WO2005042018A2 - C-class oligonucleotide analogs with enhanced immunostimulatory potency - Google Patents

C-class oligonucleotide analogs with enhanced immunostimulatory potency Download PDF

Info

Publication number
WO2005042018A2
WO2005042018A2 PCT/US2004/036240 US2004036240W WO2005042018A2 WO 2005042018 A2 WO2005042018 A2 WO 2005042018A2 US 2004036240 W US2004036240 W US 2004036240W WO 2005042018 A2 WO2005042018 A2 WO 2005042018A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
immunostimulatory nucleic
acid molecule
cancer
Prior art date
Application number
PCT/US2004/036240
Other languages
French (fr)
Other versions
WO2005042018A3 (en
Inventor
Eugen Uhlmann
Joerg Vollmer
Arthur M. Krieg
Bernhard O. Noll
Original Assignee
Coley Pharmaceutical Gmbh
Coley Pharmaceutical Group, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BRPI0416079-7A priority Critical patent/BRPI0416079A/en
Priority to EA200600865A priority patent/EA008741B1/en
Application filed by Coley Pharmaceutical Gmbh, Coley Pharmaceutical Group, Inc. filed Critical Coley Pharmaceutical Gmbh
Priority to NZ546275A priority patent/NZ546275A/en
Priority to KR1020067008222A priority patent/KR101107818B1/en
Priority to CA002540949A priority patent/CA2540949A1/en
Priority to EP04810173A priority patent/EP1678303A2/en
Priority to JP2006538383A priority patent/JP2007509983A/en
Priority to AP2006003611A priority patent/AP2006003611A0/en
Priority to AU2004285561A priority patent/AU2004285561C1/en
Publication of WO2005042018A2 publication Critical patent/WO2005042018A2/en
Publication of WO2005042018A3 publication Critical patent/WO2005042018A3/en
Priority to IL174428A priority patent/IL174428A0/en
Priority to AU2006201495A priority patent/AU2006201495A1/en
Priority to IL175215A priority patent/IL175215A0/en
Priority to NO20061857A priority patent/NO20061857L/en
Priority to TNP2006000123A priority patent/TNSN06123A1/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/17Immunomodulatory nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/05Adjuvants
    • C12N2501/056Immunostimulating oligonucleotides, e.g. CpG
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids.
  • Such CpG ODN have highly stimulatory effects on human and murine leukocytes, inducing B-cell proliferation; cytokine and immunoglobulin secretion; natural killer (NK) cell lytic activity and interferon gamma (IFN- ⁇ ) secretion; and activation of dendritic cells (DCs) and other antigen-presenting cells to express costimulatory molecules and secrete cytokines, especially the Thl-like cytokines that are important in promoting the development of Thl-like T-cell responses.
  • DCs dendritic cells
  • These immune stimulatory effects of native phosphodiester backbone CpG ODN are highly CpG-specific in that the effects are dramatically reduced if the CpG motif is methylated, changed to a GpC, or otherwise eliminated or altered.
  • mouse lymphocytes respond quite well to phosphodiester CpG motifs that do not follow this "formula” (Yi AK et al. (1998) J Immunol 160:5898-906), and the same is true of human B cells and dendritic cells (Hartmann G et al. (1999) Proc Natl Acad Sci USA 96:9305-10; Liang H et al. (1996) J Clin Invest 98:1119-29).
  • the present invention relates in part to immunostimulatory CpG-containing oligonucleotides and oligonucleotide analogs having a secondary structure with an inverted repeat at or near the 3' end of the molecule.
  • the secondary structure involves formation of duplex or higher-order structures under certain conditions.
  • the inverted repeat is not a strict Watson-Crick palindrome but rather can be interrupted by intervening sequence or nucleotide analogs.
  • the backbone can be modified to include strategically placed nuclease-resistant and nuclease-sensitive internucleotide linkages, thereby both favoring activity and reducing potential toxicity.
  • these oligonucleotides and oligonucleotide analogs are found to exert both A-class and B-class immunostimulatory activity and are therefore classified as novel C-class immunostimulatory nucleic acid molecules.
  • the invention is based, in part, on the discovery by the present inventors that CpG- containing immunostimulatory oligonucleotides and oligonucleotide analogs containing an imperfect palindrome at or near the 3' end of the molecule have certain advantages both in terms of their preparation and their biological activity.
  • the C-class oligonucleotides and oligonucleotide analogs of the instant invention are characteristically monomeric in solution. It is believed that these same nucleic acid molecules can form intramolecular duplex structures in vitro, rendering them stable against nuclease digestion. It is also believed that these same nucleic acid molecules can form intermolecular duplex and possibly even higher order structures within the environment of the intraendosomal compartment, where they are believed to exert their biological activity.
  • the invention provides a composition including an immunostimulatory nucleic acid molecule of Formula I Zi [(Xi Y1 1) N (X 2 Y 2 R 2 ) k Z 2 ] p (S ⁇ ) q N' (N Harbor)...(N 2 )(N ⁇ ) S 2 (N 1# )(N 2# )...(N n #) Z 3 (Formula I)
  • each of Zi, Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of Xi and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yi and Y 2 is independently a cytosine (C) or a modified cytosine; each of R ⁇ and R 2 is independently a guanine (G) or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; Si is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2
  • N n , and N ⁇ # , N 2# , ... N n# is any nucleotide or modified nucleotide wherein Ni base-pairs with N ⁇ # , N 2 base-pairs with N 2# , ...
  • each of N ls N 2 , .... N n , and N ⁇ , N 2# , ... N n# is chosen from C, G, or modifications thereof, wherein C base-pairs with G.
  • each of Ni, N 2 , .... N caution, and N ⁇ #, N 2# , ... N n# is chosen from T, A, or modifications thereof, and T base-pairs with A.
  • each of C, G, A, and T can refer to deoxynucleotides with corresponding bases cytosine, guanine, adenine, and thymine.
  • N n , and N ⁇ #, N 2# , ... N n# is chosen from C, T, A, G, or modifications thereof, and C base-pairs with G, T base-pairs with G, A base-pairs with T, and A base-pairs with G.
  • each of Ni, N 2 , .... N n , and Ni # , N 2# , ... N n# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs, i.e., each base pair Ni-Ni # , N 2 -N 2# , ... N n -N n# is a Watson-Crick base pair.
  • each of N l5 N 2 , .... N n , and N ⁇ # , N 2# , ... N n# is chosen from unmodified or modified nucleotides which form non- Watson-Crick base pairs, i.e., at least one base pair N ⁇ -N ⁇ # , N 2 -N 2# , ... N n -N n# is a non- Watson-Crick base pair.
  • the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with at least one phosphodiester bond.
  • the immunostimulatory nucleic acid molecule includes a backbone with at least one stabilized internucleotide linkage.
  • internucleotide linkages of the oligonucleotide are all phosphorothioate linkages.
  • the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with a phosphodiester bond joining at least one of YiRi or Y 2 R 2 .
  • Yi is C.
  • K ⁇ is G.
  • Yi is C and Ri is G.
  • Xi or X 2 is T.
  • Xi is T
  • X 2 is T
  • Yi is C
  • Rj is G
  • k is 1.
  • Xi is T
  • X 2 is T
  • Yi is C
  • Ri is G
  • k is 1
  • p is 1
  • N and N' and Z 3 each contain zero nucleotides
  • Z 2 is TTTT or d(UUUU), where d(UUUU) represents dUdUdUdU, i.e., (deoxyU) 4 .
  • S 2 is a non-nucleotidic linker.
  • S 2 contains at least one abasic dSpacer residue.
  • the oligonucleotide includes at least one branched non-nucleoside linkage.
  • the immunostimulatory nucleic acid molecule includes at least one doubler unit, at least one trebler unit, or at least one doubler unit and at least one trebler unit.
  • Si is a doubler unit or a trebler unit.
  • the oligonucleotide includes at least one 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkage.
  • the immunostimulatory nucleic acid molecule of Formula I is not an antisense nucleic acid.
  • the invention provides an immunostimulatory nucleic acid molecule of Formula II
  • each of Zi, Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of Xi and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yi and Y 2 is independently a cytosine (C) or a modified cytosine; each of Rj and R 2 is independently a guanine (G) or a modified guanine; N is any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; Si is a non- nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5
  • N n-1 , N n , and N ⁇ # , N 2#, ... N n-1# , N n# is any nucleotide or modified nucleotide wherein Ni base-pairs with N ⁇ # , N 2 base-pairs with N 2# , ...
  • Z ⁇ (N n )(N n-1 ) is TYR, where Y is a cytosine or a modified cytosine and R is a guanine or a modified guanine.
  • N n# is chosen from C, G, or modifications thereof, wherein C base-pairs with G.
  • N n- ⁇ # , N n# is chosen from T, A, or modifications thereof, and T base-pairs with A.
  • each of C, G, A, and T can refer to deoxynucleotides with corresponding bases cytosine, guanine, adenine, and thymine.
  • each of N ls N 2 , .... N n-1 , N n , and N ⁇ # , N 2# , ... N n-1# , N n# is chosen from C, T, A, G, or modifications thereof, and C base-pairs with G, T base-pairs with G, A base-pairs with T, and A base-pairs with G.
  • each of N ls N 2 , .... N n- ⁇ , N n , and Ni # , N 2# , ... N n-1# , N n# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs, i.e., each base pair Ni-Ni # , N 2 -N 2# , ... N n -N n# is a Watson-Crick base pair.
  • N n-1# , N n # is chosen from unmodified or modified nucleotides which form non- Watson-Crick base pairs, i.e., at least one base pair Ni-Ni # , N 2 -N 2# , ... N n -N n# is a non- Watson-Crick base pair.
  • the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with at least one phosphodiester bond.
  • the immunostimulatory nucleic acid molecule includes a backbone with at least one stabilized internucleotide linkage.
  • internucleotide linkages of the oligonucleotide are all phosphorothioate linkages.
  • the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with a phosphodiester bond joining at least one of YiRi or Y 2 R 2 .
  • Yi is C.
  • Ri is G.
  • Yi is C and Ri is G.
  • Xi or X 2 is T.
  • Xi is T, X 2 is T, Y ⁇ is C, R ⁇ is G, and k is 1.
  • Xi is T
  • X 2 is T
  • Yi is C
  • Ri is G
  • k is 1
  • p is 1
  • N andN' and Z 3 each contain zero nucleotides
  • Z 2 is TTTT or d(UUUU), where d(UUUU) represents (deoxyU) 4 .
  • S 2 is a non-nucleotidic linker.
  • S 2 contains at least one abasic dSpacer residue.
  • the oligonucleotide includes at least one branched non-nucleoside linkage.
  • the immunostimulatory nucleic acid molecule includes at least one doubler unit, at least one trebler unit, or at least one doubler unit and at least one trebler unit.
  • Si is a doubler unit or a trebler unit.
  • the oligonucleotide includes at least one 2 '5'-, 5 '5'-, 3 '3'-, 2 '2'-, or 2 '3'- intemucleoside linkage.
  • the immunostimulatory nucleic acid molecule of Formula I is not an antisense nucleic acid.
  • the invention provides an immunostimulatory nucleic acid molecule of Formula III
  • Z' is Z, [(Xi YiR.) N (X 2 Y 2 R 2 ) k Z 2 ] p (S ⁇ ) q N' (N n )....(N 3 )(N 2 )(N ⁇ ) S 2 (N ⁇ #)(N 2 #)(N 3 #)...(N n #); each of Z ls Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of X t and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5- substituted uracil; each of Yi and Y is independently a cytosine or a modified cytosine; each of Ri and R 2 is independently a guanine or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long
  • N n , and N ⁇ # , N 2#, ... N n# is any nucleotide or modified nucleotide wherein Ni base-pairs with N ⁇ # , N 2 base-pairs with N 2 #, N 3 base-pairs with N 3# , ... and N n base-pairs with N ⁇ #; k is an integer from 0 to 5; m is an integer from 2 to 10; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10.
  • p (S ⁇ ) q is a non-palindromic sequence.
  • Z L [ (X ⁇ R N (X 2 Y 2 R 2 ) k Z 2 ] p (Si) q is TCGTCGTTTT (SEQ ID NO:40), TCGTCGTTLL, TCGA, TCGAC, TCGACGTC, or TCGACGTCG, wherein L is dSpacer.
  • Zi [(XiYiRj) N (X 2 Y 2 R 2 ) k Z 2 ] p (Si) q is a palindromic sequence.
  • (N n )...(N 2 )(Ni) S 2 (Ni # )(N 2# )...(N n# ) Z 3 includes a sequence AGCGAAGCT, CAATATTTATTG (SEQ ID NO:l), CCGTTTTGTGG (SEQ ID NO:2), CGGCGCCGTGCCG (SEQ ID NO: 19), CGGCGCCGTTGCCG (SEQ ID NO:34), CGGCGLLCGCCG (SEQ ID NO:5), CGGCGLLLTGCCG (SEQ ID NO:6), CGGCGGLLCCGCCG (SEQ ID NO:7), CGGCGTCGCCGCCG (SEQ ID NO:8), CGTCGACGGGACGGG (SEQ ID NO: 10), CGTCGACGTGACGGG (SEQ ID NO:l 1), GAGAGTTGGGCTCTC (SEQ ID NO: 12), GTCGAGGAGGT (SEQ ID NO: 14), TAATALLTATTA (SEQ ID NO: 15), TA
  • TAATATTTATTA (SEQ ID NO: 17), wherein L is dSpacer.
  • L is dSpacer.
  • (N n )...(N 2 )(Ni) S 2 (Ni#)(N 2 #)...(N n# ) includes a sequence GGCGCGCTGCCG (SEQ ID NO: 13).
  • the immunostimulatory nucleic acid molecule includes a sequence TCGACGTCGACCGTTTTGTGG (SEQ ID NO:20), TCGACGTCGACGGGACGGG (SEQ ID NO:21), TCGACGTCGACGTGACGGG (SEQ ID NO:22), TCGACGTCGAGAGTTGGGCTCTC (SEQ ID NO:23), TCGACGTCGAGCGAAGCT (SEQ ID NO:24), or TCGACGTCGAGGAGGT (SEQ ID NO:25).
  • the immunostimulatory nucleic acid molecule includes a sequence TCGTCGTTLLACGGCGCCGTGCCG (SEQ ID NO:37), TCGTCGTTLLACGGCGLLLTGCCG (SEQ ID NO:38), TCGTCGTTLLCGGCGCGGCGCCG (SEQ ID NO:39), TCGTCGTTTTACGGCGCCGTTGCCG (SEQ ID NO:44), TCGTCGTTTTACGGCGLLLTGCCG (SEQ ID NO:45), TCGTCGTTTTACGGCGTTTTGCCG (SEQ ID NO:49), TCGTCGTTTTCAATATTTATTG (SEQ ID NO:50), TCGTCGTTTTCGGCGLLCGCCG (SEQ ID NO:52), TCGTCGTTTTCGGCGGLLCCGCCG (SEQ ID NO:54), TCGTCGTTTTCGGCGTCGCCGCCG (SEQ ID NO:55), TCGTCGTTTTTAATALLTATTA (SEQ ID NO:57), TCGTCGTTTTTAATATCCATTA
  • the immunostimulatory nucleic acid molecule includes a sequence TCGCGTCGTTCGGCGCGCTGCCG (SEQ ID NO:30). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence TCGCGACGTTCGGCGCGCTGCCG (SEQ ID NO:27). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from
  • the immunostimulatory nucleic acid molecule includes a sequence chosen from
  • the immunostimulatory nucleic acid molecule includes a sequence chosen from T*C*G*C J*T*C*G*T*T*CJ3*G*C*G*C J*C*T*G*C*G (SEQ ID NO:30), T*C*G *G*T*C*G*T*T*CJ3*G*C*G*C j*C*T*G*C*C*G (SEQ ID NO:30), and T*C*G*C*G T*C*G*T*T*CJJ*G*C*G*C J*C*T*G*C*G ( SE Q iD NO:30), wherein * is phosphorothioate and _ is phosphodiester.
  • the immunostimulatory nucleic acid molecule includes a sequence T*C*G*C 3*A*C*G*T*T*C J*G*C*G*C J*C*T*G*C*G ( SE Q ID NO:27), wherein
  • the immunostimulatory nucleic acid molecule includes a sequence chosen from ⁇ *C_G*T*C !f: G ;
  • the immunostimulatory nucleic acid molecule includes a sequence T * C ⁇ G * T * C * G * T * T ⁇ T * T * A * ⁇ G * G ⁇ C * G * T * * G * T * G * * * G ( SE Q ID NO:48), wherein * is phosphorothioate and _ is phosphodiester.
  • the immunostimulatory nucleic acid molecule includes a sequence T*C J*G*C*G*C*CJJ*T*G*C*C*G*T*C*G*T*CJ3*T*T*T (SEQ ID NO:33), wherein
  • nucleotide in the oligonucleotide is a substituted or modified purine or pyrimidine.
  • substituted pyrimidine is a C5- or C ⁇ -substituted pyrimidine.
  • substituted purine is a C8- or C7-substituted purine.
  • the substituted or modified purine or pyrimidine is selected from the group consisting of 5-substituted cytosines, 6-substituted cytosines, N4-substituted cytosines, 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems, and uracil derivatives, thymine derivatives, 7-deazaguanine, 7-deaza-7-substituted guanine, 7-deaza-8-substituted guanine, 7-deaza-8-aza guanine, hypoxanthine, N2-substituted guanines, 5-amino-3-methyl-3H,6H-thiazolo[4,5- d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, substituted adenines, 8
  • the substituted or modified purine or pyrimidine is selected from the group consisting of 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo- cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 6-hydroxy-cytosine, 5-hydroxymethyl- cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine, N4- ethyl-cytosine, N,N'-propylene cytosine, phenoxazine, 5-fluoro-uracil, 5-bromo-uracil, 5- bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil, 2-thiothymine, 4- thiothymine, 6-substituted thymines, 7-deaza-7-(C2-C6)alkyny
  • the substituted or modified purine or pyrimidine is selected from the group consisting of a universal base, an aromatic ring system, an aromatic ring system, and a hydrogen atom (dSpacer).
  • the substituted or modified purine or pyrimidine is selected from the group consisting of 4-methyl-indole, 5-nitro-indole, 3-nitropyrrole, P-base, and K-base, benzimidazole, dichloro-benzimidazole, l-methyl-lH-[l,2,4]triazole-3 -carboxylic acid amide, fluorobenzene, and difluorobenzene.
  • any of N, S, X, or Z is substituted by a residue selected from the group consisting of C6-C30 alkyl chain, bile acids, cholic acid, taurocholic acid, deoxycholate, cholesterol, oleyl litocholic acid, oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids, isoprenoids, steroids, vitamins, vitamin E, saturated fatty acids, unsaturated fatty acids, fatty acid esters, triglycerides, pyrenes, porphyrins, Texaphyrine, adamantane, acridines, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl, t-butyldiphenylsilyl, cyanine dyes, cyanine dye Cy3, cyanine dye Cy576, Hoechs,
  • the invention provides an immunostimulatory nucleic acid molecule including (a) a 5' end beginning with an immunostimulatory motif chosen from (TCG) n N and RDCGYi Y 2 N, wherein T is thymine, C is unmethylated cytosine, G is guanine, R is a purine, D is not C, each of Yi and Y 2 independently is a pyrimidine, n is an integer between 1 and 4, inclusive, and N is any sequence 0-12 bases long; (b) a 3' end terminating in an inverted repeat capable of forming a hairpin or stem-loop structure, said structure including a GC-rich stem 2 to 6 consecutive base pairs long and at least one unmatched or mismatched base; and (c) a partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage.
  • T thymine
  • C unmethylated cytosine
  • G guanine
  • R is a purine
  • D is not C
  • the GC-rich stem is 2 consecutive base pairs long. In one embodiment the GC-rich stem is 3 consecutive base pairs long. In one embodiment the GC-rich stem is 4 consecutive base pairs long. In one embodiment the GC-rich stem is 5 consecutive base pairs long. In one embodiment the GC-rich stem is 6 consecutive base pairs long. In one embodiment the GC-rich stem includes at least 2 G-C base pairs. In one embodiment the GC-rich stem includes at least 3 G-C base pairs. In certain embodiments the at least one unmatched or mismatched base is T.
  • the partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage further includes a plurality of phosphorothioate internucleotide linkages.
  • the 5' end has a sequence provided as TCGTCGTTTTA (SEQ ID NO:41).
  • the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGCCGTGCCG (SEQ ID NO: 19).
  • the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGTCGTGCCG (SEQ ID NO:9).
  • the invention provides an immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:43).
  • the invention provides an immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48). In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as ⁇ :i: C_G*T*C*G !i! T !,i T*T*T*A !,! C*G !,: G*C*G :,! C*C*G !,: T :1: G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage.
  • the invention provides an immunostimulatory nucleic acid having a base sequence provided as ⁇ *C 5,! G ⁇
  • the invention provides an immunostimulatory nucleic acid having a base sequence provided as ⁇ *c*G !l: T*C !,!
  • the invention provides an immunostimulatory nucleic acid having a base sequence provided as T :1: C !,: G*T*C_G*T*T si! T !i: T*A*C_G !i! G*C*G*C :l!
  • the invention provides a vaccine including an immunostimulatory nucleic acid molecule of the invention and an antigen.
  • the invention provides a pharmaceutical composition including an immunostimulatory nucleic acid molecule of the invention and a pharmaceutically acceptable carrier.
  • the invention provides a method for inducing type I interferon (IFN) expression.
  • IFN type I interferon
  • the method according to this aspect of the invention involves contacting a cell capable of expressing type I IFN with an immunostimulatory nucleic acid of the invention, in an effective amount to induce expression of type I IFN.
  • the type I IFN is an interferon alpha (IFN- ⁇ ).
  • the type I IFN is an interferon beta (IFN- ⁇ ).
  • the invention provides a method for inducing gamma interferon (IFN- ⁇ ) expression.
  • the method according to this aspect of the invention involves contacting a cell capable of expressing IFN- ⁇ with an immunostimulatory nucleic acid of the invention, in an effective amount to induce expression of IFN- ⁇ .
  • the invention provides a method for activating a natural killer (NK) cell.
  • NK natural killer
  • the method according to this aspect of the invention involves contacting an NK cell with an immunostimulatory nucleic acid of the invention, in an effective amount to activate the NK cell.
  • the invention provides a method for treating an infection.
  • the method according to this aspect of the invention involves administering to a subject having or at risk of developing an infection an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the infection.
  • the subject has or is at risk of developing an infection chosen from a viral, bacterial, fungal or parasitic infection.
  • the subject has or is at risk of developing a viral infection with a virus chosen from hepatitis B virus (HBV), hepatitis C vims (HCV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), papillomavims, human immunodeficiency vims (HIV), or herpes simplex vims (HSV).
  • a virus chosen from hepatitis B virus (HBV), hepatitis C vims (HCV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), papillomavims, human immunodeficiency vims (HIV), or herpes simplex vims (HSV).
  • HBV hepatitis B virus
  • HCV hepatitis C vims
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • papillomavims human immunodeficiency vims
  • HSV herpes
  • the method according to this aspect of the invention involves administering to a subject having or at risk of developing an allergic condition an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the allergic condition.
  • the allergic condition is allergic asthma.
  • the invention provides a method for treating cancer.
  • the method according to this aspect of the invention involves administering to a subject having or at risk of developing a cancer an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the cancer.
  • the cancer is chosen from basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system cancer, breast cancer, cervical cancer, choriocarcinoma, colon and rectum cancer, connective tissue cancer, cancer of the digestive system, endometrial cancer, esophageal cancer, eye cancer, cancer of the head and neck, gastric cancer, intra-epithelial neoplasm, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, lymphoma including Hodgkin's and non-Hodgkin's lymphoma, melanoma, myeloma, neuroblastoma, oral cavity cancer, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, renal cancer, cancer of the respiratory system, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, cancer of the urinary system, or other carcinomas
  • the cancer is a cancer sensitive to treatment with interferon alpha (IFN- ⁇ ).
  • IFN- ⁇ interferon alpha
  • the cancer sensitive to treatment with IFN- ⁇ is chosen from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, AIDS-related Kaposi's sarcoma, renal cell carcinoma, prostate carcinoma, cervical dysplasia, or colon carcinoma.
  • the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of an infection.
  • the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of an allergic condition. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of allergic asthma. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of a cancer.
  • an immunostimulatory nucleic acid of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
  • FIG. 1 is a series of graphs depicting induction of IFN- ⁇ and TLR9 signaling by ODN 332, 333, and 334.
  • FIG.2 is a series of graphs depicting induction of IFN- ⁇ and TLR9 signaling by ODN 611, 614, and 620.
  • FIG. 3 is a graph depicting IFN- ⁇ production in peripheral blood mononuclear cells (PBMC) stimulated by a panel of oligonucleotides.
  • PBMC peripheral blood mononuclear cells
  • FIG. 4 is a graph depicting group mean titers (GMT) of antigen-specific total IgG following immunization with 1 ⁇ g hepatitis B surface antigen (HBsAg) with the indicated amount of ODN.
  • FIG. 5 is a a graph depicting GMT of antigen-specific individual IgG isotypes following immunization with 1 ⁇ g HBsAg with the indicated amount of ODN.
  • FIG. 6 is a graph depicting antigen-specific cytolytic T lymphocyte responses following immunization with 1 ⁇ g HBsAg with the indicated amount of ODN.
  • FIG. 7A is a graph depicting survival according to different ODN treatments in a murine neuroblastoma tumor model.
  • FIG. 7B is a graph depicting tumor volume according to different ODN treatments in a murine neuroblastoma tumor model.
  • the invention in one aspect involves the finding that specific sub-classes of CpG immunostimulatory oligonucleotides having defined secondary structure are highly effective in mediating immune stimulatory effects.
  • CpG nucleic acids are useful therapeutically and prophylactically for stimulating the immune system to treat cancer, infectious diseases, allergy, asthma and other disorders and to help protect against opportunistic infections following cancer chemotherapy.
  • the strong yet balanced cellular and humoral immune responses that result from CpG stimulation reflect the body's own natural defense system against invading pathogens and cancerous cells.
  • sequences of the invention share some stmctural similarities with a class of CpG oligonucleotides referred to as C-class or combination motif CpG oligonucleotides. See published PCT international patent application WO 03/015711. Similar to the previously described C-class oligonucleotides, the C-class CpG oligonucleotides of the instant invention have defined 5' and 3' motifs as parts of the molecule.
  • C-class oligonucleotides have both a traditional "stimulatory" CpG sequence, generally positioned at or near the 5' end or 3' end of the molecule, and a "GC-rich palindrome” motif, generally positioned at or near the other end of the molecule.
  • These combination motif nucleic acids have immune stimulating effects that fall somewhere between those effects associated with traditional "B-class” CpG ODN, which are strong inducers of B cell activation and dendritic cell activation, and those effects associated with a more recently described class of immune stimulatory nucleic acids ("A-class” CpG ODN) which are strong inducers of IFN- ⁇ andNK cell activation but relatively poor inducers of B-cell and DC activation.
  • A-class CpG ODN immune stimulatory nucleic acids
  • the new C-class CpG oligonucleotides of the instant invention are also structurally distinct from the previously described C-class CpG oligonucleotides.
  • the immunostimulatory nucleic acid molecules of the instant invention feature greatly relaxed requirements with respect to the GC-rich palindrome at one end of the molecule.
  • the previously described C- class oligonucleotides include in one embodiment a strict or perfect palindrome at least 10 nucleotides in length and having a GC content of at least 2/3.
  • the palindrome of the previously described C-class oligonucleotides can include at most a minimal number of consecutive mismatched nucleotides.
  • the C-class oligonucleotide analogs of the instant invention feature palindromic motifs that can have, in various embodiments, fewer than 10 nucleotides; a GC content between zero and less than 2/3; various nucleotide analogs and substitutes including those lacking any nucleobase (dSpacer); extended intervening sequence involving four or more consecutive nucleotides or nucleotide substitutes that do not form Watson-Crick base pairs; and any combination thereof.
  • 3' parts of two or more molecules can be linked together via their 3' ends. It has been discovered that this new sub-class of oligonucleotides which do not have a perfect palindrome are still capable, like the previously described combination motif CpG oligonucleotides, of inducing high levels of IFN production, including type I IFN (e.g., IFN- ⁇ , IFN- ⁇ ) and IFN- ⁇ .
  • type I IFN e.g., IFN- ⁇ , IFN- ⁇
  • IFN- ⁇ type IFN
  • a “palindrome” and, equivalently, “palindromic sequence” as used herein refers to a nucleic acid sequence which is its own perfect reverse complement (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A', B and B', C and , D and D', and E and E' are bases capable of forming the usual Watson-Crick base pairs, i.e., G-C, A-T, and A-U.
  • a “palindrome” in a strict sense excludes intervening sequence or intervening non- nucleotide structure that does not participate in forming the usual Watson-Crick base pairs.
  • An "inverted repeat” as used herein refers to an imperfect palindrome, i.e., a nucleic acid sequence in which are present both nucleotides capable of forming the usual Watson- Crick base pairs and nucleotides, nucleotide analogs, or other structures that do not participate in forming the usual Watson-Crick base pairs (e.g., a sequence such as ABCDE-S- E'D'C'B'A' in which A and A', B and B', C and C, D and D', and E and E' are bases capable of forming the usual Watson-Crick base pairs, and S is a non-palindromic sequence or a non- nucleotidic linker or an abasic linker (dSpacer)).
  • a sequence such as ABCDE-S- E'D'C'B'A' in which A and A', B and B', C and C, D and D', and E and E' are bases capable of forming the usual Watson-Crick base
  • nucleotides, nucleotide analogs, or other structures that do not participate in forming the usual Watson- Crick base pairs interrupt an otherwise perfect palindrome.
  • nucleotides that do not participate in forming the usual Watson-Crick base pairs can form non- Watson-Crick base pairs with another nucleotide, e.g., G-T.
  • a non- Watson-Crick base pair as used herein is any base pair other than a Watson-Crick base pair, including but not limited to a Hoogsteen base pair and a so-called wobble base pair.
  • the nucleotides that do not participate in forming the usual Watson-Crick base pairs are unmatched and have no nucleotide base or nucleotide base analog with which to form a Watson-Crick or non- Watson-Crick base pair, e.g., G opposite to dSpacer.
  • the nucleotides that do not participate in forming base pairs can form non- standard base pairs with another nucleotide, e.g., diaminopyridine can form a base pair with xanthosine.
  • the 5' end of the nucleic acid begins with an immunostimulatory motif chosen from (TCG) n N and RDCGY ⁇ Y 2 N.
  • T is thymine
  • C is unmethylated cytosine
  • G is guanine
  • R is a purine
  • D is not C
  • each of Yi and Y 2 independently is a pyrimidine
  • n is an integer between 1 and 4, inclusive
  • N is any sequence 0-12 bases long.
  • the 3' end of the nucleic acid terminates in an inverted repeat capable of forming a hairpin or stem-loop stmcture.
  • the tem "terminates” refers to a stmcture at or near the 3' end.
  • the end of the imperfect palindrome may be positioned at the actual 3' end of the molecule or alternatively the 3' end may include 1 or more additional nucleotides that are not part of the inverted repeat stmcture.
  • the 3' end of the molecule includes 3 or fewer nucleotides that do not form part of the inverted repeat stmcture.
  • an "inverted repeat capable of forming a hairpin or stem-loop stmcture" as used herein refers to a sequence of nucleotides that forms a GC-rich stem or hairpin that is 2 to 10 consecutive base pairs long, and includes at least one unmatched or mismatched base.
  • the GC-rich stem is 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive base pairs long. In some embodiments the GC-rich stem includes at least 2, 3, or 4 G-C base pairs. In one embodiment an "inverted repeat capable of forming a hairpin or stem-loop stmcture" as used hererin refers to a sequence of nucleotides that forms an AT-rich stem or hairpin that is 2 to 10 consecutive base pairs long, and includes at least one unmatched or mismatched base. In individual embodiments the AT-rich stem is 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive base pairs long. In some embodiments the AT-rich stem includes at least 2, 3, or 4 A-T base pairs.
  • the at least one unmatched or mismatched base bridges the ends of the stem or hairpin. This may allow the formation of the secondary structure by providing a flexible point in the molecule for the stems to base pair and form a hairpin.
  • the unmatched or mismatched base(s) may be within the stem. Preferably if the mismatched base is within the stem, then the stem is at least 3 base pairs long.
  • the unmatched or mismatched bases(s) may be any nucleotide.
  • the unmatched or mismatched base is a T. Unmatched nucleotides at the end of double-strands are also known as overhanging nucleotides or dangling ends which can significantly stabilize duplex formation or hairpin formation. Freier SM et al.
  • the nucleic acid also includes a partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage.
  • the double-stranded part of the molecule may also contain unnatural (non-standard) base pairs (e.g., diaminopyridine paired with xanthosine). Lutz MJ et al. (1998) Recognition of a non-standard base pair by thermostable DNA polymerases. Bioorg Med Chem Lett 8:1149-52.
  • the formulas define subsets of the class of CpG oligonucleotides which demonstrated excellent immune stimulating properties.
  • 5' refers to the free 5' end of the oligonucleotide and 3' refers to the free 3' end of the oligonucleotide.
  • the oligonucleotides may have one or more accessible 5' or 3' ends. In some embodiments a 3' end can be linked to another 3' end. Since the importance of the 5' and 3' motifs has been discovered and described herein, it is also possible to create modified oligonucleotides having two such 5 ' or 3' ends.
  • This may be achieved, for example, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having two accessible 5' ends.
  • the 3 '3'- or 5 '5 '-linkage may be a phosphodiester, phosphorothioate, or any other modified intemucleoside bridge. Methods for accomplishing such linkages are known in the art. For instance, such linkages have been described in Seliger H et al.
  • 3 '-3 '-linked or 5 '-5 '-linked ODNs where the linkage between the 3'- or 5 '-terminal nucleosides is not a phosphodiester, phosphorothioate or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethyleneglycol phosphate moiety (Durand M et al. (1992) Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains, Biochemistry 31 :9197-204; U.S. Pat. No. 5,658,738; and U.S. Pat. No. 5,668,265).
  • an additional spacer such as tri- or tetra-ethyleneglycol phosphate moiety (Durand M et al. (1992) Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)
  • the non- nucleotidic linker may be derived from ethanediol, propanediol, or from an abasic deoxyribose (dSpacer) unit (Fontanel ML et al. (1994) Sterical recognition by T4 polynucleotide kinase of non-nucleosidic moieties 5 '-attached to oligonucleotides, Nucleic Acids Res 22:2022-7) using standard phosphoramidite chemistry.
  • the non-nucleotidic linkers can be incorporated once or multiple times, or combined with each other allowing for any desirable distance between the 3' ends of the two ODNs to be linked.
  • non-nucleotidic linker refers to any linker element that is not a nucleotide or polymer thereof (i.e., a polynucleotide), wherein a nucleotide includes a purine or pyrimidine nucleobase and a sugar phosphate.
  • a non-nucleotidic linker thus includes an abasic nucleotide (dSpacer), i.e., a nucleotide-like sugar phosphate unit in which the nucleobase is replaced by a hydrogen atom.
  • a non-nucleotidic linker can be a polyethyleneglycol, including but not limited to a triethyleneglcol and a hexaethyleneglycol.
  • the oligonucleotide has one of the following stmctures: TCGTCGTTTTA (SEQ ID NO:41), CGGCGCCGTGCCG (SEQ ID NO: 19), CGGCGTCGTGCCG (SEQ ID NO:9), TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:43), TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48), ⁇ *C_G*X*C*G*T*T*T*T*A*C*G*G*C*G*C*C*C*T*G*C*C*C*G*C*G (SEQ ID NO:43), ⁇ * c * G * ⁇ * c * G * ⁇ * ⁇ * ⁇ * ⁇ * A * c _ G * G * c _
  • the symbol * refers to the presence of a stabilized internucleotide linkage and _ refers to the presence of a phosphodiester linkage.
  • the immunostimulatory oligonucleotides generally have a length in the range of between 6 and 100 nucleotides. In some embodiments the length is in the range of 6-40, 13- 100, 13-40, 13-30, 15-50, or 15-30 nucleotides or any integer range therebetween.
  • nucleic acid and “oligonucleotide” are used interchangeably to mean multiple nucleotides (i.e., molecules including a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)).
  • a substituted pyrimidine e.g., cytosine (C), thymine (T) or uracil (U)
  • purine e.g., adenine (A) or guanine (G)
  • nucleic acid and oligonucleotide refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
  • the terms “nucleic acid” and “oligonucleotide” shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base containing polymer.
  • Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by nucleic acid synthesis).
  • nucleic acid and oligonucleotide shall encompass nucleic acid molecules and oligonucleotides of the invention, as well as oligonucleotide analogs of the invention.
  • oligodeoxynucleotide and, equivalaently, “ODN” as used herein shall encompass unmodified oligodeoxynucleotides of the invention as well as oligodeoxynucleotide analogs of the invention.
  • ODN oligodeoxynucleotide
  • nucleic acid and oligonucleotide also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars.
  • nucleic acids having backbone sugars that are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 2' position and other than a phosphate group or hydroxy group at the 5' position.
  • modified nucleic acids may include a 2'-O-alkylated ribose group.
  • modified nucleic acids may include sugars such as arabinose or 2'-fluoroarabinose instead of ribose.
  • the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have a peptide-like backbone with nucleic acid bases). Other examples are described in more detail below.
  • the immunostimulatory oligonucleotides of the instant invention can encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester intemucleoside bridge, a ⁇ -D-ribose unit and/or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil).
  • Examples of chemical modifications are known to the skilled person and are described, for example, in Uhlmann E et al. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S.
  • An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester intemucleoside bridge and/or at a particular ⁇ -D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide of the same sequence which is composed of natural DNA or RNA.
  • the oligonucleotides may include one or more modifications and wherein each modification is independently selected from: a) the replacement of a phosphodiester intemucleoside bridge located at the 3' and/or the 5' end of a nucleoside by a modified intemucleoside bridge, b) the replacement of phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge, c) the replacement of a sugar phosphate unit from the sugar phosphate backbone by another unit, d) the replacement of a ⁇ -D-ribose unit by a modified sugar unit, and e) the replacement of a natural nucleoside base by a modified nucleoside base.
  • each modification is independently selected from: a) the replacement of a phosphodiester intemucleoside bridge located at the 3' and/or the 5' end of a nucleoside by a modified intemucleoside bridge, b) the replacement of phospho
  • the oligonucleotides may include modified internucleotide linkages, such as those described in a or b above. These modified linkages may be partially resistant to degradation (e.g., are stabilized).
  • a "stabilized oligonucleotide molecule" shall mean an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endo-nuclease) resulting form such modifications.
  • Oligonucleotides having phosphorothioate linkages may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
  • a phosphodiester intemucleoside bridge located at the 3' and/or the 5' end of a nucleoside can be replaced by a modified intemucleoside bridge, wherein the modified intemucleoside bridge is for example selected from phosphorothioate, phosphorodithioate, NR R -phosphoramidate, boranophosphate, ⁇ -hydroxybenzyl phosphonate, phosphate-(Ci- C 21 )-0-alkyl ester, phosphate-[(C 6 -C 12 )aryl-(C 1 -C 21 )-O-alkyl]ester, (Ci-C 8 )alkylphosphonate and/or (C 6 -C 12 )arylphosphonate bridges, (C
  • dephospho bridges are described, for example, in Uhlmann E and Peyman A in "Methods in Molecular Biology", Vol. 20, “Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is for example selected from the dephospho bridges formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and/or silyl groups.
  • a sugar phosphate unit i.e., a ⁇ -D-ribose and phosphodiester intemucleoside bridge together forming a sugar phosphate unit
  • the sugar phosphate backbone i.e., a sugar phosphate backbone is composed of sugar phosphate units
  • the other unit is for example suitable to build up a "morpholino-derivative" oligomer (as described, for example, in Stirchak EP et al.
  • Nucleic Acids Res 17:6129-41 that is, e.g., the replacement by a morpholino-derivative unit; or to build up a polyamide nucleic acid ("PNA"; as described for example, in Nielsen PE et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., the replacement by a PNA backbone unit, e.g., by 2-aminoethylglycine.
  • PNA polyamide nucleic acid
  • the oligonucleotide may have other carbohydrate backbone modifications and replacements, such as peptide nucleic acids with phosphate groups (PHONA), locked nucleic acids (LNA), and oligonucleotides having backbone sections with alkyl linkers or amino linkers.
  • the alkyl linker may be branched or unbranched, substituted or unsubstituted, and chirally pure or a racemic mixture.
  • a ⁇ -ribose unit or a ⁇ -D-2'-deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is for example selected from ⁇ -D-ribose, ⁇ -D-2'- deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabinose, 2'-O-(C 1 -C 6 )alkyl-ribose, preferably 2'-O-(Ci-C 6 )alkyl-ribose is 2'-O-methylribose, 2'-O-(C 2 -C 6 )alkenyl-ribose, 2'-[O- (Ci-C6)alkyl-O-(Ci-C 6 )alkyl]-ribose, 2'-NH 2 -2'-deoxyribose, ⁇ -D-xylo-furanose,
  • the sugar is 2'-O-methylribose, particularly for one or both nucleotides linked by a phosphodiester or phosphodiester-like intemucleoside linkage.
  • Nucleic acids also include substituted purines and pyrimidines such as C-5 propyne pyrimidine and 7-deaza-7-substituted purine modified bases. Wagner RW et al. (1996) Nat Biotechnol 14:840-4.
  • Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, and uracil, and other naturally and non-naturally occurcing nucleobases, substituted and unsubstituted aromatic moieties.
  • a modified base is any base which is chemically distinct from the naturally occuning bases typically found in D ⁇ A and R ⁇ A such as T, C, G, A, and U, but which share basic chemical stmctures with these naturally occurring bases.
  • the modified nucleoside base may be, for example, selected from hypoxanthine, uracil, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(Ci-C 6 )-alkyluracil, 5-(C 2 -C 6 )-alkenyluracil, 5-(C 2 -C 6 )- alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Ci-C 6 )-alkylcytosine, 5-(C 2 -C 6 )-alkenylcytosine, 5-(C 2 -C 6 )- alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, ⁇ 2 -dimethylguanine, 2,4-diamino-purine, 8-
  • modified bases may be incorporated.
  • a cytosine may be replaced with a modified cytosine.
  • a modified cytosine as used herein is a naturally occuning or non-naturally occurring pyrimidine base analog of cytosine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide.
  • Modified cytosines include but are not limited to 5-substituted cytosines (e.g., 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo- cytosine, 5 -hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines (e.g., 6-hydroxy- cytosine), N4-substituted cytosines (e.g., N4-ethyl-cytosine), 5-aza-cytosine, 2-mercapto- cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g., N,N'-propylene cytosine or phenoxazine), and uracil and
  • the prefened cytosines include 5-methyl-cytosine, 5-fluoro-cytosine, 5- hydroxy-cytosine, 5-hydroxymethyl-cytosine, and N4-ethyl-cytosine.
  • the cytosine base is substituted by a universal base (e.g., 3-nitropyrrole, P- base), an aromatic ring system (e.g., fluorobenzene or difluorobenzene) or a hydrogen atom (dSpacer).
  • a guanine may be replaced with a modified guanine base.
  • a modified guanine as used herein is a naturally occuning or non-naturally occuning purine base analog of guanine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide.
  • Modified guanines include but are not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, N2-substituted guanines (e.g., N2-methyl- guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenines (e.g., N6-methyl-adenine
  • the guanine base is substituted by a universal base (e.g., 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g., benzimidazole or dichloro- benzimidazole, 1 -methyl- lH-[l,2,4]triazole-3 -carboxylic acid amide) or a hydrogen atom (dSpacer).
  • a universal base e.g., 4-methyl-indole, 5-nitro-indole, and K-base
  • an aromatic ring system e.g., benzimidazole or dichloro- benzimidazole, 1 -methyl- lH-[l,2,4]triazole-3 -carboxylic acid amide
  • dSpacer hydrogen atom
  • the oligonucleotides of the invention can be synthesized de novo using any of a number of procedures well known in the art, for example, the ⁇ -cyanoethyl phosphoramidite method (Beaucage SL et al. (1981) Tetrahedron Lett 22:1859); or the nucleoside H-phosphonate method (Garegg et al. (1986) Tetrahedron Lett 27:4051 -4; Froehler BC et al. (1986) Nucleic Acids Res 14:5399-407; Garegg et al. (1986) Tetrahedron Lett 27:4055-8; Gaffney et al.
  • oligonucleotide generally refers to an oligonucleotide which is separated from components which it is normally associated with in nature.
  • an isolated oligonucleotide may be one which is separated from a cell, from a nucleus, from mitochondria or from chromatin.
  • Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
  • Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (e.g., Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1:165).
  • the immunostimulatory oligonucleotides may also contain one or more unusual linkages between the nucleotide or nucleotide-analog moieties.
  • the usual intemucleoside linkage is the 3 '5 '-linkage. All other linkages are considered as unusual intemucleoside linkages, such as 2'5'-, 5 '5'-, 3 '3'-, 2'2'-, and 2 '3 '-linkages.
  • the nomenclature 2' to 5' is chosen according to the carbon atom of ribose.
  • unnatural sugar moieties such as ring-expanded sugar analogs (e.g., hexanose, cylohexene, or pyranose) or bi- or tri cyclic sugar analogs
  • this nomenclature changes according to the nomenclature of the monomer.
  • 3'-deoxy- ⁇ -D-ribopyranose analogs also called p-UNA
  • the mononucleotides are e.g. connected via a 4'2'-linkage. If the nucleotide contains one 3 '3 '-linkage, then this oligonucleotide analog will usually have two unlinked 5 '-ends.
  • nucleotide contains one 5 '5 '-linkage
  • this oligonucleotide analog will usually have two unlinked 3 '-ends.
  • the accessibility of unlinked ends of nucleotides may be better accessible by their receptors.
  • Both types of unusual linkages (3 '3'- and 5'5'-) were described by Ortigao JF et al. (1992) Antisense Res Dev 2:129-46, whereby oligonucleotides having a 3 '3 '-linkage were reported to show enhanced stability towards cleavage by nucleases.
  • Different types of linkages can also be combined in one molecule which may lead to branching of the oligomer.
  • oligonucleotide is connected at the 3 '-end via a 3 '3 '-linkage to a second oligonucleotide part and at the 2'-end via a 2'3 '-linkage to a third part of the molecule, this results e.g. in a branched oligonucleotide with three 5 '-ends (3 '3'-, 2'3'- branched).
  • linkages between different parts of an oligonucleotide or between different oligonucleotides, respectively can occur via all parts of the molecule, as long as this does not negatively interfere with the recognition by its receptor.
  • the linkage can involve the sugar moiety (Su), the heterocyclic nucleobase (Ba) or the phosphate backbone (Ph).
  • Ser sugar moiety
  • Ba heterocyclic nucleobase
  • Ph phosphate backbone
  • linkages of the type Su-Su, Su-Ph, Su-Ba, Ba-Ba, Ba-Su, Ba-Ph, Ph-Ph, Ph-Su, and Ph-Ba are possible.
  • the linkage can also occur via the modified parts of the oligonucleotides. These modifications include also modified nucleic acids, e.g., PNA, LNA, or morpholino oligonucleotide analogs.
  • the linkages are preferably composed of C, H, N, O, S, B, P, and halogen, containing 3 to 300 atoms.
  • An example with 3 atoms is an acetal linkage (ODNl-3'-O-CH 2 -O-3'- ODN2; Froehler and Matteucci) connecting e.g. the 3 '-hydroxy group of one nucleotide to the 3 '-hydroxy group of a second oligonucleotide.
  • An example with about 300 atoms is PEG-40 (tetraconta polyethyleneglycol).
  • Prefened linkages are phosphodiester, phosphorothioate, methylphosphonate, phosphoramidate, boranophosphonate, amide, ether, thioether, acetal , thioacetal, urea, tliiourea, sulfonamide, Schiff base, and disulfide linkages.
  • Another possibility is the use of the Solulink BioConjugation System (TriLink BioTechnologies, San Diego, CA). If the oligonucleotide is composed of two or more sequence parts, these parts can be identical or different.
  • the sequences can be identical, e.g., 5'-ODNl-3'3'-ODNl-5', or different, e.g., 5'-ODNl-3'3'-ODN2-5'.
  • the chemical modification of the various oligonucleotide parts as well as the linker connecting them may be different. Since the uptake of short oligonucleotides appears to be less efficient than that of long oligonucleotides, linking of two or more short sequences results in improved immune stimulation.
  • the length of the short oligonucleotides is preferably 2-20 nucleotides, more preferably 3-16 nucleotides, but most preferably 5-10 nucleotides.
  • Prefereed are linked oligonucleotides which have two or more unlinked 5 '-ends.
  • the oligonucleotide partial sequences may also be linked by non-nucleotidic linkers, in particular abasic linkers (dSpacers), triethylene glycol units or hexaethylene glycol units.
  • Other linkers include alkylamino linkers, such as C3, C6, C12 amino linkers, and also alkylthiol linkers, such as C3 or C6 thiol linkers.
  • the oligonucleotides can also be linked by aromatic residues which may be further substituted by alkyl or substituted alkyl groups.
  • the oligonucleotides may also contain a doubler or trebler unit (Glen Research, Sterling, VA), in particular those oligonucleotides with a 3 '3 '-linkage.
  • a doubler unit in one embodiment can be based on l,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
  • a trebler unit in one embodiment can be based on incorporation of Tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. Branching of the oligonucleotides by multiple doubler, trebler, or other multiplier units leads to dendrimers which are a further embodiment of this invention.
  • the oligonucleotides may also contain linker units resulting from peptide-modifying reagents or oligonucleotide-modifying reagents (Glen Research, Sterling, VA).
  • linkers may contain one or more natural or unnatural amino acid residues which are connected by peptide (amide) linkages.
  • Another possibility for linking oligonucleotides is via crosslinking of the heterocyclic bases (Verma S et al (1998) Annu Rev Biochem 67:99-134; page 124).
  • Yet another possibility is a linkage between the sugar moiety of one sequence part with the heterocyclic base of another sequence part (Iyer et al. (1999) Curr Opin Mol Therapeutics 1 :344-58; page 352).
  • the different oligonucleotides containing unusual linkages are synthesized by established methods and can be linked together on-line during solid-phase synthesis. Alternatively, they may be linked together following synthesis of the individual partial sequences.
  • CpG phosphorothioate oligonucleotides with strong stimulatory activity in the mouse system tend to show lower activity on human and other non-rodent immune cells.
  • DNA containing these (TCG) n N or RDCGYi Y 2 N motifs strongly stimulated human peripheral blood cells to produce IFN- ⁇ . It has been discovered according to the invention that the subsets of CpG immunostimulatory oligonucleotides have dramatic immune stimulatory effects on human cells such as PBMC, suggesting that these CpG immunostimulatory oligonucleotides are effective therapeutic agents for human vaccination, cancer immunotherapy, asthma immunotherapy, general enhancement of immune function, enhancement of hematopoietic recovery following radiation or chemotherapy, and other immune modulatory applications.
  • the terms treat, treated, or treating, when used with respect to a disorder such as an infectious diseasb, cancer, allergy, or asthma refers to a prophylactic treatment which increases the resistance of a subject to development of the disease (e.g., to infection with a pathogen) or, in other words, decreases the likelihood that the subject will develop the disease (e.g., become infected with the pathogen), as well as to a treatment after the subject has developed the disease in order to fight the disease (e.g., reduce or eliminate the infection) or to prevent the disease from becoming worse.
  • the CpG immunostimulatory oligonucleotides are useful in some aspects of the invention as a vaccine for the treatment of a subject having or at risk of developing allergy or asthma, an infection with an infectious organism, or a cancer in which a specific cancer antigen has been identified.
  • the CpG immunostimulatory oligonucleotides thus can be administered to a subject in conjunction with an antigen or allergen for treatment of infection, allergy, asthma, or cancer.
  • the CpG immunostimulatory oligonucleotides can also be given alone without the antigen or allergen for protection against infection, allergy or cancer or may be administered with other therapeutic agents.
  • the CpG immunostimulatory oligonucleotides also may be administered with other therapeutic agents.
  • a subject at risk as used herein is a subject who has any identifiable risk of exposure to an infection-causing pathogen or allergen or a risk of developing cancer.
  • a subject at risk of developing infection may be a subject who is planning to travel to an area where a particular type of infectious agent is found, or it may be a subject who through lifestyle or medical procedures is exposed to bodily fluids which may contain infectious organisms or directly to the organism, or it may be any subject living in an area where an infectious organism or an allergen has been identified.
  • Subjects at risk of developing infection also include general populations to which a medical agency recommends vaccination with a particular infectious organism antigen.
  • a subject at risk of developing an allergy or asthma includes those subjects that have been identified as having an allergy or asthma but that do not have active disease during the CpG immunostimulatory oligonucleotide treatment.
  • a subject at risk of developing an allergy or asthma also includes subjects that are considered to be at risk of developing these diseases because of genetic or environmental factors.
  • a subject at risk of developing a cancer is one who has a high probability of developing cancer.
  • subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer, subjects exposed to cancer-associated agents such as tobacco, asbestos, or other chemical toxins, and subjects who have previously been treated for cancer and are in apparent remission.
  • a subject at risk of developing a cancer is treated with a CpG immunostimulatory oligonucleotide and optionally an antigen specific for the type of cancer to which the subject is at risk of developing, the subject may be able to kill the cancer cells as they develop. If a tumor begins to form in the subject, the subject will develop an innate immune response or a specific immune response against the tumor antigen.
  • the invention also encompasses the use of the CpG immunostimulatory oligonucleotides for the treatment of a subject having an infection, an allergy, asthma, or a cancer.
  • a subject having an infection is a subject that has been exposed to an infectious pathogen and has acute or chronic detectable levels of the pathogen in the body.
  • the CpG immunostimulatory oligonucleotides can be used with or without an antigen or other therapeutic to mount an innate or an antigen specific systemic or mucosal immune response that is capable of reducing the level of or eradicating the infectious pathogen.
  • An infectious disease is a disease arising from the presence of a foreign microorganism in the body. It is particularly important to develop effective vaccine strategies and treatments to protect the body's mucosal surfaces, which are the primary site of pathogenic entry.
  • a subject having an allergy is a subject that is capable of developing an allergic reaction in response to an allergen.
  • An allergy refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, conjunctivitis, bronchial asthma, allergic asthma, urticaria (hives), food allergies, and other atopic conditions. Allergies are generally caused by IgE antibody generation against harmless allergens.
  • cytokines that are induced by systemic or mucosal administration of CpG immunostimulatory oligonucleotides are predominantly of a class called Thl (examples are IL-12, IP- 10, iFN-a and IFN- ⁇ ) and these induce both humoral and cellular immune responses.
  • Thl a class called IL-12, IP- 10, iFN-a and IFN- ⁇
  • Th2 immune response The other major type of immune response, which is associated with the production of IL-4 and IL-5 cytokines, is termed a Th2 immune response.
  • Th2 immune response In general, it appears that allergic diseases are mediated by Th2 type immune responses.
  • an effective dose for inducing an immune response of a CpG immunostimulatory oligonucleotide can be administered to a subject to treat asthma and allergy.
  • the CpG immunostimulatory oligonucleotides have significant therapeutic utility in the treatment of allergic conditions and asthma.
  • Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects.
  • Thl cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotope switching, eosinophil chemotaxis and activation, and mast cell growth.
  • Thl cytokines especially IFN- ⁇ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines.
  • Asthma refers to a disorder of the respiratory system characterized by inflammation, nanowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms. Thus, asthma includes allergic asthma and non-allergic asthma.
  • a subject having a cancer is a subject that has detectable cancerous cells. The cancer may be a malignant or non-malignant cancer.
  • Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g., small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
  • the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma.
  • a subject shall mean a human or vertebrate animal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, turkey, chicken, primate, e.g., monkey, and fish (aquaculture species), e.g., salmon.
  • the compounds may be used to treat cancer and tumors, infections, and allergy/asthma in human and non-human subjects.
  • Cancer is one of the leading causes of death in companion animals (e.g., cats and dogs).
  • the subject may be exposed to the antigen.
  • the term "exposed to” refers to either the active step of contacting the subject with an antigen or the passive exposure of the subject to the antigen in vivo.
  • Methods for the active exposure of a subject to an antigen are well- known in the art.
  • an antigen is administered directly to the subject by any means such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration.
  • the antigen can be administered systemically or locally.
  • a subject is passively exposed to an antigen if an antigen becomes available for exposure to the immune cells in the body.
  • a subject may be passively exposed to an antigen, for instance, by entry of a foreign pathogen into the body or by the development of a tumor cell expressing a foreign antigen on its surface.
  • the methods in which a subject is passively exposed to an antigen can be particularly dependent on timing of administration of the CpG immunostimulatory oligonucleotide.
  • the subject may be administered the CpG immunostimulatory oligonucleotide on a regular basis when that risk is greatest, e.g., during allergy season or after exposure to a cancer causing agent.
  • the CpG immunostimulatory oligonucleotide may be administered to travelers before they travel to foreign lands where they are at risk of exposure to infectious agents.
  • the CpG immunostimulatory oligonucleotide may be administered to soldiers or civilians at risk of exposure to biowarfare to induce a systemic or mucosal immune response to the antigen when and if the subject is exposed to it.
  • An antigen as used herein is a molecule capable of provoking an immune response.
  • Antigens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts and muticellular organisms such as parasites and allergens.
  • the term antigen broadly includes any type of molecule which is recognized by a host immune system as being foreign.
  • Antigens include but are not limited to cancer antigens, microbial antigens, and allergens.
  • a cancer antigen as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule.
  • Cancer antigens can be prepared from cancer cells either by preparing cmde extracts of cancer cells, for example, as described in Cohen PA et al. (1994) Cancer Res 54:1055-8, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens.
  • Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion thereof, or a whole tumor or cancer cell.
  • cancer antigens can be isolated or prepared recombinantly or by any other means known in the art.
  • cancer antigens are used interchangeably to refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells.
  • Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens.
  • cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those canied on RNA and DNA tumor vimses.
  • a microbial antigen as used herein is an antigen of a microorganism and includes but is not limited to vimses, bacteria, parasites, and fungi.
  • Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism.
  • a compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen.
  • Such antigens are used routinely in the art and are well known to those of ordinary skill in the art.
  • Retroviridae e.g., human immunodeficiency vimses, such as HIV-1 (also refereed to as HTLV-IH, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio vimses, hepatitis A vims; enterovirases, human Coxsackie vimses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis vimses, rubella vimses); Flaviviridae (e.g., dengue vimses, encephalitis viruses, yellow fever vimses); Coronaviridae (e.g., coronavirases); Rhabdoviridae (e.g., vesicular
  • Both gram negative and gram positive bacteria serve as antigens in vertebrate animals.
  • Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species.
  • Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species.
  • infectious bacteria include but are not limited to, Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M.
  • Streptococcus pyogenes Group A Streptococcus
  • Streptococcus agalactiae Group B Streptococcus
  • Streptococcus viridans group
  • Streptococcus faecalis Streptococcus bovis
  • Streptococcus anaerobic sps.
  • Streptococcus pneumoniae pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp.
  • fungi examples include Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
  • Other infectious organisms i.e., protists
  • Plasmodium spp. such as Plasmodium falciparum, Plasmodium malar iae, Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii.
  • Blood-borne and/or tissues parasites include Plasmodium spp., B ⁇ besia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
  • Other medically relevant microorganisms have been described extensively in the literature, e.g., see C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incorporated by reference.
  • An allergen refers to a substance (antigen) that can induce an allergic or asthmatic response in a susceptible subject.
  • the list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and dmgs (e.g., penicillin).
  • Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g., Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium perenne or Lolium multi ⁇ orum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago lanceolata); Parietaria (e.g., Parietaria of ⁇ cinalis or Parietariajudaica); Blattella (e.g., Blattella germanica
  • the antigen may be substantially purified.
  • substantially purified as used herein refers to an antigen, i.e., a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • One skilled in the art can purify polypeptide antigens using standard techniques for protein purification.
  • the substantially pure polypeptide will often yield a single major band on a non-reducing polyacrylamide gel. In the case of partially glycosylated polypeptides or those that have several start codons, there may be several bands on a non-reducing polyacrylamide gel, but these will form a distinctive pattern for that polypeptide.
  • the purity of the polypeptide antigen may also be determined by amino-terminal amino acid sequence analysis.
  • antigens such as polysaccharides, small molecule, mimics, etc.
  • the oligonucleotides of the invention may be administered to a subject with an antimicrobial agent.
  • An anti-microbial agent refers to a naturally-occuning or synthetic compound which is capable of killing or inhibiting infectious microorganisms.
  • the type of anti-microbial agent useful according to the invention will depend upon the type of microorganism with which the subject is infected or at risk of becoming infected.
  • Antimicrobial agents include but are not limited to anti-bacterial agents, anti-viral agents, anti- fungal agents and anti-parasitic agents.
  • anti-bacterial agents kill or inhibit bacteria, and include antibiotics as well as other synthetic or natural compounds having similar functions.
  • Antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more bacterial functions or structures which are specific for the microorganism and which are not present in host cells.
  • Anti-viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting vimses.
  • Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections. Anti-parasitic agents kill or inhibit parasites. Examples of anti-parasitic agents, also refened to as parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxanide furoate, eflomithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, oxamniquine, paromomycin,
  • Antibacterial agents kill or inhibit the growth or function of bacteria.
  • a large class of antibacterial agents is antibiotics.
  • Antibiotics which are effective for killing or inhibiting a wide range of bacteria, are refened to as broad spectrum antibiotics.
  • Other types of antibiotics are predominantly effective against the bacteria of the class gram-positive or gram-negative. These types of antibiotics are refened to as narrow spectrum antibiotics.
  • Other antibiotics which are effective against a single organism or disease and not against other types of bacteria are refened to as limited spectrum antibiotics.
  • Antibacterial agents are sometimes classified based on their primary mode of action. In general, antibacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors.
  • Anti iral agents are compounds which prevent infection of cells by vimses or replication of the vims within the cell. There are many fewer antiviral drags than antibacterial drugs because the process of viral replication is so closely related to DNA replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents.
  • These stages include, attachment of the vims to the host cell (immunoglobulin or binding peptides), uncoating of the vims (e.g., amantadine), synthesis or translation of viral mRNA (e.g., interferon), replication of viral RNA or DNA (e.g., nucleoside analogs), maturation of new vims proteins (e.g., protease inhibitors), and budding and release of the vims.
  • Nucleotide analogs are synthetic compounds which are similar to nucleotides, but which have an incomplete or abnormal deoxyribose or ribose group.
  • nucleotide analogs are in the cell, they are phosphorylated, producing the triphosphate form which competes with normal nucleotides for incorporation into the viral DNA or RNA. Once the triphosphate form of the nucleotide analog is incorporated into the growing nucleic acid chain, it causes reversible association with the viral polymerase and thus chain termination.
  • Nucleotide analogs include, but are not limited to, acyclovir (used for the treatment of herpes simplex vims and varicella-zoster vims), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial vims), dideoxyinosine, dideoxycytidine, zidovudine (azidothymidine), imiquimod, and resimiquimod.
  • the interferons are cytokines which are secreted by vims-infected cells as well as immune cells.
  • interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the vims, ⁇ and ⁇ -interferon also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition, oc and ⁇ -interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection. At the dosages which are effective for anti-viral therapy, interferons have severe side effects such as fever, malaise and weight loss.
  • Anti- viral agents useful in the invention include but are not limited to immunoglobulins, amantadine, interferons, nucleoside analogs, and protease inhibitors.
  • Specific examples of anti-virals include but are not limited to Acemannan; Acyclovir; Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox; Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate; Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride; Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril; Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium;
  • Anti-fungal agents are useful for the treatment and prevention of infective fungi. Anti-fungal agents are sometimes classified by their mechanism of action. Some anti-fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other anti-fungal agents function by destabilizing membrane integrity. These include, but are not limited to, imidazoles, such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafme, and terbinafine.
  • imidazoles such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphoter
  • CpG immunostimulatory oligonucleotides can be combined with other therapeutic agents such as adjuvants to enhance immune responses.
  • the CpG immunostimulatory oligonucleotide and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents are administered simultaneously they can be administered in the same or separate formulations, but are administered at the same time.
  • the other therapeutic agents are administered sequentially with one another and with CpG immunostimulatory oligonucleotide, when the administration of the other therapeutic agents and the CpG immunostimulatory oligonucleotide is temporally separated.
  • the CpG immunostimulatory oligonucleotide can be administered before or after administration of (or exposure to) at least one other therapeutic agent.
  • the separation in time between the administration of these compounds may be a matter of minutes or it may be longer.
  • Other therapeutic agents include but are not limited to adjuvants, cytokines, antibodies, antigens, etc.
  • the compositions of the invention may also be administered with non-nucleic acid adjuvants.
  • a non-nucleic acid adjuvant is any molecule or compound except for the CpG immunostimulatory oligonucleotides described herein which can stimulate the humoral and/or cellular immune response.
  • Non-nucleic acid adjuvants include, for instance, adjuvants that create a depot effect, immune stimulating adjuvants, and adjuvants that create a depot effect and stimulate the immune system.
  • the CpG immunostimulatory oligonucleotides are also useful as mucosal adjuvants. It has previously been discovered that both systemic and mucosal immunity are induced by mucosal delivery of CpG nucleic acids. Thus, the oligonucleotides may be administered in combination with other mucosal adjuvants.
  • Immune responses can also be induced or augmented by the co-administration or co- linear expression of cytokines (Bueler & Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997; Iwasaki et al., 1997; Kim et al, 1997) or co-stimulatory molecules such as B7 (Iwasaki et al., 1997; Tsuji et al., 1997) with the CpG immunostimulatory oligonucleotides.
  • cytokines Buseler & Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997; Iwasaki et al., 1997; Kim et al, 1997) or co-stimulatory molecules such as B7 (Iwasaki et al., 1997; Tsuji et al., 1997) with the CpG immunostimulatory oligonucleotides.
  • cytokine is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment.
  • cytokines examples include, but are not limited to interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , tumor necrosis factor (TNF), TGF- ⁇ , Flt-3 ligand, and CD40 ligand.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-3 IL-4
  • IL-5 IL-6
  • IL-7 IL-10
  • IL-12 IL-15
  • IL-18 granulocyte-macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • IFN- ⁇ IFN- ⁇
  • IFN- ⁇ tumor necrosis factor
  • Flt-3 ligand tumor nec
  • the CpG oligonucleotides may be used in combination with antibodies against certain cytokines, such as anti-IL-10 and anti-TGF- ⁇ , as well as cyclooxygenase inhibitors, i.e., COX-1 and COX-2 inhibitors.
  • the oligonucleotides are also useful for redirecting an immune response from a Th2 immune response to a Thl immune response. This results in the production of a relatively balanced Thl/Th2 environment.
  • Redirection of an immune response from a Th2 to a Thl immune response can be assessed by measuring the levels of cytokines produced in response to the nucleic acid (e.g., by inducing monocytic cells and other cells to produce Thl cytokines, including IFN- ⁇ ).
  • the redirection or rebalance of the immune response from a Th2 to a Thl response is particularly useful for the treatment of asthma.
  • an effective amount for treating asthma can be that amount useful for redirecting a Th2 type of immune response that is associated with asthma to a Thl type of response or a balanced Thl/Th2 environment.
  • Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects.
  • the CpG immunostimulatory oligonucleotides described herein cause an increase in Thl cytokines which helps to rebalance the immune system, preventing or reducing the adverse effects associated with a predominately Th2 immune response. Redirection of an immune response from a Th2 to a Thl immune response can also be assessed by measuring the levels of specific isotypes of immunoglobulin. For example, in mice IgG2a is associated with a Thl immune response, and IgGl and IgE are associated with a Th2 immune response.
  • the CpG immunostimulatory oligonucleotides have the unique capability to promote cell survival, differentiation, activation and maturation of dendritic cells, and are useful for in vitro, in vivo, and ex vivo methods' involving dendritic cells.
  • CpG immunostimulatory oligonucleotides also increase natural killer cell lytic activity and antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC can be performed using a CpG immunostimulatory oligonucleotide in combination with an antibody specific for a cellular target, such as a cancer cell.
  • the antibodies useful in the ADCC procedure include antibodies which interact with a cell in the body. Many such antibodies specific for cellular targets have been described in the art and many are commercially available.
  • the CpG immunostimulatory oligonucleotides may also be administered in conjunction with an anti-cancer therapy.
  • Anti-cancer therapies include cancer medicaments, radiation and surgical procedures.
  • a "cancer medicament” refers to an agent which is administered to a subject for the purpose of treating a cancer.
  • treating cancer includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer.
  • the cancer medicament is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer.
  • cancer medicaments are classified as chemotherapeutic agents, immunotherapeutic agents, cancer vaccines, hormone therapy, and biological response modifiers. Additionally, the methods of the invention are intended to embrace the use of more than one cancer medicament along with the CpG immunostimulatory oligonucleotides. As an example, where appropriate, the CpG immunostimulatory oligonucleotides may be administered with both a chemotherapeutic agent and an immunotherapeutic agent.
  • the cancer medicament may embrace an immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent, an immunotherapeutic agent and a cancer vaccine all administered to one subject for the purpose of treating a subject having a cancer or at risk of developing a cancer.
  • the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxombicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrabicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS farnesyl transferase inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9
  • the immunotherapeutic agent may be selected from the group consisting of Rituxan, Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE- 1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX- 260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab, and ImmuRAIT-CEA
  • the cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it is not so limited.
  • CpG immunostimulatory oligonucleotides in conjunction with immunotherapeutic agents such as monoclonal antibodies is able to increase long-term survival tlirough a number of mechanisms including significant enhancement of ADCC (as discussed above), activation of NK cells and an increase in IFN- ⁇ levels.
  • the nucleic acids when used in combination with monoclonal antibodies serve to reduce the dose of the antibody required to achieve a biological result.
  • the invention also includes methods for inducing antigen non-specific innate immune activation and broad spectrum resistance to infectious challenge using the CpG immunostimulatory oligonucleotides.
  • innate immune activation refers to the activation of immune cells other than memory B cells and for instance can include the activation of monocytes, neutrophils, macrophages, dendritic cells, NK cells, and/or other immune cells that can respond in an antigen-independent fashion.
  • a broad spectrum resistance to infectious challenge is induced because the immune cells are in active form and are primed to respond to any invading compound or microorganism. The cells do not have to be specifically primed against a particular antigen. This is particularly useful in biowarfare, and the other circumstances described above such as travelers.
  • the CpG immunostimulatory oligonucleotides may be directly administered to the subject or may be administered in conjunction with a nucleic acid delivery complex.
  • a nucleic acid delivery complex shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell.
  • a targeting means e.g., a molecule that results in higher affinity binding to target cell.
  • nucleic acid delivery complexes include nucleic acids associated with a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor).
  • Prefened complexes may be sufficiently stable in vivo to prevent significant uncoupling prior to intemalization by the target cell.
  • the complex can be cleavable under appropriate conditions within the cell so that the oligonucleotide is released in a functional form.
  • the CpG immunostimulatory oligonucleotide and/or the antigen and/or other therapeutics may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art.
  • an effective amount of a CpG immunostimulatory oligonucleotide administered with an antigen for inducing mucosal immunity is that amount necessary to cause the development of IgA in response to an antigen upon exposure to the antigen, whereas that amount required for inducing systemic immunity is that amount necessary to cause the development of IgG in response to an antigen upon exposure to the antigen.
  • an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
  • the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular CpG immunostimulatory oligonucleotide being administered the size of the subject, or the severity of the disease or condition.
  • Subject doses of the compounds described herein for mucosal or local delivery typically range from about 10 ⁇ g to 10 g per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween or as otherwise required. More typically mucosal or local doses range from about 1 mg to 500 mg per administration, and most typically from about 1 mg to 100 mg, with 2 - 4 administrations being spaced days or weeks apart.
  • immune stimulant doses range from 10 ⁇ g to 100 mg per administration, and most typically 100 ⁇ g to 10 mg, with daily or weekly administrations.
  • Subject doses of the compounds described herein for parenteral delivery for the purpose of inducing an antigen-specific immune response, wherein the compounds are delivered with an antigen but not another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose for vaccine adjuvant or immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher.
  • Doses of the compounds described herein for parenteral delivery for the purpose of inducing an innate immune response or for increasing ADCC or for inducing an antigen specific immune response when the CpG immunostimulatory oligonucleotides are administered in combination with other therapeutic agents or in specialized delivery vehicles typically range from about 100 ⁇ g to 10 g per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween or as otherwise required. More typically parenteral doses for these purposes range from about 1 mg to 5 g per administration, and most typically from about 1 mg to 1 g, with 2 - 4 administrations being spaced days or weeks apart.
  • parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
  • the therapeutically effective amount can be initially determined from animal models.
  • a therapeutically effective dose can also be determined from human data for other CpG oligonucleotides which have been tested in humans (human clinical trials are ongoing) and for compounds which are known to exhibit similar pharmacological activities, such as other adjuvants, e.g., LT and other antigens for vaccination purposes. Higher doses may be required for parenteral administration.
  • the applied dose can be adjusted based on the relative bioavailability and potency of the administered compound.
  • the formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible earners, adjuvants, and optionally other therapeutic ingredients.
  • an effective amount of the CpG immunostimulatory oligonucleotide and/or other therapeutics can be administered to a subject by any mode that delivers the compound to the desired surface, e.g., local, mucosal, systemic.
  • Administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
  • Prefened routes of administration include but are not limited to oral, parenteral, intravenous, intramuscular, subcutaneous, intralesional, intratumoral, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, and rectal
  • the compounds i.e., CpG immunostimulatory oligonucleotides, antigens and/or other therapeutic agents
  • caniers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
  • compositions for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol
  • cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carb
  • disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any caniers.
  • Dragee cores are provided with suitable coatings.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds may be administered by inhalation to pulmonary tract, especially the bronchi and more particularly into the alveoli of the deep lung, using standard inhalation devices.
  • the compounds may be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • An inhalation apparatus may be used to deliver the compounds to a subject.
  • An inhalation apparatus is any device for administering an aerosol, such as dry powdered form of the compounds. This type of equipment is well known in the art and has been described in detail, such as that description found in Remington: The Science and Practice of Pharmacy, 19 th Edition, 1995, Mac Publishing Company, Easton, Pennsylvania, pages 1676-1692. Many U.S. patents also describe inhalation devices, such as U.S. Pat. No. 6,116,237.
  • "Powder” as used herein refers to a composition that consists of finely dispersed solid particles.
  • the compounds are relatively free flowing and capable of being dispersed in an inhalation device and subsequently inhaled by a subject so that the compounds reach the lungs to permit penetration into the alveoli.
  • a "dry powder” refers to a powder composition that has a moisture content such that the particles are readily dispersible in an inhalation device to form an aerosol.
  • the moisture content is generally below about 10% by weight (% w) water, and in some embodiments is below about 5% w and preferably less than about 3% w.
  • the powder may be formulated with polymers or optionally may be formulated with other materials such as liposomes, albumin and/or other carriers.
  • Aerosol dosage and delivery systems may be selected for a particular therapeutic application by one of skill in the art, such as described, for example in Gonda, I. "Aerosols for delivery of therapeutic and diagnostic agents to the respiratory tract,” in Critical Reviews in Therapeutic Drug Canier Systems, 6:273-313 (1990), and in Moren, "Aerosol dosage fonris and formulations," in Aerosols in Medicine. Principles, Diagnosis and Therapy, Moren, et al, Eds., Elsevier, Amsterdam, 1985.
  • the compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the compounds may also be formulated as a depot preparation.
  • Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • suitable polymeric or hydrophobic materials for example as an emulsion in an acceptable oil
  • ion exchange resins for example, as an emulsion in an acceptable oil
  • sparingly soluble derivatives for example, as a sparingly soluble salt.
  • the pharmaceutical compositions also may include suitable solid or gel phase caniers or excipients. Examples of such caniers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
  • the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)ca ⁇ sules, suppositories, symps, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
  • the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for dmg delivery, see Langer R (1990) Science 249:1527-33, which is inco ⁇ orated herein by reference.
  • the CpG immunostimulatory oligonucleotides and optionally other therapeutics and/or antigens may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic.
  • such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
  • Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2%) w/v).
  • Suitable preservatives include benzalkonium chloride (0.003-0.03%) w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
  • compositions of the invention contain an effective amount of a CpG immunostimulatory oligonucleotide and optionally antigens and/or other therapeutic agents optionally included in a pharmaceutically-acceptable canier.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
  • canier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
  • CpG ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT, SEQ ID NO:56) was used as a positive control for TLR9 signal activation.
  • C-class CpG ODN 2429 (TCGTCGTTTTGTCGTTTTGTCGTT, SEQ ID NO:56) was used as a positive control for TLR9 signal activation.
  • TCGTCGTTTTCGGCGGCCGCCG was used as a positive control for IFN- ⁇ induction.
  • Non-CpG ODN 1982 TCCAGGACTTCTCTCAGGTT, SEQ ID NO: 18
  • Peripheral blood buffy coat preparations from healthy male and female human donors were obtained from the Blood Bank of the University of D ⁇ sseldorf (Germany) and from these, PBMC were purified by centrifugation over Ficoll-Hypaque (Sigma).
  • the purified PBMC were resuspended in RPMI 1640 culture medium (BioWhittaker, Belgium) supplemented with 5% (v/v) heat-inactivated human AB semm (BioWhittaker) or 10% (v/v) heat-inactivated FCS, 2 mM L-glutamine (BioWhittaker), 100 U/ml penicillin and 100 ⁇ g/ml streptomycin (Invitrogen, Düsseldorf, Germany).
  • Fresh PBMC were seeded on 96- well round-bottom plates and incubated for 48 hours with ODN in the concentrations as indicated in a humidified incubator at 37°C. Culture supernatants were collected and if not used immediately, frozen at -20°C until required.
  • Amounts of IFN- ⁇ in the supernatants were assessed using an enzyme-linked immunosorbent assay (ELISA) developed using commercially available antibodies (Alexis GmbH, Grunberg, Germany).
  • ELISA enzyme-linked immunosorbent assay
  • ODN 128, 331-344, 611 and 620 were tested with PBMC from four different donors, and ODN 614 was tested with PBMC from three different donors.
  • Stably transfected HEK293 cells used for a human TLR9 reporter gene assay expressed the human TLR9 receptor and an NF- ⁇ B reporter gene construct. Cells were incubated with ODNs for 16h at 37°C in a humidified incubator. Each data point was done in triplicate. Cells were lysed and assayed for reporter gene activity.
  • FIG. 1 shows that C-class ODN 332, 333, and 334 induced large amounts of IFN- ⁇ (ca. 2000-2500 pg/ml typical) when present at a concentration of 1 ⁇ M. The amount of IFN- ⁇ induced by these ODN significantly exceeded the amount of IFN- ⁇ induced by the same concentration of ODN 2006 or 1982.
  • FIG. 1 also shows that C-class ODN 332, 333, and 334 induced significant amounts of TLR9 signaling activity (typically with a stimulation index of ca. 15) when present at a concentration of 10 ⁇ M.
  • FIG. 2 shows that C-class ODN 611, 614, and 620 induced even greater amounts of IFN- ⁇ (ca. 3000-4000 pg/ml typical) when present at a concentration of 1 ⁇ M. The amount of IFN- ⁇ induced by these ODN significantly exceeded the amount of IFN- ⁇ induced by the same concentration of ODN 2006 or 1982.
  • FIG. 2 also shows that C-class ODN 611, 614, and 620 induced significant amounts of TLR9 signaling activity (typically with a stimulation index of ca.
  • Example 2 Additional C-Class ODN Analogs Induce IFN- Secretion In Vitro
  • additional C-class ODN analogs of the invention were tested in vitro for their ability to induce IFN- ⁇ secretion.
  • the C-class ODN analogs in these experiments were characterized in part by the presence of AT-rich interrupted inverted repeats or by the presence of intenupted inverted repeats containing dSpacer residues in place of conventional nucleotide residues.
  • ODN were obtained as in Example 1.
  • Test ODN included the following:
  • the amount of IFN- ⁇ induced by these ODN significantly exceeded the amount of IFN- ⁇ induced by the same concentration of ODN 2006 or 1982.
  • C-class ODN 649, 650, and 651 characterized in part by the presence of interrupted inverted repeats containing dSpacer residues, induced large amounts of IFN- ⁇ (ca. 2000-2500 pg/ml typical) when present at a concentration of 1 ⁇ M.
  • the amount of IFN- ⁇ induced by these ODN significantly exceeded the amount of IFN- ⁇ induced by the same concentration of ODN 2006 or 1982.
  • Example 3 Additional C-Class ODN Analogs Induce IFN- Secretion and Human TLR9 Activity In Vitro
  • C-class ODN analogs of the invention were tested in vitro for their ability to stimulate human PBMC to secreted IFN- ⁇ and to stimulate HEK293 cells, stably transfected with human TLR9 and NF- ⁇ B reporter construct, to demonstrate TLR9 signaling.
  • the basic protocol is as described for Example 1, with the exception that the test ODN included the following:
  • IFN- ⁇ Large amounts of IFN- ⁇ were secreted by human PBMC upon 48 h incubation with these C-class CpG ODN. Typical amounts of IFN- ⁇ were in the range of 3000-4000 pg/ml following incubation with ODN at concentrations less than or equal to 1 ⁇ M. Response curves for IFN- ⁇ in these experiments were very similar to those shown in FIG. 2.
  • Example 4 C-Class ODN Analogs Induce Antigen-Specific Immune Response In Vivo
  • C-class ODN of the invention were tested in vivo in conjunction with vaccination of mice.
  • C-class ODN of the invention were observed to boost titers of antigen-specific total IgG and IgG2a (Thl-like IgG in mice), as well as antigen-specific cytolytic T lymphocyte (CTL) responses, in a manner at least comparable to B-class CpG ODN 2006.
  • ODN were obtained as in Example 1.
  • Female BALB/c mice (6-8 weeks of age) were used for all experiments.
  • Animals were purchased from Charles River Canada (Quebec, Canada) and housed in micro isolators at the animal care facility of the Ottawa Hospital Research Institute, Civic Site. Naive BALB/c mouse splenocytes were used for all in vitro assays. Animals were anesthetized with isofluorane and euthanized by cervical dislocation. Spleens were removed under aseptic conditions and placed in phosphate-buffered saline (PBS) + 0.2% bovine serum albumin (Sigma Chemical Company).
  • PBS phosphate-buffered saline
  • bovine serum albumin Sigma Chemical Company
  • Spleens were then homogenized and splenocytes were re-suspended in RPMI 1640 tissue culture medium (Life Technologies, Grand Island, NY) supplemented with 2% normal mouse serum (Cedarlane Laboratories, Ontario, Canada), penicillin-streptomycin solution (final concentration of 1000 U/ml and 1 mg/ml respectively; Sigma Chemical Company), and 5 x IO "5 M ⁇ -mercaptoethanol (Sigma Chemical Company).
  • HBsAg hepatitis B surface antigen sub type ad
  • CA International Enzymes
  • Antibodies (total IgG, IgGl and IgG2a) specific to HBsAg (anti-HBs) were detected and quantified by endpoint dilution ELIS A assay, which was performed in triplicate on samples from individual animals. End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of non- immune plasma with a cut-off value of 0.05. These were reported as group mean titers (GMT) ⁇ SEM. CTL assays were conducted according to standard manner.
  • spleens were removed at 4 weeks post immunization and homogenized into single-cell suspension in RPMI 1640 tissue culture medium (Life Technologies, Grand Island, NY) supplemented with 10%> fetal bovine semm (Life Technologies), penicillin-streptomycin solution (final concentration of 1000 U/ml and 1 mg/ml respectively; Sigma, Irvine, UK), and 5 ⁇ l0 "5 M ⁇ - mercaptoethanol (Sigma) (Complete RPMI 1640).
  • HBsAg-specific lymphocytes in splenocyte suspensions (3 x IO 6 cells/ml) were re-stimulated for 5 days by incubating with a murine cell line (p815-S) expressing HBsAg.
  • results were presented as %> specific lysis at different effector:target (E:T) ratios. Results. Representative results are shown in FIG. 4-6. As shown in FIG. 4, total IgG titers for ODN 2006 and ODN 620 were dose-dependent and found to be ca. 5 x IO 3 and 6.5 x 10 3 , respectively, at ODN dose of 1 ⁇ g. Total IgG titers for ODN 2006 and ODN 620 were found to be ca. 1 x IO 4 at ODN dose of 100 ⁇ g. As shown in FIG.
  • ODN 2006 and ODN 620 both significantly boosted IgG2a (Thl-like IgG in mice) compared to non-CpG control ODN 2137 (TGCTGCTTTTGTGCTTTTGTGCTT; SEQ ID NO:60).
  • IgG2a titers for ODN 2006, 620, and 2137 each administered in doses of 10 ⁇ g, were ca. 3 x IO 3 , 6 x 10 3 , and 3 x IO 2 , respectively.
  • CTL activity at an E:T ratio of 100:1 for ODN 2006 and 620 was significantly greater than control at administered doses of 10 and 100 ⁇ g.
  • Example 5 C-Class ODN Analogs Improve Survival and Reduce Tumor Volume In a Tumor Model In Vivo
  • C-class ODN analogs of the invention were tested in vivo in a murine neuroblastoma model.
  • C-class ODN analogs of the invention were found to improve dramatically both overall survival and tumor burden.
  • ODN were obtained as in Example 1.
  • BALB/c mice were obtained as in Example 4.
  • BALB/c mice were injected subcutaneously (s.c.) into the left flank on day 0 with lxlO 6 neuroblastoma (Neuro-2a) cells (e.g., ATCC CCL-131, American Type Culture Collection, Manassas, VA). Mice were given s.c.
  • Neuro-2a neuroblastoma
  • mice treated with 100 ⁇ g ODN 620 had a 50%) survival rate at 80 days, as compared with conesponding survival rates of 0-20% for ODN 2006, ODN 2137, or PBS.
  • mice treated with 100 ⁇ g ODN 620 had a tumor volume that peaked at about 1000 mm 3 on day 28 and declined to 0 mm 3 by 38 days.
  • mice treated with ODN 2137 or PBS had more rapid, monotonic tumor growth.
  • the ODNs of this invention (e.g., 611 and 620) showed less accumulation in organs as compared to the known fully phosphorothioate palindromic ODNs, such as 2429.
  • kidney levels of ODN 611, 620, and 2429 were ca. 70 ⁇ 28, 30 ⁇ 18, and 90 ⁇ 10 mg/kg, respectively.
  • liver levels of ODN 611, 620, and 2429 were ca. 45 ⁇ 15, 28 ⁇ 12, and 150 ⁇ 15 mg/kg, respectively.
  • ODN 611 and ODN 620 were investigated by size exclusion chromatography (225 ⁇ M in PBS), only one peak was observed for each compound, i.e., each oligonucleotide eluted like a monomer.
  • ODN 608 and 618 were investigated by size exclusion chromatography, two peaks were observed for each oligonucleotide, consistent with the presence of an intermolecular dimer in addition to the monomer.
  • UV thermal denaturation studies indicated that ODN 611 and ODN 620 had a secondary stmcture in solution, consistent with an intramolecular hairpin stmcture.
  • the hairpin stmcture is believed to result from the inverted repeat in the 611 and 620 sequences. Generally sharper pealcs were observed in HPLC and CGE for these sequences as compared to ODN 2429 and ODN 608. Taken as a whole, these results demonstrate that C-class ODN analogs of the invention tend to form intramolecular secondary stmctures and do not form intermolecular complexes in vitro at the concentration examined, whereas palindrome-containing C-class ODN tend to associate into complexes through intermolecular interactions.
  • concentrations of ODN attained in the intraendosomal compartment are sufficiently high to favor duplex or even higher-order complexes of ODN, including duplex or even higher-order complexes of C-class ODN analogs of the invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pulmonology (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • AIDS & HIV (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-Ϝ), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.

Description

C-CLASS OLIGONUCLEOTIDE ANALOGS WITH ENHANCED IMMUNOSTIMULATORY POTENCY
FIELD OF THE INVENTION The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids.
BACKGROUND OF THE INVENTION Bacterial DNA has immune stimulatory effects to activate B cells and natural killer cells, but vertebrate DNA does not. Tokunaga T et al. (1988) Jpn J Cancer Res 79:682-6; Tokunaga T et al. (1984) JNCI 72:955-62; Messina JP et al. (1991) J Immunol 147:1759-64; and reviewed in Krieg, 1998, In: Applied Oligonucleotide Technology, CA. Stein and A.M. Krieg, (Eds.), John Wiley and Sons, Inc., New York, NY, pp. 431 -448) and Krieg AM (2002) Annu Rev Immunol 20:709-60. It is now understood that these immune stimulatory effects of bacterial DNA are a result of the presence of unmethylated CpG dinucleotides in particular base contexts (CpG motifs), which are common in bacterial DNA, but methylated and underrepresented in vertebrate DNA. Krieg AM et al. (1995) Nature 374:546-9; Krieg AM (1999) Biochim Biophys Acta 1489:107-16. The immune stimulatory effects of bacterial DNA can be mimicked with synthetic oligodeoxynucleotides (ODN) containing these CpG motifs. Such CpG ODN have highly stimulatory effects on human and murine leukocytes, inducing B-cell proliferation; cytokine and immunoglobulin secretion; natural killer (NK) cell lytic activity and interferon gamma (IFN-γ) secretion; and activation of dendritic cells (DCs) and other antigen-presenting cells to express costimulatory molecules and secrete cytokines, especially the Thl-like cytokines that are important in promoting the development of Thl-like T-cell responses. These immune stimulatory effects of native phosphodiester backbone CpG ODN are highly CpG-specific in that the effects are dramatically reduced if the CpG motif is methylated, changed to a GpC, or otherwise eliminated or altered. Krieg AM et al. (1995) Nature 374:546-9; Hartmann G et al. (1999) Proc Natl. Acad Sci USA 96:9305-10. In early studies, it was thought that the immune stimulatory CpG motif followed the formula purine-purine-CpG-pyrimidine-pyrimidine. Krieg AM et al. (1995) Nature 374:546- 9; Pisetsky DS (1996) J Immunol 156:421-3; Hacker H et al. (1998) EMBO J 17:6230-40; Lipford GB et al. (1998) Trends Microbiol 6:496-500. However, it is now clear that mouse lymphocytes respond quite well to phosphodiester CpG motifs that do not follow this "formula" (Yi AK et al. (1998) J Immunol 160:5898-906), and the same is true of human B cells and dendritic cells (Hartmann G et al. (1999) Proc Natl Acad Sci USA 96:9305-10; Liang H et al. (1996) J Clin Invest 98:1119-29).
SUMMARY OF THE INVENTION The present invention relates in part to immunostimulatory CpG-containing oligonucleotides and oligonucleotide analogs having a secondary structure with an inverted repeat at or near the 3' end of the molecule. The secondary structure involves formation of duplex or higher-order structures under certain conditions. As an important feature of the oligonucleotides and oligonucleotide analogs of the invention, the inverted repeat is not a strict Watson-Crick palindrome but rather can be interrupted by intervening sequence or nucleotide analogs. As another feature of the oligonucleotides and oligonucleotide analogs of the invention, the backbone can be modified to include strategically placed nuclease-resistant and nuclease-sensitive internucleotide linkages, thereby both favoring activity and reducing potential toxicity. In addition, these oligonucleotides and oligonucleotide analogs are found to exert both A-class and B-class immunostimulatory activity and are therefore classified as novel C-class immunostimulatory nucleic acid molecules. The invention is based, in part, on the discovery by the present inventors that CpG- containing immunostimulatory oligonucleotides and oligonucleotide analogs containing an imperfect palindrome at or near the 3' end of the molecule have certain advantages both in terms of their preparation and their biological activity. Specifically, the C-class oligonucleotides and oligonucleotide analogs of the instant invention are characteristically monomeric in solution. It is believed that these same nucleic acid molecules can form intramolecular duplex structures in vitro, rendering them stable against nuclease digestion. It is also believed that these same nucleic acid molecules can form intermolecular duplex and possibly even higher order structures within the environment of the intraendosomal compartment, where they are believed to exert their biological activity.
In one aspect the invention provides a composition including an immunostimulatory nucleic acid molecule of Formula I Zi [(Xi Y1 1) N (X2Y2R2)k Z2]p (Sι)q N' (N„)...(N2)(Nι) S2 (N1#)(N2#)...(Nn#) Z3 (Formula I)
wherein each of Zi, Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of Xi and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yi and Y2 is independently a cytosine (C) or a modified cytosine; each of RΪ and R2 is independently a guanine (G) or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; Si is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5 '5'-, 3 '3'-, 2'2'-, or 2'3'- internucleoside linkages; S2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; each of Nl5 N2, .... Nn, and Nι#, N2#, ... Nn# is any nucleotide or modified nucleotide wherein Ni base-pairs with Nι#, N2 base-pairs with N2#, ... and Nn base-pairs with Nn#; k is an integer from 0 to 5; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10, and wherein when (Nn)...(N2)(Nι) S2 (Nι#)(N2#)...(Nn#) is 10 to 42 nucleotides long, S2 is 4 to 10 nucleotides long, S2 comprises a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (Nn)...(N2)(N S2 (N1 )(N2#)...(Nn#) has a GC content that is less than 2/3. In one embodiment each of Nls N2, .... Nn, and N^, N2#, ... Nn# is chosen from C, G, or modifications thereof, wherein C base-pairs with G. In one embodiment each of Ni, N2, .... N„, and Nι#, N2#, ... Nn# is chosen from T, A, or modifications thereof, and T base-pairs with A. In these and other embodiments each of C, G, A, and T can refer to deoxynucleotides with corresponding bases cytosine, guanine, adenine, and thymine. In one embodiment each of Nls N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from C, T, A, G, or modifications thereof, and C base-pairs with G, T base-pairs with G, A base-pairs with T, and A base-pairs with G. In one embodiment each of Ni, N2, .... Nn, and Ni#, N2#, ... Nn# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs, i.e., each base pair Ni-Ni#, N2-N2#, ... Nn-Nn# is a Watson-Crick base pair. In one embodiment at least one of each of Nl5 N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from unmodified or modified nucleotides which form non- Watson-Crick base pairs, i.e., at least one base pair Nι-Nι#, N2-N2#, ... Nn-Nn# is a non- Watson-Crick base pair. In one embodiment the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with at least one phosphodiester bond. In one embodiment the immunostimulatory nucleic acid molecule includes a backbone with at least one stabilized internucleotide linkage. In one embodiment internucleotide linkages of the oligonucleotide are all phosphorothioate linkages. In one embodiment the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with a phosphodiester bond joining at least one of YiRi or Y2R2. In one embodiment Yi is C. In one embodiment K\ is G. In one embodiment Yi is C and Ri is G. In one embodiment Xi or X2 is T. In one embodiment Xi is T, X2 is T, Yi is C, Rj is G, and k is 1. In one embodiment Xi is T, X2 is T, Yi is C, Ri is G, k is 1, p is 1, N and N' and Z3 each contain zero nucleotides, and Z2 is TTTT or d(UUUU), where d(UUUU) represents dUdUdUdU, i.e., (deoxyU)4. In one embodiment S2 is a non-nucleotidic linker. In one embodiment S2 contains at least one abasic dSpacer residue. In one embodiment the oligonucleotide includes at least one branched non-nucleoside linkage. In one embodiment the immunostimulatory nucleic acid molecule includes at least one doubler unit, at least one trebler unit, or at least one doubler unit and at least one trebler unit. In one embodiment Si is a doubler unit or a trebler unit. In one embodiment the oligonucleotide includes at least one 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkage. In one embodiment the immunostimulatory nucleic acid molecule of Formula I is not an antisense nucleic acid. In one aspect the invention provides an immunostimulatory nucleic acid molecule of Formula II
Zi (Nn)(Nn-1)...(N2)(Ni) S2 (Nι#)(N2#)...(N„.1#) (Nn#) (S,)q Z3 [(Xj YjRi) N (X2Y2R2)k Z2]p (Formula II)
wherein each of Zi, Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of Xi and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yi and Y2 is independently a cytosine (C) or a modified cytosine; each of Rj and R2 is independently a guanine (G) or a modified guanine; N is any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; Si is a non- nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkages; S2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; each of Ni, N2, .... Nn-1, Nn, and Nι#, N2#, ... Nn-1#, Nn# is any nucleotide or modified nucleotide wherein Ni base-pairs with Nι#, N2 base-pairs with N2#, ... Nn-1 base-pairs with Nn-1#, and Nn base-pairs with Nn#; k is an integer from 0 to 5; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10, and wherein when (Nn)...(N2)(N S2 (Ni#)(N2#)...(Nn§) is 10 to 42 nucleotides long, S2 is 4 to 10 nucleotides long, S2 comprises a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (Nn)...(N2)(Ni) S2 (Nι#)(N2#)...(Nn#) has a GC content that is less than 2/3. In one embodiment Z\ (Nn)(Nn-1) is TYR, where Y is a cytosine or a modified cytosine and R is a guanine or a modified guanine. In one embodiment each of Ni, N2, .... N„-ι, Nn, and Nι#, N2#, ... N„-ι#, Nn# is chosen from C, G, or modifications thereof, wherein C base-pairs with G. In one embodiment each of Ni, N2, .... N„-ι, Nn, and Nj#, N2#, ... Nn-ι#, Nn# is chosen from T, A, or modifications thereof, and T base-pairs with A. In these and other embodiments each of C, G, A, and T can refer to deoxynucleotides with corresponding bases cytosine, guanine, adenine, and thymine. In one embodiment each of Nls N2, .... Nn-1, Nn, and Nι#, N2#, ... Nn-1#, Nn# is chosen from C, T, A, G, or modifications thereof, and C base-pairs with G, T base-pairs with G, A base-pairs with T, and A base-pairs with G. In one embodiment each of Nls N2, .... Nn-ι, Nn, and Ni#, N2#, ... Nn-1#, Nn# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs, i.e., each base pair Ni-Ni#, N2-N2#, ... Nn-Nn# is a Watson-Crick base pair. In one embodiment at least one of each of Nls N2, .... Nn-1, Nn, and Nι#, N2#, ... Nn-1#, Nn# is chosen from unmodified or modified nucleotides which form non- Watson-Crick base pairs, i.e., at least one base pair Ni-Ni#, N2-N2#, ... Nn-Nn# is a non- Watson-Crick base pair. In one embodiment the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with at least one phosphodiester bond. In one embodiment the immunostimulatory nucleic acid molecule includes a backbone with at least one stabilized internucleotide linkage. In one embodiment internucleotide linkages of the oligonucleotide are all phosphorothioate linkages. In one embodiment the immunostimulatory nucleic acid molecule includes a partially stabilized backbone with a phosphodiester bond joining at least one of YiRi or Y2R2. In one embodiment Yi is C. In one embodiment Ri is G. In one embodiment Yi is C and Ri is G. In one embodiment Xi or X2 is T. In one embodiment Xi is T, X2 is T, Y\ is C, R\ is G, and k is 1. In one embodiment Xi is T, X2 is T, Yi is C, Ri is G, k is 1, p is 1, N andN' and Z3 each contain zero nucleotides, and Z2 is TTTT or d(UUUU), where d(UUUU) represents (deoxyU)4. In one embodiment S2 is a non-nucleotidic linker. In one embodiment S2 contains at least one abasic dSpacer residue. In one embodiment the oligonucleotide includes at least one branched non-nucleoside linkage. In one embodiment the immunostimulatory nucleic acid molecule includes at least one doubler unit, at least one trebler unit, or at least one doubler unit and at least one trebler unit. In one embodiment Si is a doubler unit or a trebler unit. In one embodiment the oligonucleotide includes at least one 2 '5'-, 5 '5'-, 3 '3'-, 2 '2'-, or 2 '3'- intemucleoside linkage. In one embodiment the immunostimulatory nucleic acid molecule of Formula I is not an antisense nucleic acid. In one aspect the invention provides an immunostimulatory nucleic acid molecule of Formula III
(Z')m Z3 (S3) (Formula III)
wherein Z' is Z, [(Xi YiR.) N (X2Y2R2)k Z2]p (Sι)q N' (Nn)....(N3)(N2)(Nι) S2 (Nι#)(N2#)(N3#)...(Nn#); each of Zls Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally includes a non-nucleotidic linker or abasic dSpacer; each of Xt and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5- substituted uracil; each of Yi and Y is independently a cytosine or a modified cytosine; each of Ri and R2 is independently a guanine or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally includes a non- nucleotidic linker or abasic dSpacer; Si is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- intemucleoside linkages; S2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; S3 is a direct or indirect 2'5'-, 5 '5'-, 3 '3'-, 2'2'-, or 2'3'- intemucleoside linkage, or a non-nucleotidic linker, said non-nucleotidic linker including abasic linkers (dSpacers), triethylene glycol units, or hexaethylene glycol units facilitating a 2'5'-, 5'5'-, 3'3'~, 2'2'-, or 2'3'- linkage of m sequence parts; each of Ni, N2, .... Nn, and Nι#, N2#, ... Nn# is any nucleotide or modified nucleotide wherein Ni base-pairs with Nι#, N2 base-pairs with N2#, N3 base-pairs with N3#, ... and Nn base-pairs with Nπ#; k is an integer from 0 to 5; m is an integer from 2 to 10; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10. In certain embodiments Zi [(XiYiRj) N (X2Y R2)k Z2]p (Sι)q is a non-palindromic sequence. In certain embodiments ZL [ (X^R N (X2Y2R2)k Z2]p (Si)q is TCGTCGTTTT (SEQ ID NO:40), TCGTCGTTLL, TCGA, TCGAC, TCGACGTC, or TCGACGTCG, wherein L is dSpacer. In certain embodiments Zi [(XiYiRj) N (X2Y2R2)k Z2]p (Si)q is a palindromic sequence. In certain embodiments Zi 4Y1R1) N (X2Y2R2)k Z2]p (S q is TCGACGTCGA (SEQ ID NO:19) or TCGTCGACGA (SEQ ID NO:34). In certain embodiments Zi [(XjYiR N (X2Y2R2)k Z2]p (S q is TCGCGACGTT (SEQ ID NO:26) or TCGCGTCGTT (SEQ ID NO:69). In one embodiment (Nn)...(N2)(Ni) S2 (Ni#)(N2#)...(Nn#) Z3 includes a sequence AGCGAAGCT, CAATATTTATTG (SEQ ID NO:l), CCGTTTTGTGG (SEQ ID NO:2), CGGCGCCGTGCCG (SEQ ID NO: 19), CGGCGCCGTTGCCG (SEQ ID NO:34), CGGCGLLCGCCG (SEQ ID NO:5), CGGCGLLLTGCCG (SEQ ID NO:6), CGGCGGLLCCGCCG (SEQ ID NO:7), CGGCGTCGCCGCCG (SEQ ID NO:8), CGTCGACGGGACGGG (SEQ ID NO: 10), CGTCGACGTGACGGG (SEQ ID NO:l 1), GAGAGTTGGGCTCTC (SEQ ID NO: 12), GTCGAGGAGGT (SEQ ID NO: 14), TAATALLTATTA (SEQ ID NO: 15), TAATATCCATTA (SEQ ID NO: 16), or >
TAATATTTATTA (SEQ ID NO: 17), wherein L is dSpacer. In one embodiment (Nn)...(N2)(Ni) S2 (Ni#)(N2#)...(Nn#) includes a sequence GGCGCGCTGCCG (SEQ ID NO: 13). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence TCGACGTCGACCGTTTTGTGG (SEQ ID NO:20), TCGACGTCGACGGGACGGG (SEQ ID NO:21), TCGACGTCGACGTGACGGG (SEQ ID NO:22), TCGACGTCGAGAGTTGGGCTCTC (SEQ ID NO:23), TCGACGTCGAGCGAAGCT (SEQ ID NO:24), or TCGACGTCGAGGAGGT (SEQ ID NO:25). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence TCGTCGTTLLACGGCGCCGTGCCG (SEQ ID NO:37), TCGTCGTTLLACGGCGLLLTGCCG (SEQ ID NO:38), TCGTCGTTLLCGGCGCGGCGCCG (SEQ ID NO:39), TCGTCGTTTTACGGCGCCGTTGCCG (SEQ ID NO:44), TCGTCGTTTTACGGCGLLLTGCCG (SEQ ID NO:45), TCGTCGTTTTACGGCGTTTTGCCG (SEQ ID NO:49), TCGTCGTTTTCAATATTTATTG (SEQ ID NO:50), TCGTCGTTTTCGGCGLLCGCCG (SEQ ID NO:52), TCGTCGTTTTCGGCGGLLCCGCCG (SEQ ID NO:54), TCGTCGTTTTCGGCGTCGCCGCCG (SEQ ID NO:55), TCGTCGTTTTTAATALLTATTA (SEQ ID NO:57), TCGTCGTTTTTAATATCCATTA (SEQ ID NO:58), or TCGTCGTTTTTAATATTTATTA (SEQ ID NO:59), wherein L is dSpacer. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence TCGCGTCGTTCGGCGCGCTGCCG (SEQ ID NO:30). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence TCGCGACGTTCGGCGCGCTGCCG (SEQ ID NO:27). In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from
T*C*G*T* *G*TΦT*T*T*A*C_G*G*C_G*C*C_G*T*G* *C*G (SEQ ID NO:43),
Figure imgf000011_0001
τ*G*G*τ*c*G=f=T Φ T ΦχΦ'r*A!i:C*G!f!A*C:,:G !C!,!C*Gϊ|!T!i!G;,!C!(!C:lsG (SEQ ID NO:42), T*C*G*TΨC*G*C*TΦT*T*G*C*G*A*C*GΦG*G*G*T*G* *C>HG (SEQ ID N0:36),
T*C*G*T*C*G*C*C*C*G*G*C*G*A*C*G*C*C*G*T*G*C*C*G (SEQ iD NO:35), T*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*T*G*C*C*G (SEQ ID NO:44), T*C*G*T*C*G*T*T*L*L*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:37), T*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*L*L*L*T*G*C*C*G (SEQ ID NO:45), T*c*G*T*c*G*T*T*L*L*A* *G*G*c*G*L*L*L:1<T*G!i:C!,!C:,:G (SEQ ID NO:38), χ*C*G ,*C*G*T*T*T*T*C*G*G*C*G*G*L*L*C*C*G*C*C*G (SEQ ID NO:54), T*C*G*T*C*0*T*T*T*T*C*G*G*C*G*T*C*0*C*C*G*C*C*G (SEQ ID NO:55), T*C*G*T*C*G*T*T*L*L*C*G*G*C*G*C*G*G*C*G*C*C*G (SEQ ID NO:39), T* H=G*T*C*G Φ T*T*T*T!1=C: )=G*G Φ *G*L=I=L*C*G*C*C!1!G (SEQ ID NO:52), T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A (SEQ ID NO*59) pt=C*G*χ*c 3*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A (SEQ ID NO:59), T*C*G*T*C 3*T*T*T*T*C*A*A*T*A*T*T*T*A*T*T*G (sEQ ID NO:50), T*C*G*T*CJJ*T*T*T*T*T*A*A*T*A*T*C*C*A*T*T*A (SEQ ID NO:58), T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*L*L*T*A*T*T*A (SEQ I NO:57), T*C*GΦT*C_GH=T*T*T*TΦA*C*G*G*CΦG*LΦL*L*T*GΦCH=C*G (SEQ I NO:45),
T*C*G*T*C J*T*T*L*L*A*C*G*G*C*G*L*L*L*T*G*C*C*G (SEQ iD NO:38), and T*C*G*T*C_G*T*T*T*T*C*G*G*C*G*G*L*L*C*C*G*C*C*G (SEQ ID NO:54), wherein L is dSpacer, * is phosphorothioate, and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from
T*C*G*A*C*G*T*C*G_A_C*G*G*G*A*C*G*G*G (SEQ ID NO:21), T*C*G*A*C*G*T*C*G_A_C*G*T*G*A*C*G*G*G (SEQ ID NO:22), T*C*G*A*C*G*T*C*G*A*C*G*G*G*A*C*G*G*G (SEQ ID NO:21), T*C*G*A*C*G*T*C*G*A*G*G*A*G*G*T (SEQ ID NO:25), T*C*G*A*C*G*T*C*G*A*G*C*G*A*A*G*C*T (SEQ ID NO:24), T*C*G*AΦC*G*TΦC*GΦAΦC*C*G*TΦTΦT=I=T*G*T*GΦG (SEQ ID NO:20), and T*C*G*A*C*G*T*C*GΦAΨG*A*GΦTH=T*GΦG*G*C*T*C*T*C (SEQ iD NO:23), wherein * is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from
T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*G (SEQ ID NO:62), T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G (SEQ ID NO:61), T Φ C^G*T Φ C^G Φ A Φ C_G*T Φ T*G_G*G* Φ G H=C*C_G!1:T:,!G*C*C*G (SEQ ID NO:65), T*C*G*T*C 3*T*A*C J*G*C*G*C*C J*T*G*C*C*G (SEQ ID NO:66), T*C*G*T*CJ3*T*T*A*C *G*C*G*C*CJ3*T*G*C*C*G (SEQ D NO:67), τ*G*G*AΦGΦGH=τ*c*G*A*G*G*TΦG=ι=A*c>!=G*τ*τ (SEQ ID NO:63),
T*C*G*T*C 3*A*C J*A*T*C J*G*C*G*C*C J*T*G*C*C*G (SEQ ID NO:64), T*C*G*T*C*G*A*C*G*A T *G*G*C*G*C*C*G*T*G*C*C*G (SEQ iD NO:64), τ*c*G*A=f=c_G*τ*c=1=GΦA*C_G*τ*G*A=1=c=1=G*τ*τ (SEQ ID NO:63),
T*C*G*A*C 3*T*C*G*A*C*G*T_G*A*C*G*T*T (-SEQ ID NO:63), and T*C*G*T*C_G*T*T*T*A*C_G*G* *G*C*C_G*T*G*CΦC*G*T (SEQ ID NO:68), wherein * is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from T*C*G*C J*T*C*G*T*T*CJ3*G*C*G*C J*C*T*G*C*C*G (SEQ ID NO:30), T*C*G *G*T*C*G*T*T*CJ3*G*C*G*C j*C*T*G*C*C*G (SEQ ID NO:30), and T*C*G*C*G T*C*G*T*T*CJJ*G*C*G*C J*C*T*G*C*C*G (SEQ iD NO:30), wherein * is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence T*C*G*C 3*A*C*G*T*T*C J*G*C*G*C J*C*T*G*C*C*G (SEQ ID NO:27), wherein
* is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence chosen from τ*C_G*T*C!f:G;|!T!!:T*T*T !A*C:i:G!l:G*C:i:G!,!T:i:C!l:G*T!i!G*C!,!CJl!G (SEQ ID
NO:48), τ*C 3*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G*C*C*G (SEQ ID
NO:47), and T*CJj*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G (SEQ ID NO:46), wherein * is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence T*C^G*T*C*G*T*TΦT*T*A* ΦG*GΦC*G*T* *G*T*G* * *G (SEQ ID NO:48), wherein * is phosphorothioate and _ is phosphodiester. In one embodiment the immunostimulatory nucleic acid molecule includes a sequence T*C J*G*C*G*C*CJJ*T*G*C*C*G*T*C*G*T*CJ3*T*T*T (SEQ ID NO:33), wherein
* is phosphorothioate and _ is phosphodiester. In one embodiment at least one nucleotide in the oligonucleotide is a substituted or modified purine or pyrimidine. In one embodiment the substituted pyrimidine is a C5- or Cό-substituted pyrimidine. In one embodiment the substituted purine is a C8- or C7-substituted purine. In one embodiment the substituted or modified purine or pyrimidine is selected from the group consisting of 5-substituted cytosines, 6-substituted cytosines, N4-substituted cytosines, 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems, and uracil derivatives, thymine derivatives, 7-deazaguanine, 7-deaza-7-substituted guanine, 7-deaza-8-substituted guanine, 7-deaza-8-aza guanine, hypoxanthine, N2-substituted guanines, 5-amino-3-methyl-3H,6H-thiazolo[4,5- d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, substituted adenines, 8-substituted guanine, and 6-thioguanine. In one embodiment the substituted or modified purine or pyrimidine is selected from the group consisting of 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo- cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 6-hydroxy-cytosine, 5-hydroxymethyl- cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine, N4- ethyl-cytosine, N,N'-propylene cytosine, phenoxazine, 5-fluoro-uracil, 5-bromo-uracil, 5- bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil, 2-thiothymine, 4- thiothymine, 6-substituted thymines, 7-deaza-7-(C2-C6)alkynylguanine, N2-methyl-guanine, N6-methyl-adenine, 8-oxo-adenine, 8-hydroxyguanine, and 8-bromoguanine. In one embodiment the substituted or modified purine or pyrimidine is selected from the group consisting of a universal base, an aromatic ring system, an aromatic ring system, and a hydrogen atom (dSpacer). In one embodiment the substituted or modified purine or pyrimidine is selected from the group consisting of 4-methyl-indole, 5-nitro-indole, 3-nitropyrrole, P-base, and K-base, benzimidazole, dichloro-benzimidazole, l-methyl-lH-[l,2,4]triazole-3 -carboxylic acid amide, fluorobenzene, and difluorobenzene. In one embodiment any of N, S, X, or Z is substituted by a residue selected from the group consisting of C6-C30 alkyl chain, bile acids, cholic acid, taurocholic acid, deoxycholate, cholesterol, oleyl litocholic acid, oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids, isoprenoids, steroids, vitamins, vitamin E, saturated fatty acids, unsaturated fatty acids, fatty acid esters, triglycerides, pyrenes, porphyrins, Texaphyrine, adamantane, acridines, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl, t-butyldiphenylsilyl, cyanine dyes, cyanine dye Cy3, cyanine dye Cy576, Hoechst 33258 dye, psoralen, and ibuprofen. In one aspect the invention provides an immunostimulatory nucleic acid molecule including (a) a 5' end beginning with an immunostimulatory motif chosen from (TCG)nN and RDCGYi Y2N, wherein T is thymine, C is unmethylated cytosine, G is guanine, R is a purine, D is not C, each of Yi and Y2 independently is a pyrimidine, n is an integer between 1 and 4, inclusive, and N is any sequence 0-12 bases long; (b) a 3' end terminating in an inverted repeat capable of forming a hairpin or stem-loop structure, said structure including a GC-rich stem 2 to 6 consecutive base pairs long and at least one unmatched or mismatched base; and (c) a partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage. Either or both of C and G in the CpG dinucleotide may be modified. In one embodiment the GC-rich stem is 2 consecutive base pairs long. In one embodiment the GC-rich stem is 3 consecutive base pairs long. In one embodiment the GC-rich stem is 4 consecutive base pairs long. In one embodiment the GC-rich stem is 5 consecutive base pairs long. In one embodiment the GC-rich stem is 6 consecutive base pairs long. In one embodiment the GC-rich stem includes at least 2 G-C base pairs. In one embodiment the GC-rich stem includes at least 3 G-C base pairs. In certain embodiments the at least one unmatched or mismatched base is T. In one embodiment the partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage further includes a plurality of phosphorothioate internucleotide linkages. In one embodiment the 5' end has a sequence provided as TCGTCGTTTTA (SEQ ID NO:41). In one embodiment the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGCCGTGCCG (SEQ ID NO: 19). In one embodiment the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGTCGTGCCG (SEQ ID NO:9). In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:43). In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48). In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as χ:i:C_G*T*C*G!i!T!,iT*T*T*A!,!C*G!,:G*C*G:,!C*C*G!,:T:1:G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage. In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as τ*C5,!Gϊ|!T*C:l!G*T*T*T*T*A*C_G*G*C_G>1:C!,!C_G*T!,:G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage. In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as τ*c*G!l:T*C!,!G*T*T*T*T:);A:iiC_G*G*C!,:G*C!,;C_G!,:T*G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage. In one aspect the invention provides an immunostimulatory nucleic acid having a base sequence provided as T:1:C!,:G*T*C_G*T*Tsi!T!i:T*A*C_G!i!G*C*G*C:l!C_G*T*G:i:C:):C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage. In one aspect the invention provides a vaccine including an immunostimulatory nucleic acid molecule of the invention and an antigen. In one aspect the invention provides a pharmaceutical composition including an immunostimulatory nucleic acid molecule of the invention and a pharmaceutically acceptable carrier. In one aspect the invention provides a method for inducing type I interferon (IFN) expression. The method according to this aspect of the invention involves contacting a cell capable of expressing type I IFN with an immunostimulatory nucleic acid of the invention, in an effective amount to induce expression of type I IFN. In one embodiment the type I IFN is an interferon alpha (IFN-α). In one embodiment the type I IFN is an interferon beta (IFN-β). In one aspect the invention provides a method for inducing gamma interferon (IFN-γ) expression. The method according to this aspect of the invention involves contacting a cell capable of expressing IFN-γ with an immunostimulatory nucleic acid of the invention, in an effective amount to induce expression of IFN-γ. In one aspect the invention provides a method for activating a natural killer (NK) cell. The method according to this aspect of the invention involves contacting an NK cell with an immunostimulatory nucleic acid of the invention, in an effective amount to activate the NK cell. In one aspect the invention provides a method for treating an infection. The method according to this aspect of the invention involves administering to a subject having or at risk of developing an infection an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the infection. In one embodiment the subject has or is at risk of developing an infection chosen from a viral, bacterial, fungal or parasitic infection. In one embodiment the subject has or is at risk of developing a viral infection with a virus chosen from hepatitis B virus (HBV), hepatitis C vims (HCV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), papillomavims, human immunodeficiency vims (HIV), or herpes simplex vims (HSV). In one embodiment the subject has or is at risk of developing a bacterial infection with a species of bacterium chosen from Leishmania, Listeria, ox Anthrax. In one aspect the invention provides a method for treating an allergic condition. The method according to this aspect of the invention involves administering to a subject having or at risk of developing an allergic condition an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the allergic condition. In one embodiment the allergic condition is allergic asthma. In one aspect the invention provides a method for treating cancer. The method according to this aspect of the invention involves administering to a subject having or at risk of developing a cancer an immunostimulatory nucleic acid of the invention, in an effective amount to treat or prevent the cancer. In one embodiment the cancer is chosen from basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system cancer, breast cancer, cervical cancer, choriocarcinoma, colon and rectum cancer, connective tissue cancer, cancer of the digestive system, endometrial cancer, esophageal cancer, eye cancer, cancer of the head and neck, gastric cancer, intra-epithelial neoplasm, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, lymphoma including Hodgkin's and non-Hodgkin's lymphoma, melanoma, myeloma, neuroblastoma, oral cavity cancer, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, renal cancer, cancer of the respiratory system, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, cancer of the urinary system, or other carcinomas and sarcomas. In one embodiment the cancer is a cancer sensitive to treatment with interferon alpha (IFN-α). In one embodiment the cancer sensitive to treatment with IFN-α is chosen from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, AIDS-related Kaposi's sarcoma, renal cell carcinoma, prostate carcinoma, cervical dysplasia, or colon carcinoma. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of an infection. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of an allergic condition. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of allergic asthma. In one aspect the invention provides use of an immunostimulatory nucleic acid of the invention for manufacture of a medicament for use in treatment of a cancer. Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS The present invention may be more easily and completely understood when taken in conjunction with the accompanying figures. The figures are provided for illustrative purposes only and are not required for understanding or practicing the invention. FIG. 1 is a series of graphs depicting induction of IFN-α and TLR9 signaling by ODN 332, 333, and 334. FIG.2 is a series of graphs depicting induction of IFN-α and TLR9 signaling by ODN 611, 614, and 620. FIG. 3 is a graph depicting IFN-α production in peripheral blood mononuclear cells (PBMC) stimulated by a panel of oligonucleotides. FIG. 4 is a graph depicting group mean titers (GMT) of antigen-specific total IgG following immunization with 1 μg hepatitis B surface antigen (HBsAg) with the indicated amount of ODN. FIG. 5 is a a graph depicting GMT of antigen-specific individual IgG isotypes following immunization with 1 μg HBsAg with the indicated amount of ODN. FIG. 6 is a graph depicting antigen-specific cytolytic T lymphocyte responses following immunization with 1 μg HBsAg with the indicated amount of ODN. FIG. 7A is a graph depicting survival according to different ODN treatments in a murine neuroblastoma tumor model. FIG. 7B is a graph depicting tumor volume according to different ODN treatments in a murine neuroblastoma tumor model. TABLE OF SELECTED SEQUENCES
Figure imgf000019_0001
Figure imgf000020_0001
DETAILED DESCRIPTION OF THE INVENTION The invention in one aspect involves the finding that specific sub-classes of CpG immunostimulatory oligonucleotides having defined secondary structure are highly effective in mediating immune stimulatory effects. These CpG nucleic acids are useful therapeutically and prophylactically for stimulating the immune system to treat cancer, infectious diseases, allergy, asthma and other disorders and to help protect against opportunistic infections following cancer chemotherapy. The strong yet balanced cellular and humoral immune responses that result from CpG stimulation reflect the body's own natural defense system against invading pathogens and cancerous cells. The sequences of the invention share some stmctural similarities with a class of CpG oligonucleotides referred to as C-class or combination motif CpG oligonucleotides. See published PCT international patent application WO 03/015711. Similar to the previously described C-class oligonucleotides, the C-class CpG oligonucleotides of the instant invention have defined 5' and 3' motifs as parts of the molecule. These previously described C-class oligonucleotides have both a traditional "stimulatory" CpG sequence, generally positioned at or near the 5' end or 3' end of the molecule, and a "GC-rich palindrome" motif, generally positioned at or near the other end of the molecule. These combination motif nucleic acids have immune stimulating effects that fall somewhere between those effects associated with traditional "B-class" CpG ODN, which are strong inducers of B cell activation and dendritic cell activation, and those effects associated with a more recently described class of immune stimulatory nucleic acids ("A-class" CpG ODN) which are strong inducers of IFN-α andNK cell activation but relatively poor inducers of B-cell and DC activation. The new C-class CpG oligonucleotides of the instant invention are also structurally distinct from the previously described C-class CpG oligonucleotides. In comparison to the previously described C-class CpG oligonucleotides, the immunostimulatory nucleic acid molecules of the instant invention feature greatly relaxed requirements with respect to the GC-rich palindrome at one end of the molecule. For example, the previously described C- class oligonucleotides include in one embodiment a strict or perfect palindrome at least 10 nucleotides in length and having a GC content of at least 2/3. In some embodiments the palindrome of the previously described C-class oligonucleotides can include at most a minimal number of consecutive mismatched nucleotides. In contrast to the previously described C-class oligonucleotides, the C-class oligonucleotide analogs of the instant invention feature palindromic motifs that can have, in various embodiments, fewer than 10 nucleotides; a GC content between zero and less than 2/3; various nucleotide analogs and substitutes including those lacking any nucleobase (dSpacer); extended intervening sequence involving four or more consecutive nucleotides or nucleotide substitutes that do not form Watson-Crick base pairs; and any combination thereof. Furthermore, in some embodiments 3' parts of two or more molecules can be linked together via their 3' ends. It has been discovered that this new sub-class of oligonucleotides which do not have a perfect palindrome are still capable, like the previously described combination motif CpG oligonucleotides, of inducing high levels of IFN production, including type I IFN (e.g., IFN-α, IFN-β) and IFN-γ. A "palindrome" and, equivalently, "palindromic sequence" as used herein refers to a nucleic acid sequence which is its own perfect reverse complement (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A', B and B', C and , D and D', and E and E' are bases capable of forming the usual Watson-Crick base pairs, i.e., G-C, A-T, and A-U. As used herein, a "palindrome" in a strict sense excludes intervening sequence or intervening non- nucleotide structure that does not participate in forming the usual Watson-Crick base pairs. An "inverted repeat" as used herein refers to an imperfect palindrome, i.e., a nucleic acid sequence in which are present both nucleotides capable of forming the usual Watson- Crick base pairs and nucleotides, nucleotide analogs, or other structures that do not participate in forming the usual Watson-Crick base pairs (e.g., a sequence such as ABCDE-S- E'D'C'B'A' in which A and A', B and B', C and C, D and D', and E and E' are bases capable of forming the usual Watson-Crick base pairs, and S is a non-palindromic sequence or a non- nucleotidic linker or an abasic linker (dSpacer)). In certain embodiments the nucleotides, nucleotide analogs, or other structures that do not participate in forming the usual Watson- Crick base pairs interrupt an otherwise perfect palindrome. In certain embodiments the nucleotides that do not participate in forming the usual Watson-Crick base pairs can form non- Watson-Crick base pairs with another nucleotide, e.g., G-T. A non- Watson-Crick base pair as used herein is any base pair other than a Watson-Crick base pair, including but not limited to a Hoogsteen base pair and a so-called wobble base pair. In certain embodiments the nucleotides that do not participate in forming the usual Watson-Crick base pairs are unmatched and have no nucleotide base or nucleotide base analog with which to form a Watson-Crick or non- Watson-Crick base pair, e.g., G opposite to dSpacer. In certain embodiments the nucleotides that do not participate in forming base pairs can form non- standard base pairs with another nucleotide, e.g., diaminopyridine can form a base pair with xanthosine. In one embodiment the 5' end of the nucleic acid begins with an immunostimulatory motif chosen from (TCG)nN and RDCGYιY2N. T is thymine, C is unmethylated cytosine, G is guanine, R is a purine, D is not C, each of Yi and Y2 independently is a pyrimidine, n is an integer between 1 and 4, inclusive, and N is any sequence 0-12 bases long. The 3' end of the nucleic acid terminates in an inverted repeat capable of forming a hairpin or stem-loop stmcture. The tem "terminates" refers to a stmcture at or near the 3' end. Thus, the end of the imperfect palindrome may be positioned at the actual 3' end of the molecule or alternatively the 3' end may include 1 or more additional nucleotides that are not part of the inverted repeat stmcture. Preferably the 3' end of the molecule includes 3 or fewer nucleotides that do not form part of the inverted repeat stmcture. In one embodiment an "inverted repeat capable of forming a hairpin or stem-loop stmcture" as used herein refers to a sequence of nucleotides that forms a GC-rich stem or hairpin that is 2 to 10 consecutive base pairs long, and includes at least one unmatched or mismatched base. In individual embodiments the GC-rich stem is 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive base pairs long. In some embodiments the GC-rich stem includes at least 2, 3, or 4 G-C base pairs. In one embodiment an "inverted repeat capable of forming a hairpin or stem-loop stmcture" as used hererin refers to a sequence of nucleotides that forms an AT-rich stem or hairpin that is 2 to 10 consecutive base pairs long, and includes at least one unmatched or mismatched base. In individual embodiments the AT-rich stem is 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive base pairs long. In some embodiments the AT-rich stem includes at least 2, 3, or 4 A-T base pairs. In some instances the at least one unmatched or mismatched base bridges the ends of the stem or hairpin. This may allow the formation of the secondary structure by providing a flexible point in the molecule for the stems to base pair and form a hairpin. Alternatively the unmatched or mismatched base(s) may be within the stem. Preferably if the mismatched base is within the stem, then the stem is at least 3 base pairs long. The unmatched or mismatched bases(s) may be any nucleotide. In some embodiments the unmatched or mismatched base is a T. Unmatched nucleotides at the end of double-strands are also known as overhanging nucleotides or dangling ends which can significantly stabilize duplex formation or hairpin formation. Freier SM et al. (1983) Effects of 3' dangling end stacking on the stability of GGCC and CCGG double helixes. Biochemistry 22:6198-206. The nucleic acid also includes a partially stabilized backbone including at least one phosphodiester 5'-CpG-3' linkage. In some instances the double-stranded part of the molecule may also contain unnatural (non-standard) base pairs (e.g., diaminopyridine paired with xanthosine). Lutz MJ et al. (1998) Recognition of a non-standard base pair by thermostable DNA polymerases. Bioorg Med Chem Lett 8:1149-52. The formulas define subsets of the class of CpG oligonucleotides which demonstrated excellent immune stimulating properties. In the formulas 5' refers to the free 5' end of the oligonucleotide and 3' refers to the free 3' end of the oligonucleotide. The oligonucleotides may have one or more accessible 5' or 3' ends. In some embodiments a 3' end can be linked to another 3' end. Since the importance of the 5' and 3' motifs has been discovered and described herein, it is also possible to create modified oligonucleotides having two such 5 ' or 3' ends. This may be achieved, for example, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having two accessible 5' ends. The 3 '3'- or 5 '5 '-linkage may be a phosphodiester, phosphorothioate, or any other modified intemucleoside bridge. Methods for accomplishing such linkages are known in the art. For instance, such linkages have been described in Seliger H et al. (1991) Oligonucleotide analogs with terminal 3 '-3'- and 5'-5'-internucleotidic linkages as antisense inhibitors of viral gene expression, Nucleosides & Nucleotides 10:469-77 and Jiang Z et al. (1999) Pseudo-cyclic oligonucleotides: in vitro and in vivo properties, Bioorg Med Chem 7:2727-35. Additionally, 3 '-3 '-linked or 5 '-5 '-linked ODNs where the linkage between the 3'- or 5 '-terminal nucleosides is not a phosphodiester, phosphorothioate or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethyleneglycol phosphate moiety (Durand M et al. (1992) Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains, Biochemistry 31 :9197-204; U.S. Pat. No. 5,658,738; and U.S. Pat. No. 5,668,265). Alternatively, the non- nucleotidic linker may be derived from ethanediol, propanediol, or from an abasic deoxyribose (dSpacer) unit (Fontanel ML et al. (1994) Sterical recognition by T4 polynucleotide kinase of non-nucleosidic moieties 5 '-attached to oligonucleotides, Nucleic Acids Res 22:2022-7) using standard phosphoramidite chemistry. The non-nucleotidic linkers can be incorporated once or multiple times, or combined with each other allowing for any desirable distance between the 3' ends of the two ODNs to be linked. A "non-nucleotidic linker" as used herein refers to any linker element that is not a nucleotide or polymer thereof (i.e., a polynucleotide), wherein a nucleotide includes a purine or pyrimidine nucleobase and a sugar phosphate. A non-nucleotidic linker thus includes an abasic nucleotide (dSpacer), i.e., a nucleotide-like sugar phosphate unit in which the nucleobase is replaced by a hydrogen atom. A non-nucleotidic linker can be a polyethyleneglycol, including but not limited to a triethyleneglcol and a hexaethyleneglycol. In some embodiments the oligonucleotide has one of the following stmctures: TCGTCGTTTTA (SEQ ID NO:41), CGGCGCCGTGCCG (SEQ ID NO: 19), CGGCGTCGTGCCG (SEQ ID NO:9), TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:43), TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48), χ*C_G*X*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:43), τ*c*G*χ*c*G*χ*χ*χ*χ*A*c_G*G*c_G*c*c_G*χ*G*c*c*G (SEQ ID NO:43), χ*C*G*T*C*G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43), and χ*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43). The symbol * refers to the presence of a stabilized internucleotide linkage and _ refers to the presence of a phosphodiester linkage. The immunostimulatory oligonucleotides generally have a length in the range of between 6 and 100 nucleotides. In some embodiments the length is in the range of 6-40, 13- 100, 13-40, 13-30, 15-50, or 15-30 nucleotides or any integer range therebetween. The terms "nucleic acid" and "oligonucleotide" are used interchangeably to mean multiple nucleotides (i.e., molecules including a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). As used herein, the terms "nucleic acid" and "oligonucleotide" refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms "nucleic acid" and "oligonucleotide" shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by nucleic acid synthesis). The terms "nucleic acid" and "oligonucleotide" as used herein shall encompass nucleic acid molecules and oligonucleotides of the invention, as well as oligonucleotide analogs of the invention. The terms "oligodeoxynucleotide" and, equivalaently, "ODN" as used herein shall encompass unmodified oligodeoxynucleotides of the invention as well as oligodeoxynucleotide analogs of the invention. The terms "nucleic acid" and "oligonucleotide" also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars. For example, they include nucleic acids having backbone sugars that are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 2' position and other than a phosphate group or hydroxy group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose or 2'-fluoroarabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have a peptide-like backbone with nucleic acid bases). Other examples are described in more detail below. The immunostimulatory oligonucleotides of the instant invention can encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester intemucleoside bridge, a β-D-ribose unit and/or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil). Examples of chemical modifications are known to the skilled person and are described, for example, in Uhlmann E et al. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; Crooke ST et al. (1996) Annu Rev Pharmacol Toxicol 36:107-29; and Hunziker J et al. (1995) Mod Synth Methods 7:331-417. An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester intemucleoside bridge and/or at a particular β-D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide of the same sequence which is composed of natural DNA or RNA. For example, the oligonucleotides may include one or more modifications and wherein each modification is independently selected from: a) the replacement of a phosphodiester intemucleoside bridge located at the 3' and/or the 5' end of a nucleoside by a modified intemucleoside bridge, b) the replacement of phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge, c) the replacement of a sugar phosphate unit from the sugar phosphate backbone by another unit, d) the replacement of a β-D-ribose unit by a modified sugar unit, and e) the replacement of a natural nucleoside base by a modified nucleoside base. More detailed examples for the chemical modification of an oligonucleotide are as follows. The oligonucleotides may include modified internucleotide linkages, such as those described in a or b above. These modified linkages may be partially resistant to degradation (e.g., are stabilized). A "stabilized oligonucleotide molecule" shall mean an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endo-nuclease) resulting form such modifications. Oligonucleotides having phosphorothioate linkages, in some embodiments, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. A phosphodiester intemucleoside bridge located at the 3' and/or the 5' end of a nucleoside can be replaced by a modified intemucleoside bridge, wherein the modified intemucleoside bridge is for example selected from phosphorothioate, phosphorodithioate, NR R -phosphoramidate, boranophosphate, α-hydroxybenzyl phosphonate, phosphate-(Ci- C21)-0-alkyl ester, phosphate-[(C6-C12)aryl-(C1-C21)-O-alkyl]ester, (Ci-C8)alkylphosphonate and/or (C6-C12)arylphosphonate bridges, (C -C12)-α-hydroxymethyl-aryl (e.g., disclosed in WO 95/01363), wherein (C6-C12)aryl, (C6-C20)aryl and (C6-C14)aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and where R1 and R2 are, independently of each other, hydrogen, (Ci-C18)-alkyl, (C6-C20)-aryl, (C6-C14)-aryl-(Ci-C8)-alkyl, preferably hydrogen, (Ci-Cs)-alkyl, preferably (Ci-C )-alkyl and/or methoxyethyl, or R1 and R2 form, together with the nitrogen atom carrying them, a 5-6-membered heterocyclic ring which can additionally contain a further heteroatom from the group O, S and N. The replacement of a phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge (dephospho bridges are described, for example, in Uhlmann E and Peyman A in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is for example selected from the dephospho bridges formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and/or silyl groups. A sugar phosphate unit (i.e., a β-D-ribose and phosphodiester intemucleoside bridge together forming a sugar phosphate unit) from the sugar phosphate backbone (i.e., a sugar phosphate backbone is composed of sugar phosphate units) can be replaced by another unit, wherein the other unit is for example suitable to build up a "morpholino-derivative" oligomer (as described, for example, in Stirchak EP et al. (1989) Nucleic Acids Res 17:6129-41), that is, e.g., the replacement by a morpholino-derivative unit; or to build up a polyamide nucleic acid ("PNA"; as described for example, in Nielsen PE et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., the replacement by a PNA backbone unit, e.g., by 2-aminoethylglycine. The oligonucleotide may have other carbohydrate backbone modifications and replacements, such as peptide nucleic acids with phosphate groups (PHONA), locked nucleic acids (LNA), and oligonucleotides having backbone sections with alkyl linkers or amino linkers. The alkyl linker may be branched or unbranched, substituted or unsubstituted, and chirally pure or a racemic mixture. A β-ribose unit or a β-D-2'-deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is for example selected from β-D-ribose, α-D-2'- deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabinose, 2'-O-(C1-C6)alkyl-ribose, preferably 2'-O-(Ci-C6)alkyl-ribose is 2'-O-methylribose, 2'-O-(C2-C6)alkenyl-ribose, 2'-[O- (Ci-C6)alkyl-O-(Ci-C6)alkyl]-ribose, 2'-NH2-2'-deoxyribose, β-D-xylo-furanose, α-arabinofuranose, 2,4-dideoxy-β-D-erythro-hexo-pyranose, and carbocyclic (described, for example, in Froehler (1992) J Am Chem Soc 114:8320) and/or open-chain sugar analogs (described, for example, in Vandendriessche et al. (1993) Tetrahedron 49:7223) and/or bicyclosugar analogs (described, for example, in Tarkov M et al. (1993) Helv Chim Acta 76:481). In some embodiments the sugar is 2'-O-methylribose, particularly for one or both nucleotides linked by a phosphodiester or phosphodiester-like intemucleoside linkage. Nucleic acids also include substituted purines and pyrimidines such as C-5 propyne pyrimidine and 7-deaza-7-substituted purine modified bases. Wagner RW et al. (1996) Nat Biotechnol 14:840-4. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, and uracil, and other naturally and non-naturally occurcing nucleobases, substituted and unsubstituted aromatic moieties. A modified base is any base which is chemically distinct from the naturally occuning bases typically found in DΝA and RΝA such as T, C, G, A, and U, but which share basic chemical stmctures with these naturally occurring bases. The modified nucleoside base may be, for example, selected from hypoxanthine, uracil, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(Ci-C6)-alkyluracil, 5-(C2-C6)-alkenyluracil, 5-(C2-C6)- alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Ci-C6)-alkylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)- alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, Ν2-dimethylguanine, 2,4-diamino-purine, 8-azapurine, a substituted 7-deazapurine, preferably 7-deaza-7-substituted and/or 7-deaza-8-substituted purine, 5-hydroxymethylcytosine, N4- alkylcytosine, e.g., N4-ethylcytosine, 5-hydroxydeoxycytidine, 5- hydroxymethyldeoxycytidine, N4-alkyldeoxycytidine, e.g., N4-ethyldeoxycytidine, 6- thiodeoxyguanosine, and deoxyribonucleosides of nitropynole, C5-propynylpyrimidine, and diaminopurine e.g., 2,6-diaminopurine, inosine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, hypoxanthine or other modifications of a natural nucleoside bases. This list is meant to be exemplary and is not to be interpreted to be limiting. In particular formulas described herein modified bases may be incorporated. For instance a cytosine may be replaced with a modified cytosine. A modified cytosine as used herein is a naturally occuning or non-naturally occurring pyrimidine base analog of cytosine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified cytosines include but are not limited to 5-substituted cytosines (e.g., 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo- cytosine, 5 -hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines (e.g., 6-hydroxy- cytosine), N4-substituted cytosines (e.g., N4-ethyl-cytosine), 5-aza-cytosine, 2-mercapto- cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g., N,N'-propylene cytosine or phenoxazine), and uracil and its derivatives (e.g., 5-fluoro- uracil, 5-bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl- uracil). Some of the prefened cytosines include 5-methyl-cytosine, 5-fluoro-cytosine, 5- hydroxy-cytosine, 5-hydroxymethyl-cytosine, and N4-ethyl-cytosine. In another embodiment of the invention, the cytosine base is substituted by a universal base (e.g., 3-nitropyrrole, P- base), an aromatic ring system (e.g., fluorobenzene or difluorobenzene) or a hydrogen atom (dSpacer). A guanine may be replaced with a modified guanine base. A modified guanine as used herein is a naturally occuning or non-naturally occuning purine base analog of guanine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified guanines include but are not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, N2-substituted guanines (e.g., N2-methyl- guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenines (e.g., N6-methyl-adenine, 8-oxo- adenine), 8-substituted guanine (e.g., 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. In another embodiment of the invention, the guanine base is substituted by a universal base (e.g., 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g., benzimidazole or dichloro- benzimidazole, 1 -methyl- lH-[l,2,4]triazole-3 -carboxylic acid amide) or a hydrogen atom (dSpacer). In one embodiment both the C and the G of a CG dinucleotide are unmodified cytosine and guanine bases, respectively. In one embodiment the C of a CG dinucleotide is unmethylated. For use in the instant invention, the oligonucleotides of the invention can be synthesized de novo using any of a number of procedures well known in the art, for example, the β-cyanoethyl phosphoramidite method (Beaucage SL et al. (1981) Tetrahedron Lett 22:1859); or the nucleoside H-phosphonate method (Garegg et al. (1986) Tetrahedron Lett 27:4051 -4; Froehler BC et al. (1986) Nucleic Acids Res 14:5399-407; Garegg et al. (1986) Tetrahedron Lett 27:4055-8; Gaffney et al. (1988) Tetrahedron Lett 29:2619-22). These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These oligonucleotides are referred to as synthetic oligonucleotides. An isolated oligonucleotide generally refers to an oligonucleotide which is separated from components which it is normally associated with in nature. As an example, an isolated oligonucleotide may be one which is separated from a cell, from a nucleus, from mitochondria or from chromatin. Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (e.g., Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1:165). The immunostimulatory oligonucleotides may also contain one or more unusual linkages between the nucleotide or nucleotide-analog moieties. The usual intemucleoside linkage is the 3 '5 '-linkage. All other linkages are considered as unusual intemucleoside linkages, such as 2'5'-, 5 '5'-, 3 '3'-, 2'2'-, and 2 '3 '-linkages. Thereby, the nomenclature 2' to 5' is chosen according to the carbon atom of ribose. However, if unnatural sugar moieties are employed, such as ring-expanded sugar analogs (e.g., hexanose, cylohexene, or pyranose) or bi- or tri cyclic sugar analogs, then this nomenclature changes according to the nomenclature of the monomer. In 3'-deoxy-β-D-ribopyranose analogs (also called p-UNA), the mononucleotides are e.g. connected via a 4'2'-linkage. If the nucleotide contains one 3 '3 '-linkage, then this oligonucleotide analog will usually have two unlinked 5 '-ends. Similarly, if the nucleotide contains one 5 '5 '-linkage, then this oligonucleotide analog will usually have two unlinked 3 '-ends. The accessibility of unlinked ends of nucleotides may be better accessible by their receptors. Both types of unusual linkages (3 '3'- and 5'5'-) were described by Ortigao JF et al. (1992) Antisense Res Dev 2:129-46, whereby oligonucleotides having a 3 '3 '-linkage were reported to show enhanced stability towards cleavage by nucleases. Different types of linkages can also be combined in one molecule which may lead to branching of the oligomer. If one part of the oligonucleotide is connected at the 3 '-end via a 3 '3 '-linkage to a second oligonucleotide part and at the 2'-end via a 2'3 '-linkage to a third part of the molecule, this results e.g. in a branched oligonucleotide with three 5 '-ends (3 '3'-, 2'3'- branched). In principle, linkages between different parts of an oligonucleotide or between different oligonucleotides, respectively, can occur via all parts of the molecule, as long as this does not negatively interfere with the recognition by its receptor. According to the nature of the nucleic acid, the linkage can involve the sugar moiety (Su), the heterocyclic nucleobase (Ba) or the phosphate backbone (Ph). Thus, linkages of the type Su-Su, Su-Ph, Su-Ba, Ba-Ba, Ba-Su, Ba-Ph, Ph-Ph, Ph-Su, and Ph-Ba are possible. If the oligonucleotides are further modified by certain non-nucleotidic substituents, the linkage can also occur via the modified parts of the oligonucleotides. These modifications include also modified nucleic acids, e.g., PNA, LNA, or morpholino oligonucleotide analogs. The linkages are preferably composed of C, H, N, O, S, B, P, and halogen, containing 3 to 300 atoms. An example with 3 atoms is an acetal linkage (ODNl-3'-O-CH2-O-3'- ODN2; Froehler and Matteucci) connecting e.g. the 3 '-hydroxy group of one nucleotide to the 3 '-hydroxy group of a second oligonucleotide. An example with about 300 atoms is PEG-40 (tetraconta polyethyleneglycol). Prefened linkages are phosphodiester, phosphorothioate, methylphosphonate, phosphoramidate, boranophosphonate, amide, ether, thioether, acetal , thioacetal, urea, tliiourea, sulfonamide, Schiff base, and disulfide linkages. Another possibility is the use of the Solulink BioConjugation System (TriLink BioTechnologies, San Diego, CA). If the oligonucleotide is composed of two or more sequence parts, these parts can be identical or different. Thus, in an oligonucleotide with a 3 '3 '-linkage, the sequences can be identical, e.g., 5'-ODNl-3'3'-ODNl-5', or different, e.g., 5'-ODNl-3'3'-ODN2-5'. Furthermore, the chemical modification of the various oligonucleotide parts as well as the linker connecting them may be different. Since the uptake of short oligonucleotides appears to be less efficient than that of long oligonucleotides, linking of two or more short sequences results in improved immune stimulation. The length of the short oligonucleotides is preferably 2-20 nucleotides, more preferably 3-16 nucleotides, but most preferably 5-10 nucleotides. Prefereed are linked oligonucleotides which have two or more unlinked 5 '-ends. The oligonucleotide partial sequences may also be linked by non-nucleotidic linkers, in particular abasic linkers (dSpacers), triethylene glycol units or hexaethylene glycol units. Other linkers include alkylamino linkers, such as C3, C6, C12 amino linkers, and also alkylthiol linkers, such as C3 or C6 thiol linkers. The oligonucleotides can also be linked by aromatic residues which may be further substituted by alkyl or substituted alkyl groups. The oligonucleotides may also contain a doubler or trebler unit (Glen Research, Sterling, VA), in particular those oligonucleotides with a 3 '3 '-linkage. A doubler unit in one embodiment can be based on l,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. A trebler unit in one embodiment can be based on incorporation of Tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. Branching of the oligonucleotides by multiple doubler, trebler, or other multiplier units leads to dendrimers which are a further embodiment of this invention. The oligonucleotides may also contain linker units resulting from peptide-modifying reagents or oligonucleotide-modifying reagents (Glen Research, Sterling, VA). Furthermore, linkers may contain one or more natural or unnatural amino acid residues which are connected by peptide (amide) linkages. Another possibility for linking oligonucleotides is via crosslinking of the heterocyclic bases (Verma S et al (1998) Annu Rev Biochem 67:99-134; page 124). Yet another possibility is a linkage between the sugar moiety of one sequence part with the heterocyclic base of another sequence part (Iyer et al. (1999) Curr Opin Mol Therapeutics 1 :344-58; page 352). The different oligonucleotides containing unusual linkages are synthesized by established methods and can be linked together on-line during solid-phase synthesis. Alternatively, they may be linked together following synthesis of the individual partial sequences. CpG phosphorothioate oligonucleotides with strong stimulatory activity in the mouse system tend to show lower activity on human and other non-rodent immune cells. DNA containing these (TCG)nN or RDCGYi Y2N motifs strongly stimulated human peripheral blood cells to produce IFN-α. It has been discovered according to the invention that the subsets of CpG immunostimulatory oligonucleotides have dramatic immune stimulatory effects on human cells such as PBMC, suggesting that these CpG immunostimulatory oligonucleotides are effective therapeutic agents for human vaccination, cancer immunotherapy, asthma immunotherapy, general enhancement of immune function, enhancement of hematopoietic recovery following radiation or chemotherapy, and other immune modulatory applications. As used herein, the terms treat, treated, or treating, when used with respect to a disorder such as an infectious diseasb, cancer, allergy, or asthma, refers to a prophylactic treatment which increases the resistance of a subject to development of the disease (e.g., to infection with a pathogen) or, in other words, decreases the likelihood that the subject will develop the disease (e.g., become infected with the pathogen), as well as to a treatment after the subject has developed the disease in order to fight the disease (e.g., reduce or eliminate the infection) or to prevent the disease from becoming worse. Thus the CpG immunostimulatory oligonucleotides are useful in some aspects of the invention as a vaccine for the treatment of a subject having or at risk of developing allergy or asthma, an infection with an infectious organism, or a cancer in which a specific cancer antigen has been identified. The CpG immunostimulatory oligonucleotides thus can be administered to a subject in conjunction with an antigen or allergen for treatment of infection, allergy, asthma, or cancer. Alternatively and in addition, the CpG immunostimulatory oligonucleotides can also be given alone without the antigen or allergen for protection against infection, allergy or cancer or may be administered with other therapeutic agents. The CpG immunostimulatory oligonucleotides also may be administered with other therapeutic agents. Repeated doses may allow longer term protection. A subject at risk as used herein is a subject who has any identifiable risk of exposure to an infection-causing pathogen or allergen or a risk of developing cancer. For instance, a subject at risk of developing infection may be a subject who is planning to travel to an area where a particular type of infectious agent is found, or it may be a subject who through lifestyle or medical procedures is exposed to bodily fluids which may contain infectious organisms or directly to the organism, or it may be any subject living in an area where an infectious organism or an allergen has been identified. Subjects at risk of developing infection also include general populations to which a medical agency recommends vaccination with a particular infectious organism antigen. If the antigen is an allergen and the subject develops allergic responses to that particular antigen and the subject may be exposed to the antigen, e.g., during pollen season, then that subject is at risk of developing an allergic response. A subject at risk of developing an allergy or asthma includes those subjects that have been identified as having an allergy or asthma but that do not have active disease during the CpG immunostimulatory oligonucleotide treatment. A subject at risk of developing an allergy or asthma also includes subjects that are considered to be at risk of developing these diseases because of genetic or environmental factors. A subject at risk of developing a cancer is one who has a high probability of developing cancer. These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer, subjects exposed to cancer-associated agents such as tobacco, asbestos, or other chemical toxins, and subjects who have previously been treated for cancer and are in apparent remission. When a subject at risk of developing a cancer is treated with a CpG immunostimulatory oligonucleotide and optionally an antigen specific for the type of cancer to which the subject is at risk of developing, the subject may be able to kill the cancer cells as they develop. If a tumor begins to form in the subject, the subject will develop an innate immune response or a specific immune response against the tumor antigen. In addition to the use of the CpG immunostimulatory oligonucleotides for prophylactic treatment, the invention also encompasses the use of the CpG immunostimulatory oligonucleotides for the treatment of a subject having an infection, an allergy, asthma, or a cancer. A subject having an infection is a subject that has been exposed to an infectious pathogen and has acute or chronic detectable levels of the pathogen in the body. The CpG immunostimulatory oligonucleotides can be used with or without an antigen or other therapeutic to mount an innate or an antigen specific systemic or mucosal immune response that is capable of reducing the level of or eradicating the infectious pathogen. An infectious disease, as used herein, is a disease arising from the presence of a foreign microorganism in the body. It is particularly important to develop effective vaccine strategies and treatments to protect the body's mucosal surfaces, which are the primary site of pathogenic entry. A subject having an allergy is a subject that is capable of developing an allergic reaction in response to an allergen. An allergy refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, conjunctivitis, bronchial asthma, allergic asthma, urticaria (hives), food allergies, and other atopic conditions. Allergies are generally caused by IgE antibody generation against harmless allergens. The cytokines that are induced by systemic or mucosal administration of CpG immunostimulatory oligonucleotides are predominantly of a class called Thl (examples are IL-12, IP- 10, iFN-a and IFN-γ) and these induce both humoral and cellular immune responses. The other major type of immune response, which is associated with the production of IL-4 and IL-5 cytokines, is termed a Th2 immune response. In general, it appears that allergic diseases are mediated by Th2 type immune responses. Based on the ability of the CpG immunostimulatory oligonucleotides described herein to shift the immune response in a subject from a predominant Th2 (which is associated with production of IgE antibodies and allergy) to a balanced Th2/Thl response (which is protective against allergic reactions), an effective dose for inducing an immune response of a CpG immunostimulatory oligonucleotide can be administered to a subject to treat asthma and allergy. Thus, the CpG immunostimulatory oligonucleotides have significant therapeutic utility in the treatment of allergic conditions and asthma. Th2 cytokines, especially IL-4 and IL-5, are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotope switching, eosinophil chemotaxis and activation, and mast cell growth. Thl cytokines, especially IFN-γ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines. Asthma refers to a disorder of the respiratory system characterized by inflammation, nanowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms. Thus, asthma includes allergic asthma and non-allergic asthma. A subject having a cancer is a subject that has detectable cancerous cells. The cancer may be a malignant or non-malignant cancer. Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g., small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas. In one embodiment the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma. A subject shall mean a human or vertebrate animal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, turkey, chicken, primate, e.g., monkey, and fish (aquaculture species), e.g., salmon. Thus, the compounds may be used to treat cancer and tumors, infections, and allergy/asthma in human and non-human subjects. Cancer is one of the leading causes of death in companion animals (e.g., cats and dogs). In the instances when the CpG oligonucleotide is administered with an antigen, the subject may be exposed to the antigen. As used herein, the term "exposed to" refers to either the active step of contacting the subject with an antigen or the passive exposure of the subject to the antigen in vivo. Methods for the active exposure of a subject to an antigen are well- known in the art. In general, an antigen is administered directly to the subject by any means such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. The antigen can be administered systemically or locally. Methods for administering the antigen and the CpG immunostimulatory oligonucleotide are described in more detail below. A subject is passively exposed to an antigen if an antigen becomes available for exposure to the immune cells in the body. A subject may be passively exposed to an antigen, for instance, by entry of a foreign pathogen into the body or by the development of a tumor cell expressing a foreign antigen on its surface. The methods in which a subject is passively exposed to an antigen can be particularly dependent on timing of administration of the CpG immunostimulatory oligonucleotide. For instance, in a subject at risk of developing a cancer or an infectious disease or an allergic or asthmatic response, the subject may be administered the CpG immunostimulatory oligonucleotide on a regular basis when that risk is greatest, e.g., during allergy season or after exposure to a cancer causing agent. Additionally the CpG immunostimulatory oligonucleotide may be administered to travelers before they travel to foreign lands where they are at risk of exposure to infectious agents. Likewise the CpG immunostimulatory oligonucleotide may be administered to soldiers or civilians at risk of exposure to biowarfare to induce a systemic or mucosal immune response to the antigen when and if the subject is exposed to it. An antigen as used herein is a molecule capable of provoking an immune response. Antigens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts and muticellular organisms such as parasites and allergens. The term antigen broadly includes any type of molecule which is recognized by a host immune system as being foreign. Antigens include but are not limited to cancer antigens, microbial antigens, and allergens. A cancer antigen as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared from cancer cells either by preparing cmde extracts of cancer cells, for example, as described in Cohen PA et al. (1994) Cancer Res 54:1055-8, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens. Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion thereof, or a whole tumor or cancer cell. Such antigens can be isolated or prepared recombinantly or by any other means known in the art. As used herein, the terms "cancer antigen" and "tumor antigen" are used interchangeably to refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells. Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those canied on RNA and DNA tumor vimses. A microbial antigen as used herein is an antigen of a microorganism and includes but is not limited to vimses, bacteria, parasites, and fungi. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to those of ordinary skill in the art. < Examples of viruses that have been found in humans include but are not limited to: Retroviridae (e.g., human immunodeficiency vimses, such as HIV-1 (also refereed to as HTLV-IH, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio vimses, hepatitis A vims; enterovirases, human Coxsackie vimses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis vimses, rubella vimses); Flaviviridae (e.g., dengue vimses, encephalitis viruses, yellow fever vimses); Coronaviridae (e.g., coronavirases); Rhabdoviridae (e.g., vesicular stomatitis vimses, rabies vimses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps vims, measles vims, respiratory syncytial vims); Orthomyxoviridae (e.g., influenza vimses); Bunyaviridae (e.g., Hantaan vimses, bunya vimses, phleboviruses and Nairo vimses); Arena viridae (hemonhagic fever vimses); Reoviridae (e.g., reovimses, orbiviurses and rotavimses); Bornaviridae; epadnaviridae (Hepatitis B vims); Parvoviridae (parvo viruses); Papovaviridae (papilloma vimses, polyoma vimses); Adenoviridae (most adenovimses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster vims, cytomegaloviras (CMV), herpes virus; Poxviridae (variola viruses, vaccinia vimses, pox vimses); and Iridoviridae (e.g., African swine fever vims); and unclassified vimses (e.g., the agent of delta hepatitis (thought to be a defective satellite of hepatitis B vims), Hepatitis C; Norwalk and related vimses, and astro vimses). Both gram negative and gram positive bacteria serve as antigens in vertebrate animals. Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to, Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp. , Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, Rickettsia, and Actinomyces israelii. Examples of fungi include Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (i.e., protists) include Plasmodium spp. such as Plasmodium falciparum, Plasmodium malar iae, Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii. Blood-borne and/or tissues parasites include Plasmodium spp., Bάbesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii. Other medically relevant microorganisms have been described extensively in the literature, e.g., see C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incorporated by reference. An allergen refers to a substance (antigen) that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and dmgs (e.g., penicillin). Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g., Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium perenne or Lolium multiβorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago lanceolata); Parietaria (e.g., Parietaria ofβcinalis or Parietariajudaica); Blattella (e.g., Blattella germanica); Apis (e.g., Apis multiflorum); Cupressus (e.g., Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g., Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g., Thuya orientalis); Chamaecyparis (e.g., Chamaecyparis obtusa); Periplaneta (e.g., Periplaneta americana); Agropyron (e.g., Agropyron repens); Secale (e.g., Secale cereale); Triticum (e.g., Triticum aestτvum); Dactylis (e.g., Dactylis glomerata); Festuca (e.g., Festuca elatior); Poa (e.g., Poapratensis or Poa compressa); Avena (e.g., Avena sativά); Holcus (e.g., Holcus lanatus); Anthoxanthum (e.g., Anihoxanihum odoratum); Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis (e.g., Agrostis alba); Phleum (e.g., Phleum pratense); Phalaris (e.g., Phalaris arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum (e.g., Sorghum halepensis); and Bromus (e.g., Bromus inermis). The antigen may be substantially purified. The term substantially purified as used herein refers to an antigen, i.e., a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify polypeptide antigens using standard techniques for protein purification. The substantially pure polypeptide will often yield a single major band on a non-reducing polyacrylamide gel. In the case of partially glycosylated polypeptides or those that have several start codons, there may be several bands on a non-reducing polyacrylamide gel, but these will form a distinctive pattern for that polypeptide. The purity of the polypeptide antigen may also be determined by amino-terminal amino acid sequence analysis. Other types of antigens such as polysaccharides, small molecule, mimics, etc., are included within the invention and may optionally be substantially pure. The oligonucleotides of the invention may be administered to a subject with an antimicrobial agent. An anti-microbial agent, as used herein, refers to a naturally-occuning or synthetic compound which is capable of killing or inhibiting infectious microorganisms. The type of anti-microbial agent useful according to the invention will depend upon the type of microorganism with which the subject is infected or at risk of becoming infected. Antimicrobial agents include but are not limited to anti-bacterial agents, anti-viral agents, anti- fungal agents and anti-parasitic agents. Phrases such as "anti-infective agent", "anti-bacterial agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic agent" and "parasiticide" have well-established meanings to those of ordinary skill in the art and are defined in standard medical texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and include antibiotics as well as other synthetic or natural compounds having similar functions. Antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more bacterial functions or structures which are specific for the microorganism and which are not present in host cells. Anti-viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting vimses. Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections. Anti-parasitic agents kill or inhibit parasites. Examples of anti-parasitic agents, also refened to as parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxanide furoate, eflomithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, oxamniquine, paromomycin, pentamidine isethionate, piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine, quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin, stibogluconate sodium (sodium antimony gluconate), suramin, tetracycline, doxycycline, thiabendazole, tinidazole, trimethroprim-sulfamethoxazole, and tryparsamide some of which are used alone or in combination with others. Antibacterial agents kill or inhibit the growth or function of bacteria. A large class of antibacterial agents is antibiotics. Antibiotics, which are effective for killing or inhibiting a wide range of bacteria, are refened to as broad spectrum antibiotics. Other types of antibiotics are predominantly effective against the bacteria of the class gram-positive or gram-negative. These types of antibiotics are refened to as narrow spectrum antibiotics. Other antibiotics which are effective against a single organism or disease and not against other types of bacteria, are refened to as limited spectrum antibiotics. Antibacterial agents are sometimes classified based on their primary mode of action. In general, antibacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors. Anti iral agents are compounds which prevent infection of cells by vimses or replication of the vims within the cell. There are many fewer antiviral drags than antibacterial drugs because the process of viral replication is so closely related to DNA replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents. These stages include, attachment of the vims to the host cell (immunoglobulin or binding peptides), uncoating of the vims (e.g., amantadine), synthesis or translation of viral mRNA (e.g., interferon), replication of viral RNA or DNA (e.g., nucleoside analogs), maturation of new vims proteins (e.g., protease inhibitors), and budding and release of the vims. Nucleotide analogs are synthetic compounds which are similar to nucleotides, but which have an incomplete or abnormal deoxyribose or ribose group. Once the nucleotide analogs are in the cell, they are phosphorylated, producing the triphosphate form which competes with normal nucleotides for incorporation into the viral DNA or RNA. Once the triphosphate form of the nucleotide analog is incorporated into the growing nucleic acid chain, it causes reversible association with the viral polymerase and thus chain termination. Nucleotide analogs include, but are not limited to, acyclovir (used for the treatment of herpes simplex vims and varicella-zoster vims), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial vims), dideoxyinosine, dideoxycytidine, zidovudine (azidothymidine), imiquimod, and resimiquimod. The interferons are cytokines which are secreted by vims-infected cells as well as immune cells. The interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the vims, α and β-interferon also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition, oc and β-interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection. At the dosages which are effective for anti-viral therapy, interferons have severe side effects such as fever, malaise and weight loss. Anti- viral agents useful in the invention include but are not limited to immunoglobulins, amantadine, interferons, nucleoside analogs, and protease inhibitors. Specific examples of anti-virals include but are not limited to Acemannan; Acyclovir; Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox; Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate; Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride; Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril; Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium; Idoxuridine; Kethoxal; Lamivudine; Lobucavir; Memotine Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir; Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate; Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine; Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride; Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate; Viroxime; Zalcitabine; Zidovudine; and Zinviroxime. Anti-fungal agents are useful for the treatment and prevention of infective fungi. Anti-fungal agents are sometimes classified by their mechanism of action. Some anti-fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other anti-fungal agents function by destabilizing membrane integrity. These include, but are not limited to, imidazoles, such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafme, and terbinafine. Other anti-fungal agents function by breaking down chitin (e.g., chitinase) or immunosuppression (501 cream). CpG immunostimulatory oligonucleotides can be combined with other therapeutic agents such as adjuvants to enhance immune responses. The CpG immunostimulatory oligonucleotide and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents are administered simultaneously they can be administered in the same or separate formulations, but are administered at the same time. The other therapeutic agents are administered sequentially with one another and with CpG immunostimulatory oligonucleotide, when the administration of the other therapeutic agents and the CpG immunostimulatory oligonucleotide is temporally separated. More specifically, the CpG immunostimulatory oligonucleotide can be administered before or after administration of (or exposure to) at least one other therapeutic agent. The separation in time between the administration of these compounds may be a matter of minutes or it may be longer. Other therapeutic agents include but are not limited to adjuvants, cytokines, antibodies, antigens, etc. The compositions of the invention may also be administered with non-nucleic acid adjuvants. A non-nucleic acid adjuvant is any molecule or compound except for the CpG immunostimulatory oligonucleotides described herein which can stimulate the humoral and/or cellular immune response. Non-nucleic acid adjuvants include, for instance, adjuvants that create a depot effect, immune stimulating adjuvants, and adjuvants that create a depot effect and stimulate the immune system. The CpG immunostimulatory oligonucleotides are also useful as mucosal adjuvants. It has previously been discovered that both systemic and mucosal immunity are induced by mucosal delivery of CpG nucleic acids. Thus, the oligonucleotides may be administered in combination with other mucosal adjuvants. Immune responses can also be induced or augmented by the co-administration or co- linear expression of cytokines (Bueler & Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997; Iwasaki et al., 1997; Kim et al, 1997) or co-stimulatory molecules such as B7 (Iwasaki et al., 1997; Tsuji et al., 1997) with the CpG immunostimulatory oligonucleotides. The term cytokine is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), IFN-γ, IFN-α, IFN-β, tumor necrosis factor (TNF), TGF-β, Flt-3 ligand, and CD40 ligand. In addition to cytokines the CpG oligonucleotides may be used in combination with antibodies against certain cytokines, such as anti-IL-10 and anti-TGF-β, as well as cyclooxygenase inhibitors, i.e., COX-1 and COX-2 inhibitors. The oligonucleotides are also useful for redirecting an immune response from a Th2 immune response to a Thl immune response. This results in the production of a relatively balanced Thl/Th2 environment. Redirection of an immune response from a Th2 to a Thl immune response can be assessed by measuring the levels of cytokines produced in response to the nucleic acid (e.g., by inducing monocytic cells and other cells to produce Thl cytokines, including IFN-α). The redirection or rebalance of the immune response from a Th2 to a Thl response is particularly useful for the treatment of asthma. For instance, an effective amount for treating asthma can be that amount useful for redirecting a Th2 type of immune response that is associated with asthma to a Thl type of response or a balanced Thl/Th2 environment. Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. The CpG immunostimulatory oligonucleotides described herein cause an increase in Thl cytokines which helps to rebalance the immune system, preventing or reducing the adverse effects associated with a predominately Th2 immune response. Redirection of an immune response from a Th2 to a Thl immune response can also be assessed by measuring the levels of specific isotypes of immunoglobulin. For example, in mice IgG2a is associated with a Thl immune response, and IgGl and IgE are associated with a Th2 immune response. The CpG immunostimulatory oligonucleotides have the unique capability to promote cell survival, differentiation, activation and maturation of dendritic cells, and are useful for in vitro, in vivo, and ex vivo methods' involving dendritic cells. CpG immunostimulatory oligonucleotides also increase natural killer cell lytic activity and antibody-dependent cellular cytotoxicity (ADCC). ADCC can be performed using a CpG immunostimulatory oligonucleotide in combination with an antibody specific for a cellular target, such as a cancer cell. When the CpG immunostimulatory oligonucleotide is administered to a subject in conjunction with the antibody, the subject's immune system is induced to kill the tumor cell. The antibodies useful in the ADCC procedure include antibodies which interact with a cell in the body. Many such antibodies specific for cellular targets have been described in the art and many are commercially available. The CpG immunostimulatory oligonucleotides may also be administered in conjunction with an anti-cancer therapy. Anti-cancer therapies include cancer medicaments, radiation and surgical procedures. As used herein, a "cancer medicament" refers to an agent which is administered to a subject for the purpose of treating a cancer. As used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer medicament is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the purpose of this specification, cancer medicaments are classified as chemotherapeutic agents, immunotherapeutic agents, cancer vaccines, hormone therapy, and biological response modifiers. Additionally, the methods of the invention are intended to embrace the use of more than one cancer medicament along with the CpG immunostimulatory oligonucleotides. As an example, where appropriate, the CpG immunostimulatory oligonucleotides may be administered with both a chemotherapeutic agent and an immunotherapeutic agent. Alternatively, the cancer medicament may embrace an immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent, an immunotherapeutic agent and a cancer vaccine all administered to one subject for the purpose of treating a subject having a cancer or at risk of developing a cancer. The chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxombicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrabicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS farnesyl transferase inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrabicin, Metastron strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxombicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS- 182751 /oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxombicin, Caelyx/liposomal doxombicin, Fludara/Fludarabine, Pharmambicin Epirabicin, DepoCyt, ZD1839, LU 79553/Bis- Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxombicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodmg of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphelan and cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorabicin HCl, Estramustine phosphate sodium, Etoposide (VP 16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, Leuprolide acetate (LHRH- releasing factor analog), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26), and Vindesine sulfate, but it is not so limited. The immunotherapeutic agent may be selected from the group consisting of Rituxan, Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE- 1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX- 260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab, and ImmuRAIT-CEA, but it is not so limited. The cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it is not so limited. The use of CpG immunostimulatory oligonucleotides in conjunction with immunotherapeutic agents such as monoclonal antibodies is able to increase long-term survival tlirough a number of mechanisms including significant enhancement of ADCC (as discussed above), activation of NK cells and an increase in IFN-α levels. The nucleic acids when used in combination with monoclonal antibodies serve to reduce the dose of the antibody required to achieve a biological result. The invention also includes methods for inducing antigen non-specific innate immune activation and broad spectrum resistance to infectious challenge using the CpG immunostimulatory oligonucleotides. The term innate immune activation as used herein refers to the activation of immune cells other than memory B cells and for instance can include the activation of monocytes, neutrophils, macrophages, dendritic cells, NK cells, and/or other immune cells that can respond in an antigen-independent fashion. A broad spectrum resistance to infectious challenge is induced because the immune cells are in active form and are primed to respond to any invading compound or microorganism. The cells do not have to be specifically primed against a particular antigen. This is particularly useful in biowarfare, and the other circumstances described above such as travelers. The CpG immunostimulatory oligonucleotides may be directly administered to the subject or may be administered in conjunction with a nucleic acid delivery complex. A nucleic acid delivery complex shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell. Examples of nucleic acid delivery complexes include nucleic acids associated with a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Prefened complexes may be sufficiently stable in vivo to prevent significant uncoupling prior to intemalization by the target cell. However, the complex can be cleavable under appropriate conditions within the cell so that the oligonucleotide is released in a functional form. The CpG immunostimulatory oligonucleotide and/or the antigen and/or other therapeutics may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. For instance the following delivery vehicles have been described: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al, 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998, Morein et al, 1999); Liposomes (Childers et al, 1999, Michalek et al, 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Escherichia coli, bacillus Calmette-Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al, 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovims, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al, 1998, Flexner et al, 1988, Monow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al, 1995, O'Hagan et al, 1994, Eldridge et al, 1989); Nucleic acid vaccines (Fynan et al, 1993, Kuklin et al, 1997, Sasaki et al, 1998, Okada et al, 1997, Ishii et al, 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al, 1998, Jabbal-Gill et al, 1998); Polymer rings (Wyatt et al, 1998); Proteosomes (Vancott et al, 1998, Lowell et al, 1988, 1996, 1997); Sodium Fluoride (Hashi et al, 1998); Transgenic plants (Tacket et al, 1998, Mason et al, 1998, Haq et al, 1995); Virosomes (Gluck et al, 1992, Mengiardi et al, 1995, Cryz et al, 1998); Vims-like particles (Jiang et al, 1999, Leibl et al, 1998). Other delivery vehicles are known in the art. The term "effective amount" refers generally to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a CpG immunostimulatory oligonucleotide administered with an antigen for inducing mucosal immunity is that amount necessary to cause the development of IgA in response to an antigen upon exposure to the antigen, whereas that amount required for inducing systemic immunity is that amount necessary to cause the development of IgG in response to an antigen upon exposure to the antigen. ' Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and prefened mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular CpG immunostimulatory oligonucleotide being administered the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular CpG immunostimulatory oligonucleotide and/or antigen and/or other therapeutic agent without necessitating undue experimentation. Subject doses of the compounds described herein for mucosal or local delivery typically range from about 10 μg to 10 g per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween or as otherwise required. More typically mucosal or local doses range from about 1 mg to 500 mg per administration, and most typically from about 1 mg to 100 mg, with 2 - 4 administrations being spaced days or weeks apart. More typically, immune stimulant doses range from 10 μg to 100 mg per administration, and most typically 100 μg to 10 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery for the purpose of inducing an antigen-specific immune response, wherein the compounds are delivered with an antigen but not another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose for vaccine adjuvant or immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. Doses of the compounds described herein for parenteral delivery for the purpose of inducing an innate immune response or for increasing ADCC or for inducing an antigen specific immune response when the CpG immunostimulatory oligonucleotides are administered in combination with other therapeutic agents or in specialized delivery vehicles typically range from about 100 μg to 10 g per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween or as otherwise required. More typically parenteral doses for these purposes range from about 1 mg to 5 g per administration, and most typically from about 1 mg to 1 g, with 2 - 4 administrations being spaced days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above. For any compound described herein the therapeutically effective amount can be initially determined from animal models. A therapeutically effective dose can also be determined from human data for other CpG oligonucleotides which have been tested in humans (human clinical trials are ongoing) and for compounds which are known to exhibit similar pharmacological activities, such as other adjuvants, e.g., LT and other antigens for vaccination purposes. Higher doses may be required for parenteral administration. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan. The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible earners, adjuvants, and optionally other therapeutic ingredients. For use in therapy, an effective amount of the CpG immunostimulatory oligonucleotide and/or other therapeutics can be administered to a subject by any mode that delivers the compound to the desired surface, e.g., local, mucosal, systemic. Administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Prefened routes of administration include but are not limited to oral, parenteral, intravenous, intramuscular, subcutaneous, intralesional, intratumoral, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, and rectal For oral administration, the compounds (i.e., CpG immunostimulatory oligonucleotides, antigens and/or other therapeutic agents) can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such caniers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any caniers. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. The compounds may be administered by inhalation to pulmonary tract, especially the bronchi and more particularly into the alveoli of the deep lung, using standard inhalation devices. The compounds may be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. An inhalation apparatus may be used to deliver the compounds to a subject. An inhalation apparatus, as used herein, is any device for administering an aerosol, such as dry powdered form of the compounds. This type of equipment is well known in the art and has been described in detail, such as that description found in Remington: The Science and Practice of Pharmacy, 19th Edition, 1995, Mac Publishing Company, Easton, Pennsylvania, pages 1676-1692. Many U.S. patents also describe inhalation devices, such as U.S. Pat. No. 6,116,237. "Powder" as used herein refers to a composition that consists of finely dispersed solid particles. Preferably the compounds are relatively free flowing and capable of being dispersed in an inhalation device and subsequently inhaled by a subject so that the compounds reach the lungs to permit penetration into the alveoli. A "dry powder" refers to a powder composition that has a moisture content such that the particles are readily dispersible in an inhalation device to form an aerosol. The moisture content is generally below about 10% by weight (% w) water, and in some embodiments is below about 5% w and preferably less than about 3% w. The powder may be formulated with polymers or optionally may be formulated with other materials such as liposomes, albumin and/or other carriers. Aerosol dosage and delivery systems may be selected for a particular therapeutic application by one of skill in the art, such as described, for example in Gonda, I. "Aerosols for delivery of therapeutic and diagnostic agents to the respiratory tract," in Critical Reviews in Therapeutic Drug Canier Systems, 6:273-313 (1990), and in Moren, "Aerosol dosage fonris and formulations," in Aerosols in Medicine. Principles, Diagnosis and Therapy, Moren, et al, Eds., Elsevier, Amsterdam, 1985. The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. The pharmaceutical compositions also may include suitable solid or gel phase caniers or excipients. Examples of such caniers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols. Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)caρsules, suppositories, symps, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for dmg delivery, see Langer R (1990) Science 249:1527-33, which is incoφorated herein by reference. The CpG immunostimulatory oligonucleotides and optionally other therapeutics and/or antigens may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2%) w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03%) w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v). The pharmaceutical compositions of the invention contain an effective amount of a CpG immunostimulatory oligonucleotide and optionally antigens and/or other therapeutic agents optionally included in a pharmaceutically-acceptable canier. The term pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term canier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
The present invention is further illustrated by the following Examples, which in no way should be constmed as further limiting.
EXAMPLES Example 1 C-Class ODN Analogs Induce IFN- a Secretion and Human TLR9 Activity In Vitro In this series of experiments, C-class ODN analogs of the invention were tested in vitro for their ability to stimulate human peripheral blood mononuclear cells (PBMC) to secreted IFN-α and to stimulate HEK293 cells, stably transfected with human TLR9 and NF- B reporter constmct, to demonstrate TLR9 signaling. ODN were purchased from Biospring (Frankfurt, Germany), and were controlled for identity and purity by Coley Pharmaceutical GmbH (Langenfeld, Germany). ODNs were diluted in phosphate-buffered saline (Sigma, Germany), and stored at -20°C. All dilutions were carried out using pyrogen-free reagents. Test ODN included the following:
128 χ*c_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*T*G*C*C*G (SEQ ID NO:48)
611 χ*c*G*T*C*G*T*T*T*T*A*C_G*G*C_G*C*C_G*T*G*C*C*G (SEQ ID NO:43)
614 χ*c*G*T*C*G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43)
620 τ*c*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43)
331 T*C*G*C_G*A*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQIDNO:27)
332 χ*c*G*C_G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:30)
333 T*C*G*C_G*A*C*G*T*T*C_G*G*C*G*C_G*T*C*G*C*C*G (SEQIDNO:28)
334 χ*c=f=G*c_G*A*c*G*T*T*C_G*G*C*G*G*C_T*C*G*C*C*G (SEQ ID NO:29)
335 T*C*G_C*G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQIDNO:30)
336 T*C*G*C*G_T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQIDNO:30)
337 T*C*G*C*G_A*C*G*T*T*C Ϊ*G*C*G*C_G*T*C*G*C*C*G (SEQ ID NO:28)
338 T*C*G*C*G_A*C*G*T*T*C_G*G*C*G*G*C_T*C*G*C*C*G (SEQ ID NO:29) 339 T*C*G_C*G*A*C*G*T*T*C_G*G*C*G*C_G*T*C*G*C*C*G (SEQ ID NO:28)
340 T*C*G_C*G*A*C*G*T*T*C_G*G*C*G*G*C_T*C*G*C*C*G (SEQ ID NO:29)
341 χ*c*G*C_G*T*C*G*T*T*C_G*G*C*G*C_G*T*C*G*C*C*G (SEQ ID NO:31)
342 T*C*G*C_G*T*C*G*T*T*C_G*G*C*G*G*C_T*C*G*C*C*G (SEQ ID NO:32)
343 T*C*G*C*G_T*C*G*T*T*C_G*G*C*G*C_G*T*C*G*C*C*G (SEQ ID NO:31)
344 T*C*G*C*G_T*C*G*T*T*C_G*G*C*G*G*C_T*C*G*C*C*G (SEQ ID NO:32)
wherein * represents phophorothioate linkage, and _ represents phosphodiester linkage. CpG ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT, SEQ ID NO:56) was used as a positive control for TLR9 signal activation. C-class CpG ODN 2429
(TCGTCGTTTTCGGCGGCCGCCG, SEQ ID NO:53) was used as a positive control for IFN-α induction. Non-CpG ODN 1982 (TCCAGGACTTCTCTCAGGTT, SEQ ID NO: 18) was used as a negative control. Peripheral blood buffy coat preparations from healthy male and female human donors were obtained from the Blood Bank of the University of Dϋsseldorf (Germany) and from these, PBMC were purified by centrifugation over Ficoll-Hypaque (Sigma). The purified PBMC were resuspended in RPMI 1640 culture medium (BioWhittaker, Belgium) supplemented with 5% (v/v) heat-inactivated human AB semm (BioWhittaker) or 10% (v/v) heat-inactivated FCS, 2 mM L-glutamine (BioWhittaker), 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen, Karlsruhe, Germany). Fresh PBMC were seeded on 96- well round-bottom plates and incubated for 48 hours with ODN in the concentrations as indicated in a humidified incubator at 37°C. Culture supernatants were collected and if not used immediately, frozen at -20°C until required. Amounts of IFN-α in the supernatants were assessed using an enzyme-linked immunosorbent assay (ELISA) developed using commercially available antibodies (Alexis GmbH, Grunberg, Germany). ODN 128, 331-344, 611 and 620 were tested with PBMC from four different donors, and ODN 614 was tested with PBMC from three different donors. Stably transfected HEK293 cells used for a human TLR9 reporter gene assay expressed the human TLR9 receptor and an NF-κB reporter gene construct. Cells were incubated with ODNs for 16h at 37°C in a humidified incubator. Each data point was done in triplicate. Cells were lysed and assayed for reporter gene activity. Stimulation indices were < calculated in reference to reporter gene activity of medium without addition of ODN. Results. Representative results are presented in FIG. 1 and FIG. 2. FIG. 1 shows that C-class ODN 332, 333, and 334 induced large amounts of IFN-α (ca. 2000-2500 pg/ml typical) when present at a concentration of 1 μM. The amount of IFN-α induced by these ODN significantly exceeded the amount of IFN-α induced by the same concentration of ODN 2006 or 1982. FIG. 1 also shows that C-class ODN 332, 333, and 334 induced significant amounts of TLR9 signaling activity (typically with a stimulation index of ca. 15) when present at a concentration of 10 μM. The amount of TLR9 signaling activity induced by these ODN was about half the TLR9 signaling activity induced by the same concentration of ODN 2006. Essentially the same results were observed for ODN 128 and 335-344. FIG. 2 shows that C-class ODN 611, 614, and 620 induced even greater amounts of IFN-α (ca. 3000-4000 pg/ml typical) when present at a concentration of 1 μM. The amount of IFN-α induced by these ODN significantly exceeded the amount of IFN-α induced by the same concentration of ODN 2006 or 1982. FIG. 2 also shows that C-class ODN 611, 614, and 620 induced significant amounts of TLR9 signaling activity (typically with a stimulation index of ca. 10-20) when present at a concentration of 10 μM. The amount of TLR9 signaling activity induced by these ODN was again about half the TLR9 signaling activity induced by the same concentration of ODN 2006. ODNs 611 (SEQ ID NO:43), 614 (SEQ ID NO:43), and 620 (SEQ ID NO:43) were also compared with ODN 2429 (one of the original palindrome-containing C-class oligonucleotides described). These new C-class ODN showed higher activity in the human TLR9 assay, while induction of IFN-α was similar to ODN 2429 (FIG. 3). Taken together, the results of these experiments demonstrate that C-Class ODN analogs of the invention effectively induce IFN-α secretion and human TLR9 activity in vitro.
Example 2 Additional C-Class ODN Analogs Induce IFN- Secretion In Vitro In this series of experiments, additional C-class ODN analogs of the invention were tested in vitro for their ability to induce IFN-α secretion. The C-class ODN analogs in these experiments were characterized in part by the presence of AT-rich interrupted inverted repeats or by the presence of intenupted inverted repeats containing dSpacer residues in place of conventional nucleotide residues. ODN were obtained as in Example 1. Test ODN included the following:
645 χ*c*G*T*C_G*T*T*X*X*X*A*A*T*A*T*T*X*A*X*T*A SEQ IDNO:59
646 χ*c*G*T*C_G*X*X*T*X*C*A*A*X*A*T*T*X*A*T*T*G SEQ IDNO:50
647 χ*c*G*T*C_G*T*T*T*T*T*A*A*T*A*T*C*C*A*T*T*A SEQ IDNO:58 649 χ*c*G*T*C_G*X*X*X*X*A*C*G*G*C*G*L*L*L*T*G*C*C*G SEQ IDNO:45 "650 χ*c*G*T*C 3*X*T*L*L*A*C*G*G*C*G*L*L*L*X*G*C*C*G SEQ IDNO:38 651 χ* *G*χ*c_G*X*X*T*X*C*G*G*C*G*G*L*L*C*C*G*C*C*G SEQ ID NO:54
wherein * represents phosphorothioate internucleotide linkage, _ represents phosphodiester internucleotide linkage, and L represents dSpacer. Human PBMC were obtained and treated in a manner analogous to Example 1. Amounts of IFN-α in the supernatants were assessed using an enzyme-linked immunosorbent assay (ELISA) in a manner analogous to Example 1. Results. C-class ODN 645, 646, and 647, characterized in part by the presence of AT- rich intenupted inverted repeats, induced moderate amounts of IFN-α (ca. 1200-1500 pg/ml typical) when present at a concentration of 1 μM. The amount of IFN-α induced by these ODN significantly exceeded the amount of IFN-α induced by the same concentration of ODN 2006 or 1982. C-class ODN 649, 650, and 651, characterized in part by the presence of interrupted inverted repeats containing dSpacer residues, induced large amounts of IFN-α (ca. 2000-2500 pg/ml typical) when present at a concentration of 1 μM. The amount of IFN- α induced by these ODN significantly exceeded the amount of IFN-α induced by the same concentration of ODN 2006 or 1982. Taken together, the results of these experiments demonstrate that C-Class ODN analogs of the invention, characterized in part by the presence of AT-rich intenupted inverted repeats or by the presence of intenupted inverted repeats containing dSpacer residues in place of conventional nucleotide residues, effectively induce IFN-α secretion in vitro. Example 3 Additional C-Class ODN Analogs Induce IFN- Secretion and Human TLR9 Activity In Vitro In this series of experiments, C-class ODN analogs of the invention were tested in vitro for their ability to stimulate human PBMC to secreted IFN-α and to stimulate HEK293 cells, stably transfected with human TLR9 and NF-κB reporter construct, to demonstrate TLR9 signaling. The basic protocol is as described for Example 1, with the exception that the test ODN included the following:
664 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*G (SEQ ID O:62)
376 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G (SEQ IDNO:61)
801 T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ IDNO:65)
893 T*C*G*T*C_G*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ IDNO:66)
894 T*C*G*T*C_G*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:67) 882 τ*c*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*T (SEQ IDNO:63) 2290 T*C*G*T*C_G*A*C_G*A*T*C_G*G*C*G*C*C__G*T*G*C*C*G (SEQ IDNO:64) 2292 T*C*G*T*C*G*A*C*G*A_T_C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO: 64) 2337 τ*C*G*A*C_G*T*C*G*A*C_G*T*G*A*C*G*T*T (SEQ IDNO:63) 2341 τ*C*G*A*C_G*T*C*G*A*C*G*T_G*A*C*G*T*T (SEQ ID NO:63) 2357 τ*C*G*T*C 3*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G*T (SEQ ID NO:68)
wherein * represents phosphorothioate linkage and _ represents phophodiester linkage. ODN in different conentrations were tested in the TLR9 reporter gene assay. The EC50 (concentration of ODN at which effect was 50 percent maximal effect) was calculated using SigmaPlot (SigmaPlot 2002 for Windows Version 8.0). The maximal stimulation index (max SI) was calculated as the quotient between the highest value of all concentrations tested for any ODN and the medium control. Results are shown in Table 1, wherein it can be seen that stimulation indices in the range of 10-30 were common. TABLE 1
Figure imgf000060_0001
Large amounts of IFN-α were secreted by human PBMC upon 48 h incubation with these C-class CpG ODN. Typical amounts of IFN-α were in the range of 3000-4000 pg/ml following incubation with ODN at concentrations less than or equal to 1 μM. Response curves for IFN-α in these experiments were very similar to those shown in FIG. 2.
Example 4 C-Class ODN Analogs Induce Antigen-Specific Immune Response In Vivo In this series of experiments, C-class ODN of the invention were tested in vivo in conjunction with vaccination of mice. C-class ODN of the invention were observed to boost titers of antigen-specific total IgG and IgG2a (Thl-like IgG in mice), as well as antigen- specific cytolytic T lymphocyte (CTL) responses, in a manner at least comparable to B-class CpG ODN 2006. ODN were obtained as in Example 1. Female BALB/c mice (6-8 weeks of age) were used for all experiments. Animals were purchased from Charles River Canada (Quebec, Canada) and housed in micro isolators at the animal care facility of the Ottawa Hospital Research Institute, Civic Site. Naive BALB/c mouse splenocytes were used for all in vitro assays. Animals were anesthetized with isofluorane and euthanized by cervical dislocation. Spleens were removed under aseptic conditions and placed in phosphate-buffered saline (PBS) + 0.2% bovine serum albumin (Sigma Chemical Company). Spleens were then homogenized and splenocytes were re-suspended in RPMI 1640 tissue culture medium (Life Technologies, Grand Island, NY) supplemented with 2% normal mouse serum (Cedarlane Laboratories, Ontario, Canada), penicillin-streptomycin solution (final concentration of 1000 U/ml and 1 mg/ml respectively; Sigma Chemical Company), and 5 x IO"5 M β-mercaptoethanol (Sigma Chemical Company). BALB/c mice (n=10/group) were immunized with 1 μg hepatitis B surface antigen (HBsAg) sub type ad (International Enzymes, CA) alone or in combination with 1-100 μg CpG ODN 2006, 608, 611, 618 or CpG ODN 620. Animals were bled and boosted at 4 weeks post-primary immunization. At 2 weeks post boost, 5 animals from each group were euthanized and spleens removed for CTL assays. Antibodies (total IgG, IgGl and IgG2a) specific to HBsAg (anti-HBs) were detected and quantified by endpoint dilution ELIS A assay, which was performed in triplicate on samples from individual animals. End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of non- immune plasma with a cut-off value of 0.05. These were reported as group mean titers (GMT) ± SEM. CTL assays were conducted according to standard manner. Briefly, spleens were removed at 4 weeks post immunization and homogenized into single-cell suspension in RPMI 1640 tissue culture medium (Life Technologies, Grand Island, NY) supplemented with 10%> fetal bovine semm (Life Technologies), penicillin-streptomycin solution (final concentration of 1000 U/ml and 1 mg/ml respectively; Sigma, Irvine, UK), and 5χl0"5 M β- mercaptoethanol (Sigma) (Complete RPMI 1640). HBsAg-specific lymphocytes in splenocyte suspensions (3 x IO6 cells/ml) were re-stimulated for 5 days by incubating with a murine cell line (p815-S) expressing HBsAg. Following re-stimulation, the potential of the lymphocytes to kill cells expressing HBsAg was determined by using 51Cr release assay. The results are presented as %> specific lysis at different effector:target (E:T) ratios. Results. Representative results are shown in FIG. 4-6. As shown in FIG. 4, total IgG titers for ODN 2006 and ODN 620 were dose-dependent and found to be ca. 5 x IO3 and 6.5 x 103, respectively, at ODN dose of 1 μg. Total IgG titers for ODN 2006 and ODN 620 were found to be ca. 1 x IO4 at ODN dose of 100 μg. As shown in FIG. 5, ODN 2006 and ODN 620 both significantly boosted IgG2a (Thl-like IgG in mice) compared to non-CpG control ODN 2137 (TGCTGCTTTTGTGCTTTTGTGCTT; SEQ ID NO:60). Specifically, IgG2a titers for ODN 2006, 620, and 2137, each administered in doses of 10 μg, were ca. 3 x IO3, 6 x 103, and 3 x IO2, respectively. As shown in FIG. 6, CTL activity at an E:T ratio of 100:1 for ODN 2006 and 620 was significantly greater than control at administered doses of 10 and 100 μg. For example, percent specific lysis for ODN 2006, 260, and 2137, each administered in a dose of 10 μg, was ca. 26%, 24%, and 12%. Taken together, the results of these experiments demonstrate that C-Class ODN analogs of the invention effectively induce antigen-specific immune responses in vivo.
Example 5 C-Class ODN Analogs Improve Survival and Reduce Tumor Volume In a Tumor Model In Vivo In this series of experiments, C-class ODN analogs of the invention were tested in vivo in a murine neuroblastoma model. C-class ODN analogs of the invention were found to improve dramatically both overall survival and tumor burden. ODN were obtained as in Example 1. BALB/c mice were obtained as in Example 4. BALB/c mice were injected subcutaneously (s.c.) into the left flank on day 0 with lxlO6 neuroblastoma (Neuro-2a) cells (e.g., ATCC CCL-131, American Type Culture Collection, Manassas, VA). Mice were given s.c. injections of PBS, CpG 2006, CpG 620, or non-CpG control ODN 2137 daily from day 10-25. Percent survival and tumor volume were measured. Results. Representative results are shown in FIG. 7. As shown in FIG. 7A, mice treated with 100 μg ODN 620 had a 50%) survival rate at 80 days, as compared with conesponding survival rates of 0-20% for ODN 2006, ODN 2137, or PBS. Furthermore, as shown in FIG. 7B, mice treated with 100 μg ODN 620 had a tumor volume that peaked at about 1000 mm3 on day 28 and declined to 0 mm3 by 38 days. By comparison, mice treated with ODN 2137 or PBS had more rapid, monotonic tumor growth. Taken together, the results of these experiments demonstrate that C-Class ODN analogs of the invention effectively improve survival and reduce tumor volume in a tumor model in vivo. Example 6 Tissue Metabolism and Distribution of C-Class ODN Analogs Adsorption/distribution studies with C-class ODN analogs of the invention showed favorable metabolism and clearance from organs such as the kidney and liver after subcutaneous treatment of mice. Mice were divided into groups of 5 and each mouse was administered 250 μg of ODN in a single subcutaneous dose on day 0. At various time points, the organs (liver, kidneys and spleen) were been removed and the oligonucleotide and its metabolites were extracted for quantification of content. Results. The ODNs of this invention (e.g., 611 and 620) showed less accumulation in organs as compared to the known fully phosphorothioate palindromic ODNs, such as 2429. For example, on day 3, kidney levels of ODN 611, 620, and 2429 were ca. 70 ± 28, 30 ± 18, and 90 ± 10 mg/kg, respectively. Likewise on day 3, liver levels of ODN 611, 620, and 2429 were ca. 45± 15, 28 ± 12, and 150 ± 15 mg/kg, respectively. Taken as a whole, these results demonstrate that C-class ODN analogs of the invention have favorable metabolism and clearance from organs where ODN might otherwise accumulate.
Example 7 Physical Characteristics of C-Class ODN Analogs In this set of experiments ODN 2429, 611, 620, 608 (T*C*G*T*C_G*T*T*T*T*C_G*G*C_G*C*G*C_G*C*C*G; SEQ ID NO:51), and 618 (T*C*G*T*C_G*T*T*T*T*C_G*G*C*G*G*C*C_G*C*C*G; SEQ ID NO:53) were characterized using size exclusion chromatography, capillary gel electrophoresis (CGE), UV thermal denaturation, and high pressure liquid chromatography (HPLC). When ODN 611 and ODN 620 were investigated by size exclusion chromatography (225 μM in PBS), only one peak was observed for each compound, i.e., each oligonucleotide eluted like a monomer. In contrast, when ODN 608 and 618 (each containing palindromic sequence) were investigated by size exclusion chromatography, two peaks were observed for each oligonucleotide, consistent with the presence of an intermolecular dimer in addition to the monomer. However, UV thermal denaturation studies indicated that ODN 611 and ODN 620 had a secondary stmcture in solution, consistent with an intramolecular hairpin stmcture. The hairpin stmcture is believed to result from the inverted repeat in the 611 and 620 sequences. Generally sharper pealcs were observed in HPLC and CGE for these sequences as compared to ODN 2429 and ODN 608. Taken as a whole, these results demonstrate that C-class ODN analogs of the invention tend to form intramolecular secondary stmctures and do not form intermolecular complexes in vitro at the concentration examined, whereas palindrome-containing C-class ODN tend to associate into complexes through intermolecular interactions. In vivo, however, it is likely that concentrations of ODN attained in the intraendosomal compartment are sufficiently high to favor duplex or even higher-order complexes of ODN, including duplex or even higher-order complexes of C-class ODN analogs of the invention.
EQUIVALENTS The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
All references, patents, and patent publications cited herein are incorporated in their entirety herein by reference.
We claim:

Claims

1. A composition comprising an immunostimulatory nucleic acid molecule of Formula I Zi [(Xi YiRi) N (X2Y2R2)k Z2]p (S,)q N' (Nn)...(N2)(Nι) S2 (Nι#)(N2#)...(Nn#) Z3 (Formula I)
wherein each of Zi, Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer; each of Xi and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yi and Y2 is independently a cytosine (C) or a modified cytosine; each of Ri and R2 is independently a guanine (G) or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer; St is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkages; S2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; each of Nl5 N2, .... Nn, and Ni#, N2#; ... Nn# is any nucleotide or modified nucleotide wherein Ni base-pairs with Nι#, N2 base-pairs with N2#, ... and Nn base-pairs with Nn#; k is an integer from 0 to 5; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10, and wherein when (Nn)...(N2)(Nι) S2 (Nι#)(N2#)...(Nn#) is 10 to 42 nucleotides long, S2 is 4 to 10 nucleotides long, S2 comprises a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (Nn)...(N2)(Nι) S2 (Nι#)(N2#)...(Nn#) has a GC content that is less than 2/3.
2. The immunostimulatory nucleic acid molecule of claim 1, wherein each of N1} N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from C, G, or modifications thereof, and wherein C base- pairs with G.
3. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of N i , N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from T, A, or modifications thereof, and wherein T base- pairs with A.
4. The immunostimulatory nucleic acid molecule of claim 1, wherein each of Ni, N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from C, T, A, G, or modifications thereof, and wherein C base-pairs with G, T base-pairs with G, A base-pairs with T, and A base-pairs with G.
5. The immunostimulatory nucleic acid molecule of claim 1, wherein each of Ni, N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs.
6. The immunostimulatory nucleic acid molecule of claim 1, wherein at least one of each of Nls N2, .... Nn, and Nι#, N2#, ... Nn# is chosen from unmodified or modified nucleotides which form non- Watson-Crick base pairs.
7. The immunostimulatory nucleic acid molecule of claim 1 , further comprising a partially stabilized backbone with at least one phosphodiester bond.
8. The immunostimulatory nucleic acid molecule of claim 1 , further comprising a backbone with at least one stabilized internucleotide linkage.
9. The immunostimulatory nucleic acid molecule of claim 1, wherein internucleotide linkages of the oligonucleotide are all phosphorothioate linkages.
10. The immunostimulatory nucleic acid molecule of claim 1, further comprising a partially stabilized backbone with a phosphodiester bond joining at least one of YΪRΪ or
11. The immunostimulatory nucleic acid molecule of claim 1 , wherein Yi is C.
12. The immunostimulatory nucleic acid molecule of claim 1 , wherein Ri is G.
13. The immunostimulatory nucleic acid molecule of claim 1 , wherein Yi is C and R\ is G.
14. The immunostimulatory nucleic acid molecule of claim 1 wherein Xj or X2 is T.
15. The immunostimulatory nucleic acid molecule of claim 1 , wherein Xi is T, X2 is T,
Figure imgf000067_0001
16. The immunostimulatory nucleic acid molecule of claim 1, wherein Xi is T, X is T, Y\ is C, Ri is G, k is 1, p is 1, N and N' and Z3 each contain zero nucleotides, and Z is TTTT or d(UUUU).
17. The immunostimulatory nucleic acid molecule of claim 1 , wherein S2 is a non- nucleotidic linker.
18. The immunostimulatory nucleic acid molecule of claim 1 , wherein S contains at least one abasic dSpacer residue.
19. The immunostimulatory nucleic acid molecule of claim 1 , wherein the oligonucleotide includes at least one branched non-nucleoside linkage.
20. The immunostimulatory nucleic acid molecule of claim 1, further comprising at least one doubler unit, at least one trebler unit, or at least one doubler unit and at least one trebler unit.
21. The immunostimulatory nucleic acid molecule of claim 1 , wherein S i is a doubler unit or a trebler unit.
22. The immunostimulatory nucleic acid molecule of claim 1 , wherein the oligonucleotide comprises at least one 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- intemucleoside linkage.
23. An immunostimulatory nucleic acid molecule of Formula III
(Z')ra Z3 (S3) (Formula III)
wherein
Z' is Zi [(Xi YiRi) N (X2Y2R2)k Z2]p (βι N' (Nn)....(N3)(N2)(Nι) S2 (N1#)(N2#)(N3#)...(Nn#); each of Zl5 Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer; each of X] and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Yt and Y2 is independently a cytosine or a modified cytosine; each of Ri and R2 is independently a guanine or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer; Si is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkages; 52 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; 53 is a direct or indirect 2'5'-, 5 '5'-, 3 '3'-, 2'2'-, or 2'3'- intemucleoside linkage, or a non-nucleotidic linker, said non-nucleotidic linker comprising abasic linkers (dSpacers), triethylene glycol units, or hexaethylene glycol units facilitating a 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- linkage of m sequence parts; each of Ni, N2, .... Nn, and Ni#, N2#, ... Nn# is any nucleotide or modified nucleotide wherein Ni base-pairs with Ni#, N2 base-pairs with N2#, N3 base-pairs with N3#, ... and Nn base-pairs with Nn#; k is an integer from 0 to 5; m is an integer from 2 to 10; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10.
24. A composition comprising an immunostimulatory nucleic acid molecule of claim 1 or claim 23, wherein Zi [(XiYiRi) N (X2Y2R2)k Z2]p (Sι)q is a non-palindromic sequence.
25. A composition comprising an immunostimulatory nucleic acid molecule of claim 1 or claim 23, wherein Zi [ (XiYiRi) N (X2Y2R2)k Z2]p (Sι)q is TCGTCGTTTT (SEQ ID NO:40), TCGTCGTTLL, TCGA, TCGAC, TCGACGTC, or TCGACGTCG, wherein L is dSpacer.
26. A composition comprising an immunostimulatory nucleic acid molecule of claim 1 or claim 23, wherein Zi [(XiYiRi) N (X2Y2R_)k Z2]p (Sι)q is a palindromic sequence.
27. The immunostimulatory nucleic acid molecule of claim 1 or claim 23, wherein Zi [(XiYiRi) N (X2Y2R2) Z2]p (Sι)q is TCGACGTCGA (SEQ ID NO: 19) or TCGTCGACGA (SEQ ID NO:34).
28. The immunostimulatory nucleic acid molecule of claim 1 or claim 23, wherein Zi [(Xi YiRi) N (X2Y2R2)k Z2]p (Sι)q is TCGCGACGTT (SEQ ID NO:26) or TCGCGTCGTT (SEQ ID NO:69).
29. The immunostimulatory nucleic acid molecule of claim 1, wherein (Nn)...(N2)(Ni) S2 (N1#)(N2#)...(Nn#) Z3 comprises a sequence AGCGAAGCT,
CAATATTTATTG (SEQ IDNO:l), CCGTTTTGTGG (SEQ IDNO:2), CGGCGCCGTGCCG (SEQ IDNO:19), CGGCGCCGTTGCCG (SEQ IDNO:34), CGGCGLLCGCCG (SEQ IDNO:5), CGGCGLLLTGCCG (SEQ IDNO:6), CGGCGGLLCCGCCG (SEQ IDNO:7), CGGCGTCGCCGCCG (SEQ ID NO:8), CGTCGACGGGACGGG (SEQ ID NO: 10), CGTCGACGTGACGGG (SEQ ID NO: 11), GAGAGTTGGGCTCTC (SEQ ID NO: 12), GTCGAGGAGGT (SEQ ID NO: 14), TAATALLTATTA (SEQ ID NO: 15), TAATATCCATTA (SEQ ID NO: 16), or TAATATTTATTA (SEQ ID NO: 17), wherein L is dSpacer.
30. The immunostimulatory nucleic acid molecule of claim 1 , wherein
(N„) ...(N2)(N S2 (N1#)(N2#)...(Nn#) comprises a sequence GGCGCGCTGCCG (SEQ ID NO: 13).
31. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence TCGACGTCGACCGTTTTGTGG (SEQ ID NO:20), TCGACGTCGACGGGACGGG (SEQ ID NO:21), TCGACGTCGACGTGACGGG (SEQ ID NO:22), TCGACGTCGAGAGTTGGGCTCTC (SEQ ID NO:23), TCGACGTCGAGCGAAGCT (SEQ ID O:24), or TCGACGTCGAGGAGGT (SEQ ID NO:25).
32. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence TCGTCGTTLLACGGCGCCGTGCCG (SEQ ID NO:37), TCGTCGTTLLACGGCGLLLTGCCG (SEQ ID NO:38), TCGTCGTTLLCGGCGCGGCGCCG (SEQ ID NO:39), TCGTCGTTTTACGGCGCCGTTGCCG (SEQ ID NO:44), TCGTCGTTTTACGGCGLLLTGCCG (SEQ ID NO:45), TCGTCGTTTTACGGCGTTTTGCCG (SEQ ID NO:49), TCGTCGTTTTCAATATTTATTG (SEQ ID NO:50), TCGTCGTTTTCGGCGLLCGCCG (SEQ ID NO:52), TCGTCGTTTTCGGCGGLLCCGCCG (SEQ ID NO:54), TCGTCGTTTTCGGCGTCGCCGCCG (SEQ ID NO:55), TCGTCGTTTTTAATALLTATTA (SEQ ID NO:57), TCGTCGTTTTTAATATCCATTA (SEQ ID NO:58), or TCGTCGTTTTTAATATTTATTA (SEQ ID NO:59), wherein L is dSpacer.
33. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence TCGCGTCGTTCGGCGCGCTGCCG (SEQ ID NO:30).
34. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence TCGCGACGTTCGGCGCGCTGCCG (SEQ ID NO:27).
35. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence chosen from χ*c*G*χ*c*G*χ*χ*χ*χ*A* _G*G*c_G*c*c_G*χ*G* *c*G (SEQ ID NO:43),
X*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43), T*C*G*T*C*G*T*T*T*T*A*C*G*A*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:42), X*C*G*T*C*G*C*T*T*T*G*C*G*A*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:36), T*C*G*T*C*G*C*C*C*G*G*C*G*A*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:35), χ*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*T*G*C*C*G (SEQ ID NO:44), T*C*G*T*C*G*T*T*L*L*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:37), χ*c*G*χ* *G*τ=i=χ*χ*χ*A*c*G*G*C H=G*L*L*L*T*G*C*C*G (SEQ ID NO:45), χ*c*G*χ*c*G*T Φχ*L*L*A*C*G*G*C*G*L*L*L*T*G!,:C*C*G (SEQ ID NO:38), χ* *G*χ* *G*χ*χ*χ*χ*c*G*G*C*G*G*L*L*C*C*G*C*C*G (SEQ ID NO:54), χ*C*G*T*C*G*T*T*T*T*C*G*G*C*G*T*C*G*C*C*G*C*C*G (SEQ ID NO:55), χ*C*G*T*C*G*T*T*L*L*C*G*G*C*G*C*G*G*C*G*C*C*G (SEQ ID NO:39), X*C*G*T*C*G*T*T*T*T*C*G*G*C*G*L*L*C*G*C*C*G (SEQ ID NO:52), T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A (SEQ ID NO:59) χ*C*G*T*C_G*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A (SEQ ID NO:59), χ*C*G*T*C_G*T*T*T*T*C*A*A*T*A*T*T*T*A*T*T*G (SEQ ID NO:50), T*C*G*T*C_G*T*T*T*T*T*A*A*T*A*T*C*C*A*T*T*A (SEQ ID NO:58), T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*L*L*T*A*T*T*A (SEQ ID NO:57), T*C*G*T*C_G*T*T*T*T*A*C*G*G*C*G*L*L*L*T*G*C*C*G (SEQ ID NO:45), T*C*G*T*C_G*T*T*L*L*A*C*G*G*C*G*L*L*L*T*G*C*C*G (SEQ ID NO:38), and T*C*G*T*C 3*T*T*T*T*C*G*G*C*G*G*L*L*C*C*G*C*C*G (SEQ ID NO:54), wherein L is dSpacer, * is phosphorothioate, and _ is phosphodiester.
36. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence chosen from
T*C*G*A*C*G*T*C*G_A_C*G*G*G*A*C*G*G*G (SEQ ID NO:21), T*C*G*A*C*G*T*C*G_A_C*G*T*G*A*C*G*G*G (SEQ ID NO:22), T*C*G*A*C*G*T*C*G*A*C*G*G*G*A*C*G*G*G (SEQ ID NO:21), χ*C*G*A*C*G*T*C*G*A*G*G*A*G*G*T (SEQ ID NO:25), T*C*G*A*C*G*T*C*G*A*G*C*G*A*A*G*C*T (SEQ ID NO:24), T*C*G*A*C*G*T*C*G*A*C*C*G*T*T*T*T*G*T*G*G (SEQ ID NO:20), and χ*C*G*A*C*G*T*C*G*A*G*A*G*T*T*G*G*G*C*T*C*T*C (SEQ ID NO:23), wherein * is phosphorothioate and _ is phosphodiester.
37. The immunostimulatory nucleic acid molecule of claim 1, comprising a sequence chosen from
T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*G (SEQ ID NO:62), T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G (SEQ ID NO:61), T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:65), T*C*G*T*C_G*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:66), T*C*G*T*C_G*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:67), χ*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*T (SEQ ID NO:63), T*C*G*T*C_G*A*C_G*A*T*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:64), T*C*G*T*C*G*A*C*G*A_T_C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:64), χ*C*G*A*C_G*T*C*G*A*C_G*T*G*A*C*G*T*T (SEQ ID NO:63), X*C*G*A*C_G*T*C*G*A*C*G*T_G*A*C*G*T*T (SEQ ID NO:63), and T*C*G*T*C_G*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G*T (SEQ ID NO:68), wherein * is phosphorothioate and _ is phosphodiester.
38. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from
T*C*G*C_G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:30), X*C*G_C*G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:30), and χ*C*G*C*G T*C*G*T*T*C _G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:30), wherein * is phosphorothioate and _ is phosphodiester.
39. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence T*C*G*C_G*A*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:27), wherein * is phosphorothioate and _ is phosphodiester.
40. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from
T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*T*G*C*C*G (SEQ ID NO:48), X*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G*C*C*G (SEQ ID NO:47), and X*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G (SEQ ID NO:46), wherein * is phosphorothioate and _ is phosphodiester.
41. The immunostimulatory nucleic acid molecule of claim 1 , comprising s a sequence T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*T*G*C*C*G (SEQ ID NO:48), wherein * is phosphorothioate and _ is phosphodiester.
42. The immunostimulatory nucleic acid molecule of claim 1 , wherein at least one nucleotide in the oligonucleotide is a substituted or modified purine or pyrimidine.
43. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted pyrimidine is a C5- or C6-substituted pyrimidine.
44. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted purine is a C8- or C7-substituted purine.
45. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 5-substituted cytosines, 6-substituted cytosines, N4-substituted cytosines, 5-aza-cytosine, 2-mercapto- cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems, and uracil derivatives, thymine derivatives, 7-deazaguanine, 7-deaza-7-substituted guanine, 7-deaza-8-substituted guanine, 7-deaza-8-aza guanine, hypoxanthine, N2-substituted guanines, 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, substituted adenines, 8-substituted guanine, and 6-thioguanine.
46. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 5-methyl-cytosine, 5- fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 6-hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl~cytosine, and unsubstituted or substituted 5-alkynyl-cytosine, N4-ethyl-cytosine, N,N'-propylene cytosine, phenoxazine, 5-fluoro-uracil, 5-bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5- propynyl-uracil, 2-thiothymine, 4-thiothymine, 6-substituted thymines, 7-deaza-7-(C2-C6)alkynylguanine, N2-methyl-guanine, N6-methyl-adenine, 8-oxo-adenine, 8 -hydroxy guanine, and 8-bromoguanine.
47. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted or modified purine or pyrimidine is selected from the group consisting of a universal base, an aromatic ring system, an aromatic ring system, and a hydrogen atom (dSpacer).
48. The immunostimulatory nucleic acid molecule of claim 42, wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 4-methyl-indole, 5- nitro-indole, 3-nitropynole, P-base, and K-base, benzimidazole, dichloro -benzimidazole, 1- methyl-lH-[l,2,4]triazole-3 -carboxylic acid amide, fluorobenzene, and difluorobenzene.
49. The immunostimulatory nucleic acid molecule of claim 1, wherein any of N, S, X, or Z is substituted by a residue selected from the group consisting of C6-C30 alkyl chain, bile acids, cholic acid, taurocholic acid, deoxycholate, cholesterol, oleyl litocholic acid, oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids, isoprenoids, steroids, vitamins, vitamin E, saturated fatty acids, unsaturated fatty acids, fatty acid esters, triglycerides, pyrenes, porphyrins, Texaphyrine, adamantane, acridines, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl, t-' butyldiphenylsilyl, cyanine dyes, cyanine dye Cy3, cyanine dye Cy576, Hoechst 33258 dye, psoralen, and ibuprofen.
50. An immunostimulatory nucleic acid molecule comprising (a) a 5' end beginning with an immunostimulatory motif chosen from (TCG)nN and RDCGYi Y2N, wherein T is thymine, C is unmethylated cytosine, G is guanine, R is a purine, D is not C, each of Yi and Y2 independently is a pyrimidine, n is an integer between 1 and 4, inclusive, and N is any sequence 0-12 bases long; (b) a 3' end terminating in an inverted repeat capable of forming a hairpin or stem- loop structure, said stmcture comprising a GC-rich stem 2 to 6 consecutive base pairs long, and at least one unmatched or mismatched base; and (c) a partially stabilized backbone comprising at least one phosphodiester 5'-CpG-3' linkage.
51. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem is 2 consecutive base pairs long.
52. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem is 3 consecutive base pairs long.
53. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem is 4 consecutive base pairs long.
54. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem is 5 consecutive base pairs long.
55. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem is 6 consecutive base pairs long.
56. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem comprises at least 2 G-C base pairs.
57. The immunostimulatory nucleic acid molecule of claim 50, wherein the GC-rich stem comprises at least 3 G-C base pairs.
58. The immunostimulatory nucleic acid molecule of any one of claims 50-57, wherein the at least one unmatched or mismatched base is T.
59. The immunostimulatory nucleic acid molecule of claim 50, wherein the partially stabilized backbone comprising at least one phosphodiester 5'-CpG-3' linkage further comprises a plurality of phosphorothioate internucleotide linkages.
60. The immunostimulatory nucleic acid molecule of claim 50, wherein the 5' end has a sequence provided as TCGTCGTTTTA (SEQ ID NO:41).
61. The immunostimulatory nucleic acid molecule of claim 50, wherein the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGCCGTGCCG (SEQ ID NO: 19).
62. The immunostimulatory nucleic acid molecule of claim 50, wherein the 3' end terminating in an inverted repeat has a base sequence provided as CGGCGTCGTGCCG (SEQ ID NO:9).
63. An immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:43).
64. An immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48).
65. An immunostimulatory nucleic acid having a base sequence provided as T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage.
66. An immunostimulatory nucleic acid having a base sequence provided as T*C*G*T*C*G*T*T*T*T*A*C_G*G*C_G*C*C_G*T*G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage.
67. An immunostimulatory nucleic acid having a base sequence provided as X*C*G*T*C*G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage.
68. An immunostimulatory nucleic acid having a base sequence provided as X*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G (SEQ ID NO:43), wherein * represents phosphorothioate internucleotide linkage and _ represents phosphodiester internucleotide linkage.
69. A vaccine comprising an immunostimulatory nucleic acid molecule of any one of claims 1-68 and an antigen.
70. A pharmaceutical composition comprising an immunostimulatory nucleic acid molecule of any one of claims 1-68 and a pharmaceutically acceptable carrier.
71. A method for inducing type I interferon (IFN) expression, comprising contacting a cell capable of expressing type I IFN with an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to induce expression of type I IFN.
72. The method of claim 71 , wherein the type I IFN is an interferon alpha (IFN-α).
73. A method for inducing gamma interferon (IFN-γ) expression, comprising contacting a cell capable of expressing IFN-γ with an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to induce expression of IFN-γ.
74. A method for activating a natural killer (NK) cell, comprising contacting an NK cell with an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to activate the NK cell.
75. A method for treating an infection, comprising administering to a subject having or at risk of developing an infection an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to treat or prevent the infection.
76. The method of claim 75, wherein the subject has or is at risk of developing an infection chosen from a viral, bacterial, fungal or parasitic infection.
77. The method of claim 75, wherein the subject has or is at risk of developing a viral infection with a vims chosen from hepatitis B vims (HBV), hepatitis C vims (HCV), cytomegalovirus (CMV), Epstein-Ban vims (EBV), papillomavims, human immunodeficiency vims (HIV), or herpes simplex vims (HSV).
78. The method of claim 75, wherein the subject has or is at risk of developing a bacterial infection with a species of bacterium chosen from Leishmania, Listeria, ox Anthrax.
79. A method for treating an allergic condition, comprising administering to a subject having or at risk of developing an allergic condition an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to treat or prevent the allergic condition.
80. The method of claim 79, wherein the allergic condition is allergic asthma.
81. A method for treating cancer, comprising administering to a subject having or at risk of developing a cancer an immunostimulatory nucleic acid of any one of claims 1-68, in an effective amount to treat or prevent the cancer.
82. The method of claim 81, wherein the cancer is chosen from basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system cancer, breast cancer, cervical cancer, choriocarcinoma, colon and rectum cancer, connective tissue cancer, cancer of the digestive system, endometrial cancer, esophageal cancer, eye cancer, cancer of the head and neck, gastric cancer, intra-epithelial neoplasm, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, lymphoma including Hodgkin's and non- Hodgkin's lymphoma, melanoma, myeloma, neuroblastoma, oral cavity cancer, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, renal cancer, cancer of the respiratory system, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, cancer of the urinary system, or other carcinomas and sarcomas.
83. The method of claim 81 , wherein the cancer is a cancer sensitive to treatment with interferon alpha (IFN-α).
84. The method of claim 83, wherein the cancer sensitive to treatment with IFN-α is chosen from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, AIDS-related Kaposi's sarcoma, renal cell carcinoma, prostate carcinoma, cervical dysplasia, or colon carcinoma.
85. Use of an immunostimulatory nucleic acid of any one of claims 1-68 for manufacture of a medicament for use in treatment of an infection.
86. Use of an immunostimulatory nucleic acid of any one of claims 1-68 for manufacture of a medicament for use in treatment of an allergic condition.
84. Use of an immunostimulatory nucleic acid of any one of claims 1 -68 for manufacture of a medicament for use in treatment of allergic asthma.
85. Use of an immunostimulatory nucleic acid of any one of claims 1-68 for manufacture of a medicament for use in treatment of a cancer.
PCT/US2004/036240 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency WO2005042018A2 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
AU2004285561A AU2004285561C1 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
AP2006003611A AP2006003611A0 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
NZ546275A NZ546275A (en) 2003-10-30 2004-10-29 C-class oligonucleotides analogs with enhanced immunostimulatory potency
EA200600865A EA008741B1 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
CA002540949A CA2540949A1 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
EP04810173A EP1678303A2 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
JP2006538383A JP2007509983A (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immune stimulation
BRPI0416079-7A BRPI0416079A (en) 2003-10-30 2004-10-29 c-class oligonucleotide analogs with increased immunostimulatory potency
KR1020067008222A KR101107818B1 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency
IL174428A IL174428A0 (en) 2003-10-30 2006-03-20 C-class oligonucleotide analogs with enhanced immunostimulatory potency
AU2006201495A AU2006201495A1 (en) 2003-10-30 2006-04-10 C-class oligonucleotide analogs with enhanced immunostimulatory potency
IL175215A IL175215A0 (en) 2003-10-30 2006-04-26 C-class oligonucleotide analogs with enhanced immunostimulatory potency
NO20061857A NO20061857L (en) 2003-10-30 2006-04-26 C-class oligonucleotide analogs with oct immunostimulatory potency
TNP2006000123A TNSN06123A1 (en) 2003-10-30 2006-04-28 C-class oligonucleotide analogs with enhaced immunostimulatory potency

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US51619303P 2003-10-30 2003-10-30
US60/516,193 2003-10-30

Publications (2)

Publication Number Publication Date
WO2005042018A2 true WO2005042018A2 (en) 2005-05-12
WO2005042018A3 WO2005042018A3 (en) 2005-07-21

Family

ID=34549500

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/036240 WO2005042018A2 (en) 2003-10-30 2004-10-29 C-class oligonucleotide analogs with enhanced immunostimulatory potency

Country Status (23)

Country Link
US (1) US8188254B2 (en)
EP (2) EP1728863A3 (en)
JP (1) JP2007509983A (en)
KR (1) KR101107818B1 (en)
CN (1) CN101454451A (en)
AP (1) AP2006003611A0 (en)
AU (2) AU2004285561C1 (en)
BR (1) BRPI0416079A (en)
CA (1) CA2540949A1 (en)
CR (1) CR8423A (en)
EA (1) EA008741B1 (en)
EC (1) ECSP066589A (en)
GE (1) GEP20094767B (en)
IL (2) IL174428A0 (en)
MA (1) MA28182A1 (en)
NO (1) NO20061857L (en)
NZ (2) NZ546475A (en)
OA (1) OA13278A (en)
SG (2) SG123799A1 (en)
TN (1) TNSN06123A1 (en)
UA (1) UA88457C2 (en)
WO (1) WO2005042018A2 (en)
ZA (2) ZA200602352B (en)

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006080946A2 (en) * 2004-06-08 2006-08-03 Coley Pharmaceutical Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
WO2006135434A2 (en) 2004-10-20 2006-12-21 Coley Pharmaceutical Group, Inc. Semi-soft c-class immunostimulatory oligonucleotides
WO2008094737A2 (en) * 2007-01-26 2008-08-07 Irm Llc Purine compounds and compositions as kinase inhibitors for the treatment of plasmodium related diseases
WO2008136748A1 (en) * 2007-05-04 2008-11-13 Index Pharmaceuticals Ab Tumour growth inhibitory compounds and methods of their use
WO2008138658A2 (en) * 2007-05-14 2008-11-20 Technische Universität München Pharmaceutical compounds comprising abasic oligonucleotides
WO2009022215A1 (en) * 2007-08-13 2009-02-19 Pfizer Inc. Combination motif immune stimulatory oligonucleotides with improved activity
JP2009517048A (en) * 2005-11-25 2009-04-30 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory oligoribonucleotides
JP2009528027A (en) * 2006-02-15 2009-08-06 コーリー ファーマシューティカル ゲーエムベーハー Compositions and methods for the formulation of oligonucleotides
JP2010504750A (en) * 2006-09-27 2010-02-18 コーリー ファーマシューティカル ゲーエムベーハー CpG oligonucleotide analogues containing hydrophobic T analogues with enhanced immunostimulatory activity
US7749975B2 (en) * 2001-10-24 2010-07-06 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
US7973069B2 (en) 2004-07-14 2011-07-05 Ptc Therapeutics, Inc. Methods for treating hepatitis C
CN103233011A (en) * 2013-04-22 2013-08-07 中国科学技术大学 Application of PEG (polyethylene glycol)-PLA (Poly Lactic Acid) nano-material-coated HBV (Hepatitis B Virus)-CpG (Cytosine Phosphate Guanosine) in prevention and/or treatment of hepatitis B
CN101932707B (en) * 2008-01-31 2013-08-21 库瑞瓦格有限责任公司 Nucleic acids of formula (i) (nuglxmgnnv)a and derivatives thereof as an immunostimulating agent/adjuvant
US8574564B2 (en) 2005-12-14 2013-11-05 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
WO2014173814A1 (en) 2013-04-22 2014-10-30 F. Hoffmann-La Roche Ag Combination therapy of antibodies against human csf-1r and tlr9 agonist
WO2015024992A3 (en) * 2013-08-22 2015-04-30 Cytos Biotechnology Ag Treatment of asthma
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
WO2015124614A1 (en) 2014-02-18 2015-08-27 Mologen Ag Covalently closed non-coding immunomodulatory dna construct
KR20160113332A (en) 2010-12-23 2016-09-28 몰로젠 아게 Non-coding immunomodulatory dna construct
US9580708B2 (en) 2011-09-14 2017-02-28 Rana Therapeutics, Inc. Multimeric oligonucleotides compounds
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9790494B2 (en) 2012-09-14 2017-10-17 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds having non-nucleotide based cleavable linkers
US9816094B2 (en) 2010-11-12 2017-11-14 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9902972B2 (en) 2006-06-12 2018-02-27 Kuros Biosciences Ag Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
US10058623B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating UTRN expression
US10059941B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10174323B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating ATP2A2 expression
US10174315B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating hemoglobin gene family expression
WO2019066571A2 (en) 2017-09-28 2019-04-04 연세대학교 산학협력단 Method for producing myeloid-derived suppressor cells, myeloid-derived suppressor cells produced thereby, and uses thereof
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
EP3393480A4 (en) * 2015-12-23 2020-04-22 Queensland University Of Technology Nucleic acid oligomers and uses therefor
US10655128B2 (en) 2012-05-16 2020-05-19 Translate Bio Ma, Inc. Compositions and methods for modulating MECP2 expression
US10758558B2 (en) 2015-02-13 2020-09-01 Translate Bio Ma, Inc. Hybrid oligonucleotides and uses thereof
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US10858650B2 (en) 2014-10-30 2020-12-08 The General Hospital Corporation Methods for modulating ATRX-dependent gene repression
US10900036B2 (en) 2015-03-17 2021-01-26 The General Hospital Corporation RNA interactome of polycomb repressive complex 1 (PRC1)
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses
US11578331B2 (en) 2015-09-09 2023-02-14 Gilead Sciences, Inc. Combination comprising immunostimulatory oligonucleotides
US11583581B2 (en) 2015-09-21 2023-02-21 Gilead Sciences, Inc. Methods of treating a retroviral infection

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030026782A1 (en) * 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
IL139813A0 (en) 1998-05-22 2002-02-10 Loeb Health Res Inst At The Ot Methods and products for inducing mucosal immunity
US20030022854A1 (en) 1998-06-25 2003-01-30 Dow Steven W. Vaccines using nucleic acid-lipid complexes
WO2000048630A1 (en) 1999-02-17 2000-08-24 Csl Limited Immunogenic complexes and methods relating thereto
EP1176966B1 (en) * 1999-04-12 2013-04-03 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Oligodeoxynucleotide and its use to induce an immune response
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
EP1366077B1 (en) * 2000-09-15 2011-05-25 Coley Pharmaceutical GmbH PROCESS FOR HIGH THROUGHPUT SCREENING OF CpG-BASED IMMUNO-AGONIST/ANTAGONIST
CN100334228C (en) * 2001-06-21 2007-08-29 戴纳瓦克斯技术公司 Cimeric immunomodulatory compounds and methods of using the same
IL160157A0 (en) 2001-08-17 2004-07-25 Coley Pharm Group Inc Combination motif immune stimulation oligonucleotides with improved activity
ES2734652T3 (en) 2002-04-04 2019-12-11 Zoetis Belgium S A Immunostimulatory oligonucleotides containing G and U
US7569553B2 (en) * 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
AR040996A1 (en) 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
ATE544466T1 (en) 2002-10-29 2012-02-15 Coley Pharm Group Inc USE OF CPG OLIGONUCLEOTIDES TO TREAT HEPATITIS C VIRUS INFECTION
WO2004053104A2 (en) * 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5’ cpg nucleic acids and methods of use
JP4989225B2 (en) * 2003-09-25 2012-08-01 コーリー ファーマシューティカル グループ,インコーポレイテッド Nucleic acid lipophilic conjugate
KR101107818B1 (en) 2003-10-30 2012-01-31 콜레이 파마시티컬 그룹, 인코포레이티드 C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
CA2687535C (en) * 2007-05-18 2017-08-22 Coley Pharmaceutical Gmbh Phosphate-modified oligonucleotide analogs with enhanced immunostimulatory activity
KR20100068422A (en) * 2007-10-09 2010-06-23 콜리 파마슈티칼 게엠베하 Immune stimulatory oligonucleotide analogs containing modified sugar moieties
PE20110998A1 (en) * 2008-12-09 2012-02-10 Coley Pharm Group Inc IMMUNOSTIMULATORY OLIGONUCLEOTIDES
US8552165B2 (en) * 2008-12-09 2013-10-08 Heather Davis Immunostimulatory oligonucleotides
EP2411521B1 (en) 2009-03-25 2015-01-14 The Board of Regents of The University of Texas System Compositions for stimulation of mammalian innate immune resistance to pathogens
JP5785168B2 (en) * 2009-07-31 2015-09-24 エスリス ゲーエムベーハーethris GmbH RNA having a combination of unmodified and modified nucleotides for protein expression
EP3511426B1 (en) 2012-02-01 2022-08-17 Gen-Probe Incorporated Asymmetric hairpin target capture oligomers
CN105925583B (en) * 2013-11-08 2019-05-17 上海交通大学 Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof
EP3508198A1 (en) 2014-06-04 2019-07-10 Exicure, Inc. Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
WO2016044839A2 (en) 2014-09-19 2016-03-24 The Board Of Regents Of The University Of Texas System Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds
CN109415731A (en) 2016-05-06 2019-03-01 埃克西奎雷股份有限公司 Present liposome spherical shape nucleic acid (SNA) construct that the antisense oligonucleotides (ASO) of low interleukin-17 acceptor mRNA is struck for specificity
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
JP7458977B2 (en) * 2017-12-15 2024-04-01 エランコ アニマル ヘルス ゲー・エム・ベー・ハー Immunostimulatory Compositions

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5658738A (en) 1994-05-31 1997-08-19 Becton Dickinson And Company Bi-directional oligonucleotides that bind thrombin

Family Cites Families (133)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5194428A (en) 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US4806463A (en) 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5004810A (en) 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5166195A (en) 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
CA2139319A1 (en) 1992-07-02 1994-01-20 Sudhir Agrawal Self-stabilized oligonucleotides as therapeutic agents
US5523389A (en) 1992-09-29 1996-06-04 Isis Pharmaceuticals, Inc. Inhibitors of human immunodeficiency virus
US5646126A (en) 1994-02-28 1997-07-08 Epoch Pharmaceuticals Sterol modified oligonucleotide duplexes having anticancer activity
US6727230B1 (en) 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US5696248A (en) 1994-06-15 1997-12-09 Hoechst Aktiengesellschaft 3'-modified oligonucleotide derivatives
EP1167377B2 (en) 1994-07-15 2012-08-08 University of Iowa Research Foundation Immunomodulatory oligonucleotides
US20030050263A1 (en) 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20030026782A1 (en) 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US5856462A (en) * 1996-09-10 1999-01-05 Hybridon Incorporated Oligonucleotides having modified CpG dinucleosides
ES2241042T3 (en) 1996-10-11 2005-10-16 The Regents Of The University Of California IMMUNO STIMULATOR POLINUCLEOTIDE CONJUGATES / IMMUNOMODULATOR MOLECULA.
AU7890598A (en) 1996-12-27 1998-07-31 Yoshitomi Pharmaceutical Industries, Ltd. Fused pyrimidine compounds and medicinal use thereof
EP0855184A1 (en) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
CA2281838A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated cpg dinucleotide in the treatment of lps-associated disorders
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6426334B1 (en) 1997-04-30 2002-07-30 Hybridon, Inc. Oligonucleotide mediated specific cytokine induction and reduction of tumor growth in a mammal
DE69838294T2 (en) 1997-05-20 2009-08-13 Ottawa Health Research Institute, Ottawa Process for the preparation of nucleic acid constructs
US5939421A (en) 1997-07-01 1999-08-17 Signal Pharmaceuticals, Inc. Quinazoline analogs and related compounds and methods for treating inflammatory conditions
DE69840025D1 (en) 1997-07-03 2008-10-30 Donald E Macfarlane ASSOCIATED ANSWERS
CA2323929C (en) 1998-04-03 2004-03-09 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
JP2002513763A (en) 1998-05-06 2002-05-14 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Methods for preventing and treating parasitic infections and related diseases using CPG oligonucleotides
WO1999058118A2 (en) 1998-05-14 1999-11-18 Cpg Immunopharmaceuticals Gmbh METHODS FOR REGULATING HEMATOPOIESIS USING CpG-OLIGONUCLEOTIDES
IL139813A0 (en) 1998-05-22 2002-02-10 Loeb Health Res Inst At The Ot Methods and products for inducing mucosal immunity
US6562798B1 (en) 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
JP2002521489A (en) 1998-07-27 2002-07-16 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Stereoisomers of CpG oligonucleotides and related methods
EP1108017A2 (en) 1998-09-03 2001-06-20 Coley Pharmaceutical GmbH G-motif oligonucleotides and uses thereof
WO2000015645A1 (en) 1998-09-11 2000-03-23 Kyorin Pharmaceutical Co., Ltd. Phosphonic ester derivatives and process for producing the same
US6207819B1 (en) 1999-02-12 2001-03-27 Isis Pharmaceuticals, Inc. Compounds, processes and intermediates for synthesis of mixed backbone oligomeric compounds
WO2000054803A2 (en) * 1999-03-16 2000-09-21 Panacea Pharmaceuticals, Llc Immunostimulatory nucleic acids and antigens
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
EP1176966B1 (en) 1999-04-12 2013-04-03 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Oligodeoxynucleotide and its use to induce an immune response
AU4978100A (en) 1999-04-29 2000-11-17 Coley Pharmaceutical Gmbh Screening for immunostimulatory dna functional modifyers
WO2000076982A1 (en) 1999-06-16 2000-12-21 University Of Iowa Research Foundation Antagonism of immunostimulatory cpg-oligonucleotides by 4-aminoquinolines and other weak bases
US6514948B1 (en) 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
AU783745B2 (en) 1999-08-13 2005-12-01 Hybridon, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
AP1775A (en) 1999-09-25 2007-08-28 Univ Iowa Res Found Immunostimulatory nucleic acids.
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
ATE378348T1 (en) 2000-01-14 2007-11-15 Us Health OLIGODEOXYNUCLEOTIDES AND THEIR USE FOR INDUCING AN IMMUNE RESPONSE
CA2396871A1 (en) 2000-01-20 2001-12-20 Ottawa Health Research Institute Immunostimulatory nucleic acids for inducing a th2 immune response
US6815429B2 (en) 2000-01-26 2004-11-09 Hybridon, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
US6887580B2 (en) * 2000-02-01 2005-05-03 Nippon Steel Chemical Co., Ltd. Adhesive polyimide resin and adhesive laminate
US7585847B2 (en) 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US6613751B2 (en) 2000-02-23 2003-09-02 The Regents Of The University Of California Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
US20020156033A1 (en) 2000-03-03 2002-10-24 Bratzler Robert L. Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
US20040131628A1 (en) 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
AU5736601A (en) 2000-05-01 2001-11-12 Hybridon Inc Modulation of oligonucleotide cpg-mediated immune stimulation by positional modification of nucleosides
US20020013287A1 (en) 2000-05-09 2002-01-31 Reliable Biopharmaceuticals, Inc. St Louis Missouri Polymeric compounds useful as prodrugs
WO2001097843A2 (en) 2000-06-22 2001-12-27 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US20020165178A1 (en) 2000-06-28 2002-11-07 Christian Schetter Immunostimulatory nucleic acids for the treatment of anemia, thrombocytopenia, and neutropenia
US20020198165A1 (en) 2000-08-01 2002-12-26 Bratzler Robert L. Nucleic acids for the prevention and treatment of gastric ulcers
US20020091097A1 (en) 2000-09-07 2002-07-11 Bratzler Robert L. Nucleic acids for the prevention and treatment of sexually transmitted diseases
EP1366077B1 (en) 2000-09-15 2011-05-25 Coley Pharmaceutical GmbH PROCESS FOR HIGH THROUGHPUT SCREENING OF CpG-BASED IMMUNO-AGONIST/ANTAGONIST
ES2298269T3 (en) 2000-09-26 2008-05-16 Idera Pharmaceuticals, Inc. MODULATION OF THE IMMUNO-STIMULATING ACTIVITY OF OLIGONUCLEOTIDIC ANALOGS IMMUNO-STIMULANTS THROUGH POSITIONAL CHEMICAL CHANGES.
NZ525320A (en) 2000-10-18 2004-10-29 Glaxosmithkline Biolog S Combinations of immunostimulatory oligonucleotides (CpG), saponin and optionally lipopolysaccharides as potent vaccine adjuvants
DE60134421D1 (en) 2000-12-08 2008-07-24 Coley Pharmaceuticals Gmbh CPG-ART NUCLEIC ACIDS AND METHOD FOR THEIR USE
AU2002248185A1 (en) 2000-12-14 2002-07-16 Coley Pharmaceutical Group, Inc. Inhibition of angiogenesis by nucleic acids
US20030050268A1 (en) 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US7176296B2 (en) 2001-04-30 2007-02-13 Idera Pharmaceuticals, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
US7785610B2 (en) 2001-06-21 2010-08-31 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—III
US20040132677A1 (en) 2001-06-21 2004-07-08 Fearon Karen L. Chimeric immunomodulatory compounds and methods of using the same-IV
CN100334228C (en) 2001-06-21 2007-08-29 戴纳瓦克斯技术公司 Cimeric immunomodulatory compounds and methods of using the same
US20030003970A1 (en) 2001-06-28 2003-01-02 Alan Johnson Portable communications device
WO2003012061A2 (en) 2001-08-01 2003-02-13 Coley Pharmaceutical Gmbh Methods and compositions relating to plasmacytoid dendritic cells
US7354909B2 (en) 2001-08-14 2008-04-08 The United States Of America As Represented By Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
IL160157A0 (en) 2001-08-17 2004-07-25 Coley Pharm Group Inc Combination motif immune stimulation oligonucleotides with improved activity
US20030067902A1 (en) * 2001-09-21 2003-04-10 Skeba Kirk W. Method for providing multiple certified radio modules with a baseband
IL160837A0 (en) 2001-10-05 2004-08-31 Coley Pharm Gmbh Toll-like receptor 3 signaling agonists and antagonists
WO2003094836A2 (en) 2001-10-12 2003-11-20 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
RU2185819C1 (en) * 2001-10-18 2002-07-27 Дорофеенко Алла Ивановна Agent showing antitumor effect
US7276489B2 (en) 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
WO2003035836A2 (en) 2001-10-24 2003-05-01 Hybridon Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends
US20030232443A1 (en) 2002-06-18 2003-12-18 Isis Pharmaceuticals Inc. Antisense modulation of centromere protein B expression
ES2734652T3 (en) 2002-04-04 2019-12-11 Zoetis Belgium S A Immunostimulatory oligonucleotides containing G and U
EP2264172B1 (en) 2002-04-05 2017-09-27 Roche Innovation Center Copenhagen A/S Oligomeric compounds for the modulation of hif-1alpha expression
US20040009949A1 (en) 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
WO2004007743A2 (en) 2002-07-17 2004-01-22 Coley Pharmaceutical Gmbh Use of cpg nucleic acids in prion-disease
CN1468957A (en) 2002-07-19 2004-01-21 中国人民解放军第二军医大学 Plasmid used as human therapeutic vaccine adjuvant
AR040996A1 (en) 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
AU2003278845A1 (en) 2002-09-19 2004-04-08 Coley Pharmaceutical Gmbh Toll-like receptor 9 (tlr9) from various mammalian species
ATE544466T1 (en) 2002-10-29 2012-02-15 Coley Pharm Group Inc USE OF CPG OLIGONUCLEOTIDES TO TREAT HEPATITIS C VIRUS INFECTION
WO2004053104A2 (en) 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5’ cpg nucleic acids and methods of use
EP1625140A4 (en) 2002-12-23 2008-06-18 Dynavax Tech Corp Branched immunomodulatory compounds and methods of using the same
WO2004064782A2 (en) 2003-01-16 2004-08-05 Hybridon, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
WO2004087203A2 (en) * 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
WO2004094671A2 (en) 2003-04-22 2004-11-04 Coley Pharmaceutical Gmbh Methods and products for identification and assessment of tlr ligands
WO2005001055A2 (en) 2003-06-11 2005-01-06 Hybridon, Inc. Stabilized immunomodulatory oligonucleotides
CA2528774A1 (en) 2003-06-20 2005-01-27 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (tlr) antagonists
JP4989225B2 (en) 2003-09-25 2012-08-01 コーリー ファーマシューティカル グループ,インコーポレイテッド Nucleic acid lipophilic conjugate
US20050215501A1 (en) 2003-10-24 2005-09-29 Coley Pharmaceutical Group, Inc. Methods and products for enhancing epitope spreading
KR101107818B1 (en) 2003-10-30 2012-01-31 콜레이 파마시티컬 그룹, 인코포레이티드 C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
CA2549173A1 (en) 2003-12-08 2005-07-07 Hybridon, Inc. Modulation of immunostimulatory properties by small oligonucleotide-based compounds
WO2005097993A2 (en) 2004-02-19 2005-10-20 Coley Pharmaceutical Group, Inc. Immunostimulatory viral rna oligonucleotides
CA2560108A1 (en) 2004-04-02 2005-11-24 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing il-10 responses
EP1753453A2 (en) 2004-06-08 2007-02-21 Coley Pharmaceutical GmbH Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
HUE036894T2 (en) 2004-06-15 2018-08-28 Idera Pharmaceuticals Inc Immunostimulatory oligonucleotide multimers
US7427405B2 (en) 2004-06-15 2008-09-23 Idera Pharmaceuticals, Inc. Immunostimulatory oligonucleotide multimers
JP2008506683A (en) 2004-07-18 2008-03-06 コーリー ファーマシューティカル グループ, リミテッド Methods and compositions for inducing innate immune responses
NZ553244A (en) 2004-07-18 2009-10-30 Csl Ltd Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses
MY159370A (en) 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
WO2006091915A2 (en) 2005-02-24 2006-08-31 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
KR20080008350A (en) 2005-04-08 2008-01-23 콜레이 파마시티컬 그룹, 인코포레이티드 Methods for treating infectious disease exacerbated asthma
AU2006241149A1 (en) 2005-04-26 2006-11-02 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
AU2006269555A1 (en) 2005-07-07 2007-01-18 Coley Pharmaceutical Group, Inc. Anti-CTLA-4 antibody and CpG-motif-containing synthetic oligodeoxynucleotide combination therapy for cancer treatment
KR20080047463A (en) 2005-09-16 2008-05-28 콜리 파마슈티칼 게엠베하 Modulation of immunostimulatory properties of short interfering ribonucleic acid (sirna) by nucleotide modification
KR20080048067A (en) 2005-09-16 2008-05-30 콜리 파마슈티칼 게엠베하 Immunostimulatory single-stranded ribonucleic acid with phosphodiester backbone
PT1957647E (en) 2005-11-25 2015-06-01 Zoetis Belgium S A Immunostimulatory oligoribonucleotides
ES2553284T5 (en) 2006-02-15 2021-08-31 Rechtsanwalt Thomas Beck Compositions and Procedures for Oligonucleotide Formulations
US8027888B2 (en) 2006-08-31 2011-09-27 Experian Interactive Innovation Center, Llc Online credit card prescreen systems and methods
WO2008033432A2 (en) 2006-09-12 2008-03-20 Coley Pharmaceutical Group, Inc. Immune modulation by chemically modified ribonucleosides and oligoribonucleotides
AU2007300378A1 (en) 2006-09-27 2008-04-03 Coley Pharmaceutical Gmbh Compositions of TLR ligands and antivirals
NZ575437A (en) 2006-09-27 2012-02-24 Coley Pharm Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
CN101558157A (en) 2006-10-26 2009-10-14 科勒制药有限责任公司 Oligoribonucleotides and uses thereof
US20090142362A1 (en) 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
KR20100010509A (en) 2007-05-17 2010-02-01 콜레이 파마시티컬 그룹, 인코포레이티드 Class a oligonucleotides with immunostimulatory potency

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5658738A (en) 1994-05-31 1997-08-19 Becton Dickinson And Company Bi-directional oligonucleotides that bind thrombin
US5668265A (en) 1994-05-31 1997-09-16 Becton Dickinson And Company Bi-directional oligonucleotides that bind thrombin

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DURAND M ET AL.: "Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains", BIOCHEMISTRY, vol. 31, 1992, pages 9197 - 204
FONTANEL ML ET AL.: "Sterical recognition by T4 polynucleotide kinase of non-nucleosidic moieties 5'-attached to oligonucleotides", NUCLEIC ACIDS RES, vol. 22, 1994, pages 2022 - 7
HARTMANN G ET AL., PROC NATL ACAD SCI USA, vol. 96, 1999, pages 9305 - 10
JIANG Z ET AL.: "Pseudo-cyclic oligonucleotides: in vitro and in vivo properties", BIOORG MED CHEM, vol. 7, 1999, pages 2727 - 35
LIANG H ET AL., J CLIN INVEST, vol. 98, 1996, pages 1119 - 29
See also references of EP1678303A2
SELIGER H ET AL., OLIGONUCLEOTIDE ANALOGS, 1991
YI AK ET AL., JLMMUNOL, vol. 160, 1998, pages 5898 - 906

Cited By (86)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7749975B2 (en) * 2001-10-24 2010-07-06 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
WO2006080946A3 (en) * 2004-06-08 2006-12-21 Coley Pharm Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
WO2006080946A2 (en) * 2004-06-08 2006-08-03 Coley Pharmaceutical Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
US7973069B2 (en) 2004-07-14 2011-07-05 Ptc Therapeutics, Inc. Methods for treating hepatitis C
WO2006135434A2 (en) 2004-10-20 2006-12-21 Coley Pharmaceutical Group, Inc. Semi-soft c-class immunostimulatory oligonucleotides
JP2009517048A (en) * 2005-11-25 2009-04-30 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory oligoribonucleotides
US8574564B2 (en) 2005-12-14 2013-11-05 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
EP1991678B1 (en) * 2006-02-15 2015-09-09 AdiuTide Pharmaceuticals GmbH Compositions and methods for oligonucleotide formulations
EP2405002A1 (en) * 2006-02-15 2012-01-11 AdiuTide Pharmaceuticals GmbH Compositions and methods for oligonucleotide formulations
JP2014011998A (en) * 2006-02-15 2014-01-23 Adiutide Pharmaceutical Gmbh Composition and method for oligonucleotide formulation
JP2009528027A (en) * 2006-02-15 2009-08-06 コーリー ファーマシューティカル ゲーエムベーハー Compositions and methods for the formulation of oligonucleotides
EP1991678B2 (en) 2006-02-15 2020-07-15 Rechtsanwalt Thomas Beck Compositions and methods for oligonucleotide formulations
US10358656B2 (en) 2006-06-12 2019-07-23 Kuros Biosciences Ag Oligonucleotides packaged into virus-like particles of RNA bacteriophages
US9902972B2 (en) 2006-06-12 2018-02-27 Kuros Biosciences Ag Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US10260071B2 (en) 2006-09-27 2019-04-16 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
RU2477315C2 (en) * 2006-09-27 2013-03-10 Коули Фармасьютикал ГмбХ Cpg-oligonucleotide analogues, containing hydrophobic t-analogues with amplified immunostimulatory activity
JP2014036652A (en) * 2006-09-27 2014-02-27 Coley Pharmaceutical Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
JP2010504750A (en) * 2006-09-27 2010-02-18 コーリー ファーマシューティカル ゲーエムベーハー CpG oligonucleotide analogues containing hydrophobic T analogues with enhanced immunostimulatory activity
WO2008094737A3 (en) * 2007-01-26 2009-03-12 Irm Llc Purine compounds and compositions as kinase inhibitors for the treatment of plasmodium related diseases
WO2008094737A2 (en) * 2007-01-26 2008-08-07 Irm Llc Purine compounds and compositions as kinase inhibitors for the treatment of plasmodium related diseases
WO2008136748A1 (en) * 2007-05-04 2008-11-13 Index Pharmaceuticals Ab Tumour growth inhibitory compounds and methods of their use
US8309529B2 (en) 2007-05-04 2012-11-13 Index Pharmaceuticals Ab Tumour growth inhibitory compounds and methods of their use
EP2573176A1 (en) * 2007-05-04 2013-03-27 Index Pharmaceuticals AB Tumour growth inhibitory compounds and methods of their use
WO2008138658A3 (en) * 2007-05-14 2009-04-23 Univ Muenchen Tech Pharmaceutical compounds comprising abasic oligonucleotides
WO2008138658A2 (en) * 2007-05-14 2008-11-20 Technische Universität München Pharmaceutical compounds comprising abasic oligonucleotides
EP2591787A1 (en) * 2007-08-13 2013-05-15 Pfizer Inc Combination motif immune stimulatory oligonucleotides with improved activity
US20120219571A1 (en) * 2007-08-13 2012-08-30 Coley Pharmaceutical Gmbh Combination motif immune stimulatory oligonucleotides with improved activity
US8198251B2 (en) 2007-08-13 2012-06-12 Coley Pharmaceutical Gmbh Combination motif immune stimulatory oligonucleotides with improved activity
WO2009022215A1 (en) * 2007-08-13 2009-02-19 Pfizer Inc. Combination motif immune stimulatory oligonucleotides with improved activity
CN101932707B (en) * 2008-01-31 2013-08-21 库瑞瓦格有限责任公司 Nucleic acids of formula (i) (nuglxmgnnv)a and derivatives thereof as an immunostimulating agent/adjuvant
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9764031B2 (en) 2010-05-26 2017-09-19 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
US11066673B2 (en) 2010-11-12 2021-07-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10119144B2 (en) 2010-11-12 2018-11-06 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10358644B2 (en) 2010-11-12 2019-07-23 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9816094B2 (en) 2010-11-12 2017-11-14 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9856479B2 (en) 2010-11-12 2018-01-02 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10053694B2 (en) 2010-11-12 2018-08-21 The General Hospital Corporation Polycomb-associated non-coding RNAS
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
KR20160113332A (en) 2010-12-23 2016-09-28 몰로젠 아게 Non-coding immunomodulatory dna construct
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses
US10704046B2 (en) 2011-09-14 2020-07-07 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds
US9732340B2 (en) 2011-09-14 2017-08-15 Translate Bio Ma, Inc. Multimeric oligonucleotides compounds having cleavable linkers
US10093924B2 (en) 2011-09-14 2018-10-09 Translate Bio Ma, Inc. Multimetric oligonucleotide compounds
US9732341B2 (en) 2011-09-14 2017-08-15 Translate Bio Ma, Inc. Methods of delivering multiple targeting oligonucleotides to a cell using cleavable linkers
US9580708B2 (en) 2011-09-14 2017-02-28 Rana Therapeutics, Inc. Multimeric oligonucleotides compounds
US10059941B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US10174323B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating ATP2A2 expression
US10174315B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating hemoglobin gene family expression
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US11788089B2 (en) 2012-05-16 2023-10-17 The General Hospital Corporation Compositions and methods for modulating MECP2 expression
US10058623B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating UTRN expression
US10655128B2 (en) 2012-05-16 2020-05-19 Translate Bio Ma, Inc. Compositions and methods for modulating MECP2 expression
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US10844375B2 (en) 2012-09-14 2020-11-24 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds having non-nucleotide based cleavable linkers
US9790494B2 (en) 2012-09-14 2017-10-17 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds having non-nucleotide based cleavable linkers
CN103233011A (en) * 2013-04-22 2013-08-07 中国科学技术大学 Application of PEG (polyethylene glycol)-PLA (Poly Lactic Acid) nano-material-coated HBV (Hepatitis B Virus)-CpG (Cytosine Phosphate Guanosine) in prevention and/or treatment of hepatitis B
WO2014173814A1 (en) 2013-04-22 2014-10-30 F. Hoffmann-La Roche Ag Combination therapy of antibodies against human csf-1r and tlr9 agonist
WO2015024992A3 (en) * 2013-08-22 2015-04-30 Cytos Biotechnology Ag Treatment of asthma
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
WO2015124614A1 (en) 2014-02-18 2015-08-27 Mologen Ag Covalently closed non-coding immunomodulatory dna construct
US10858650B2 (en) 2014-10-30 2020-12-08 The General Hospital Corporation Methods for modulating ATRX-dependent gene repression
US10758558B2 (en) 2015-02-13 2020-09-01 Translate Bio Ma, Inc. Hybrid oligonucleotides and uses thereof
US10900036B2 (en) 2015-03-17 2021-01-26 The General Hospital Corporation RNA interactome of polycomb repressive complex 1 (PRC1)
US11578331B2 (en) 2015-09-09 2023-02-14 Gilead Sciences, Inc. Combination comprising immunostimulatory oligonucleotides
US11583581B2 (en) 2015-09-21 2023-02-21 Gilead Sciences, Inc. Methods of treating a retroviral infection
EP3393480A4 (en) * 2015-12-23 2020-04-22 Queensland University Of Technology Nucleic acid oligomers and uses therefor
US11534451B2 (en) 2015-12-23 2022-12-27 Repluca Pty Ltd Nucleic acid oligomers and uses therefor
US11911410B2 (en) 2015-12-23 2024-02-27 Repluca Pty Ltd Nucleic acid oligomers and uses therefor
WO2019066571A2 (en) 2017-09-28 2019-04-04 연세대학교 산학협력단 Method for producing myeloid-derived suppressor cells, myeloid-derived suppressor cells produced thereby, and uses thereof
US11806364B2 (en) 2017-09-28 2023-11-07 Industry-Academic Cooperation Foundation, Yonsei University Method for producing myeloid-derived suppressor cells, myeloid-derived suppressor cells produced thereby, and methods thereof

Also Published As

Publication number Publication date
IL174428A0 (en) 2006-08-01
EP1728863A2 (en) 2006-12-06
EA008741B1 (en) 2007-08-31
CA2540949A1 (en) 2005-05-12
NO20061857L (en) 2006-07-31
SG122973A1 (en) 2006-06-29
UA88457C2 (en) 2009-10-26
IL175215A0 (en) 2006-09-05
NZ546275A (en) 2009-05-31
ZA200603212B (en) 2008-03-26
AU2004285561C1 (en) 2012-06-21
NZ546475A (en) 2008-08-29
ECSP066589A (en) 2006-10-17
SG123799A1 (en) 2006-07-26
WO2005042018A3 (en) 2005-07-21
US8188254B2 (en) 2012-05-29
KR101107818B1 (en) 2012-01-31
OA13278A (en) 2007-01-31
AP2006003611A0 (en) 2006-06-30
KR20060109443A (en) 2006-10-20
TNSN06123A1 (en) 2007-11-15
ZA200602352B (en) 2007-09-26
CR8423A (en) 2007-09-03
CN101454451A (en) 2009-06-10
BRPI0416079A (en) 2007-01-02
EP1678303A2 (en) 2006-07-12
EP1728863A3 (en) 2006-12-20
US20050239734A1 (en) 2005-10-27
JP2007509983A (en) 2007-04-19
EA200600865A1 (en) 2006-10-27
AU2006201495A1 (en) 2006-04-27
GEP20094767B (en) 2009-09-10
AU2004285561B2 (en) 2011-11-24
AU2004285561A1 (en) 2005-05-12
MA28182A1 (en) 2006-09-01

Similar Documents

Publication Publication Date Title
US8188254B2 (en) C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20180171338A1 (en) Compositions and methods for oligonucleotide formulations
US7956043B2 (en) 5′ CpG nucleic acids and methods of use
AU2004275876B2 (en) Nucleic acid-lipophilic conjugates
US20060211644A1 (en) Immunostimulatory oligonucleotides
EP2078080A2 (en) Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
WO2009047610A1 (en) Immune stimulatory oligonucleotide analogs containing modified sugar moieties
MXPA06004891A (en) C-class oligonucleotide analogs with enhanced immunostimulatory potency

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480032018.4

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 174428

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2004285561

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2006/02352

Country of ref document: ZA

Ref document number: 200602352

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 2540949

Country of ref document: CA

Ref document number: 546275

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2004810173

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12006500712

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2004285561

Country of ref document: AU

Date of ref document: 20041029

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004285561

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 175215

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2006538383

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 1020067008222

Country of ref document: KR

Ref document number: PA/a/2006/004891

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: AP/P/2006/003611

Country of ref document: AP

WWE Wipo information: entry into national phase

Ref document number: DZP2006000227

Country of ref document: DZ

WWE Wipo information: entry into national phase

Ref document number: 1367/KOLNP/2006

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 06050574

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 200600865

Country of ref document: EA

Ref document number: CR2006-008423

Country of ref document: CR

WWE Wipo information: entry into national phase

Ref document number: 9419

Country of ref document: GE

Ref document number: 20060202

Country of ref document: UZ

Ref document number: 1200600860

Country of ref document: VN

WWP Wipo information: published in national office

Ref document number: 2004810173

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020067008222

Country of ref document: KR

ENP Entry into the national phase

Ref document number: PI0416079

Country of ref document: BR