WO2005040216A2 - Use of metallic cations to improve functional activity of antibodies - Google Patents

Abstract

The present invention relates to the use of metallic cations, in particular zinc, to improve functional activity of antibodies. More particularly, said invention is concerned with pharmaceutical compositions, comprising antibodies with metallic cations.

Description

 USE OF METAL CATIONS FOR IMPROVING THE FUNCTIONAL ACTIVITY OF ANTIBODIES

The present invention relates to the use of metal cations, in particular divalent or trivalent, and more particularly of Zinc, Copper, Cadmium or Iron, to improve the functional activity of antibodies. More particularly, the subject of the invention is pharmaceutical compositions of antibodies comprising divalent or trivalent metal cations.

Introduction and prior art

Passive immunotherapy, which is very widespread, is based on the administration of antibodies, for example monoclonal antibodies directed against a given cell or substance. Passive immunotherapy using monoclonal antibodies has given encouraging results. However, if the use of monoclonal antibodies has several advantages, such as an assurance of product safety as regards the absence of infectious contamination, it can however prove difficult to obtain an effective monoclonal antibodies.

Indeed, the risk is to develop a monoclonal anticoφs which proves to be ineffective and for which one observes side effects incompatible with a use in clinical therapy. These two aspects are closely linked, knowing that weakly active anticoφs are administered in high doses to compensate for their weak activity and obtain a therapeutic response. The administration of large doses not only induces side effects but is economically unprofitable.

These problems are major in the industrial development of monoclonal, chimeric, humanized or human anticoφs. For example, the company Protein Design Labs has suspended clinical trials in phase EV of Remitogen®, which is an anti-HLA-DR anticoφs that can be used to treat cancers of MHC cells of class π positive, in particular leukemia of B and T lymphocytes.

Thus, one of the objects of the invention is to provide new products or methods making it possible to overcome the drawbacks encountered during the industrial development of anticoφs, namely their low efficiency and their high cost.

Today, research is focused on the Fc region of immunoglobulin (Ig) in order to improve the functional properties of anticoφs. Ultimately, this should make it possible to obtain anticoφs which bind and activate the receptors of effector cells (monocytes / macrophages, B lymphocytes, NK cells and dendritics) more efficiently. The Fc region of IgG consists of 2 globular domains named CH2 and CH3. The 2 heavy chains interact closely at the level of the CH3 domains while at the level of the CH2 domains, the presence, on each of the 2 chains, of an oligosaccharide linked to Asn 297 (Kabat numbering) contributes to the separation of the 2 CH2 domains. Furthermore, the CH2 and CH3 domains of the same chain are separated by a flexible region defining an interface between the 2 domains.

The interface between the CH2-CH3 domains has been described as a common site for the attachment of numerous (glyco) proteins such as FcRn, rheumatoid factors (Coφer et al., 1997) and certain bacterial and viral proteins, for example the protein A of Staphylococcus aureus (Deisenhofer, 1981), protein G of Streptococcus group G (Sauer-Eriksson et al., 1995), the gE-gl complex of the Heφes simplex 1 virus (Chapman et al., 1999)) and the “core” protein of the hepatitis C virus (Maillard and α /., 2004).

Furthermore, it has been demonstrated that certain amino acid residues, located at this interface in the CH2 domain or the CH3 domain, were involved in the binding to FcRn, to protein A, etc. Thus, human IgGl mutated in the histidine residue 435 (His 435, Kabat numbering) lose their capacity to fix FcRn and protein A but retain their capacity to fix FcγRUI (Firan et al ^ 2001; Shields et al-, 2001).

On the other hand, none of the studies notifying modifications of the CH2-CH3 interface of human or murine IgG, shows any relation between the structure of this part of the IgG molecule and the effector capacities of these IgG via the receptors FcγR (FcγRI, FcγRII, FcγRIÏÏ).

In the context of the invention, we have deteπαiné the three-dimensional structure of the Fc regions of different monoclonal anticoφs having different functional activities, including ADCC activity and induction of cytokine production. We have discovered the presence of a zinc ion located between the CH2 and CH3 domains, more precisely, linked to residues located at the interface of the CH2-CH3 domains involved in the recognition of the Fc region of Panticoφs by the FcRn receptor as well as in the binding of protein A, derived from the bacterial wall of Staphylococcus aureus.

Due to its location at the interface of the CH2 and CH3 domains, this zinc atom plays an important role in the general conformation of Fc, and thereby allows the improvement of the binding of Fc to its FcγRs receptors.

Our studies of the three-dimensional structure of the Fc region of these anticoφs revealed that the presence of metal cations such as Zinc, Copper, Cadmium or Iron, in the crystallization solution was always associated with the so-called open conformation of the Fc region of IgG (Radaev et al., 2001). This open conformation promotes attachment to FcγR receptors, in particular to FcγRIIL. Thus, it is now possible to potentiate the functional activity of monoclonal or polyclonal anticoφs by means of metal cations. In contrast, the abolition of the fixation of metal cations such as zinc, copper, cadmium or iron with anticoφs, more particularly at the CH2-CH3 interface, by using mutants of the peptide sequence or appropriate chemicals, leads to obtaining anticoφs with repealed or greatly diminished functional properties.

Thus, the invention provides an economical and universal solution to solve the problems linked to the low efficiency of the monoclonal anticoφs available or under development by the use of metal cations which improve the functional activity of anticoφs. To this end, we propose a method to potentiate the functional activity of anticoφs by means of metal cations. Finally, by modifying the site of binding to metal cations, the invention also provides anticoφs of class IgGl having a reduced capacity for activating the receptor FcγRIÏÏ, as well as anticoφs of class IgG3 artificially having a binding site for a cation metallic.

Description

Thus, a first object of the invention is the use of divalent or trivalent metal cations to improve the functional activity of anticoφs.

Our three-dimensional studies of the Fc region of the anticoφs revealed that the presence of metal cations such as Zinc, Iron, Copper or Cadmium, was always associated with the so-called open conformation of the Fc region of IgG. This open conformation promotes the attachment of anticoφs to FcγR receptors, in particular to FcγRHI. Thus, it is now possible to potentiate the functional activity of monoclonal or polyclonal anticoφs by means of such metal cations. Preferably, the metal cation used is zinc. Indeed, our analyzes have made it possible to highlight the presence of a zinc ion linked to histidine residues 310 and histidine 435 (in the present application, the numbering is that of Kabat, Kabat database, http://immuno.bme.nwu.edu).

Due to its location on the Fc region, this zinc atom plays an important role in the general conformation of the Fc region, and thereby allows the improvement of the binding of the Fc region to its receptors.

Thus, advantageously, these cations are used to interact with the Fc region of the anticoφs in order to participate in the stabilization of this region.

More particularly, they are used in order to participate in controlling the opening of the Fc region of the anticoφs and thus of promoting the maintenance of the so-called “open” conformation of the anticoφs, that is to say the maintenance of a certain separation between the CH2 domains favoring the attachment of the Fc region to its receptors. The presence of the metal cations makes it possible to induce an opening of the Fc region, even if the metal cation does not remain in its site. Thus, advantageously, these metal cations promote the attachment of the anticoφs to the FcyR receptors, in particular to the FcvRIII receptor.

In addition, the metal cation can, in another aspect of the invention, promote the bringing together of several Fc regions of anticoφs, via a second binding site involving the histidine residues 268 and 285 (Kabat numbering), facilitating the activation of FcγRs, more particularly FcγRIÏÏ and the transduction of signaling via these receptors.

By “functional activity” is meant, without limitation, the ADCC activity (Antibody-Dependent Cell-mediated Cytotoxicity), CDC activity (Complement Dépendent Cytotoxicity), phagocytosis activity, endocytosis activity or further induction of cytokine secretion. Thus, the use of metal cations as described in the invention makes it possible to improve the functional activity by at least 50%, preferably 60%, or 70%, 80%, 100%, and preferably 200% or 300 %. In addition, by “receptors” is meant not only the molecules of FcyR., Such as FcyRIII, present on the cells of the immune system such as monocytes, macrophages, B and T lymphocytes, NK cells and dendritic cells but also FcRn, complement molecules such as Cl q and those of bacterial walls such as protein A.

By "anticoφs" is meant any polyclonal or monoclonal anticoφs. If the anticoφs is a monoclonal anticoφs, it can be chimerical, humanized or human. Advantageously, this anticoφs is an IgG, for example an IgGl or an IgG3, in particular human. In addition, the term anticoφs also includes any glycoprotein comprising an Fc region, for example human, and one or more fragments, domains or derivatives of anticoφs. The term “anticoφs domain” is understood to mean any of the domains VL, CL, VH, CH1, CH2, CH3, CH4; by "fragment of anticoφs" any fragment which contains a complete binding site for an antigen, chosen from the fragments Fv, scFv, Fab, Fab ', F (ab') 2, and by "derivative of anticoφs" all anticoφs may include one or more mutations, substitutions, deletions and / or additions of one or more amino acid residues, as well as multi-specific and polyfunctional antico ants.

By “divalent or trivalent metal cation” or by “metal cation” is meant any metal cation having an oxidation state +2 or +3 and more particularly zinc, iron, copper, cadmium, cobalt, nickel , manganese, gallium, gadolinium, selenium, gold, platinum or palladium or the like. Preferably, these metal cations are zinc, iron, copper or cadmium, and in a particularly advantageous manner it is zinc. By “analog” is meant any free or bound ion capable of binding at the level of the Fc region of the anticoφs, and more particularly to the residues His 310, His 435, the residues Asn 434 and His 433 (Kabat numbering) which may also participate at fixation. A second object of the invention relates to a method for potentiating the functional activity of the anticoφs via the Fc region, comprising a step consisting in adding an appropriate amount of at least one metal cation in the biological system producing the anticoφs or in a solution comprising anticoφs before and / or after purification or in the preservation solution or in the final formulation in the form of an injectable solution of the anticoφs.

Advantageously, these metal cations are zinc, iron, copper or cadmium.

The term “biological system” is understood to mean cell lines, non-human transgenic plants or animals. Among the cells, it is possible to choose cells originating from cell lines, transfected using a vector comprising the gene coding for said anticoφs, for example eukaryotic or prokaryotic cells, in particular mammalian, insect, plants, bacteria or yeast. More specifically, rat myeloma cells such as YB2 / 0 can be used.

CHO cells can also be used, in particular CHO-K, CHO-LeclO, CHO-Lecl, CHO Pro-5, CHO dhfr- or other cell lines among Wil-2, Jurkat, Vero, Molt-4, COS- 7, 293-HEK, K6H6, NSO, SP2 / 0-Ag 14 and P3X63Ag8.653, PERC6 or BHK.

Preferably, a molar concentration of zinc at least equal to the molar concentration of anticoφs is added.

Optionally, a molar zinc concentration at least equal to 2 times is added, and preferably 3 times or 4 times the molar concentration of anticoφs. Alternatively, a molar concentration of metal cations is added which makes it possible to improve the functional activity of the anticoφs by at least 25%, preferably 50% or 60%, 70%, 80%, 100%, and preferably 200 or 300 %. Advantageously, the metal cations exist in different forms. In a particular aspect of the invention, the zinc ions can be in the form of zinc acetate, zinc bromide, zinc hydrochloride, zinc chloride, zinc citrate, zinc gluconate, hydroxycarbonate zinc, zinc iodide, zinc L-lactate, zinc nitrate, zinc stearate, or zinc sulfate.

Another subject of the invention relates to anticoφs of class IgG3, and more particularly the allotypes G3m (b) and G3m (g), having a binding site for a metal cation comprising the residues His 310 and His 435 on its Fc region created by molecular engineering.

In the context of the invention, we have demonstrated that metal cations bind to the anticoφs of class IgGl on a site comprising the residues His 310 and His 435, the residues His 433 and Asn 434 may also be involved in this fixation. However, the class IgG3 anticoφs of allotype G3m (b) or G3m (g) do not contain such a binding site in the natural state. Indeed, they have an arginine residue (Arg) in position 435. Thus, in the context of the invention, we create, by site-directed mutagenesis, anticoφs of class IgG3 having an improved fixation of metal cations compared to unmodified anticoφs , by creating a binding site involving a His 435 residue in substitution for the Arg 435 residue.

Thus, these IgG3 anticoφs have a binding site for a metal cation, in particular zinc, iron, copper, cadmium, cobalt, nickel, manganese, gallium, selenium, gold, platinum or palladium, comprising the residues His 310 and His 435, and advantageously also comprising the residue Asn 434 and / or His 433. Advantageously, at least one of these histidine residues is replaced by at least one of the residues chosen among cysteine, aspartic acid and glutamic acid. Indeed, these residues also have the capacity to fix such metal cations. Preferably, the metal cation is zinc, iron, copper or cadmium, and preferably zinc. In a particular aspect of the invention, the anticoφs has a metal cation, - and more particularly a zinc atom, linked to one or more residues of the Fc region. In a particularly advantageous manner, this IgG3 anticoφs has a capacity for fixing to FcγRIÏÏ and an improved functional activity compared to the native anticoφs.

An object of the invention is thus the use of the anticoφs IgG3 having a binding site for a metal cation previously described for the preparation of a medicament intended for the treatment of a pathology such as hemolytic disease of the newborn, viral, bacterial or parasitic pathology, pathology linked to pathogenic agents or derived toxins, listed as being particularly dangerous in cases of bioterrorism (classification of the Centers for Disease Control, CDC), in particular anthrax (Bacillus anthracis), botulism (Clostridium botulium), plague (Yersinia pestis), smallpox (Variola major), latularemia (Francisella tularensis), viral hemorrhagic fevers (linked to filoviruses -Ebola, Marburg and arenaviruses -Lassa, Machupo), epsilon toxin Clostridium perfringens, brucellosis (Brucella species), melioidosis (Burkholderia mallei), castor toxin (Ricinus communis).

Another subject of the invention is a pharmaceutical composition of therapeutic anticoφs comprising divalent or trivalent cations and at least one excipient. Preferably, these metal cations are zinc, iron, copper or cadmium, or a mixture of several of them. In a particularly advantageous manner, zinc is chosen, which can be in the form of zinc acetate, zinc bromide, zinc hydrochloride, zinc chloride, zinc citrate, zinc gluconate, hydroxycarbonate zinc, zinc iodide, zinc L-lactate, zinc nitrate, zinc stearate, or zinc sulfate. In one particular aspect, the anticoφs contained in the composition have a metal cation according to the invention linked to the residues His 310 and His 435, the residues His 433 and Asn 434 can also participate in the fixation.

In another particular aspect of the invention, the anticoφs of the pharmaceutical composition are the anticoφs of class IgG3 created by molecular engineering described above. In another preferred aspect of the invention, these are human IgGs or having a human Fc region.

Thus, the presence of such metal cations in the composition improves the fixation of the therapeutic anticoφs that it contains to its receptors, in particular the Fc RULs, the composition thus having better therapeutic activity.

Another subject of the invention is a pharmaceutical composition in which at least 50%, 60%, 70%, 80%, 90%, or even 99% of the anticoφs have a divalent or trivalent metal cation, in particular a zinc ion, bound to a site located in the Fc region. It may preferably be the binding site comprising the amino acids His 310 and His 435, the amino acid Asn 434 and / or His 433 being capable of participating in the binding. In another aspect of the invention, it can be the binding site comprising the amino acids His 268 and His 285. In another aspect of the invention, the 2 sites can be occupied by a metal cation as described in the invention.

The metal cation is preferably one of those already mentioned above, in particular zinc, iron, copper or cadmium, or a mixture of several of them, possibly in the forms already mentioned.

Another object of the invention is a solution comprising a monoclonal anticoφs or monoclonal anticoφs and an appropriate quantity of divalent or trivalent metal cations, in particular of zinc ions at least equal to the molar concentration in anticoφs, this solution being suitable for injection by intravenous, subcutaneous or intramuscular route.

The metal cations can be any divalent or trivalent metal cation, in particular zinc, iron, copper, cadmium, cobalt, nickel, manganese, gallium, selenium, gold, platinum or palladium or a similar. Preferably, the cation is a zinc ion or zinc acetate, zinc bromide, zinc hydrochloride, zinc chloride, zinc citrate, zinc gluconate, zinc hydroxycarbonate, zinc iodide, zinc L-lactate, zinc nitrate, zinc stearate, or zinc sulfate.

Another object of the invention is the use of zinc ions to improve the crystallization of therapeutic anticoφs, and more particularly of monoclonal IgG, the zinc ions stabilizing the Fc region of the anticoφs. The addition of divalent cations, and more particularly of zinc, significantly increases the solubility of Fc of IgGs, by promoting crystalline contacts which facilitates the obtaining of the crystals necessary for structural studies.

The invention also aims to provide a test for evaluating the efficacy of an antico l'efficacités comprising the study of the 3D conformation, in particular of the field involving the residues His 310, His 435, His 433 and / or Asn 434 of the Fc region as shown in FIG. 1 or 2 or also a determination of the zinc content of said anticoφs, the presence of zinc being an indication of the effectiveness of the anticoφs.

Another subject of the invention relates to an anticoφs having at least one of its residues His 310 and His 435 modified.

In a particular aspect of the invention, the modification of the anticoφs is a mutation, in particular a substitution by an amino acid having a low affinity for divalent or trivalent metal cations. For example, the His 310 residue and / or the His 435 residue can be substituted with a residue of lysine, alanine, glycine, valine, leucine, isoleucine, proline, methionine, tryptophan, phenylalanine, serine or threonine. In a particularly advantageous manner, the His 310 and His 435 residues are both substituted by lysine residues.

These mutants can be produced from any anticoφs possessing in the “natural” state, that is to say non-mutated, a binding site for metal cations comprising the residues His 310 and His 435. It can be act in particular of IgGl, of IgG3 allotypes G3m (s) or G3m (st), IgG2 or IgG4.

These mutants have a significantly reduced capacity for activating FcγRIII.

In a second embodiment, the modification can be carried out with DEPC (diethyl pyrocarbonate), a histidine modifying agent.

Advantageously, these anticoφs are IgGl, or in any case anticoφs having in the “natural” state, that is to say not mutated, a binding site for metal cations comprising the residues His 310 and His 435.

These anticoφs have a reduced functional activity compared to the same unmodified anticoφs. However, they retain their ability to fix the antigen and the

Fc RIÏÏ.

Thus, the invention provides anticoφs having a low ADCC activity, which is of particular interest in therapy to replace IgG4, or to prevent transplant rejection. The double mutant anticoφs according to the invention can also be used as anti-tetanus, anti-diphtheria or directed against pathogens or toxins derived therefrom, listed as being particularly dangerous in cases of bioterrorism (classification of the Centers for Disease Control, CDC) , including anthrax (Bacillus anthracis), botulism (Clostridium botulium), plague (Yersinia pestis), smallpox (Variola major), tularemia (Francisella tularensis), viral haemorrhagic fevers (linked to filoviruses -Ebola, Marburg and arenaviruses -Lassa, Machupo), epsilon toxin from Clostridium perfringens, brucellosis (Brucella species ), melioidosis (Burkholderia mallei), castor toxin (Ricinus communis).

Another object of the invention therefore relates to the use of modified anticoφs as described above, and therefore having a weak functional activity, for the preparation of a medicament intended for the prevention of transplant rejection or for the treatment of 'a pathology chosen from tetanus, diphtheria, or caused by a pathogen or derived toxin, listed as being particularly dangerous in cases of bioterrorism ^" (classification by the Centers for Disease Control, CDC), in particular anthrax (Bacillus anthracis ), botulism (Clostridium botulium), plague (Yersinia pestis), smallpox (Variola major), tularemia (Francisella tularensis), viral haemorrhagic fevers (linked to filoviruses -Ebola, Marburg and arenaviruses -Lassa, Machupo) , epsilon toxin from Clostridium perfringens, brucellosis (Brucella species), melioidosis (Burkholderia mallei), castor toxin (Ricinus communis).

Finally, anticoφs having an impaired functional activity as previously described are also used for the preparation of a medicament to replace IgG4.

By way of example, the anticoφs described in the invention, in particular the anticoφs having an improved functional activity due to metal cations, or the modified antico donts whose functional activity is impaired, or the compositions or solutions of the invention, can be chosen from anti Ep-CAM, anti-KIR3DL2, anti-EGFR, anti-VEGFR, anti HER1, anti HER2, anti GD, anti GD2, anti GD3, anti-CD20, anti CD-23, anti CD-25 , anti-CD30, anti-CD33, anti-CD38, anti-CD44, anti CD52, anti CA125 and anti ProteinC, anti-HLA-DR, anti-virals: HBV, HCV, HIV and RS V, and more particularly among the anticoφs of Table I below: Table I: Name and brand Target company commercial indication of the antibody Edrecolomab Centocor anti Ep-CAM colorectal cancer PANOREX Rituximab Idea anti CD20 B cell lymphoma RITUXAN Licensed to thrombocytopenia puφura Genentech / Hofïman rock Trastuzumab Genentech anti HER2 ovarian cancer HERCEPTIN Licensed to Hofïman la roche / Immunogen Palivizumab Medimmune RSV SYNAGIS Licensed to Abott Alemtuzumab BTG anti CD52 leukemia CAMPATH Licensed to Schering ibritumomab IDEC anti CD20 NHL tiuxetan Licensed to Schering ZEVALIN Cetuximab Merck / BMS / anti EGFR cancers C-C225

Bevacizumab Genentech / anti VEGFR cancer AVASTIN Hoffinan la roche Epratuzumab hnmumedics / anti CD22 cancers: Amgen non-Hogkinian lymphoma

Hu M195Mab Protein Design Anti CD33 cancers Labs MDX-210 Lnmuno-Designed ND cancers Molecules BEC2 hnclone anti GD3 cancers Mitumomab Oregovomab Altarex anti CA125 ovarian cancer OVAREX

Ecromeximab Kyowa-Hakko anti GD3 malignant melanoma KW-2971 ABX-EGF Abgenix EGF cancers

MDX010 Medarex Anti CD4R Cancers

XTL 002 XTL ND anti-viral: HCV biopharmaceuticals Hll SCFV viesia biotech ND cancers

4B5 viesia biotech anti GD2 Cancers XTL 001 XTL ND anti-viral: HBV biopharmaceuticals MDX-070 MEDAREX Anti-PSMA prostate cancer

TΝX-901 TANOX anti IgE Allergies

IDEC-114 IDEC inhibition of non-Hodgkin's lymphoma ProteinC For example, the invention relates to a solution in the form of a concentrate at a concentration of anticoφs ranging from 0.1 to 50 mg / ml, or 1 to 25 mg / ml which can be formulated for administration IV. The solute may contain as an example: 9.0 mg / mL sodium chloride, 7.35 mg / mL sodium citrate dihydrate, and 0.7 mg / mL polysorbate-80 in sterile water. 0.1 to 50 mg / ml, or 1 to 20 mg / ml of a cation are added to this solute or concentrate, the concentration of said cation being 1, 2, 3, 4 or 5 times the antico ants concentration either from 0.1 to 250 mg / mL or from 1100 mg / mL. This concentrate can be injected into a pocket of serum or infusion liquid so as to obtain the dose which it is desired to administer, while maintaining the same cation content relative to the anticoφs content.

The invention also relates to a lyophilized powder, sterile in a container and which can be reconstituted with sterile water just before injection comprising the appropriate amount of anticoφs and the amount of said cation according to the invention 1 ", 2, 3 , 4 or 5 times higher than that of the anticoφs.

This powder can be reconstituted for IV or subcutaneous injection. In the latter case, the powder can comprise from 10 to 500 mg of anticoφs and a quantity of said cation according to the invention 1, 2, 3, 4 or 5 times greater than that of anticoφs, ie for example from 10 to 500 mg. We can add excipients such as sucrose, an amino acid, polysorbate:

It should be understood that the invention preferably relates to the compositions described above in which the cation content is at least equal to the content of anticoφs, but also relates to any composition in which an amount of cation is added (zinc, iron, copper , cadmium, or the like, or a mixture thereof) less than said equimolar amount, for example 0.1 to 0.99 molar (0.1, 0.2, 0.3, 0.4, 0.5, 0 , 6, 0.7, 0.8 or 0.9 molar), but still sufficient to improve by at least 10% or 25%, or 50% or even 100% the effectiveness and / or the functional properties of the anticoφs.

Other aspects and advantages of the invention will be described in the examples which follow, which should be considered as illustrative and do not limit the scope of the invention.

In order to acquire new data on the structure-function relationships of the Fc region of anticoφs. the applicant has crystallized the Fc fragments of the monoclonal anticoφs EMAB5, expressed in the cell line YB2 / 0, in the presence or in the absence of zinc. An X-ray diffraction (X-ray) study of the crystallized Fc fragments was undertaken; part of this study is presented in examples 1 and 2 which follow. Example 3 shows the effect of a chemical modification of histidines on Fc activity and Example 4 the effect of a double mutation of histidine residues 310 and 435 into lysines.

Description of the figures

Figure 1: Diagram showing the position of Zn2 + ions in the vicinity of the Fc fragment of the monoclonal anticoφs EMAB5 (2Â).

Figure 2: Detail of the electronic density map in the vicinity of histidine residues 310 and 435.

Figure 3: Supeφosition of the structures of the Fc fragment of the anticoφs EMAB5 obtained in the absence (gray) and in the presence (white) of Zn2 + ion.

Figure 4: Attachment of the anticoφs EMAB5 modified by DEPC to the FcγRIH receptor. This figure shows, on the abscissa, the fixation of the anticoφs on the red cells and on the ordinate the fixation of the CD 16 (FcγRJH) present on the surface of the Jurkat CD 16 cells. f (*) anticoφs witness AD1; (M) EMAB5 control; (A) EMAB5 FNR; (•) EMAB5 FR.

Figure 5: Activation by anticoφs EMAB5 modified by DEPC of the FcγPJII receptor present on Jurkat CD 16 cells.

This figure represents the quantity, expressed in pg / ml, of IL-2 secreted by Jurkat CD16 cells whose CD16 receptor was activated by the antico EMs EMAB5 control () and the fractions separated on protein A after modification of the anticoφs EMAB5 by DEPC: FNR (•), FR (M).

Figure 6: Effect of the DEPC modification on the ADCC activity of the EMAB5 monoclonal antibody.

This figure represents the percentage of lysis of Rh red blood cells (D +) induced by the control monoclonal anticoφs EMAB5 and by the 2 fractions FR and FNR, separated on Sepharose-protein A gel, of the anticoφs modified by DEPC.

Figure 7: Measurement of the Fc binding of the doubly mutated His310-435Lys anticoφs to the FcγRÏÏI receptor. Anticoips 1C7, 2H11, 4G5 and 4H10 are the mutated anticoφs. Anticoφs 16D11, 11G5 and 6H11 are not mutated. This figure shows on the abscissa, the fixation of the anticoφs on the red cells and on the ordinate the fixation of the CD 16 (FcγRIII) present on the surface of the Jurkat CD 16 cells. The figure groups together the results obtained with the supernatants containing the doubly mutated anticoφs (curves in solid lines) and those containing non-mutated anticoφs (dotted curves).

Figure 8: Study of the secretion of IL-2 induced by monoclonal anti-Rh (D) antibodies, mutated or not. This figure represents the percentage of IL-2 secreted by native anti-Rh (D) monoclonal antibodies (n = 3 clones) and carrying the double mutation His310-435Lys (n = 4 clones). The results are expressed as a percentage relative to a purified control anticoφs, EMAB5.

Figure 9: Influence of imidazole on the binding of monoclonal anticoφs EMAB5 to the CD16 receptor (Fc-) R1II).

Figure 10: Study by flow cytometry of the binding of anticoφs carrying the double mutation His310-435Lys to the CD 16 receptor

EXAMPLES

In order to acquire new data on the structure-function relationships of the Fc region of the anticoφs, the applicant crystallized the Fc fragments of the monoclonal anticoφs EMAB5, expressed in the cell line YB2 / 0, in the presence or absence of zinc . An X-ray diffraction study of the crystallized Fc fragments was undertaken; part of this study is presented in examples 1 and 2 which follow. Example 3 shows the effect of a chemical modification of histidines on Fc activity and Example 4 the effect of a double mutation of histidine residues 310 and 435 into lysines. Monoclonal antibody:

EMAB5. It is a human IgGl (κ), directed against the Rh (D) antigen, produced in the cell line YB2 / 0 (rat myeloma, line ATCC No. CRL 1662) suitable for culture in medium without serum.

- Purification: EMAB5 was purified by affinity chromatography on Sepharose- protein A.

- Glycan analysis: by HPCE-LIF, it was shown that the majority structure is an oligosaccharide of the biantenné type, containing approximately 25% of fucose.

- Biological activity: the ADCC activity of EMAB5 is at least equal to that of the reference anti-Rh (D) polyclonal antibody, WinRho (Cangene). Preparation of the Fc fragment:

- Hydrolysis conditions: the purified anticoφs EMAB5 is dialyzed overnight against 50 mM Tris buffer, pH 8.0. The antico d'ants solution, adjusted to 50 mM CaCl 2 and 10 mM cysteine, is incubated for 30 min. at 37 ° C before adding the trypsin solution (1 mg / ml) in an enzyme / substrate ratio of 1/25. After 5 a.m. incubation at 37 ° C, the reaction is stopped by the addition of diisopropyl fluorophosphate (1 mM final). The hydrolyzate is dialyzed overnight against 50 mM Imidazole buffer, pH 7.8.

- Purification of the Fc fragment: The dialysis hydrolyzate is brought into contact with Affarose-protein L at the rate of 1 ml of gel for 3.6 mg of anticoφs. After 4 h. incubation at room temperature with shaking, the gel is mounted in a column and washed with 50 mM Imidazole buffer, pH 7.8. The effluent and the washing buffer which contain the Fc fragments are combined, concentrated by centrifugation on Vivaspin 20 using the conditions described by the manufacturer.

EXAMPLE 1. Presence of zinc ions linked to the Fc fragments.

Crystallogenesis: After development, the crystallization conditions adopted are as follows: the solution of Fc fragments, at 2 mg / ml in 50 mM imidazole buffer, pH 7.8, is brought to 10% of 5,000, 100 mM monomethyl polyethylene glycol sodium cacodylate, 0.1 mM zinc chloride, pH 5.1 by vapor diffusion in seated drops at 17 ° C. Collection of diffraction data and determination of the structure: The crystal obtained is subjected to X-rays at the ESRF in Grenoble and the information collected is processed by the DENZO and SCALEPACK programs (Otwinowski and Minor, 1997). The structure is solved and refined to 2.3 Â (Fig.l) using the rest of the CCP4 programs.

Results: This crystal of the Fc fragment of EMAB5 belongs to the C222ι space group with a fragment per asymmetric unit The mesh parameters are the following: a = 50.2 A; b = 147.7 Â; c = 75.6Â; α = β = γ = 90 °.

The three-dimensional structure (shown diagrammatically in FIG. 1) makes it possible to highlight the presence of zinc ions (in white) near the CH2 and CH3 domains (in gray). The electronic density map presented in FIG. 2 shows the zinc ion linked to the histidine residues 310 (CH2) and 435 (CH3). Another zinc ion is linked to histidine 268 from an Fc and to histidine 285 from a symmetrical Fc. The third is near histidine 433.

EXAMPLE 2. Effect of metal cations on the conformation of Fc fragments.

In this example, the crystals obtained all belong to the space group

P2 (l) 2 (l) 2 (l) with two chains per asymmetric unit and the opening of the Fc is characterized by the distances between the proline residues 329 of chains A and B and between the mannose residues 4 of chains A and B. Crystallized in the absence of metal ion, the Fc fragments of Panticoφs EMAB5 are characterized by a distance between pralines 329 of 32.53 Â and a distance between mannoses 4 of 17.61 Â. When a metal ion is added to the crystallization solution (see Table II), these characteristic distances increase.

Table II: Main characteristics of the crystals of the Fc fragment of the monoclonal anticoφs EMAB5 in the space group P2 (l) 2 (l) 2 (l).

FIG. 3 shows the supeφosition of the main chains of the structures obtained in the absence (in gray) and in the presence of zinc (white) in the crystallization solution. The addition of a metal salt to the Fc solution therefore promotes a so-called open conformation, a conformation close to that of Fc linked to the FcγRHI receptor.

EXAMPLE 3 Modification of histidine residues by DEPC

Diethylpyrocarbonate (DEPC) is a reagent that has been widely used to modify and study the role of histidine residues in proteins (Miles, 1977). Firan et al. (2001) showed that human IgGl treated with DEPC lost their ability to bind the FcRn receptor which is involved in the transfer of maternal IgG to the fetus. DEPC acts by substitution of a nitrogen group present on the imidazole cycle of histidine, thus transforming the histidine residue into 3-carboethoxy histidine.

1. Modification by DEPC

The monoclonal anticoφs EMAB5, dialysis against 0.1 M sodium acetate buffer, pH 6.0, is brought into contact with DEPC at a rate of 70 μg of DEPC / mg of IgG. After 30 minutes of incubation at room temperature, the reaction is stopped by the addition of imidazole (0.2 mg / ml final).

After desalting in 20 mM sodium phosphate buffer, 50 mM NaCl, pH 7.2, the modified monoclonal antibody is fractionated by affinity chromatography on Sepharose-protein A. A fraction of the modified monoclonal antibody is not retained on the affinity gel and constitutes the non-retained fraction or FNR. The fraction retained on the gel and called FR is eluted with 0.1 M Glycine-HCl buffer, pH 2.8. The two fractions thus obtained are dialyzed against 20 mM sodium phosphate buffer, 50 mM NaCl, pH 7.2, concentrated on Vivaspin according to the manufacturer's recommendations and stored at 4 ° C for 15 days maximum. The control anticoφs, which serves as a reference, underwent the same treatment except for DEPC which was replaced by an identical volume of ethanol.

2. Measurement of the binding of the Fc of the anticoφs to the FcγRffl receptor by CFC test.

In order to check the integrity of the anticoφs treated by DEPC, the anticoφs are subjected to a test, called CFC, which estimates the capacity of the anticoφs to fix, firstly, the antigen against which they are directed then, in a second, the FcγRlJJ (CD 16) receptor expressed on the surface of the Jurkat CD 16 cell line. The wells of a microtiter plate are covered with papain Rb (D +) red cells. Anti-Rit (D) anticoφs, diluted to concentrations varying from 7.8 to 500 ng / ml in UVIDM + 2.5% fetal calf serum (SVF) are deposited in parallel on two microtiter plates previously "coated" with red cells. After 90 min. incubation at 37 ° C, the wells are washed.

One of the plates, used to detect IgG fixed on red cells, is incubated in the presence of an anti-human mouse Fcγ antibody labeled with alkaline phosphatase (Jackson ImmunoResearch Laboratories).

In the other plate, the Jurkat CD16 cells, diluted to the concentration of 2 × 10 ⁶ cells / ml in DVLDM + 1% FCS, are added. After 15 min. of contact at 37 ° C., the plate is centrifuged by gradually increasing the speed and the duration of centrifugation until the negative controls are negativized. The expression “negative control” means anticoφs which bind to the red cells immobilized in the wells of the microtitration plate but which do not fix the FcγRIII receptor present on the surface of the Jurkat CD 16 cells. In the wells containing the negative control, the Jurkat cells CD 16, after centrifugation, form a cluster in the center of the well whereas in wells containing a positive control, Jurkat CD 16 cells line the well.

After centrifugation, the wells are read and a score is given as a function of the spreading of Jurkat CD 16 cells in the well.

3. Measurement of the activation of the FcγRIII receptor The activation test of the Jurkat CD16 cells measures the secretion of interleukin-2 (IL-2) induced by the binding of the Fc of the anticoφs to the FcγRIJI receptor (CD 16) after binding of Fab to its antigen, present on the target cell. The level of IL-2 secreted by Jurkat CD 16 cells is proportional to the activation of the CD 16 receptor. In a 96-well microtiter plate, 50 μl of dilutions of anticoφs, 50 μl of a red cell suspension at 6.10 ⁵ / ml, 50 μl of a suspension of Jurkat CD 16 cells at 1.10 ⁶ / ml and 50 μl of a PMA solution at 40 ng / ml. All dilutions were carried out in EVIDM culture medium containing 5% FCS. After 16 hours of incubation at 37 ° C and 7% CO 2, the microtiter plate is centrifuged and the amount of IL-2 contained in the supernatant is assayed by a commercial kit (Duoset, R&D). The levels of secreted IL-2 are expressed in pg / ml. The results are expressed in% of CD16 activation, the level of dTL-2 secreted in the presence of the control monoclonal antibody being considered equal to 100%.

4. Measurement of ADCC activity The ADCC technique (Antibody-Dependent Cell-mediated Cytotoxicity) makes it possible to evaluate the ability of antibodies to induce the lysis of Rh (D +) red cells, in the presence of effector cells (mononuclear cells or lymphocytes) .

Briefly, the red cells of a globular concentrate RbD (+) are treated with papain (1 mg / ml, 10 min at 37 ° C.) then washed in 0.9% NaCl. The effector cells are isolated from a pool of at least 3 buffy coats, by centrifugation on Ficoll (Amersham Biosciences), followed by an adhesion step in the presence of 25% of FCS, so as to obtain a lymphocyte / monocyte ratio of the order of 9. In a microtiter plate (96 wells), each well is deposited: 100 μl of a dilution of purified anti-Rh (D) anticoφs (from 9.3 to 150 ng / ml), 25 μl of Rh (Dr-) papain red cells at 4 x 10 ⁷ , 25 μl of effector cells at 8 x .10 ⁷ and 50 μl of polyvalent IgG (Tegeline, LFB) at the usual concentrations of 2 and 10 mg / ml. The dilutions are made in EVIDM containing 0.25% of SVF. After incubation for 1 night at 37 ° C., the plates are centrifuged, then the hemoglobin released in the supernatant is measured via its peroxidase activity in the presence of a chromogenic substrate, 2,7-diaminofluorene (DAF). The results are expressed as a percentage of lysis, 100% corresponding to the total lysis of the red cells in NH ₄ C1 (control 100%) and 0% to the reaction mixture without anticoφs (control 0%). The specific lysis is calculated as a percentage according to the following formula:

(DO sample -DO control 0%) XI 00 _{= 0 /} DO control 100% - DO control 0% ^{/ o} Results:

After treatment with DEPC according to the conditions described above, approximately 20% of the molecules of the monoclonal anticoφs EMAB5, constituting the FNR fraction, lose their capacity to bind to the gel of Sepharose-protein A. Knowing that histidine 435 is an essential amino acid for the attachment of IgG to protein A, it seems likely that the IgG of the FNR fraction differs from the FR fraction, retained on the Sepharose-protein A gel, by the modification of the residue His435. In the test for measuring the binding to the CD 16 receptor in the presence of antigen, the FΝR fraction has the same capacities as the FR fraction, capacities which are identical to those of the control anticoφs (Fig. 4). In addition, the binding of the different fractions of the monoclonal anticoφs EMAB5, modified or not by DEPC, is much higher than that of the monoclonal anticoφs AD1, used in this test as a negative control. Thus, the modification of histidine residues by DEPC does not induce a change in the ability of the monoclonal antibody EMAB5 to bind to Rh (D +) red blood cells or to the CD 16 receptor present on the surface of the Jurkat cell line. CD 16.

On the other hand, the functional activity of the monoclonal anticoφs EMAB5 modified by DEPC is very slight. Thus, the secretion of IL-2 of the Jurkat CD16 line induced by the FR and FNR fractions of the monoclonal antibody EMAB5 modified by DEPC represents, respectively, 42.8% and 19.5% of the secretion induced by the antibody witness (Fig. 5). The results of the ADCC activity, expressed as% of actual lysis, show that the activity of the FNR fraction is lower than that of the FR fraction (FIG. 6). On the other hand, the FR fraction shows a decrease in ADCC activity compared to the control anticoφs, when the amount of anticoφs added to the well is lower (<20 ng / ml) and that the amount of Multipurpose IgG is 2.5 mg / ml. In conclusion, although having retained their ability to bind the antigen and the FcγRUI receptor (CD16), the fractions of EMAB5 monoclonal anticoφs modified by DEPC have a reduced functional activity (ADCC, induction of cytokine secretion). This decrease in activity is more marked for the FNR fraction, fraction! which probably presents a modification of the residue His435. These results therefore show that the conservation of the His435 residue is important for the preservation of the functional activity of the IgG1 type anticoφs.

EXAMPLE 4 Functional Activity of Antibodies Carrying the His310-435Lys Double Mutation

The modification of histidine residues by a chemical agent (DEPC or other) does not make it possible to control either the degree or the location of the modifications. Thus, the two histidine residues, His310 and His435, which play an essential role in the binding of the zinc cation at the CH2-CH3 interface of IgGl, are replaced by lysine residues, by site-directed mutagenesis.

1. Obtaining an anti-R_h (D) anticoφs carrying the double mutation His310-435Lys The expression vector containing the cDNA coding the amino acid sequence of the heavy chain of the anti-Rh (D) anticoφs EMAB5 , served as a matrix for carrying out a double directed mutagenesis carried out by PCR ("PCR-based site-directed mutagenesis"). The following four nucleotide substitutions have been introduced: - C1229A and C1301G for the change of the residue His338 into Lys (position 310 according to the Kabat numbering), ie CAC->AAG; - C1674A and C1676G for the mutation of the residue His463 in Lys (position 435 according to the numbering of Kabat), namely CAC -> AAG. The mutated sequence has been sequenced and the results of the sequencing are given in Table II.

TABLE III Oligonucleotide and polypeptide sequences of the doubly mutated heavy chain of the monoclonal antico EMs EMAB5

The residues His338 and His461 of the heavy chain of the monoclonal anticoφs EMAB5, which correspond to the residues His310 and His435 according to the numbering of Kabat, were substituted with lysine residues.

CDNA sequence of the double mutant His310-435Lys (SEQ ID No. 1) atggagtttgggctgagctgggttttcctcgttgctcttttaagaggtgtccagtgtcaggtgcagctggtggagtctgggggag gcgtggtccagcctgggaggtccctgagactctcctgtacagcctctggattcaccttcaaaaactatgctatgcattgggtcc gccaggctccagccaaggggctggagtgggtggcaactatatcatatgatggaaggaatatacaatatgcagactccgtgaa gggccgatgcaccttctccagagacaattctcaggacaccctgtatctgcaactgaacagcctcagaccggaggacacggct gtgtattactgtgcgagacccgtaagaagccgatggctgcaattaggtcttgaagatgcttttcatatctggggccaggggaca atggtcaccgtctcttcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcac agcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcgg cgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgg gcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtg acaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaa ggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttc aactggtacgtggacgg cgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgt ggtcagcgtcctcaccgtcctgaagcaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctccc agcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccggg atgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggaga gcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagct caccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaacaagtacac gcagaagagcctctccctgtctccgggtaaatag

Peptide sequence of the double mutant His310-H435Lys (SEQ ID No 2):

1 MEFGLSWVFL VAL RGVQCQ VQLVESGGGV VQPGRSLRLS CTASGFTFKΝ 51 YAMHWVRQAP AKGLEWVATI SYDGRΝIQYA DSVKGRCTFS RDΝSQDTLYL 101 QLΝSLRPEDT AVYYCARPVR SRWLQLGLED AFHI GQGTM VTVSSASTKG 151 PSVFPLAPSS KSTSGGTAAL GCLVKDYFPE PVTVSWΝSGA LTSGVHTFPA 201 VLQSSGLYSL SSWTVPSSS LGTQTYICΝV ΝHKPSΝTKVD KKVEPKSCDK 251 THTCPPCPAP ELLGGPSVFL FPPKPKDTLM ISRTPEVTCV WDVSHEDPE 301 VKFΝWYVDGV EVHΝAKTKPR EEQYΝSTYRV VSVLTVLKQD WLΝG EYKCK 351 VSΝKALPAPI EKTISKAKGQ PREPQVYTLP PSRDELTKΝQ VSLTCLVKGF 401 YPSDIAVEWE SΝGQPEΝΝYK TTPPVLDSDG SFFLYSKLTV DKSRWQQGΝV 451 FSCSVMHEAL HΝKYTQKSLS LSPGK *

The YB2 / 0 cells, co-transfected by electroporation with the mutated vector EMAB5- H-K338-K463-1 and the vector EMAB5- dhfr-K- Spel encoding the light chain of the antico EMs EMAB5, are cultured in RPMI medium supplemented with 5% of SVF dialysis, 0.5% of G418 and 25 nM of Methotrexate (MTX). The clones secreting the highest levels of human IgG are cultured in 24-well plates in medium without MTX. The supernatants, harvested after 7 days of culture, are used to carry out the tests described below. 2. Measurement of the Fc binding of the anticoφs to the FcγRIII receptor (CFC)

This test is carried out on culture supernatants, the level of human IgG contained in the supernatants being determined by ELISA assay.

The wells of a microtiter plate are covered by papainized Rh (D +) red cells. Culture supernatants containing native or mutated anti-Rh (D) antico dils and diluted to concentrations varying from 7.8 to 500 ng / ml in IMDM + 2.5% FCS are deposited in parallel on two microtiter plates previously “coated” by the red cells. After 90 min. incubation at 37 ° C, the wells are washed. One of the plates, used to detect the IgGs fixed on the red cells, is incubated in the presence of an anti-human mouse anti-Fcγ labeled with alkaline phosphatase (Jackson LnmunoReaserch Laboratories).

In the other plate, Jurkat CD 16 cells are added after 15 min. contact at 37 ° C., the plate is centrifuged by gradually increasing the speed and the duration of centrifugation until the negative controls are negativized. After centrifugation, the wells are read and a score is given as a function of the spreading of Jurkat CD 16 cells in the well.

3. Measurement of the activation of the CD16 receptor In a 96-well microtiter plate, 50 μl of dilutions of culture supernatants containing native or mutated anti-Rb. (D) anticoφs, 50 μl of a suspension are successively deposited. red cells at 6.10 ^s / ml, 50 μl of a suspension of Jurkat CD 16 cells at 1.10 ⁶ / ml and 50 μl of a PMA solution at 40 ng / ml. All dilutions were carried out in EVIDM culture medium containing 5% FCS. After 16 hours of incubation at 37 ° C and 7% CO 2, the microtiter plate is centrifuged and the amount of IL-2 contained in the supernatant is assayed by a commercial kit (Duoset, R&D). The levels of secreted IL-2 are expressed in pg / ml.

The results are expressed in% of CD16 activation, the level of IL-2 secreted in the presence of the control monoclonal antibody being considered equal to 100%

The various tests were carried out on the culture supernatants containing the anti-Rh (D) monoclonal antibodies that were mutated or not. The results of the CFC test show that the double mutation His310-435Lys does not induce any modification in the binding of the anticoφs to the FcγRIII receptor, carried by the Jurkat CD16 cell line (Fig. 7). While the non mutated clone 6H11 (negative control) exhibits binding to the receptor FcγRUI decreased, the mutated clones 1C7, 2H11, 4G5 and 4H10 bind the FcγRJJJ receptor similarly to the non-mutated clones 16D11 and 11G5 (positive controls).

CD 16 activation was carried out on the culture supernatants of 4 mutated clones mentioned above and of 3 non-mutated clones (16D11, 11G5 and 24G9). The results represent the mean (+/- standard deviation) of the levels of IL-2 secreted by the Jurkat CD 16 cells in the presence of the non-mutated clones (Native) and of the mutated clones (His310-435Lys). The mutated anticoφs induce a secretion of_L-2 very reduced compared to that induced by the native anticoφs (Fig. 8). Thus, the mutated anticoφs have a decrease in capacity to activate the FcγRIÏÏ receptor by 50%.

EXAMPLE 5 Study of the fixation of monoclonal antibodies, mutated or not, to the FcγRIII receptor by flow cytometry.

The influence of imidazole as well as the impact of His310-435Lys mutations on the binding of anticoφs to the FcγRUI receptor (CD 16) present on the surface of Jurkat CD 16 cells were evaluated by flow cytometry.

1. Effect of imidazole 5.10 ⁵ Jurkat CD 16 cells are incubated for 30 minutes in the presence of different concentrations of the monoclonal antibody EMAB5 diluted in PBS buffer containing 0.5% bovine albumin (BSA) or in PBS buffer 0.5% SAB supplemented with 50 mM imidazole. The cells are then washed in 0.5% PBS-SAB buffer and incubated in the presence of F (ab ') 2 of anti-human IgG (H + L) mice marked with FITC (Jackson ImmunoResearch Laboratories). After 30 minutes of incubation, the cells are washed as before and the binding of the anticoφs EMAB5 is analyzed by flow cytometry using a FACScalibur 4CA and the Cell Quest Pro program (Becton Dickinson). 2. Fixation of the doubly mutated anticoφs 5.10 ⁵ Jurkat CD16 cells are incubated for 30 minutes in PBS-SAB buffer 0.5% in the presence of different concentrations of monoclonal anticoφs contained in culture supernatants. The cells are then washed in 0.5% PBS-SAB buffer and incubated in the presence of F (ab ') 2 of anti-human IgG (H + L) mice marked with FITC. After 30 minutes of incubation, the cells are washed as above and the binding of the antibodies is analyzed by flow cytometry using a FACScalibur 4CA and the Cell Quest Pro program (Becton Dickinson).

The results of the binding of the anticoφs EMAB5 to the CD16 receptor (FcγRIÏÏ) present on the surface of Jurkat CD 16 cells in the presence or not of imidazole are presented in Fig. 9.

Thus, the addition of 50 mM of imidazole in the Panticoφs incubation buffer with the cells causes a decrease in fixation of the anticoφs which results in a significant decrease in the percentage of labeled cells; at the antico ants concentration of 1.5 μg / ml, the presence of imidazole induces a 40% decrease in the number of labeled cells.

Imidazole is a reagent that has the property of fixing cations. Thus, by depriving the incubation medium of the cations by the addition of imidazole, the fixation of the anticoφs on the CD 16 receptor is reduced.

The binding to the FcγRiπ receptor of Jurkat CD 16 cells of 3 monoclonal anticoφs contained in culture supernatants is presented in Fig. 10.

Thus, the results expressed as a percentage of cells labeled as a function of the amount of anticoφs added, show that the anticoφs 4G5 and 4H10, which have the double mutation His310-435Lys, bind significantly less well to Jurkat CD 16 cells than the clone 24G9, which is the non-mutated control anticoφs. These experiments clearly illustrate that the attachment of the anticoφs to the CD 16 receptor is affected by the absence of cations. Conversely, the presence of cations should improve the fixation of the anticoφs on the receptor and thereby improve the cytotoxic activity of the anticoφs.

REFERENCES

Chapman TL, You I, Joseph M, Bjorkman PJ, Morrison SL, Raghavan M. Characterization of the interaction between the heφes simplex virus type I Fc receptor and immunoglobulin G. (1999) J. Biol. Chem. ; 274: 6911-9.

Coφer AL, Sohi MK, Bonagura VR, Steinitz M, Jefferis R, Feinstein A, Beale D, Taussig MJ, Sutton BJ. Structure of human IgM rheumatoid factor Fab bound to its autoantigen IgG Fc reveals a novel topology of antibody-antigen interaction. (1997) Nat Stract Biol .; 4: 374-81.

Deisenhofer J. Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-A resolution.

(1981) Biochemistry. 20, 2361-70.

Firan M, Bawdon R, Radu C, Ober RJ, Eaken D, Antohe F, Ghetie V, Ward ES. The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans. (2001) Int. I munol. 13, 993-1002.

Maillard P, Lavergne JP, Siberil S, Faure G, Roohvand F, Petres S, Teillaud JL, - Budkowska A. Fcgamma receptor-like activity of hepatitis C virus core protein. (2004) J. Biol. Chem. 279, 2430-7.

Miles EW. Modification of histidyl residues in proteins by diethylpyrocarbonate. (1977) Methods Enzymol. 47, 431-42. Otwinowski Z, Minor W. Processing of X-ray diffraction data collected in oscillation mode .. (1997). Methods Enzymol. 276, 307-26.

Sauer-Eriksson AE, Kleywegt GJ, Uhlen M, Jones TA. Crystal structure of the C2 fragment of sfreptococcal protein G in complex with the Fc domain of human IgG. (1995) Structure. 3, 265-78.

Shields RL, Namenuk AK, Hong K, Meng YG, Rae J, Briggs J, Xie D, Lai J, Stadlen A, Li B, Fox JA, Presta LG. High resolution mapping of the binding site on human IgGl for Fc gamma RI, Fc gamma Ru, Fc gamma RIII, and FcRn and design of IgGl variants with improved binding to the Fc gamma R. (2001) J Biol Chem. 276, 6591-604).

Claims

1. Use of divalent or trivalent metal cations to improve the functional activity of anticoφs. .

2. Use according to claim 1, characterized in that said anticoφs are human IgG or having a human Fc region.

3. Use according to one of claims 1 or 2, characterized in that said cations interact with the Fc region of said anticoφs.

4. Use according to any one of claims 1 to 3, characterized in that said cations participate in the control of the opening of the Fc region of said anticoφs.

5. Use according to any one of claims 1 to 4, characterized in that said cations promote the attachment of said anticoφs to FcγR receptors, in particular to the FcγRHL receptor

6. Use according to any one of claims 1 to 5, characterized in that said cation is zinc, iron, copper or cadmium.

7. Use according to any one of claims 1 to 6, characterized in that said cation is zinc.

8. Method for potentiating the functional activity of the anticoφs via the Fc region, comprising a step consisting in adding an appropriate amount of at least one divalent or trivalent metal cation in the biological system producing the anticoφs or in a solution comprising anticoφs before and / or after purification or in the preservation solution or in the final formulation in the form of an injectable solution of the anticoφs.

9. Method according to claim 8, characterized in that said cation is zinc, iron, copper or cadmium.

10. Method according to claim 9, characterized in that one adds a molar concentration of zinc at least equal to the molar concentration of anticoφs.

11. Anticoφs of class IgG3 having a binding site for a divalent or trivalent metal cation comprising the residues His 310 and His 435 (Kabat numbering) on its Fc region created by molecular engineering.

12. Anticoφs according to claim 11, characterized in that said fixing site comprises the residue Asn 434 and / or the residue His 433 (Kabat numbering).

13. Anticoφs according to any one of claims 11 or 12, characterized in that said fixing site is created by substitution of Arg 435 with His 435.

14. Anticoφs according to any one of claims 11 to 12, characterized in that at least one of said histidine residues is replaced by at least one of residues chosen from cysteine, aspartic acid and glutamic acid.

15. Anticoφs according to any one of claims 11 to 14, characterized in that it has a divalent or trivalent metal cation attached to said fixing site.

16. Anticoφs according to any one of claims 11 to 15, characterized in that said cation is zinc, iron, copper or cadmium.

17. Anticoφs according to any one of claims 11 to 16, characterized in that the allotype of said anticoφs is G3m (b) or G3m (g).

18. Anticoφs according to any one of claims 11 to 17, characterized in that it has improved binding to FC R-ÏÏI and improved functional activity compared to native anticoφs.

19. Use of the anticoφs according to any one of claims 11 to 18 for the preparation of a medicament for the treatment of pathologies such as hemolytic disease of the newborn, a viral, bacterial or parasitic pathology, a pathology linked to pathogens or derived toxins, listed as particularly dangerous in cases of bioterrorism (classification of the Centers for Disease Contrai, CDC), in particular anthrax (Bacillus anthracis), botulism (Clostridium botulium), plague (Yersinia pestis), smallpox (Variola major), tularemia (Francisella tularensis), viral haemorrhagic fevers (linked to filoviruses -Ebola, Marburg and arenaviruses -Lassa, Machupo), epsilon toxin from Clostridium perfringens, brucellosis (Brucella species) melioidosis (Burkholderia mallei), castor toxin (Ricinus communis).

20. Pharmaceutical composition of therapeutic anticoφs comprising divalent or trivalent cations and at least one excipient.

21. Composition according to claim 20, characterized in that said anticoφs have a divalent or trivalent metal cation on the residues His 310 and His 435 (Kabat numbering).

22. Pharmaceutical composition according to any one of claims 20 to 21, characterized in that said anticoφs are the anticoφs of claims 11 to 18 or human IgG or having a human Fc region.

23. Pharmaceutical composition according to any one of claims 20 to 22, characterized in that the metal cations are zinc, iron, copper or cadmium, or a mixture of several of them.

24. Pharmaceutical composition according to claim 23, characterized in that said cation is zinc, in particular zinc acetate, zinc bromide, zinc citrate, zinc hydroxycarbonate, zinc piodide, L- zinc lactate, zinc nitrate, zinc stearate, zinc gluconate, zinc sulphate, zinc chloride or zinc hydrochloride.

25. Pharmaceutical composition in which at least 50%, 60%, 70%, 80%, 90%, or even 99% of the anticoφs have a divalent or trivalent metal cation linked, in particular linked to the site comprising the residues His 310 and His 435 (Kabat numbering).

26. Composition according to claim 25, characterized in that said site comprises the residues His 433 and / or Asn 434 (Kabat numbering).

27. Composition according to any one of claims 25 or 26, characterized in that said metal cation is zinc, iron, copper or cadmium, or a mixture of several of them.

28. Solution comprising a monoclonal anticoφs or polyclonal anticoφs and an appropriate amount of divalent or trivalent metal cation, in particular a concentration of zinc ions at least equal to the concentration of anticoφs, said solution being suitable for injection by intravenous, intramuscular, or subcutaneous route.

29. Use of zinc ions to improve the crystallization of therapeutic anticoφs.

30. Test to assess the effectiveness of an anticoφs including the study of the 3D conformation of the domain involving His 310, His 435, His 433 and / or Asn 434 (Kabat numbering) as shown in Figure 1 or 2 or an assay of the Zinc content of said anticoφs, the presence of zinc being an indication of the effectiveness of the anticoφs.

31. Anticoφs having at least one of its residues His 310 and His 435 modified (Kabat numbering).

32. Anticoφs according to claim 31, characterized in that said modification is a mutation.

33. Anticoφs according to claim 32, characterized in that said mutation is a substitution by an amino acid having a low affinity for said metal cations.

34. Anticoφs according to claim 33, characterized in that said amino acid is lysine, alanine, glycine, valine, leucine, isoleucine, praline, methionine, tryptophan, phenylalanine, serine or threonine.

35. Anticoφs according to any one of claims 32 to 34, characterized in that the residues His 310 and His 435 are substituted with lysine residues.

36. Anticoφs according to claim 31, characterized in that the modification is carried out by the DEPC.

37. Anticoφs according to any one of claims 31 to 36, characterized in that they belong to the subclass of IgGl.

38. Anticoφs according to any one of claims 31 to 37, characterized in that they have a reduced functional activity compared to the same unmodified anticoφs.

39. Use of anticoφs 31 to 38 for the preparation of a medicament intended for the prevention of transplant rejection or for the treatment of a pathology chosen from tetanus, diphtheria, or caused by a pathogenic agent or derived toxin, listed as being particularly dangerous in cases of bioterrorism (classification of the Centers for Disease Confrol, CDC), in particular anthrax (Bacillus anthracis), botulism (Clostridium botulium), plague (Yersinia pestis), smallpox (Variola major), tularemia (Francisella tularensis), viral hemorrhagic fevers (linked to filoviruses -Ebola, Marburg and arenaviruses -Lassa, Machupo), epsilon toxin from Clostridium perfringens, brucellosis (Brucella species), melioidosis (Burkholderia mallei), toxin castor (Ricinus communis) ..

40. Use of the anticoφs according to any one of claims 31 to 38 for the preparation of a medicament to replace IgG4.