system include the Gata2 core promoter (Meng etal, 1997, P.N.A.S.
  • the heatshock hsp 70 core promoter (Halloran et al., 2000, Development, 127, 1953-1960).
  • the zebrafish Gata 2 core promoter can also act as a basal promoter in medaka fish.
  • the epithelial promoter from the keratin 8 gene (Gong et al 2002, Dev. Dyn 223: 204-2115. Promoters of use in the invention include those which have been designed or artificially created, or promoters that are naturally occurring. The promoters may also have been additionally modified e.g.
  • nucleotide sequence changes have been introduced according to standard techniques known in the art, in order to manipulate the activity or function of the promoter.
  • the at least partially random integration of the vector nucleic acid, including the two LTR sequences, into the genome of the cell, organ, tissue or animal in question may lead to transcription of the detectably expressible exogenous (e.g. reporter gene).
  • the detectably expressible exogenous e.g. reporter gene
  • the detection of the expression of the detectably expressible exogenous gene in a cell, or organ, or tissue or even whole animal ⁇ at different time points indicates the normal expression pattern of a gene that is, under normal or wild type conditions, influenced by the enhancer.
  • the basal promoter is inactive or active at low or undetectable levels when the insertion occurs in or near an inactive gene, however the promoter must become active when induced to by the enhancer.
  • the promoter can be active in a wide range of tissues in conjunction with the required enhancers.
  • a preferred promoter is the Gata2 core promoter (Meng et al 1997 supra), the hsp70 core promoter (Halloran et al 2000 supra) of zebrafish or the epithelial keratin 8 promoter (Gong et al., 2002 supra).
  • the basal promoter can be chosen to increase the chance of detecting a gene with that particular expression pattern.
  • reporter gene refers to any gene or nucleic acid sequence (such as a cDNA sequence) which is capable of being transcribed and translated into a protein or a peptide whose presence may be directly or indirectly detected (e.g. measured).
  • the transcription of the reporter gene i.e. into a protein or peptide product of the reporter gene, occurs only when the insertion is made in or near an endogenous gene which is being actively transcribed under the control of an endogenous promoter and/or enhancer in that cell at that time.
  • the transcription of said reporter gene in a cell, tissue organ or animal indicates that there is an active gene in this location at this time.
  • the marker protein is a protein that is detected by the investigator.
  • the marker protein may be the protein or peptide product of the reporter gene. If this is the case, this represents the case whereby the transcription of the reporter gene directly results in the production of marker proteins.
  • the reporter gene may encode a "transactivating protein". In other words, transcription and translation of the reporter gene produces a transactivating protein.
  • the transactivating protein is e.g. a transcription factor or another protein that is involved in controlling transcription. This transactivating protein can bind to an upstream regulating site which controls the expression of a further reporter gene or gene encoding a marker protein i.e.
  • the upstream regulating site may be a promoter for a further reporter gene or gene encoding a marker protein. If this is the case, transcription of the reporter gene indirectly results in the production of the marker protein.
  • the upstream regulatory site is preferably an exogenous nucleotide sequence i.e. is not normally found in the cell, tissue, organ or organism.
  • the upstream regulatory sequence may be a synthetic upstream regulatory sequence e.g. one which has been designed or artificially created, or it may be an upstream regulatory sequence that is naturally occurring, but which is not found in the normal or wild-type cell, tissue, organ or organism. A further possibility is that it is an exogenous upstream regulatory sequence, but which has been additionally modified e.g.
  • the upstream regulatory sequence may control the transcription or translation of a further transactivator protein or may control the production of a marker protein.
  • the "signal" or the output of the assay may be amplified. This is therefore of particular use if the expression of the endogenous gene, whose expression is being detected by the enhancer trap method, is low.
  • the generation of only a small amount of transactivator protein may lead to higher levels of the marker protein or further transactivator protein.
  • detection of the marker protein may be possible at lower levels of endogenous gene expression.
  • the degree of amplification will depend on the properties of the transactivation protein and the regulatory sequence to which it binds.
  • the stability of the transactivation protein will also influence the degree of amplification; the more stable and longer the half life of the transactivation protein, the longer it will be able to bind the regulatory sequence, and the more marker protein will be produced.
  • the vector of use in the invention contains a sequence encoding a transactivation protein as the reporter gene then the nucleic acid encoding the marker protein which is expressed under the control of the transactivation protein upstream regulatory sequence must also be present in the cell, tissue, organ or animal of interest. This may be achieved in a number of ways e.g. using an effector line, which contains the transactivation protein upstream regulatory sequence and the gene encoding the marker protein. The effector line may therefore provide the animal, cell or embryo into which the vector of use in the invention is introduced.
  • transactivation protein upstream regulatory sequence together with the further reporter gene are introduced (e.g. administered) to the cell, tissue, organ or animal in parallel with the first (i.e. retroviral) vector i.e. the vectors or constructs are administered separately, simultaneously or sequentially.
  • the regulatory sequence and further reporter gene may be introduced separately or in the form of a genetic construct containing the transactivation protein upstream regulatory sequence and the reporter gene (e.g. encoding the marker protein).
  • GAL4 system which is based on the yeast system.
  • the GAL4 method has been adapted for use in Drosophila (Brand and Perrimon, 1993, Development, 118,
  • the reporter gene encodes a transactivation protein, preferably the yeast transactivator GAL4, and the organism (e.g. cell or embryo) into which the vector is introduced contains a GAL4-responsive promoter termed Upstream activating sequence (UAS) functionally linked to a further reporter gene which may encode a marker protein.
  • UAS Upstream activating sequence
  • the known sequence of the reporter gene thus acts as a molecular marker to enable genetic cloning of the sequence surrounding the reporter gene in addition to encoding a reporter gene that can be detected directly or indirectly.
  • the area surrounding the reporter gene, the active gene i.e. the gene which is transcribed and translated under normal conditions in the cell at that time may be identified.
  • the method further comprises the steps of cloning and sequencing the region of the genome into which the insertion of exogenous nucleic acid (i.e. the retroviral vector) has occurred.
  • the method may further comprise the identification, isolation, cloning and/or production of the active gene into or near which the retroviral vector has been inserted.
  • active genes may be known genes or may be novel, in which case sequencing or functional analysis to try and establish the function of these novel genes may be appropriate.
  • the marker protein as described herein may be any gene product, including also shorter peptides as well as longer polypeptides proteins and RNA molecules, which may be detected, i.e. which gives, or may give rise to, a signal.
  • the marker protein may itself by directly signal-giving and hence directly detectable, for example by giving a visually or spectrophotometrically detectable signal (e.g. colour, luminescence, fluorescence, absorbance etc. or any detectable enzymatic reaction).
  • the marker protein may be indirectly signal-giving, for example it may give rise to a signal by taking part in a further signal-giving reaction, mechanism or process (e.g. by binding to a labelled or otherwise signal-giving antibody, or by taking part in an enzymatic reaction, etc.).
  • an indirectly signal-giving marker protein may be -galactosidase, as encoded for example by lacz. Examples of other proteins useful in these cases are alkaline phosphatase and luciferase. RNA molecules may also be detected.
  • the marker protein is however, preferably a protein, polypeptide or peptide or other gene product that can be detected in a live vertebrate, for example live cells, or embryos i.e.
  • the marker protein is fluorescent and thus its presence can be detected by subjecting the appropriate cell to light of the relevant wavelength and inspecting said cell under a fluorescent microscope. More preferably the marker protein is green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), enhanced green fluorescent protein (eGFP) (Chalf ⁇ e et al. (1994), Science 11 (263): 802-5) or any other fluorescent protein. It is well known in the art that GFP and other fluorescent proteins can be expressed in zebrafish, Drosophila and mice for example and retain their fluorescent properties.
  • GFP green fluorescent protein
  • YFP yellow fluorescent protein
  • RFP red fluorescent protein
  • eGFP enhanced green fluorescent protein
  • the marker protein is not normally expressed in the cell, tissue, organ or animal subjected to the method of the invention. This means that it is not required to distinguish between "normal” and “exogenous” expression of the marker protein, and false positives are not achieved.
  • the detection step i.e. the step of ascertaining whether any marker protein is expressed in any cell, tissue, organ or organism, may be carried out by standard means known in the art, such as exposing the cell, tissue, organ or animal to light of the appropriate wavelength and observing whether fluorescence (or any other spectrophotometric signal) is seen. The presence of said marker protein is thus indicative of expression of an active gene in that cell, tissue, organ or organism, at that time during development.
  • transgenic organism i.e. an organism containing an insertion of foreign or exogenous nucleic acid in its genome.
  • the foreign or exogenous nucleic acid which is inserted is the part of the retroviral vector which is flanked, i.e. surrounded, by the LTR sequences.
  • the present invention provides methods of producing transgenic organisms wherein said methods are the methods of the invention as described herein. Accordingly, a transgenic organism obtained or obtainable by the methods as described herein is a further embodiment of the invention.
  • a transgenic organism obtained or obtainable by introducing a retroviral vector into said organism or a cell of said organism wherein said vector comprises a basal promoter and a detectably expressible gene is an embodiment of the invention.
  • the progeny of said organism which contains said insertion of foreign or exogenous nucleic acid in its genome also forms part of the invention.
  • Kits comprising a transgenic organism as described herein are also contemplated and form further aspects of the invention.
  • Kits according to the invention may comprise one or more transgenic organisms as described herein and other components as described elsewhere herein.
  • Transgenic organisms as described above or kits comprising one or more transgenic organisms may be used in assays, for example assays to identify compounds or conditions which affect (e.g.
  • a detectable increase in the expression of the detectably expressible gene indicates that the compound or condition being tested increases the expression of the active gene and a detectable decrease in the expression of the detectably expressible gene indicates that the compound or condition decreases the expression of the active gene.
  • the detection steps will generally be performed as described elsewhere herein. It is then simply necessary to compare expression levels in the presence or absence of the compound or condition being tested.
  • Such assays can thus be used to screen and identify candidate compounds, e.g. candidate drugs, for use in therapy, e.g. to identify candidate compounds which can affect the expression of a particular gene in a desirable manner.
  • the present invention thus provides the use of the methods of the invention or the transgenic organisms produced by the methods of the invention in methods of screening for compounds or conditions which affect gene expression.
  • the present invention can in particular be used to identify compounds or conditions which affect early gene expression.
  • Such compounds may for example have use in therapy, in particular in cancer therapy.
  • a sample containing the compound being tested may be administered to the transgenic organism directly, e.g.
  • the present invention provides the use of the methods of the invention or the transgenic organisms produced by the methods of the invention in the identification of genes which can be targeted in therapy, e.g. genes which are potential drug targets.
  • the exogenous or detectably expressible gene may encode a therapeutic polypeptide.
  • retroviral vectors By “therapeutic” it is meant that it is of use in treating or preventing a disease or syndrome, or clinical condition.
  • Gene therapy using retroviral vectors has been shown recently to be linked to the development of certain cancers such as leukaemia (Kaiser 2003, Science, 299: 495).
  • Gene therapy vectors utilise strong, tissue specific or ubiquitous promoters.
  • the tendency of retroviral vectors to insert into the enhancer/promoter region of genes, combined with the risk of this occurring in a growth controlling gene, thus activating such a gene is one explanation for the development of leukaemia that has been seen in a number of gene therapy patients.
  • a basal promoter controlling an exogenous or detectably expressible gene, wherein the said gene encodes a therapeutic polypeptide one would reduce or even eliminate the risk of activating an endogenous growth control gene.
  • expression of the therapeutic gene will depend upon its site of insertion - the therapeutic gene will only be expressed if the vector inserts or integrates at a site where it may "trap" or utilise an enhancer of an active gene, thus reducing or eliminating the likelihood that an endogenous oncogene, or growth-controlling gene or other gene likely to give rise to cancer is expressed due to insertion of the vector.
  • a further aspect of the invention relates to method of gene therapy comprising introducing (e.g.
  • a retroviral vector comprising a basal promoter and a therapeutic gene.
  • a retroviral vector comprising a basal promoter and a therapeutic gene.
  • the invention further relates to the use of a retroviral vector comprising a basal promoter and a therapeutic gene in the manufacture of a medicament for gene therapy.
  • the invention relates to retroviral vector comprising a basal promoter and a therapeutic gene for use in gene therapy.
  • the invention further includes a pharmaceutical composition comprising a retroviral vector, wherein said vector comprises a basal promoter and a therapeutic gene, together with a pharmaceutical acceptable carrier or diluent.
  • the therapeutic gene may encode a therapeutic polypeptide or gene product as defined above.
  • a retroviral vector as used in these therapeutic aspects of the invention is an enhancer trap vector as described elsewhere herein.
  • pharmaceutically acceptable means that the composition ingredient or component is compatible with other ingredients or components of the composition as well as physiologically acceptable to the recipient.
  • a YFP fragment (BamHI/Bglll) was cloned into the BamHI digested pCL vector.
  • a GATA2 fragment (BamHtTBamHi) was cloned into the pCL- YFP (BamEQ/BamHI) to obtain pCL-GATA2-YFP.
  • Sequence is 2753 bases long, sequenced using LE-1, LE-2, YFP rev and pMV3 reverse primers.
  • Figure 1 also shows the sequence of the pCL vector construct without the GAT A- YFP insert.
  • Figure 2 shows selection of stable transgenic lines showing spatially and temporally restricted expression of YFP (Yellow Fluorescent Protein) in various tissues or organs.
  • Main domains of expression are: 5, Retina and spinal chord. 7, Ubiquitous. 11, Subset of neurons in brain. 32, Notochord. 22, Retina and hindbrain. 129, Hatching glands. 151, Optic tectum. 183, Telencephalon. 186, Central nervous system. 298, Sensory neurons. 374, Dorsal epidermis along anterior/posterior axis. 375, Ventral part of forebrain/hindbrain/spinal chord.
  • the enhancer trap vector is based on a Murine Moloney Leukemia Virus (M- MLV) type retroviral vector (pCL; Naviaux RK et al., supra).
  • M- MLV Murine Moloney Leukemia Virus
  • the reporter element of the vector (YFP) was ligated into BamHI site of the empty pCL vector.
  • the minimal promoter (Gata2 fragment) was ligated into the vector immediately upstream of the reporter element.
  • the inserted promoter- reporter cassette is oriented in a 5'-3' orientation in respect to the viral vector (Fig- 1).
  • Virus was resuspended overnight at 4 C in appropriate volume of lXPBS. - This virus may be used immediately, or stored at 4°C for up to 3-4 days, or frozen at -80°C for later use (although this will reduce the titer by 50%)
  • Zebrafish embryos are dechorinated before the blastula stage in IX Holtfreters solution (IL dH 2 O: O.lg CaCl 2 : 3.5g NaCl; 0.05g KCl: 1 ml IM HEPES pH 7.5) containing pronaseE (Sigma). 10 to 20 nl of the concentrated virus, containing 4 ⁇ g of polybrene per ml, is injected at 3-4 locations among the blastomeres of blastula-stage zebrafish embryos ( 500-2000 cell stage). After injection embryos were incubated at 37°C for 2-4 hours before being transferred to 28.5°C for further raising.
  • IX Holtfreters solution IL dH 2 O: O.lg CaCl 2 : 3.5g NaCl; 0.05g KCl: 1 ml IM HEPES pH 7.5
  • Embryo assay was performed, using real-time PCR, on a fraction of embryos for each new batch of virus, to evaluate the infection efficiency for zebrafish embryos. Furthermore, FI progeny from crosses of founders are also analysed using standard PCR, to calculate the frequency of germ-line transmission of the integrated provirus (Table 1).
  • Table 1 selected frequencies of FI transgenic progeny from founders crossed against wild type.
  • GNT-K buffer 50 mM KCl, 1.5 mM MgCl 2 , 10 mM Tris-HCl pH 8.5, 0.01% gelatin, 0.45% Nonidet P-40, 0.45% Tween-20, 100 ⁇ g/ml proteinase K
  • This qPCR identifies the number of integrated proviruses per cell.
  • Primers for PCR screen (all 5' to 3 orientation): pMV2fwd: GAA TCG TGG TCT CGC TGT TC MSCV3rev: CGG GTG TTC AGA ACT CGT CAG. This shows the integrated provirus i.e. whether the animal is transgenic.
  • ENHANCER-TRAP SCREENING Injected founders (F0 generation) were raised to sexual maturity and outcrossed to wild-type fish.
  • FI larvae were screened at 24 hours post fertilisation using a TE2000-S inverted microscope (Nikon), with a 500/20 nm excitation filter and a 515 nm BP emission filter for detection of YFP.
  • a TE2000-S inverted microscope Nakon
  • progeny from one founder that are positive for YFP are sorted into separate Petri-dishes and grouped according to YFP expression pattern (Fig. 2).
  • LM-PCR linker mediated PCR
  • Nested PCR was then performed using a second set of primers. Based on agarose gel analysis of the PCR reaction, the activated integration was identified based on its presence in all YFP positive samples of one specific line. The identified integration was then sequenced after direct cloning into the
  • Genomic DNA Preparation of single embryo each single embryo was separated into in a 1,5 ml eppendorf tube 100 ⁇ l GNT-K buffer was added and incubated for 2 h at 56°C, with vortexing every 30 minutes 250 ⁇ l ( 2,5 Vol.) of 96% EtOH was added and the mixture mixed The mixture was then centrifuged at max. speed for 30 minutes The supernatant was aspirated off and the pellet dried for 15-20 minutes at room temperature The pellet was redissolved in 25 ⁇ l 0, 1 TE buffer for 60 min at 56°C with vortexing every 30 minutes A 1 minute spin at max. speed was then performed to clear the solution.
  • Genomic DNA Msel digestion 2,0 ⁇ l DNA 1,0 ⁇ l Msel (10 U), NEB 2,0 ⁇ l l Ox buffer 0,2 ⁇ l l00x BSA 14,8 ⁇ l H,O 20 ⁇ l and the mixture was incubated for 4 hours at 37°C, then denatured for 20 minutes at 65°C.
  • PCR with one primer specific to the LTR and one to the linker 5': 1 st 5LTRMscI + Afl5, 2 nd 5LTRnest + AF15nest 3': 1 st 3LTR + API, 2 nd 3LTRnest + Af nest lx Master Mix 1 Ox buffer 2,50 ⁇ l MgCl 2 (50 mM) 0,75 ⁇ l fwd primer 0,50 ⁇ l rev primer 0,50 ⁇ l dNTP (10 mM) 0,50 ⁇ l Taq (5U/ ⁇ l, Invitrogen) 0,25 ⁇ l H 2 O 19,00 ⁇ l Ligation 1,00 ⁇ l 25,00 ⁇ l
  • reaction was repeated using up to 10 ⁇ l of template and up to 3 hrs incubation at 37°C.
  • Linker upper Strand (name: Afl3-us): length: 36 mer purification: PAGE 5' GTAATACGACTCACTATAGGGCTCCG CTTAAGGGAC 3'
  • Linker lower strand (name: Afl3-ls): length: 17 mer special modification: 5" phosphate, 3' amino C7. purification: PAGE
  • Linker lower strand (name: Afl5-ls): length: 16mer special modification: 5' phosphate, 3' amino C7 purification: PAGE 5'-PO4-TAGTCCCTCTTAAG GCCT-NH2-3'

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention a trait à un procédé de piégeage d'amplificateurs dans un organisme, comprenant l'introduction d'un vecteur rétroviral dans ledit organisme, le vecteur rétroviral comportant un promoteur basal et un gène d'expression détectable. La présente invention a également trait à des vecteur rétroviraux, des organismes transgéniques pouvant être obtenus par l'introduction d'un vecteur rétroviral dans ledit organisme et des trousses comportant des vecteurs rétroviraux ou des organismes transgéniques.
PCT/GB2004/004577 2003-10-29 2004-10-29 Procedes d'identification de genes actifs WO2005045071A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0325284A GB0325284D0 (en) 2003-10-29 2003-10-29 Methods of identifying active genes
GB0325284.8 2003-10-29

Publications (1)

Publication Number Publication Date
WO2005045071A1 true WO2005045071A1 (fr) 2005-05-19

Family

ID=29725598

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/004577 WO2005045071A1 (fr) 2003-10-29 2004-10-29 Procedes d'identification de genes actifs

Country Status (2)

Country Link
GB (1) GB0325284D0 (fr)
WO (1) WO2005045071A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5627058A (en) * 1990-05-14 1997-05-06 Massachusetts Institute Of Technology Retrovirus promoter-trap vectors
WO1998056902A2 (fr) * 1997-06-09 1998-12-17 Medical College Of Georgia Research Institute, Inc. Poissons transgeniques a expression a specificite cellulaire
EP0902092A2 (fr) * 1997-09-15 1999-03-17 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Procèdè d'identification de gènes cibles de facteurs de transcription
US6228639B1 (en) * 1996-12-31 2001-05-08 George A. Gaitanaris Vectors and methods for the mutagenesis of mammalian genes

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5627058A (en) * 1990-05-14 1997-05-06 Massachusetts Institute Of Technology Retrovirus promoter-trap vectors
US6228639B1 (en) * 1996-12-31 2001-05-08 George A. Gaitanaris Vectors and methods for the mutagenesis of mammalian genes
WO1998056902A2 (fr) * 1997-06-09 1998-12-17 Medical College Of Georgia Research Institute, Inc. Poissons transgeniques a expression a specificite cellulaire
EP0902092A2 (fr) * 1997-09-15 1999-03-17 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Procèdè d'identification de gènes cibles de facteurs de transcription

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ALONSO A ET AL: "HUMAN CHROMOSOME 12 IS REQUIRED FOR OPTIMAL INTERACTIONS BETWEEN TAT AND TAR OF HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 IN RODENT CELLS", JOURNAL OF VIROLOGY, vol. 66, no. 7, 1992, pages 4617 - 4621, XP002316874, ISSN: 0022-538X *
FRIEDRICH G ET AL: "PROMOTER TRAPS IN EMBRYONIC STEM CELLS: A GENETIC SCREEN TO IDENTIFY AND MUTATE DEVELOPMENTAL GENES IN MICE", GENES AND DEVELOPMENT, COLD SPRING HARBOR, NY, US, vol. 5, no. 9, 1 September 1991 (1991-09-01), pages 1513 - 1523, XP000562802, ISSN: 0890-9369 *
SABLITZKY FRED ET AL: "High frequency expression of integrated proviruses derived from enhancer trap retroviruses", CELL GROWTH AND DIFFERENTIATION, vol. 4, no. 6, 1993, pages 451 - 459, XP008042760, ISSN: 1044-9523 *
SORIANO P ET AL: "PROMOTER INTERACTIONS IN RETROVIRUS VECTORS INTRODUCED INTO FIBROBLASTS AND EMBRYONIC STEM CELLS", JOURNAL OF VIROLOGY, vol. 65, no. 5, 1991, pages 2314 - 2319, XP002316873, ISSN: 0022-538X *
WEBER F ET AL: "AN SV-40 ENHANCER TRAP INCORPORATES EXOGENOUS ENHANCERS OR GENERATES ENHANCERS FROM ITS OWN SEQUENCES", CELL, vol. 36, no. 4, 1984, pages 983 - 992, XP002316872, ISSN: 0092-8674 *

Also Published As

Publication number Publication date
GB0325284D0 (en) 2003-12-03

Similar Documents

Publication Publication Date Title
Amsterdam et al. The Aequorea victoria green fluorescent protein can be used as a reporter in live zebrafish embryos
Higashijima et al. High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin
Amsterdam et al. A large-scale insertional mutagenesis screen in zebrafish
Kawakami Transgenesis and gene trap methods in zebrafish by using the Tol2 transposable element
Allende et al. Insertional mutagenesis in zebrafish identifies two novel genes, pescadillo and dead eye, essential for embryonic development.
AU704178B2 (en) Vertebrate embryonic pattern-inducing hedgehog-like proteins
US20080171328A1 (en) Screening assays for hedgehog agonists and antagonists
US20080255002A1 (en) Genetic manipulation method
JP2002504821A (ja) 組織特異的発現を有するトランスジェニック魚
Amsterdam et al. Retrovirus-mediated insertional mutagenesis in zebrafish
US20090255006A1 (en) Transgenic Zebrafish
US8399257B2 (en) Transposition of maize Ac/Ds elements in vertebrates
KR20070120936A (ko) 비-인간 동물의 성별-특이적인 자동화 정렬
WO2005045071A1 (fr) Procedes d'identification de genes actifs
Zhang et al. The regulation of retina specific expression of rhodopsin gene in vertebrates
JP3803499B2 (ja) トランスジェニック真珠貝及びその作出方法
AU2003285573A1 (en) Fish disease models and uses thereof
AU736492B2 (en) Vertebrate embryonic pattern-inducing hedgehog-like proteins
WO2000056874A1 (fr) Vecteurs retroviraux, leurs procedes de production et leur utilisation
AU767640B2 (en) Vertebrate embryonic pattern-inducing hedgehog-like proteins
AU778904B2 (en) Vectors and methods for the mutagenesis of mammalian genes
CN118120703A (zh) 一种rb1突变体在神经退行性疾病中的应用
JP2005511052A (ja) 魚モデルの視覚の評価を利用するスクリーニング方法
WO2003097826A1 (fr) Utilisation de minos en genomique fonctionnelle
Kyrkjebø Characterization of Nuclear Respiratory Factor 1 using transgenic zebrafish

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase