WO2003097826A1 - Utilisation de minos en genomique fonctionnelle - Google Patents

Utilisation de minos en genomique fonctionnelle Download PDF

Info

Publication number
WO2003097826A1
WO2003097826A1 PCT/GB2003/002128 GB0302128W WO03097826A1 WO 2003097826 A1 WO2003097826 A1 WO 2003097826A1 GB 0302128 W GB0302128 W GB 0302128W WO 03097826 A1 WO03097826 A1 WO 03097826A1
Authority
WO
WIPO (PCT)
Prior art keywords
transposon
transposase
minos
gene
library
Prior art date
Application number
PCT/GB2003/002128
Other languages
English (en)
Inventor
Charalambos Savakis
Original Assignee
Minos Biosystems Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0211242A external-priority patent/GB0211242D0/en
Priority claimed from PCT/GB2003/000065 external-priority patent/WO2003056912A2/fr
Priority claimed from GB0304812A external-priority patent/GB0304812D0/en
Application filed by Minos Biosystems Limited filed Critical Minos Biosystems Limited
Priority to AU2003227945A priority Critical patent/AU2003227945A1/en
Publication of WO2003097826A1 publication Critical patent/WO2003097826A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
    • A01K67/0337—Genetically modified Arthropods
    • A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/028—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a herpesvirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/90—Vectors containing a transposable element
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor

Definitions

  • the present invention relates to the use of Minos transposon in a method of insertional mutagenesis to generate libraries of mutants.
  • a preferred method would be to generate a library of mutations throughout the genome and analyse the resultant phenotypes. Once a gene is disrupted, validation of that gene's function requires studies in animal model systems which directly relate cause (i.e. a mutation in a gene sequence, a deletion or an insertion) with a measurable effect (i.e. behavioural, developmental, metabolic etc.) in the whole animal.
  • Insertions may have small phenotypic effects, for example resulting from the insertion of a few amino acids into the sequence of a polypeptide or decreased expression of the gene. Alternatively, the effects may be more pronounced, possibly including the complete inactivation of a gene. Insertion events may be detected by screening for the presence of the vector, probing for the nucleic acid sequence thereof.
  • Transposons are natural genetic elements capable of jumping or transposing from one position to another within the genome of a species. Mobilisation of a transposon is dependant on the expression of a tranposase enzyme which binds to sequences flanking the transposon DNA leading to the excision of DNA from one position in the genome and reinsertion elsewhere in the genome. Insertion into a gene sequence will lead to a change in gene function which may, in turn, result in a measurable phenotypic change in the whole organism.
  • Transposons or transposable elements can be divided into two classes. Class I are the retro-transposons that replicate through an RNA intermediate and utilize reverse transcriptase to produce a DNA molecule that is inserted into the host cell's genome.
  • the Class II transposons include all other mobile elements and include P, hobo, mariner, Minos, Tel, and Ac elements (Berg & Howe, Mobile DNA, American Society for Microbiology, Washington, D.C. 1989).
  • Members of this transposon class have short inverted repeats at their termini and generate direct duplications of a host target sequence upon insertion.
  • the P element has a very restricted host range, and therefore other elements have been employed in the past decade as vectors for gene transfer and/or mutagenesis in a variety of complex eukaryotes, including nematodes, plants, mammals, fish e.g. zebrafish and birds.
  • P element integration preference in Drosophila is strong for some genes (hotspots) but very low for others (coldspots).
  • 5'UTRs are strong preferential intragenic targets for P element vectors.
  • Transposons generally have a target nucleic acid sequence into which they insert.
  • the target sequence is a dinucleotide recognition site.
  • the present invention describes the use of a transposon which recognises a dinucleotide target site, in particular Minos, in the generation of a library of mutants.
  • the use of this system has a number of advantages over current methods of introducing random insertional mutations into genes.
  • the system based on dinucleotide, and specifically AT recognition has a high rate of insertional efficiency and, surprisingly, has a high rate of targeting introns.
  • this system allows generation of a different set of mutations to those obtained by P element insertion.
  • the present invention provides a method of producing a library of genetic mutations in a cell population by insertional mutagenesis comprising introducing a transposon which targets a dinucleotide recognition sequence into a cell, combining it with a transposase and identifying cells having a transposon integration event.
  • the dinucleotide recognition sequence is AT.
  • the transposon is Minos.
  • Minos a type 2 transposon and member of the Tel /mariner family of elements, was isolated from D. hydei and has been used for the germ line transformation of D. melanogaster, C. capitata, and Anopheles stephensi (Loukeris, T. G. et al (1995) Proc N ⁇ tl Ac ⁇ d Sci U S A, 92, 9485-9; Loukeris, T. G. et al (1995) Science, 270, 2002-5, Catteruccia F. et ⁇ l. (2000) Nature 405 959-962) and using transient mobilisation assays it has also been shown to be active in embryos of D.
  • Minos is active in cultured cells and produces stable integrants in the germ line of several insect species, in mouse tissues and in human cells.
  • the cell population may be derived from mouse or other animal cells.
  • the cell population is a population of Drosophila larvae.
  • the method is characterised by the resultant cell population having a high frequency of insertion of Minos into introns.
  • Minos transposon is used to generate single insertions into autosomes.
  • the Minos transposition event is induced by heat shock.
  • remobilisation of a single insertion of a Minos transposon into the X chromosome can generate progeny having a single insertion into the autosomes.
  • a method of generating a transgenic progeny having an autosomal transposition comprising the steps of:
  • a progeny which comprises, in the genome of one or more of its cells, both (i) one or more copies of the transposon and (ii) a gene encoding a transposase cognate for said transposon, wherein the gene encoding the transposase is under the control of one or more regulatory sequences which permit expression of the transposase; and (d) inducing expression of said gene encoding the transposase in said progeny to cause mobilisation of said transposon within the germ line of said progeny;
  • the copy of the transposon is labelled with a marker.
  • the transposon is operably linked to EGFP.
  • the transposon is from the construct MiPRl .
  • the female adult in step (a) has a copy of the transposon on the X chromosome.
  • the male adult in step (b) has a copy of the transposase on an autosome.
  • the transposase is under the control of a heat inducible promoter.
  • the heat inducible promoter is the promoter sequence of hsp70.
  • the induction step (d) is treating the progeny with a heat shock.
  • the transgenic adults and transgenic progeny are Drosophila.
  • the progeny selected in step (c) are Drosophila jumpstart males.
  • the jumpstart males are from the cell line PhsILMiT2.4.
  • the invention thus provides a method of generating a transgenic progeny by transposon mobilisation, comprising the steps of:
  • transposase (a) providing a progeny which comprises, in the genome of one or more of its cells, both (i) one or more copies of a transposon and (ii) one or more genes encoding a transposase cognate for said transposon, wherein the gene encoding the transposase is under the control of one or more regulatory sequences which permit expression of the transposase, and
  • the female transgenic organism can be transgenic lines comprising stably integrated transposons in the X chromosome and comprising EGFP or another marker.
  • the cell line is derived from the method set out in Figure 2.
  • Such transgenic lines can be generated using standard germline transformation procedures.
  • the transposons are derived from the constructs set out in Figure 1.
  • Transposons can be induced to transpose through crossing with the male transgenic organism. Accordingly, the invention provides a method which can allow the rapid generation of thousands of mutant progeny.
  • progeny is meant the result of reproduction between the first transgenic organism and the second transgenic organism.
  • the transgenic organism is Drosophila.
  • the one or more regulatory sequences which permit expression of the transposase are sequences which allow specific expression of the transposase after heat treatment.
  • the regulatory sequences are derived from a gene whose expression is increased in response to heat shock such as hsp70.
  • Figure 3 is a schematic diagram showing in vivo transposition in Drosophila with the female contributing the transposon, and the male the transposase. Remobilisation of the transposon takes place in heat shock.
  • the progeny which have transposition events taking place in the germline are then mated to produce offspring in which the transposition events can be characterised.
  • a progeny having germline transposition can be mated to a normal mate or to a mate which, itself comprises a mutation.
  • the progeny are crossed to a white mutant which is a genetic background which enables the labelled transposon to be detected more easily.
  • Embryo or “larvae” as herein described should be understood to refer to the structure developing from a single fertilised egg or zygote to the time of birth or hatching in the case of vertebrates or invertebrates or germination in the case of plants.
  • embryo should be understood to also encompass a mammalian fetus.
  • chromatin opening domains for example ubiquitously- acting chromatin opening elements (UCOEs) (PCT/GB99/02357 (WO 0005393)), locus control regions (LCRs) (Fraser, P. & Grosveld, F. (1998). Curr. Opin. Cell Biol.10, 361-365), CpG islands or insulators to control expression of the transposon and or the gene encoding the transposase.
  • UOEs ubiquitously- acting chromatin opening elements
  • LCRs locus control regions
  • CpG islands or insulators to control expression of the transposon and or the gene encoding the transposase.
  • the transposon and the gene encoding the transposase may be provided as a single construct such that the gene encoding the transposase is disrupted when the transposon mobilises, thus limiting further mobilisation of the transposon.
  • This may be achieved by placing one of the inverted repeats of the transposon in an intron which interrupts the transposase gene in such orientation that the transposase gene is disrupted when the transposon is mobilised.
  • This vector enables a single cross step to be used to generate a transgenic organism that contains regulator, transposase gene and transposon. Further, transposition leads to complete inactivation of the transposase source, resulting in stability of the new insertion even in the presence of inducer.
  • transposase gene is not destroyed on transposition, thus allowing further transposon mobilisation on, for example, administration of inducer.
  • transposition may be induced using any system known to the skilled person.
  • Transposition may be induced by induction of transposase gene expression via application of an endogenous substance or via operation of an endogenous signal.
  • the one or more regulatory sequences of which the gene encoding the transposase is under the control may be inducible regulatory sequences.
  • suitable induction systems include tet based systems, the lac operator-repressor system, ecdysone based systems and oestrogen based systems, details of which are provided infra.
  • Exogenous inducers may be provided in any convenient fashion, e.g. by injection to the maternal animal or embryo or as an additive to the food or water supply to the maternal animal. Transposition may be induced at one or more times during embryo development. Thus inducers may be administered only once or repeatedly during one or more stages of development.
  • transposon insertion may give rise to novel phenotypic variations in the organisms.
  • the precise nature of the insertional event will determine whether it will influence functional gene expression in some or all embryonic and adult tissues.
  • gene expression patterns of modified genes can be monitored during embryo development and in adult cells and tissues.
  • the transposition event is lethal to a cell
  • the cells will not survive. If the insertional event is present in all cells from which a particular tissue or organ is composed, that tissue or organ may not function or develop and the embryo may not be viable.
  • the transposition event may have non-lethal phenotypic consequences.
  • the transposition event may have the effect of modulating the function of an enzyme in the affected cells, resulting in a relative change in metabolism compared to the unaffected cells. Phenotypic variations in cells, tissues or organs of the transgenic organisms may be traced back to transposition events in the genome of those cells, tissues or organs.
  • said construct comprises sequences derived from Minos operably linked to a reporter gene.
  • the construct is a plasmid rescue construct.
  • the construct is an enhancer trap construct.
  • the construct further comprises an origin of replication and a selectable marker.
  • the reporter gene is a derivative of Green Fluorescent Protein (GFP).
  • the reporter gene is enhanced GFP (EGFP) in a 3xP3-EGFP construct.
  • a construct comprising a fransposase for use in conjunction with a transposon-containing construct in accordance with the invention.
  • said construct comprises a transposase under the control of an inducible promoter.
  • said inducible promoter is derived from a heat shock protein and is inducible under heat shock conditions.
  • the transposase is operably linked to the hsp70 promoter.
  • Figure 1 schematically illustrates Minos plasmid rescue, Minos enhancer trap and Minos helper constructs which may be used in the present invention.
  • a construct as described herein and shown in Figure 1 in a method of generating a library of genetic mutations in a cell population.
  • the cell population is Drosophila.
  • transgenic Drosophila line capable of remobilising a single insertion of a transposon on the X chromosome to the autosomes.
  • the transgenic Drosophila line is PhsILMiT2.4.
  • the single insertion of a transposon on the X chromosome is an insertion of the transposon MiPRl on the X chromosome, X:8F3 or an insertion of the transposon MiETl on the X chromosome, X:17D3.
  • the methods of the invention may advantageously be used in the generation of a library of genetically modified organisms having a genetic modification produced by transposon mobilisation.
  • a library of mutants comprising a Minos integration event.
  • said library is generated using at least one of the constructs in accordance with the invention.
  • Said library of mutants may be a library of mutant cells derived from mice or other animals or may be a library of cells from insects, such as Drosophila.
  • the library of mutants is generated using at least one of the constructs as set out in Figure 1 and described in the examples herein.
  • the library of mutants is a library of Drosophila mutants comprising a Minos integration event in the Drosophila genome.
  • a library of mutants in accordance with this aspect of the invention will have the characteristic of having greater than 10%, greater than 20%, greater than 25% and, most preferably, greater than 30% of insertions being in introns.
  • the library will be characterised in that, apart from the absolute requirement for the target TA sequence, the Minos insertion sites do not have any preference for sequence or structural requirements.
  • the library in accordance with the invention has a random integration of exogenous sequences.
  • a Drosophila mutant having a Minos integration event in the Drosophila genome wherein the integration is into any one of the genes as set out in Table 1.
  • the transposon may be a natural transposon.
  • it is a type 2 transposon, such as Minos. Most advantageously, it is Minos.
  • Modified transposons which incorporate one or more heterologous coding sequences and/or expression control sequences may also be used in the invention.
  • Such coding sequences may include selectable and/or unselectable marker genes, which may facilitate the identification of transposons in the genome and cloning of the loci into which the transposons have been integrated.
  • Suitable markers include fluorescent and/or luminescent polypeptides, such as GFP and derivatives thereof, luciferase, ⁇ - galactosidase, or chloramphenicol acetyl transferase (CAT).
  • Other suitable markers include that encoded by the 3xP3-EGFP construct.
  • markers may be used in in vivo enhancer or silencer traps and exon traps, by, for example inserting fransposons which comprise marker genes which are modulated in their expression levels by proximity with enhancers or exons. Constructs for use in exon and enhancer traps are described in EP 0955364.
  • the plurality of cells or tissues homogeneous for a transposition event may display modulation of expression of marker gene(s), thus enabling efficient trapping of enhancers and or silencers and/or exons.
  • modulation of the expression of a marker gene may be identified by comparison with cells or tissues of the same type in the same fransgenic animal which does not display such modulation.
  • fransposons may be used to upregulate the expression of genes.
  • a fransposon may be modified to include an enhancer or other franscriptional activation element. Mobilisation and insertion of such a fransposon in the vicinity of a gene upregulates expression of the gene or gene locus.
  • This embodiment has particular advantage in the isolation of oncogenes, which may be identified in clonal tumours by localisation of the fransposon.
  • the present invention may thus be used in the identification of novel targets for molecular intervention, including targets for disease therapy in humans, plants or animals, development of insecticides, herbicides, antifungal agents and antibacterial agents.
  • targets for disease therapy in humans, plants or animals, development of insecticides, herbicides, antifungal agents and antibacterial agents.
  • One further application is the discovery of genes responsible for pathogenesis (for example, in mouse disease models).
  • the transposon may be inserted into a gene.
  • the transposon is inserted into a transcribed gene, resulting in the localisation of said transposon in open chromatin.
  • the transposon may be flanked by chromatin opening domain elements, such as locus control regions which provide tissue specific expression (Fraser, P. & Grosveld, F. (1998). Curr. Opin. Cell Biol.10, 361-365) or ubiquitously-acting chromatin opening elements - (UCOEs), which enable non-tissue specific expression (for example see WO 0005393).
  • Other chromatin opening domains which may be used in methods of the invention include CpG rich islands, which may normally be associated with housekeeping genes or tissue specific genes, or insulators.
  • the fransposon may itself comprise, between the fransposon ends, chromatin opening domains. This will cause activation of the chromatin structure into which the transposon integrates, facilitating access of the inducible fransposase in a cell or tissue specific manner thereto. 097826
  • transposase construct may comprise or be flanked by chromatin opening domain elements.
  • Transposons have a target nucleotide sequence.
  • a number of known transposons have complex recognition sites which favour controlled transposition events e.g in gene therapy applications.
  • PiggyBac (previously described as IFP2)
  • TTAA tetranucleotide
  • Baculovirus- infected cells Gary et al., Virology, Volume 172, 156-169, 1989.
  • the specificity for TTAA target sites is exhibited by other Lepidopteran fransposon-like insertions as well (Beames & Summers, Virology, Volume 162, 206-220 1988; Beames & Summers, Virology, Volume 174, 354-363 1990; Carstens, Virology, Volume 161, 8-17, 1987; Oellig et al., J. Virology, Volume 61, 3048-3057, 1987; Schetter, Oellig & Doerfler, J. Virology, Volume 64, 1844-1850, 1990).
  • Transposon-based genetic transformation systems are being developed.
  • the transposon for use in the invention has a simple recognition site.
  • simple site comprises a dinucleotide sequence and, preferably, AT. It has been demonsfrated herein that the use of a transposon having a recognition site which occurs with high frequency in infron sequences allows infrons to be targetted.
  • the transposon for use in the invention is Minos.
  • Minos is advantageously employed with its natural cognate fransposase, although the use of modified and/or improved fransposases is envisaged.
  • Minos transposons, and their cognate transposase, are described in detail in US patent 5,840,865 and European patent application EP 0955364.
  • the fransposon preferably comprises a nucleic acid sequence encoding a heterologous polypeptide.
  • This sequence will be integrated, together with the transposon, into the genome of the cell on transposon integration. Moreover, it will be excised, together with the transposon, when the latter excises on remobilisation.
  • the heterologous polypeptide is a selectable marker. This allows cells having integrated transposons to be identified and the site of integration to be accurately mapped.
  • a "transposition event” or "fransposon integration” is a change in genomic sequence caused by transposon mobilisation and includes insertion events, integration events excision events or chromosomal breaks.
  • transposons are known.
  • the hobo element of Drosophila melanogaster has been described by Gelbart WM, Blackman RK, Prog Nucleic Acid Res Mol Biol (1989);36:37-46.
  • Salmonid type transposons such as the Sleeping Beauty (SB) transposon, a Tel /mariner-like transposable element reconstructed from fish have been described by Ivies et al (1997) Cell 91, 501-510 and Horie et al (2001), Proc. Natl. Acad. Sci. USA, Vol. 98, Issue 16, 9191-9196.
  • Mariner is a fransposon originally isolated from Drosophila mauritiana, but since discovered in several invertebrate and vertebrate species.
  • Preferred marker genes include genes which encode fluorescent polypeptides.
  • green fluorescent proteins of cnidarians, which act as their energy- transfer acceptors in bioluminescence
  • a green fluorescent protein as used herein, is a protein that fluoresces green light
  • a blue fluorescent protein is a protein that fluoresces blue light.
  • GFPs have been isolated from the Pacific Northwest jellyfish, Aequorea victoria, from the sea pansy, Renilla reniformis, and from Phialidium gregarium. (Ward et al, 1982, Photochem. Photobiol., 35: 803-808; Levine et al, 1982, Comp. Biochem.
  • Fluorescent proteins have also been isolated recently from Anthoza species (accession nos. AF168419, AF168420, AF168421, AF168422, AF168423 and AF168424).
  • Anthoza species accession nos. AF168419, AF168420, AF168421, AF168422, AF168423 and AF168424.
  • a variety of Aequorea- ⁇ elated GFPs having useful excitation and emission spectra have been engineered by modifying the amino acid sequence of a naturally occurring GFP from Aequorea victoria (Prasher et ⁇ l, 1992, Gene, 111: 229-233; Hei et ⁇ , 1994, Proc. Natl. Acad. Sci. U.S.A., 91: 12501-12504; PCT/US95/14692).
  • Aequorea- related fluorescent proteins include, for example, wild-type (native) Aequorea victoria GFP, whose nucleotide and deduced amino acid sequences are presented in Genbank Accession Nos. L29345, M62654, M62653 and others Aequorea- ⁇ elated engineered versions of Green Fluorescent Protein, of which some are listed above. Several of these, i.e., P4, P4-3, W7 and W2 fluoresce at a distinctly shorter wavelength than wild type. Another useful GFP derivative is EGFP.
  • the marker gene encoded by the construct 3xP3- EGFP is particularly preferred.
  • marker genes examples include selectable marker genes such as genes encoding neomycin, puromycin or hygromycin or counter-selection genes such as the genes for cytosine deaminase or nifroreductase.
  • marker genes which may be used. Any suitable marker gene may be used and it should be appreciated that no particular choice is essential to the present invention.
  • Transposons and sites from which fransposons have been excised, may be identified by sequence analysis. For example, Minos typically integrates at a TA base pair, and on excision leaves behind a duplication of the target TA sequence, flanking the four terminal nucleotides of the fransposon. The presence of this sequence, or related sequences, may be detected by techniques such as sequencing, PCR and or hybridisation. Inserted transposons may be identified by similar techniques, for example using PCR primers complementary to the terminal repeat sequences.
  • the identification of a transposon insertion event provides a method for detecting a genetic mutation in a fransgenic organism. This mutation can then be characterised. For example, a fransposon insertion may be detected by identifying a plurality of cells displaying a variant phenotype and the position of one or more fransposon transposition events in the genome of one or more of said cells may be detected by sequencing and/or PCR as described above.
  • a correlation of the position of the transposition events with the observed variant phenotype can be made where the position of the transposition events is indicative of the location of one or more genetic loci associated with the observed variant phenotype.
  • Detecting the position of a transposon transposition event further allows cloning of the genetic loci comprising the insertion and thus the identification of a gene whose mutation is correlated with a specific phenotype.
  • the locus of the modification may be identified precisely by locating the fransposon insertion. Sequencing of flanking regions allows identification of the locus in databases, potentially without the need to sequence the locus.
  • Transpositions can be "tagged" allowing positional changes within complex genomes to be rapidly determined and flanking genes determined by sequence analysis. This allows an immediate link between cause (i.e. an insertional event in a specific gene or regulatory element) and effect (i.e. a phenotypic of measurable change).
  • Effective fransposon mobilisation depends on both efficient delivery of the fransposable element itself to the host cell and the presence of an effective cognate transposase in the cell in order to catalyse transposon jumping.
  • a "cognate" transposase is any transposase which is effective to activate transposition of the fransposon, including excision of the transposon from a first integration site and/or integration of the transposon at a second integration site.
  • the cognate transposase is the transposase which is naturally associated with the transposon in its in vivo situation in nature.
  • the invention also encompasses modified fransposases, which may have advantageously improved activities within the scope of the invention.
  • the sequence of the gene encoding the fransposase may be modified to optimise codon usage and thus increase transposition frequencies.
  • Optimisation of codon usage is a method well known in the art to increase the expression levels of a given gene.
  • the transposase may comprise one or more insertions, substitutions or deletions of amino acids to provide enhanced activity in the host organism.
  • the gene encoding the fransposase may be provided in the genome of a second organism which is crossed with a first organism comprising, in its genome, the transposon to produce an embryo for use in the methods of the invention.
  • one or more copies of both the fransposon and the gene encoding the cognate transposase are provided in the genome of a first organism, which may be crossed with a second organism comprising one or more copies of regulatory elements necessary to permit inducible transposase expression to produce an embryo.
  • transposase genes may be inserted into the host cell genome by fransgenic techniques. Such methods are discussed further below.
  • transposable element mediated transformation is by co- injecting into pre-blastoderm embryos a mixture of two plasmids: one expressing transposase (Helper) but unable to transpose, and one carrying the gene of interest flanked by the inverted terminal repeats of the element (Donor). Transformed progeny of injected animals are detected by the expression of dominant marker genes.
  • WO 01/71019 describes the generation of fransgenic animals using fransposable elements.
  • the transposase function is provided by crossing of transgenic organisms, one of which provides a fransposon function and the other providing a transposase function in order to produce organisms containing both transposon and transposase in the required cells or tissues.
  • tissue specific chromatin opening domains directs fransposase activity in a tissue specific manner and gives rise to multiple independent transposition events in somatic tissues (see Zagoraiou et al (2001) P.N.A.S. 98.11474-11478).
  • Transgenic animals where described, have the transposase provided in cis or trans, for example by cotransformation with transposase genes.
  • Regulation of Transposase Expression Coding sequences encoding the transposase may be operatively linked to regulatory sequences which modulate transposase expression as desired.
  • Control sequences operably linked to sequences encoding the fransposase include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host organism in which the expression of the transposase is required.
  • promoter is well known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.
  • the promoter is typically selected from promoters which are functional in cell types homologous to the organism in question, or the genus, family, order, kingdom or other classification to which that organism belongs, although heterologous promoters may function - e.g. some prokaryotic promoters are functional in eukaryotic cells.
  • the promoter may be derived from promoter sequences of viral or eukaryotic genes. For example, it may be a promoter derived from the genome of a cell in which expression is to occur.
  • eukaryotic promoters they may be promoters that function in a ubiquitous manner (such as promoters of ⁇ -actin, ⁇ -actin, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase).
  • the promoters may be derived from genes whose expression is induced during gametogenesis, either oogenesis or spermatogenesis.
  • the promoters may be derived from genes whose expression is developmentally regulated.
  • promoters from maternal effect genes may be used.
  • Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE promoter.
  • MMLV LTR Moloney murine leukaemia virus long terminal repeat
  • RSV rous sarcoma virus
  • CMV human cytomegalovirus
  • the gene encoding the transposase is under the confrol of one or more regulatory sequences, meaning that the levels of expression obtained using e.g. a promoter can be regulated.
  • the regulatory sequence may be an inducible regulatory sequence.
  • Inducible systems for gene expression are known in the art, and include tefracycline, ecdysone and estrogen-inducible systems or the lac operator-repressor system.
  • heat shock proteins' or HSP is a group of proteins first found in cells that were exposed to high temperatures. Heat shock proteins are also being synthesized under different kind of stress conditions, like inflammation, infection, ischemia and exposure of the cell to toxins or malignant fransformation.
  • Heat shock proteins act as molecular chaperones for protein molecules. Usually they are cytoplasmic proteins and they function in various infra-cellular processes. They play an important role in protein-protein interactions, including folding and assisting in establishing of proper protein conformation, and prevention of inappropriate protein aggregation. Heat shock proteins have been named according to their molecular weights.
  • Heat shock proteins are found ubiquitously in bacteria through to plants, insects and mammals.
  • the HSP70 family is comprised of multiple members and it may be the most abundant HSP induced in cell response to stress - up to 20% of the total cellular protein after appropriate stimulation.
  • HSP70 is localized in the cytosol, mitochondria and endoplasmic reticulum and exhibit constitutive and inducible regulation.
  • HSP70 is not typically expressed in all kind of cells, but it is expressed at high levels in stress conditions.
  • HSP70 participates in translation, protein franslocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins.
  • the activity of HSP70 appears to be regulated by co-factor chaperones.
  • the promoter sequence of hs ⁇ 70 may be isolated and used to allow inducible expression of a specific construct when treated with heat or other inducing conditions. Accordingly, particularly preferred inducible systems may be based on using a promoter derived from hs ⁇ 70.
  • a widely used system of this kind in mammalian cells is the tetO promoter-operator, combined with the tefracycline/doxycycline-repressible franscriptional activator tTA, also called Tet-Off gene expression system (Gossen, M. & Bujard, H. (1992) Tight confrol of gene expression in mammalian cells by tetracycline responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551), or the doxycycline-inducible rtTA transcriptional activator, also called Tet-On system (Gossen, M., Freundlich, S., Bender, G., MuUer, G., Hillen, W. & Bujard, H. (1995) Transcriptional activation by tetracycline in mammalian cells. Science 268:1766-1769).
  • Tet-Off gene expression is turned on when tetracycline (Tc) or doxycycline (Dox; a Tc derivative) is removed from the culture medium.
  • Tc tetracycline
  • Dox doxycycline
  • Tet-On Procedures for establishing cell lines carrying the transcriptional activator gene and the Tet- regulatable gene stably integrated in its chromosomes have been described. For example see hr ⁇ ://www.clontech.conVtechinfo/manuals/PDF/PT3001-l.pdf.
  • the Tet-On system may be employed for tefracycline-inducible expression of Minos transposase in a fransgenic animal.
  • Alternative inducible systems include tamoxifen inducible transposase [a modified oestrogen receptor domain (Indra et al., Nucl Acid Res. 27, 4324-27, 1999) coupled to the transposase which retains it in the cytoplasm until tamoxifen is given to the culture], an RU418 inducible fransposase (operating under the same principle with the glucocorticoid receptor; see Tsujita et al., J. Neuroscience, 19, 10318-23, 1999), or an ecdysone-inducible system.
  • tamoxifen inducible transposase a modified oestrogen receptor domain (Indra et al., Nucl Acid Res. 27, 4324-27, 1999) coupled to the transposase which retains it in the cytoplasm until tamoxifen is given to the culture
  • an RU418 inducible fransposase
  • the ecdysone-inducible system is based on the heterodimeric ecdysone receptor of Drosophila, which is induced by the insect hormone, ecdysone and its derivatives.
  • Drosophila Drosophila
  • ecdysone a cascade of morphological changes is triggered by the steroid hormone 20-OH ecdysone, generally referred to as "ecdysone”
  • Ecdysone responsiveness may be transferred to mammalian cells by the stable expression of a modified ecdysone receptor that regulates an optimized ecdysone responsive promoter.
  • mice expressing the modified ecdysone receptor can activate an integrated ecdysone responsive promoter upon administration of hormone or its derivatives e.g. Once the receptor binds ecdysone or muristerone, an analog of ecdysone, the receptor activates the ecdysone-responsive promoter to give controlled expression of the gene of interest.
  • Ecdysone-based inducible systems are reported to exhibit lower basal activity and higher inducibility than tetracycline based systems.
  • the lac operator-repressor system has recently been shown to be functional in mammals, in particular the mouse. Cronin et al, Genes and Development, 15, 1506- 1517 (2001), the contents of which are herein incorporated by reference, describes the use of a lac repressor transgene that resembles a typical mammalian gene both in codon usage and structure and that expresses functional lac repressor protein ubiquitously in mice to control the expression of a reporter gene under the confrol of the lac promoter. Expression of the reporter gene is reversible using the lactose analog IPTG provided in the drinking water of the mouse or mother of the embryo or nursing pup.
  • the lac operator-repressor system may thus be adapted for use to regulate expression of fransposase by placing the fransposase gene under the control of a lac promoter.
  • any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences.
  • Chimeric promoters may also be used comprising sequence elements from two or more different promoters described above.
  • LCRs locus confrol regions
  • UCOEs ubiquitously-acting chromatin opening elements -
  • TBP ubiquitously-acting chromatin opening elements -
  • hnRNPA2 ubiquitously-acting chromatin opening elements -
  • transposition is achieved by the action of the fransposase enzyme on the terminal repeat sequences of the integrated transposon, resulting in excision of the fransposon from its original position in the "host" genome and reinsertion of the fransposon at a different position in the genome.
  • this process can be made to be more efficient by simply improving the concentration of substrates, high levels of the terminal repeats sequences, i.e. an increase in copy number and high levels of the fransposase enzyme.
  • An increase in copy number can be achieved by generating multiple copy arrays at the original insertion site. For example, 10 to 100 copies can be generated through standard transgenesis or using a PAC vector. Alternatively, multiple copies can be generated by the presence of multiple insertions at different sites in the genome.
  • the sequence of the transposase may be modified to optimise codon usage and thus, increase transposition frequencies.
  • Optimisation of codon usage is a method well known in the art to increase the expression levels of a given gene.
  • the efficiency of the fly fransposase in mammalian cells or animals may be increased by increasing its concenfration as a result of a more efficient translation from mRNA by replacing the fly codon usage to mammalian codon usage.
  • Assays for determining transposase efficiency can include a standard transposition assay as described, for example, by Klinakis et al.; Insect Molecular Biology, 9 (3), 269-275, 2000.
  • the concentration of transposase mRNA can also be increased by including in the transposase mRNA sequence 5' and 3' sequences found in abundant stable mRNAs such as those encoding growth hormone, globin, actin or albumin.
  • Methods of the invention may employ one or more fransgenic organisms having integrated in the genome the transposon, a gene encoding the cognate transposase or both.
  • the introduction of the transposon or gene encoding the transposase may be accomplished by any available technique, including transformation/transfection, delivery by viral or non-viral vectors and microinjection. Each of these techniques is known in the art.
  • the transposon and the gene encoding the transposase may be inserted using the same or different methods.
  • the Drosophila P-element may be used to introduce a Minos fransposase construct into Drosophila.
  • the fransposon or gene encoding the transposase may be inserted into the host cell genome by fransgenic techniques, for example to produce a transgenic animal comprising a fransposon, a gene encoding a cognate transposase or both.
  • the transgenic animal comprises both the transposon and the gene encoding the fransposase
  • both constructs can be inserted using the same or different methods.
  • delivery of the construct is by viral vector
  • a composite vector comprising both the fransposon and the gene encoding the fransposase under the control of a confrol sequence such as the Tet operator may be used.
  • a confrol sequence such as the Tet operator
  • separate vectors may be used.
  • Any suitable transgenic animal may be used in the present invention.
  • Animals include animals of the phyla cnidaria, ctenophora, platyhelminthes, nematoda, annelida, mollusca, chelicerata, uniramia, Crustacea and chordata.
  • Uniramians include the subphylum hexapoda that includes insects such as the winged insects.
  • Chordates include vertebrate groups such as mammals, birds, fish, reptiles and amphibians. Particular examples of mammals include non-human primates, cats, dogs, ungulates such as cows, goats, pigs, sheep and horses and rodents such as mice, rats, gerbils and hamsters.
  • the animal is an insect.
  • the insect is Drosophila.
  • Methods for producing transgenic insects which may be used in the method of the invention are well known (see for example Loukeris et al (1995), Science 270 2002-2005). Briefly, a fransposable element carrying the gene of interest is inserted into a preblastoderm embryo using e.g. microinjection.
  • the new genetic material is placed at the polar plasm, which is the section of egg destined to become the still nascent insect' s own egg or sperm cells. After many divisions of the nuclear material, most of it segregates to the periphery where it will become the nuclei of the insect's body.
  • the animal is preferably a mammal.
  • Advances in technologies for embryo micromanipulation now permit introduction of heterologous DNA into, for example, fertilised mammalian ova.
  • totipotent or pluripotent stem cells can be fransformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, refroviral infection or other means, the fransformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
  • developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
  • the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
  • Those techniques as well known see reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian fertilised ova, including Hogan et al, Manipulating the Mouse Embryo, (Cold Spring Harbor Press 1986); Krimpenfort et al, Bio Technology 9:844 (1991); Palmiter et al, Cell, 41 : 343 (1985); Kraemer et al, Genetic manipulation of the Mammalian Embryo, (Cold Spring Harbor Laboratory Press 1985); Hammer et al, Nature, 315: 680 (1985); Wagner et al, U.S. Pat. No. 5,175,385; -Krimpenfort et al, U.S. Pat. No. 5,175,384, the respective contents of which are incorporated herein by reference.).
  • Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
  • Transgenic animals may also be produced by nuclear transfer technology as described in Schnieke, A.E. et al, 1997, Science, 278: 2130 and Cibelli, J.B. et al, 1998, Science, 280: 1256.
  • fibroblasts from donor animals are stably fransfected with a plasmid incorporating the coding sequences for a polypeptide of interest under the control of regulatory sequences.
  • Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
  • nucleotide constructs comprising a sequence encoding a DNA binding molecule are microinjected using, for example, the technique described in U.S. Pat. No. 4,873,191, into oocytes which are obtained from ovaries freshly removed from the mammal.
  • the oocytes are aspirated from the follicles and allowed to settle before fertilisation with thawed frozen sperm capacitated with heparin and prefractionated by Percoll gradient to isolate the motile fraction.
  • the fertilised oocytes are centrifuged, for example, for eight minutes at 15,000 g to visualise the pronuclei for injection and then cultured from the zygote to morula or blastocyst stage in oviduct tissue-conditioned medium.
  • This medium is prepared by using luminal tissues scraped from oviducts and diluted in culture medium.
  • the zygotes must be placed in the culture medium within two hours following microinjection.
  • Oesfrous is then synchronized in the intended recipient mammals, such as cattle, by administering coprostanol. Oesfrous is produced within two days and the embryos are transferred to the recipients 5-7 days after oesfrous. Successful transfer can be evaluated in the offspring by Southern blot.
  • the desired constructs can be introduced into embryonic stem cells (ES cells) and the cells cultured to ensure modification by the transgene.
  • the modified cells are then injected into the blastula embryonic stage and the blastulas replaced into pseudopregnant hosts.
  • the resulting offspring are chimeric with respect to the ES and host cells, and nonchimeric strains which exclusively comprise the ES progeny can be obtained using conventional cross-breeding. This technique is described, for example, in WO91/10741.
  • Alternative methods for delivery and stable integration of fransposons and or genes encoding fransposases into the genome of host animals include the use of viral vectors, such as adenoviral vectors, retroviral vectors, baculoviral vectors and herpesviral vectors.
  • viral vectors such as adenoviral vectors, retroviral vectors, baculoviral vectors and herpesviral vectors.
  • Such techniques have moreover been described in the art, for example by Zhang et al. (Nucl. Ac. Res., 1998, 26:3687-3693).
  • Suitable viral vectors may be retroviral vectors, and may be derived from or may be derivable from any suitable refrovirus.
  • a large number of different refroviruses have been identified. Examples include: murine leukaemia virus (MLV), human immunodeficiency virus (HIV), simian immunodeficiency virus, human T-cell leukaemia virus (HTLV).
  • EIAV equine infectious anaemia virus
  • MMTV mouse mammary tumour virus
  • RSV Rous sarcoma virus
  • FuSV Fujinami sarcoma virus
  • Mo-MLV Moloney murine leukaemia virus
  • FBR MSV FBR murine osteosarcoma virus
  • Mo-MSV Moloney murine sarcoma virus
  • Abelson murine leukaemia virus A-MLV
  • A-MLV Avian myelocytomatosis virus-29
  • AEV Avian erythroblastosis virus
  • genomic structure of some refroviruses may be found in the art.
  • details on HIV and Mo-MLV may be found from the NCBI GenBank (Genome Accession Nos. AF033819 and AF033811, respectively).
  • Refroviruses may be broadly divided into two categories: namely, "simple” and “complex”. Refroviruses may even be further divided into seven groups. Five of these groups represent refroviruses with oncogenic potential. The remaining two groups are the lentiviruses and the spumaviruses. A review of these refroviruses is presented in Coffin et al., 1997 (ibid). Host range and tissue fropism varies between different refroviruses. In some cases, this specificity may restrict the transduction potential of a recombinant refroviral vector. For this reason, many gene therapy experiments have used MLV.
  • a particular MLV that has an envelope protein called 4070A is known as an amphofropic virus, and this can also infect human cells because its envelope protein "docks" with a phosphate transport protein that is conserved between man and mouse. This transporter is ubiquitous and so these viruses are capable of infecting many cell types.
  • Replication-defective retroviral vectors are typically propagated, for example to prepare suitable tifres of the retroviral vector for subsequent transduction, by using a combination of a packaging or helper cell line and the recombinant vector. That is to say, that the three packaging proteins can be provided in trans.
  • a "packaging cell line” contains one or more of the refroviral gag, pol and env genes.
  • the packaging cell line produces the proteins required for packaging refroviral DNA but it cannot bring about encapsidation due to the lack of a psi region.
  • the helper proteins can package a psi-positive recombinant vector to produce the recombinant virus stock. This virus stock can be used to transduce cells to introduce the vector into the genome of the target cells.
  • the lentivirus group can be into “primate” and "non-primate”.
  • primate lentiviruses include human immunodeficiency virus (HIV), and simian immunodeficiency virus (SIN).
  • the non-primate lentiviral group includes the prototype "slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). See, for example, Rovira et al, Blood. 2000;96:4111- 4117; Reiser et al, J Virol.
  • lentivirus family and other types of refroviruses are that lentiviruses have the capability to infect both dividing and non-dividing cells.
  • other refroviruses - such as MLV - are unable to infect non-dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue
  • lentiviral vectors are based on HIV, SIV or EIAV.
  • the simplest vectors constructed from HIV-1 have the complete HIV genome except for a deletion of part of the env coding region or replacement of the nef coding region.
  • these vectors express gag/pol and all of the accessory genes hence require only an envelope to produce infectious virus particles.
  • vif, vpr, vpu and nef are non-essential.
  • HIV-based lentiviral vectors One preferred general format for HIV-based lentiviral vectors is, HIV 5 'LTR and leader, some gag coding region sequences (to supply packaging functions), a reporter cassette, the rev response element (RRE) and the 3 'LTR.
  • gag/pol accessory gene products and envelope functions are supplied either from a single plasmid or from two or more co-transfected plasmids, or by co-infection of vector containing cells with HIV.
  • the adenovirus is a double-stranded, linear DNA virus that does not go through an RNA intermediate.
  • adenovirus group C serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections in the young.
  • Adenoviruses/adenoviral vectors which may be used in the invention may be of human or animal origin.
  • adenoviruses of human origin preferred adenoviruses are those classified in group C, in particular the adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2).
  • Ad2 adenoviruses of type 2
  • Ad5 adenoviruses of type 2
  • Ad7 adenoviruses of type 7
  • Adl2 avian adenovirus
  • CELO virus Cotton et al., 1993, J Virol 67:3777-3785
  • HSV vectors maybe derived from, for example, HSV1 or HSV2 sfrains, or derivatives thereof. Attenuated sfrains may be used for example strain 1716 (MacLean et al., 1991, J Gen Virol 72: 632-639), strains R3616 and R4009 (Chou and Roizman, 1992, PNAS 89: 3266-3270) and R930 (Chou et al., 1994, J. Virol 68: 8304-8311) all of which have mutations in ICP34.5, and d27-l (Rice and Knipe, 1990, J. Virol 64: 1704-1715) which has a deletion in ICP27.
  • ICP4 sfrains deleted for ICP4, ICP0, ICP22, ICP6, ICP47, vhs or gH, with an inactivating mutation in VMW65, or with any combination of the above may also be used to produce HSV strains of the invention.
  • HSV genes The terminology used in describing the various HSV genes is as found in Coffin and Latchman, 1996. Herpes simplex virus-based vectors. In: Latchman DS (ed). Genetic manipulation of the nervous system. Academic Press: London, pp 99-114.
  • Baculovirus vectors may moreover be employed in the invention.
  • the baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is a DNA virus which can replicate only in cells of certain lepidopteran insects and has been used widely for expression of recombinant proteins in insect cells.
  • Baculoviruses such as AcMNPV have been used recently for infroducing heterologous DNA with high efficiency in a variety of mammalian cells, such as a hepatoma cell line and primary liver cells, and endothelial cells (Boyce FM, Bucher NL (1996) Baculovirus-mediated gene transfer into mammalian cells.
  • Vectors for use in methods of the invention may employ conventional ligation techniques. Isolated viral vectors, plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required. If desired, analysis to confirm correct sequences in the constructed vectors is performed in a known fashion. Transposon presence and/or mobilisation may be measured in a cell directly, for example, by conventional Southern blotting, dot blotting, PCR or in situ hybridisation, using an appropriately labelled probe which may be based on a sequence present in the fransposon. Those skilled in the art will readily envisage how these methods may be modified, if desired. Vectors useful in the present invention are advantageously provided with marker genes to facilitate transposon identification and localisation as described above.
  • the methods of the present invention enables the generation of fransgenic embryos and organisms comprising one or more clonal populations of cells homogeneous for one or more individual mutations.
  • the invention allows functional mapping of a genome by permitting an improved method of generating mutants with random insertion and targeting of introns.
  • the invention in an advantageous embodiment, allows genes to be marked for functional genetic analysis in a group of cells or tissues, or knocked out, by transposon insertion and then specifically identified through the transposon "tag" without requiring costly and time-consuming genetic analyses, and frequently without significant amounts of sequencing.
  • a further embodiment of the invention provides for the generation of libraries of fransgenic organisms, such as transgenic mice.
  • Target genes may be identified phenotypically according to the phenotype of one or more cells, tissues or organs, and identified genetically by determination of the transposon insertion site.
  • Inducible expression systems as described above, may be used to regulate the switch between partial and antisense-induced complete knockout of a gene.
  • Somatic cells carrying transposon insertions can be immortalized, for example by deriving immortal cell lines by standard methodologies, or by generating transgenic animal lines by nuclear implantation methodologies.
  • Such libraries can be used for phenotypic analysis and identification of gene associations.
  • the present methods allow advantages over the current methods.
  • Candidate disease genes can then become the focus of further studies to determine their precise role in animal models, and validation of a disease related role in man
  • Target validation in man will utilise existing clinical and genetic databases, containing DNA and clinical information on relevant patient and confrol groups.
  • Phenotypic analysis of the fransgenic organisms created can be through simple and rapid measurements including changes in a metabolite, protein (e.g. insulin), lipid or carbohydrate (e.g. when measuring glucose tolerance) present in urine, blood, spinal fluid or tissue. Measurements in body fluids can be made by any one of a number of techniques known to those skilled in the art including measurement by NMR, Elisa, GMS and so forth.
  • phenotypic characteristics can be analysed by measuring behavioural patterns or responses to external stimuli by using tests such as light, sound, memory and stress tests.
  • Other measurable phenotypic characteristics include growth and ageing parameters, tumour growth, obesity and so forth which can be measured by assessing, for example, weight, fat content and growth rate.
  • changes in other measurable features such as blood pressure, heart rate, lung function and so forth can be assessed.
  • the methods of the invention may be used to "mark" genes whose expression is modulated by external stimuli.
  • an embryo, organism, or tissue or cell derived from either, which has been exposed to transposon mobilisation with a marked fransposon is subjected to freatment with an external stimulus, such as a candidate drug or other test agent, and modulation of the expression of the marker observed.
  • Cells in which the marker is over or under- expressed are likely to have the fransposon inserted in or near a gene which is upregulated or downregulated in response to the stimulus.
  • the invention may thus be used to provide in vivo enhancer frap and exon trap functions, by inserting fransposons which comprise marker genes which are modulated in their expression levels by the proximity with enhancers or exons.
  • This approach is useful for the study of gene modulation by drugs in drug discovery approaches, toxicology studies and the like. Moreover, it is applicable to study of gene modulation in response to natural stimuli, such as hormones, cytokines and growth factors, and the identification of novel targets for molecular intervention, including targets for disease therapy in humans, plants or animals, development of insecticides, herbicides, antifungal agents and antibacterial agents.
  • natural stimuli such as hormones, cytokines and growth factors
  • FIG. 1 shows a schematic for the constucts described in the Examples.
  • Two Minos fransposon constructs (MiPRl; 4kb (plasmid rescue) and MiETl; 7.3kb (Enhancer Trap)) and one Minos helper vector construct (PhsILMiT; 7.4kb) are shown.
  • the fransposon vectors carry, in addition to a dominant marker (3xp3 EGFP), a bacterial origin of replication (ori) and an antibiotic resistance gene (kanR).
  • kanR antibiotic resistance gene
  • One of the transposons carries additionally the gene encoding GAL4 activator under the control of a minimal promoter (the promoter of the Minos element itself).
  • the helper vector is based on P and carries the infronless transposase gene under the confrol of a Drosophila heat shock promoter (hsp70p) + hsp70term and the Drosophila white gene as a dominant marker.
  • hsp70p Drosophila heat shock promoter
  • Figure 2 illustrates schematically the introduction of Minos fransposon and transposase source into pre-blastoderm embryos in a method of germline transformation.
  • Figure 3 illustrates schematically the generation of jumpstart males and progeny having an autosomal transposition event.
  • Figure 4 shows SeqLogo analysis of the Minos primary insertion sites. 79 insertion sites were aligned and their informational content plotted with the SeqLogo program. Maximal informational content for DNA is 2 bits per base. As a comparison, the profile for insertion of Sleeping Beauty is given.
  • Figure 5 shows HbondView analysis of 80 Minos insertion sites.
  • the program plots the hydrogen bonding properties of base pairs. Six positions for each base pair are colour-coded according to being a potential hydrogen acceptor (red), a donor (blue) or inert (gray). A graph of the average colour intensity in every position is created. As comparison, graphs for Sleeping Beauty in human DNA (Vigdal et al.) and the P- element in Drosophila (Liao et al.) are given.
  • Figure 6 illustrates the sequence of the parental and four different Minos insertions in the Mus musculus genome. Chromosomal sequences flanking the new inserted transposon are represented by capital letters, transposon sequence in small letters and the target site duplication in grey. The chromosomal locations of insertions and scaffold numbers from the Celera database are indicated. Table 1 presents the results of the analysis of Minos transposon insertion into Drosophila progeny.
  • Minos transposable element As a mutagenesis tool in Drosophila we have generated and analysed 96 Minos integration events into the Drosophila genome. Additionally, we have devised an efficient jumpstarting scheme for generating single insertions in autosomes. Our results demonstrate that a Minos- based insertional mutagenesis system is now available for genetic screens in Drosophila.
  • Plasmids construction For the generation of pMiPRl, oligonucleotides containing the Kpnl, Sfil, Bglll, Xbal, Stul, EcoRV, Sad, Sspl restriction enzymes sites were cloned in the Hindlll-Xmal sites of the vector ⁇ HSS6 (Seifert et al, 1986), resulting in pHSSK.
  • the EGFP gene flanked by the 3xP3 promoter and the SV40polyA was cloned into EcoRI-Smal digested pBlueScript KSII+ (Stratagene) as an EcoRI-Fsel blunted fragment and it was recloned as an Xbal-Xhol fragment into pMiLRtetR vector, resulting in pMi3xP3-EGFP vector.
  • An EcoRI-Notl fragment from pMi3xP3-EGFP was cloned into pMiLRoriT, resulting in the fransposon homing plasmid pMiPRl.
  • transposon MiETl was based on the fransposon MiPRl.
  • the Gal4 coding sequence, followed by a hsp70 terminator, together with 75bp of upstream sequence from the vector pHSREM (lacking the heat shock consensus sequences) were taken from the vector pGATN (Brand and Perrimon, 1993) after PCR with proof reading Vent polymerase and were cloned as a blunt fragment into pBluescript Smal site, after blue-white selection.
  • the PCR product was flanked by two EcoRI sites, designed at the 5' ends of the primers.
  • Gal4 was cloned into the unique EcoRI site of the vector pMiPRl, as a 3.3 kb EcoRI digested fragment, after the dephosphorylation of the vector.
  • the orientation of the Gal4 sequence in the final vector was cleared out after a Spel digest.
  • the plasmid pPhsILMiT was derived after the ligation of a 2.3kb Notl fragment from the vector pHSS6hsILMi20 (Klinakis et al, 2000), carrying the infronless Minos fransposase gene under the hsp70 promoter, and a Notl digested P element vector pCasper4 (Thummel and Pirrotta, 1991).
  • Germline fransformation experiments were performed by microinjection of DNA constructs into Drosophila melanogaster pre-blastoderm embryos of the strain yw 67c23 as previously described by Rubin and Spradling (1982). The embryos were co- injected with 400 ⁇ gr/ml of transposon and 100 ⁇ gr/ml of pHSS6hsMi2 helper plasmid (Loukeris et al, 1995a-b) or with 100 ⁇ gr/ml of Minos transposase mRNA, produced by the vector ⁇ BS(SK)MimRNA (Pavlopoulos A.).
  • the jumpstart males were daily heat shocked by heating to 37°C for one hour during the larval and pupal developmental stages and the jumping efficiency went up to 81%. It has to be mentioned that in the crosses that no jumping event to the autosomes was revealed, the number of the screened male offsprings was less than 30. This leads us to the assumption that the jumpstarting scheme that we have devised has a jumping efficiency of 100%, when a sufficient number of the male offsprings can be screened. Furthermore, no remobilisation events were detected when the jumpstart males were grown continuously at 30°C, in the absence of heat shock.
  • Plasmid rescue technique and mRNA production For the purification of genomic DNA we followed the protocol of Holmes-Bonner (Holmes D.S. and Bonner J., 1973) and the plasmid rescue technique was carried out according to Pirrotta protocols (Pirrotta, 1986), Genomic DNA was digested with BamHI, Xbal or a combination of Xbal and Spel. DHF5a competent cells were transformed with the ligates and the rescued plasmids were selected in kanamycin (25 ⁇ gr/ml) and nalidyxic acid (35 ⁇ gr/ml) rich mediums.
  • IMio2 primer a 26 bp sequence from Minos right inverted repeat that is 50 bp distanced from Minos end (5' GATAATATAGTGTGTTAAACATTGCGC 3', Klinakis, A.G., Zagoraiou, L practice Vassilatis, D.K & Savakis, C. (2000) EMBO Reports 11, 416-421.).
  • Minos transposase mRNA was produced with mMessage mMachine T7 kit of Ambion. The results are shown in Table 1.
  • Minos to target infrons differentiates this element as a mutagenesis tool from the P element, widely used by Drosophila geneticists, which shows a strong bias to hit 5' regions of the genes (Liao G et al.). This makes Minos a more efficient tool for gene trapping mutagenesis than the P element.
  • Minos insertions should have a more random distribution compared to P element.
  • the construction of the modified Minos fransposon pMiCMVGFP was used for the generation of fransgenic mice.
  • a lox P site was included in front of the left inverted repeat for the generation of single copy fransgenic animals if needed.
  • Minos fransposase cDNA was cloned as a 1 kb Clal/ Notl fragment in the vector
  • Pev3 (Clare Gooding, Biotechnology Dept, Zeneca, Macclesfield, UK; Pev3 is further described in Needham et al, Nucl. Acids Res., 20, 997-1003, 1992)
  • a 3.8 kb Clal / AspHS fragment from the resulting plasmid (containing the Minos fransposase cDNA followed by an infron and a polyadenylation signal from the human ⁇ globin gene) was cloned in pBluescript SK + (Stratagene, La Jolla, Ca, USA) creating the plasmid ⁇ Blue/ILMi 3 ' ⁇ .
  • a 10.3 kb Smal/Asp718 fragment was excised from pZP3/ILMi, separated from plasmid sequences by gel elecfrophoresis (Sambrook, J et al. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), purified and concentrated using an ELUTIP-d column (Schleicher & Schuell GmbH, Dassel, Germany) and injected into fertilised oocytes (FVBxFVB) at a concentration of 4 ng ⁇ l. Injected eggs were transferred into pseudopregnant mice and transgenic offspring was identified by Southern blot analysis of tail DNA (Southern, E.M. (1975). J. Mol. Biol 98,503-517).
  • the transposon carrying (MCG) line was generated as described in Zagoraiou, L et al (2001) Proc. Natl Acad. Sci. USA 98,11474-11478).
  • Reverse Transcriptase Super RT; HT Biotechnology, Cambridge, UK
  • PCR reactions were performed in a volume of 50 ⁇ l PCR buffer (Life Technologies, Paisley, UK) containing 1 ⁇ l of the cDNA from the RT reaction, 1.5 mM MgCl 2 , 100 ng of each primer, 0.2 mM dNTPs and 2.5 U Taq DNA polymerase (Pharmacia). A total number of 25 cycles were performed with denaturation at 94° C for 45 seconds, annealing at 55° C for 30 seconds and extension at 72° C for 45 seconds. PCR products were visualised by electrophoresis on a 2% agarose gel.
  • Minos transposase specific primers Minos 1 5'- CAGCTTCGAAATGAGCCAC-3' and beta EX: 5'-TGGACAGCAAGAAAGCGAG- 3' were used.
  • Primers specific for murine hypoxanthine phosphoribosylfransferase (HPRT) were: 5'CACAGGACTAGAACACCTGC-3' and 5'-
  • Mouse metaphase spreads were prepared according to routine procedures from peripheral white blood cells (Mulder, M.P et al (1995). Hum Genet 96(2):133-141).
  • the 737-bp Sacl/Notl GFP fragment from the pMiCMVGFP construct was used as a probe.
  • the probe was either labelled with biotin (Boehringer Mannheim) and immunochemically detected directly with FITC or a tyramide based step was included to improve signal detection (Raap, A.K. et al (1995) Human Molecular Genetics 4, 529-534).
  • the DNA was counterstained with DAPI.
  • PCR fragments were either sequenced directly or after cloning into the pG ⁇ M T easy vector (Promega), or PCRII vector (rnvitrogen). With the sequences obtained, a BLAST search was performed against the mouse genome sequences available at the time in the Celera (www.celera.com) database.
  • the transposon carrying fransgenic mouse line was generated. It contains 6 copies of Minos fransposon MiCMVGFP integrated in mouse chromosome 14.
  • Mobility assays confirm the broad host range activity of the Minos fransposable element and validate new transformation tools. Insect Mol. Biol, 9, 269-275.
  • Shuttle mutagenesis A method of transposon mutagenesis for Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 83:735-739.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Mycology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne l'utilisation d'un transposon qui reconnaît un site cible de dinucléotide, notamment Minos, dans la production d'une bibliothèque de mutants. La présente invention concerne un procédé permettant de produire une bibliothèque de mutations génétiques dans une population cellulaire par mutagenèse insertionnelle, selon lequel il est prévu d'introduire un transposon qui cible une séquence de reconnaissance de nucléotide dans une cellule, de le combiner avec une transposase et d'identifier des cellules présentant un épisode d'intégration de transposon.
PCT/GB2003/002128 2002-05-16 2003-05-16 Utilisation de minos en genomique fonctionnelle WO2003097826A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003227945A AU2003227945A1 (en) 2002-05-16 2003-05-16 Use of minos in functional genomics

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GB0211242.3 2002-05-16
GB0211242A GB0211242D0 (en) 2002-05-16 2002-05-16 Genetic manipulation
GBPCT/GB2003/000065 2003-01-09
PCT/GB2003/000065 WO2003056912A2 (fr) 2002-01-09 2003-01-09 Procede de manipulation genetique
GB0304812A GB0304812D0 (en) 2002-05-16 2003-03-03 Use of minos in functional genomics
GB0304812.1 2003-03-03

Publications (1)

Publication Number Publication Date
WO2003097826A1 true WO2003097826A1 (fr) 2003-11-27

Family

ID=29553852

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/002128 WO2003097826A1 (fr) 2002-05-16 2003-05-16 Utilisation de minos en genomique fonctionnelle

Country Status (2)

Country Link
AU (1) AU2003227945A1 (fr)
WO (1) WO2003097826A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111471714A (zh) * 2020-05-07 2020-07-31 西南大学 Minos转座子系统介导的真核生物转基因细胞系及构建方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073510A1 (fr) * 1999-06-01 2000-12-07 University Of Utah Research Foundation Procede de mutagenese par transposon dans le nematode caenorhabditis elegans
WO2001010220A2 (fr) * 1999-08-06 2001-02-15 Minos Biosystems Limited Systeme permettant de controler une population d'insectes
WO2001029205A2 (fr) * 1999-10-19 2001-04-26 Minos Biosystems Limited Procede de manipulation genetique
WO2001071019A1 (fr) * 2000-03-21 2001-09-27 Minos Biosystems Limited Procede de production d'organismes transgeniques a l'aide de transposons
WO2002062991A1 (fr) * 2001-02-05 2002-08-15 Minos Biosystems Limited Technique de mutagenese insertionnelle

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073510A1 (fr) * 1999-06-01 2000-12-07 University Of Utah Research Foundation Procede de mutagenese par transposon dans le nematode caenorhabditis elegans
WO2001010220A2 (fr) * 1999-08-06 2001-02-15 Minos Biosystems Limited Systeme permettant de controler une population d'insectes
WO2001029205A2 (fr) * 1999-10-19 2001-04-26 Minos Biosystems Limited Procede de manipulation genetique
WO2001071019A1 (fr) * 2000-03-21 2001-09-27 Minos Biosystems Limited Procede de production d'organismes transgeniques a l'aide de transposons
WO2002062991A1 (fr) * 2001-02-05 2002-08-15 Minos Biosystems Limited Technique de mutagenese insertionnelle

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KLINAKIS A G ET AL: "Mobility assays confirm the broad host-range activity of the Minos transposable element and validate new transformation tools", INSECT MOLECULAR BIOLOGY, BLACKWELL SCIENTIFIC, OXFORD,, GB, vol. 9, no. 3, June 2000 (2000-06-01), pages 269 - 275, XP002163113, ISSN: 0962-1075 *
KLINAKIS AG ET AL: "Genome-wide insertional mutagenesis in human cells by the Drosophila mobile element Minos", EMBO REPORTS, XX, XX, vol. 1, no. 5, November 2000 (2000-11-01), pages 416 - 421, XP002172891 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111471714A (zh) * 2020-05-07 2020-07-31 西南大学 Minos转座子系统介导的真核生物转基因细胞系及构建方法

Also Published As

Publication number Publication date
AU2003227945A1 (en) 2003-12-02

Similar Documents

Publication Publication Date Title
US20080255002A1 (en) Genetic manipulation method
ES2447422T3 (es) Sistemas de expresión para el control de insectos dañinos
Schönig et al. Conditional gene expression systems in the transgenic rat brain
EP1268837B1 (fr) PROCEDE DE PRODUCTION de MAMMIFERES TRANSGENIQUES A L'AIDE DE TRANSPOSONS
US20090105170A1 (en) Multiple Heat Shock Elements
KR100985678B1 (ko) 형질전환된 생물체에서 전위인자 벡터에 의해 전위를유발시키는 방법
WO2003097826A1 (fr) Utilisation de minos en genomique fonctionnelle
US8852928B2 (en) LexA-based chemical-inducible gene expression system for use in transgenic animals
WO2001033957A1 (fr) Mammiferes transgeniques non humains de controle du changement de concentration d'ions calcium dans des cellules
US20040092018A1 (en) Insertional mutagenesis technique
US8691564B2 (en) Female specific insect expression system
EP1456375B1 (fr) Procedes de tests d'evaluation de la vision utilisant un modele poisson
CA2506734A1 (fr) Modeles de maladies de poissons et leurs utilisations
Coleman et al. Analyses of the guanylate cyclase activating protein-1 gene promoter in the developing retina
Weber et al. Conditional gene expression systems in the transgenic rat brain.
Michel Biology and utilization of Hermes, a class II transposable element from the genome of the house fly, Musca domestica
Li Progress towards development of a genetically modified strain of the Australia sheep blowfly Lucilia cuprina suitable for a sterile release program: a thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy in Molecular Genetics at Massey University, Palmerston North, New Zealand
WO2005045071A1 (fr) Procedes d'identification de genes actifs

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP