WO2005005608A2

WO2005005608A2 - Compositions and methods for differentiating adipose stromal cells into pancratic beta cells

Info

Publication number: WO2005005608A2
Application number: PCT/US2004/020980
Authority: WO
Inventors: Alireza Rezania
Original assignee: Lifescan, Inc.
Priority date: 2003-06-30
Filing date: 2004-06-29
Publication date: 2005-01-20
Also published as: WO2005005608A3

Abstract

This invention relates generally to methods and compositions for the production of cells characteristic of pancreatic beta cell lineage. In particular, the present invention relates to methods and compositions for differentiating adipose stromal cells into cells having at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage. The present invention also relates to the cells produced in accordance with the present methods and the use of these cells in the treatment of diseases.

Description

Compositions and Methods for Differentiating Adipose Stromal Cells into Pancreatic Beta Cells

FIELD OF THE INVENTION This invention relates generally to methods and compositions for the production of cells characteristic of pancreatic beta cell lineage. In particular, the present invention relates to methods and compositions for differentiating cells obtained from mammalian adipose tissues into cells of pancreatic beta cell lineage. The present invention also relates to the cells produced in accordance with the present methods and the use of these cells in the treatment of diseases.

BACKGROUND OF THE INVENTION Diabetes is a major public health problem. In the United States, sixteen million persons have diabetes (American Diabetes Association, Professional Section Quarterly, Summer 1998). Clearly, the economic burden of diabetes is enormous. Each year, patients with diabetes or its complications spend 24 million patient-days in hospitals. Diabetes is an expensive disease with an estimated total annual cost of $98 billion. The full economic impact of this disease is even greater because additional medical expenses are often attributed to the specific complications of diabetes rather than to diabetes itself. Diabetes is a chronic, complex metabolic disease that results in the inability of the body to properly maintain and use carbohydrates, fats, and proteins. It results from the interaction of various hereditary and environmental factors and is characterized by high blood glucose levels caused by a deficiency in insulin production or an impairment of its utilization. Most cases of diabetes fall into two clinical types: Type I, or juvenile-onset, and Type II, or adult-onset. Type I diabetes is often referred to as Insulin Dependent Diabetes, or IDD. Each type has a different prognosis, treatment, and cause. Approximately 5 to 10 percent of diabetes patients have IDD. IDD is characterized by a partial or complete inability to produce insulin usually due to destruction of the insulin-producing cells of the pancreatic islets of Langerhans. Patients with IDD would die without daily insulin injections to control their disease. Additionally, a fraction of Type II diabetics are insulin dependent and require insulin injections to improve their insulin resistance. Both Type I and insulin-dependent Type II diabetics can benefit from improvements in insulin administration, such as those described herein. It is generally recognized that Type I diabetes results from a progressive autoimmune response, which selectively destroys the insulin-producing cells of the pancreatic Islets of Langerhans in individuals who are genetically predisposed. Unfortunately, the mechanisms underlying destruction of the pancreatic cells remain unknown. There are many therapies currently used to treat diabetes, however, each has its limitations. One treatment involves transplanting islet of Langerhans cells into the diabetic patient. One of the main hurdles to human islet transplantation has been the lack of sufficient number of islets to treat the large number of diabetic patients. WO078929 describes a method to dedifferentiate islet cells to grow the cells in culture. This method is limited by the availability of islet tissue and the amount of expansion possible. Another approach to generate pancreatic islet-like cells is to differentiate stem cells from other tissues into a pancreatic beta cell. Attempts have been made to differentiate stem cells derived from bone marrow, intact islets, pancreatic ductal tissue, liver oval cells, hematopoietic cells, adipose tissue, and embryonic tissue. Thus far, these efforts have not resulted in beta cells which are easy to expandand are functional in vivo. Wilkinson and Gimble (WO 01/62901) and Hulvorsen (U.S. Patent 6,391,297) describe the differentiation of pluripotent stem cells generated from adipose tissue-derived stromal cells. However, there is no indication that these cells can differentiate into pancreatic-like cells. WO02002064748 describes a population of cells derived from bone marrow that after culturing can be injected into an animal and used to treat diabetes. There were very few cells that homed to the pancreas and produced insulin. Thus, this is not a clinically relevant therapy. Ramiya and Clark (US2002/0182728A1) describe a procedure where purified CD34+ bone marrow-derived stem cells express markers of pancreatic beta cells when cultured with a large number of factors for 14 days. Toma et al. (US2003/0003574) describe a cellular population derived from peripheral tissue that can be differentiated into many cell types including pancreatic cells and can be used for the treatment of diabetes. There is no teaching on how to differentiate these cells to pancreatic beta cells. WO200009666 describes a method to differentiate non-insulin producing cells with a growth factor selected from GLP-1 (glucagons-like peptide-1), Exendin-4, or growth factors having amino acid sequences substantially homologous to GLP-1 or

Exendin-4. The publication does not teach how this can be performed in vitro and to what cells this method can be applied. It is the goal of the present invention to provide a method to differentiate stromal cells obtained from mammalian adipose tissues into pancreatic beta cells for therapeutic treatment.

SUMMARY OF THE INVENTION It has been surprisingly found that stromal cells obtained from adipose tissue can be induced by certain factors to differentiate into cells of pancreatic beta cell lineage. Accordingly, the present invention provides compositions and methods for differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of cells of pancreatic beta cell lineage. Given the availability of adipose tissue, the present invention provides a convenient source of cells or precursor of cells useful for autologous, allogenic or xenogenic transplantation for the treatment of diabetic patients. In one aspect, the present invention provides compositions capable of differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage. Such composition includes a basic defined medium and one or more factors in amounts sufficient to induce the differentiation of adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage. A preferred composition of the present invention includes a basic defined medium such as DMEM, and a combination of factors, particularly growth factors/cytokines, which factors are selected from nicotinamide, members of TGF-β family (including TGF- βl, 2, and 3), bone morphogenic proteins (BMP -2, -4, 6, -7, -11, -12, and -13), fibroblast growth factors-1 and -2 (FGF1 and -2), platelet-derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF- 5, -6, -8, -10), glucagon like peptide-I and II (GLP-I and II), Exendin-4, retinoic acid, parathyroid hormone, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na-Butyrate, activin, betacellulin, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), or islet neo genesis-associated protein (INGAP). In another aspect, the present invention provides a method of differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of cells of pancreatic beta cell lineage by culturing adipose stromal cells in a basic defined medium, supplied with differentiation inducing amounts of one or more factors. In one embodiment of this aspect of the present invention, a population of stromal cells from adipose tissue, which express CD90 and lack CD49b and CD45, are selected prior to the induction of differentiation. The sorted cells can be further modified using a defined medium to induce differentiation into cells with at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage. In still another aspect, the present invention provides cells of pancreatic beta cell lineage produced from adipose stromal cells in accordance with the methods described hereinabove. Such cells can be further modified, e.g., by subjecting to further differentiation steps or by transformation. In a further aspect, the present invention provides a method of treating a diabetic patient by administering to the patient cells having characteristic markers of pancreatic beta cells, produced from human adipose stromal cells. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the morphology of cells cultured for two days in induction media or in standard islet (control) media. Figure 2 shows the PDX-1 staining pattern of cells cultured for two weeks in induction media ("induced culture") or in standard islet (control) media. Figure 3 shows change in morphology with addition of Forskloin to the induction media. Figure 4 shows formation of islet-like structures in cultures treated with induction factors.

DETAILED DESCRIPTION OF THE INVENTION It has been surprisingly found that stromal cells found in mammalian adipose tissue can be induced to differentiate into cells of pancreatic beta cell lineage. Accordingly, the present invention provides compositions and methods for differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage. As mammalian adipose tissue is readily available and stromal cells can be easily isolated from such tissue and easily expanded in culture, the cells characteristic of pancreatic beta cell lineage produced in accordance with the present invention represent a ready source useful for autologous, allogenic, or xenogenic transplantation for the treatment of diabetic patients. As used herein, the term "stromal cell" refers to a precursor cell having the ability to replicate and to generate a variety of differentiated cell types. An "adipose stromal cell" refers to precursor cells found in adipose tissue. By "adipose" is meant any fat tissue, which can be brown or white adipose tissue and includes subcutaneous, mammary, gonadal or omental adipose tissue. Preferably, the adipose tissue is subcutaneous white adipose tissue. The adipose tissue can be from any mammal having fat tissue. The term "mammal" includes, but is not limited to, primate (such as human), porcine, canine, murine, among others. Preferably the adipose tissue is human adipose tissue. Human adipose tissue can be conveniently obtained from liposuction surgery. If beta cells are desired for autologous transplantation into a subject, the adipose tissue can be isolated from that subject. However, allo genie adipose tissue (adipose tissue from a different individual of the same mammalian species) and xenogenic adipose tissue (adipose tissue from another mammalian species) can also be used to produce cells useful for allogenic or xenogenic transplantation. In one aspect, the present invention provides compositions capable of differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of the beta cell lineage. A "pancreatic beta cell" is meant to include any cell capable of secreting insulin, or an insulin precursor, preferably in a glucose-concentration-dependent manner. Cells of "pancreatic beta cell lineage" include fully differentiated beta cells, as well as precursors of beta cells or partially differentiated cells which share one or more markers characteristic of the beta cell lineage. Markers characteristic of the beta cell lineage are well known to those skilled in the art, and additional markers of the beta cell lineage continue to be identified. Any of these markers can be used to confirm that the adipose stromal cells have differentiated to acquire the properties characteristic of the beta cell lineage. Markers characteristic of the beta cell lineage include the expression of transcription factors such as PDX-1 (pancreatic and duodenal homeobox gene-1), NGN-3 (neurogenin-3), Hlxb9, Nkx6, l, Pax6, Neurod, Hnfla, Hnf6 and others, as well as the production and/or secretion of insulin or an insulin precursor. These transcription factors have been described, e.g., in Nature Reviews Genetics, Vol3, 524-632, 2002 for identification of endocrine cells. Those skilled in the art will recognize that known immunofluorescent, immunochemical, polymerase chain reaction, in situ hybridization, Northern blot analysis, chemical or radiochemical methods can be used to readily ascertain the presence of absence of a lineage specific marker. According to the present invention, the composition capable of differentiating adipose stromal cells into cells bearing at least one, preferably two or more, markers characteristic of the beta cell lineage includes a basic defined cell culture medium, supplied with one or more factors in amounts sufficient to induce the differentiation of adipose stromal cells into cells bearing markers characteristic of the beta cell lineage. By "basic defined cell culture medium" is meant a serum free or serum containing, chemically defined cell growth medium. Such medium includes, but is not limited to, Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL-1066, RPMI 1640, M199 medium, Ham's F10 nutrient medium and DMEM/F12. These and other useful media are available from GIBCO, Grand Island, New York, U.S.A., for example. A number of these media are reviewed in Methods in Enzymology, Volume LVIII, "Cell Culture", pp. 62-72, edited by William B. Jakoby and Ira H. Pastan, published by Acedemic Press Inc. A preferred basic defined cell culture medium for use in the present invention is DMEM/F 12. A basic defined cell culture medium may contain additional components of interest, including but not limited to, antibiotics (such as penicillin and streptomycin ("PS")), fetal bovine serum or fetal calf serum (FBS or FCS), albumin, amino acids and other compounds that are conventionally used in cell culture. A basic defined culture medium, when supplied with differentiation-inducing amounts of one or more factors is referred to as an "induction medium". In accordance with the present invention, the induction medium contains less than 2% serum, such as FBS or FCS. FBS may be replaced by equivalent human serum or albumin, bovine albumin or fractions or specific compounds therein that permit or enhance transdifferentiation of stromal cells to the beta cell lineage. By "factor" is meant to include any molecule, growth factor, cytokine, substance, compound or composition that promote the differentiation of adipose stromal cells into cells bearing one or more markers characteristic of pancreatic beta cell lineage. Factors appropriate for use in the induction medium include, but are not limited to, nicotinamide, members of TGF-β family, including TGF-β 1, 2, and 3, bone morpho genie proteins (BMP-2, -4, 6, -7, -11, -12, and -13), fibroblast growth factors-1 and -2 (FGF1 and -2), platelet-derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10), glucagon like peptide- I and II (GLP-I and II), Exendin-4, retinoic acid, parathyroid hormone, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na-Butyrate, activin, betacellulin, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), islet neogenesis- associated protein (INGAP), or combinations thereof. The amounts of the factors should be such that, when supplied in a basic defined medium, the factors induce the differentiation of adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of the beta cell lineage over a time period of about one to four weeks. In a preferred embodiment of the present invention, a combination of growth factors is used to induce the differentiation of adipose stromal cells into cells bearing one or more markers characteristic of pancreatic beta cell lineage. In a particularly preferred embodiment, a combination of growth factors including at least bFGF, EGF, GLP-1 and IGF-1, is supplied to a basic defined medium to induce differentiation of adipose stromal cells into the beta cell lineage. Preferably, the induction medium contains about 25-60 ng/ml bFGF, about 10-30 ng/ml EGF, about 600-1200 ng/ml GLP-1, and about 150-250 ng/ml IGF-1. More preferably, the induction medium contains about 40 ng/ml bFGF, about 20 ng/ml EGF, about 800-1000 ng/ml GLP-1, and about 200 ng/ml IGF-1. In another preferred embodiment, the induction media also contains bone morphogenic protein-2 (BMP-2), preferably at a concentration of 10-200 ng/ml, more preferably 50-100 ng/ml. In another aspect, the present invention provides a method of differentiating adipose stromal cells into cells bearing at least one marker, preferably two or more markers, characteristic of cells of pancreatic beta cell lineage by culturing adipose stromal cells in a basic defined medium in the presence of differentiation inducing amounts of one or more factors as described hereinabove. Adipose tissue from which adipose stromal cells are isolated can be obtained from any mammal, preferably from human. Human adipose tissues can be readily obtained by liposuction or any other suitable method. Typically, the adipose tissue is treated with proteolytic enzymes, such as collagenase or trypsin or both, to form a single cell suspension. Stromal cells can then be partially or completely purified by a variety of procedures known to those skilled in the art, such as differential centrifugation, fluorescence-activated cell sorting, affinity chromatography, and the like. Relevant teachings for isolating stromal cells from adipose tissue can be found in e.g., WO 00/53795, WO 01/62901, U.S. Patent 6,200,606, and BBRC, Nol 294, pg 371-379, 2002. In one embodiment, a population of stromal cells from adipose tissue, which express CD90 and lack CD49b and CD45, are selected prior to the induction of differentiation. The partially or completely isolated adipose stromal cells, or a pre-selected population of adipose stromal cells, can be cultured in a basic defined medium for up to ten cell passages prior to treatment with an induction medium. Any basic defined cell culture medium as described hereinabove, e.g., DMEM/F12 (1:1 v/v), alpha MMEM, and BME, can be used. A preferred basic defined culture medium for use is DMEM/F12 (1 : 1 v/v). Typically, 5-20% Fetal Calf/Bovine Serum (FCS or FBS) is added to the basic cell culture medium to support the growth of adipose stromal cells. Prior to induction of differentiation, adipose stromal cells are plated at a desired density, e.g., at about 50000 cells/ well in 24-well plates, and cultured in a basic defined culture medium supplied with about 10% FBS until the culture reaches about 60-80% confluency, or preferably 70% confluency. The cells are then switched to a basic defined culture medium supplied with 20% FBS for one or two days until being switched to an induction medium. Alternatively, following 60-80% confluency, the cell medium is switched to an induction media containing differentiation-inducing factors. As described hereinabove, an induction medium is composed of a basic defined culture medium, which preferably contains a small amount of serum (<2%), and which is supplied with differentiation inducing amounts of one or more factors as described. Adipose stromal cells are cultured in an induction medium for a period of time sufficient to induce differentiation into cells of the beta cell lineage. The length of culture required for differentiation of stromal cells into cells having characteristic markers of the beta cell lineage depends on a number of factors, for example, the nature and concentrations of the growth factors, and the seeding density of adipose stromal cells prior to induction. Generally speaking, the cells are cultured in the induction medium for one to four weeks, preferably two to three weeks, to acquire two or more markers characteristic of the beta cell lineage . The combination and concentrations of growth factors, the length of culture, and other culture conditions can be optimized by those skilled in the art to achieve effective differentiation by, e.g., monitoring the percentage of cells that have differentiated into cells characteristic of the beta cell lineage and the extent of differentiation by determining the type of markers being expressed by the cells. In still another aspect, the present invention provides cells having at least one marker, preferably two or more markers, characteristic of pancreatic beta cell lineage produced from adipose stromal cells in accordance with the methods described hereinabove. In a preferred embodiment, cells of the beta cell lineage produced from adipose stromal cells express both PDX-1 and NGN-3. The cells produced in accordance with the present invention can be fully differentiated beta cells, or partially differentiated cells of the beta cell lineage. The partially differentiated cells can be subjected to further differentiation steps in vitro or in vivo. The cells produced in accordance with the present invention, whether fully or partially differentiated, can also be modified by, e.g., transformation to express one or more growth factors or cytokines capable of promoting the growth or differentiation of cells. The cells produced from adipose stromal cells are useful for transplantation to patients such as diabetic patients, or for the production of cells that are useful for transplantation. Accordingly, in a further aspect, the present invention provides a device for implantation, which is incorporated with cells produced in accordance with the present invention. Such device can be any biocompatible degradable polymeric scaffolds, porous non-degradable devices or encapsulation. In still another aspect, the present invention provides a method of treating a human diabetic patient by administering to the patient cells having at least one marker, preferably two or more markers, characteristic of pancreatic beta cells, which are produced from adipose stromal cells as described hereinabove. The cells can be used as dispersed cells or formed into clusters that may be infused into the hepatic portal vein. Alternatively, the cells can be provided in biocompatible degradable polymeric scaffolds, porous non-degradable devices or encapsulation for implantation into an appropriate site in the subject. The site can be selected from the liver, the natural pancreas, the renal subcapsular space, the mesentery, the omentum, a subcutaneous pocket or the peritoneum.

The cells administered to the patient can be partially differentiated or fully differentiated cells of the beta cell lineage. When partially differentiated cells are used, such cells can fully differentiate into beta cells in the patient after transplantation. To enhance further differentiation, survival or activity of implanted cells, additional factors, such as growth factors including those identified hereinabove, antioxidants or anti-inflammatory agents, may be administered either before, simultaneously with, or after the administration of the cells characteristic of pancreatic beta cell lineage. For example, the cells (fully or partially differentiated) and one or more growth factors can be included in the same device or encapsulation for implantation. It is preferred that the administered cells be derived from the patient that is being treated so as to avoid immune rejection. However, where autologous cells are not available, pancreatic beta lineage cells produced from allogenic adipose stromal cells or xenogenic adipose cells can be used. In this instance, it can be useful to encapsulate the pancreatic beta lineage cells in a capsule that is permeable to the endocrine hormones, including insulin, glucagon, somatostatin and other pancreas produced factors, yet impermeable to immune humoral factors and cells. Preferably the encapsulant is hypoallergenic, is easily and stably situated in a target tissue, and provides added protection to the implanted structure. The amount of cells that should be used in implantation depends on a number of factors including the patient's condition and response to the therapy, and can be determined by a physician. The present invention is further illustrated but not limited by the following examples.

Example 1 Isolation Of Stromal Cells From Adipose Tissue Human adipose tissue derived stromal cells (PHAAT cells) were isolated from human liposuction fat according to the protocol described by Zuk et al. (Tissue Engineering (2001) 7; 211-228). Briefly, human liposuction fat was obtained a few hours after an elective liposuction procedure and was mixed with an equal volume of 0.15% (w/v) Collagenase type IN in DMEM medium. The enzyme/liposuction fat mixture was incubated at 37 °C for 30 min with slow shaking to allow for digestion of fatty tissue.

Cells were isolated by centrifugation at 1200 x g for 10 minutes and washed with DMEM with 10% (v/v) FBS and IX P/S. The cells were cultured in DMEM-F12 containing 10% FBS and 1%P/S. Typically, 0.5 million stromal cells were isolated per ml of liposuction fat. Human preadipocytes were also obtained from Cambrex (Walkersville, MD) and cultured in the same growth media.

Example 2 Induction of Differentiation Adipose stromal cells were cultured initially in basic media (DMEM: F12, 1 :1,

P/S), with the addition of FBS to 10% (v/v). Cells were passed prior to confluency. For all the studies, P2-P6 (passage 2 to passage 6) cells were used. The passed cells were subsequently grown in 24 well plates (tissue culture polystyrene treated, Ν=6 wells per culture plate) at a density of 50000 cells/well, and allowed to expand until 70% confluency in the control media supplied with 10%o FBS. In some cultures, the media was then switched to basic media supplied with 20% FBS for 1-2 additional days. The cultured cells were then switched to an induction media with 0.1% FBS containing the following: DMEM:F12 1% P/S 0.5% BSA 50 mM IBMX (3-isobutil-l-methylxanthine) 10 mM Nicotinamide Growth factors 40 ng/ml bFGF 20 ng/ml EGF 800-1000 ng/ml GLP-1 200 ng/ml IGF-1 As control, half of the wells in the culture plates were cultured in the absence of any growth factors and in low serum (<2%). Every three days, the media from the culture were discarded and fresh induction media were provided. The cells were grown for 2-3 weeks. At various time points during the culture, the cells were examined for morphology and the expression of PDX-1 by indirect immunofluorescence staining as follows. Briefly, the adherent cells were fixed for 10 mins in 1%> formaldehyde followed by three rinses with PBS. The cells were permeabilized with 0.5%. Triton-X at 37°C for 10 mins followed by three rinses with PBS. The permeabilized cells were blocked for 20 mins with 10% blocking serum at 37°C. The blocking serum was from the species in which the 2^nd antibody is raised. The cells were incubated with a goat anti-human PDX-1 antibody (Santa Cruz Biotechnology, Ca) for 60 mins at 37°C, followed by three rinses with PBS. Next, the cells were incubated for 45 mins at 37°C with rabbit anti-goat IgG (Sigma, MO) conjugated with TRITC (tetramethylrhodamine isothiocyanate) in PBS. Figure 1 depicts the morphology of cells treated with the cocktail of growth factors listed above as compared to control cultures. By day 2, there was a clear difference in morphology of treated cells as compared to controls. Following 2 weeks of culturing in the induction media, a large proportion of cells stained positive for PDX-1, as shown in Figure 2.

Example 3 Induction of Differentiation

P3 adipose-derived stromal cells were cultured as described in Example 2, and one of the following factors was added to the induction media of Example 2: BMP-2 (50 ng/ml), BMP-3 (125 ng/ml), BMP-4 (50 ng/ml), BMP-5 (125 ng/ml), BMP-6 (50 ng/ml), BMP-7 (50 ng/ml), GDF-6 (125 ng/ml), GDF-8 (50 ng/ml), or GDF-15 (125 ng/ml). Following 2 wks of culturing in the induction media, RNA was collected from the cells using RiboPure kit (Ambion, Texas). Approximately 10 μg of total RNA from each sample was analyzed by Real Time PCR using the TaqMan^® One-Step RT-PCR kit according to the manufacturer's specifications (Applied Biosystems, Foster City, CA). The RNA and PCR reaction components were combined and the samples were incubated at 48 °C for 30 minutes followed by 10 minutes at 95 °C then 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. PCR was performed using an Applied Biosystems SDS 7000 machine. Samples were normalized by 18S rRNA gene expression using the TaqMan^® Ribosomal RNA Control Reagents (Applied Biosystems) according to the manufacturer's specifications. The Cx and ΔCx values were determined according to published methods (User Bulletin #2, ABI Prism 7700 Sequence Detection System, updated 10/2001, Applied Biosystems) and normalized to 18sRNA expression. The following probes and primers were used for PDX-1 and NGN-3:

PDX-1

Forward Primer GGCCGCAGCCATGAAC

Reverse Primer CGCATGGGTCCTTGTAAAGCT

Probe CCGCGTAGTACTGCTCC NGN3

Forward Primer GCTGCTCATCGCTCTCTATTCTT

Reverse Primer CGAGGGTTGAGGCGTCAT

Probe

18S primer and probe was purchased from Applied Biosystems Foster City, CA (TaqMan® Ribosomal RNA Control Reagents Product # 4308329). As controls, human foreskin fibroblasts and undifferentiated adipose-derived cells were also evaluated using real-time PCR. Addition of BMP2 induced a 25-fold increase in expression of PDX-1 expression as compared to undifferentiated cells. There was also a significant increase in ngn3 expression in the cells which were treated with BMP2

Example 4 ι Induction of Differentiation

P2-P5 adipose-derived stromal cells were cultured in control media containing

DMEM: F12, P/S with the addition of FBS to 10% (v/v). At 60-80% confluency, the cells were passed and subsequently grown in 24 well plates (tissue culture polystyrene treated) at a density of 50000 cells/well and allowed to expand until 70% confluency in the control media supplied with 10% FBS. The cultured cells were then switched to an induction media with 0.1% FBS, 1% P/S, 500 ng/ml GLP-1 or 500 ng/ml of Exendin-4, 20 ng/ml Activin, 10 ng/ml Betacellulin, 100 M Forskolin, and 100 mM Na-Butyrate. The cells were fixed and stained for PDX-1 as described in Example 2. Similar to the results disclosed in Example 2, the cells treated with the induction factors also stained positive for PDX-1. Furthermore, cells treated with 100 mM Forskolin showed a 74 fold increase in NGN3 expression, by real-time PCR, as compared to controls and there was a significant change in morphology in the treated cells as compared to controls (Figure 3). Example 5 Induction of Differentiation

P2-P5 adipose-derived stromal cells were cultured in control media containing DMEM: F12, P/S with the addition of FBS to 10% (v/v). At 60-80% confluency, the cells were passed and subsequently grown in 24 well plates (tissue culture polystyrene treated) at a density of 50000 cells/well and allowed to expand until 70% confluency in the control media supplied with 10% FBS. The cultured cells were then switched to an induction media with 0.1%. FBS, 1% P/S and the combination of the following factors: 10 μM triethylene pentamine, 10 nM gastrin I, 10 nM sulfated gastrin and 20 ng/ml TGF alpha. The cells were fixed and stained for PDX-1 as described in Example 2. Similar to the results disclosed in Example 2, the cells treated with the induction factors also stained positive for PDX-1. Example 6 Induction of differentiation

P2-P5 adipose-derived stromal cells were cultured at a density of 50000 cells/cm² in 24 well plates (untreated tissue culture plates) for 2 days in basic media containing DMEM: F12, 0J%FBS, and 1% P/S. Next, the media was switched to induction media described in Example 2 and the cells cultured for additional 2 wks. Following 2 days of incubation in the induction media, islet-like structures were observed in the cultures (Figure 4). Example 7 Selection of CB90 positive cells

P2-P5 adipose-derived stromal cells were cultured in basic defined media containing DMEM:F12, 10% FBS, and 1% P/S until 70% confluency was reached. The cells were released using 0.05% trypsin-EDTA solution followed by rinsing with basic media to neutralize trypsin. The cell suspension was centrifuged for 5 mins at 1800 RPM, and the supernatant was discarded. The resulting cell pellet was resupspended at a density of 10⁶ cells/ml in PBS containing 0.1% BSA. 5 μg/ml of mouse anti-human CD49b was added to the cell suspension for 15 mins at 4°C. The cell suspension was respun at 1200 RPM for 10 mins and the supernatant removed. The pellet was resuspended in 480 μl of PBS with 0.1% BSA and 20 μl of anti-mouse IgG bound to magnetic microbeads (Miltenyi Biotech, Ca) for 15 mins at 4°C. The cell suspension was depleted of the magnetically bound cells using a column and magnet provided by the manufacturer. The resulting cells were again depleted of CD45 positive cells using the above procedure. Next, the CD49b and CD45 depleted cells were positively selected for CD90+ cells using the above procedure with the exception that the cells bound to the column were eluted by removal of the column from the magnet. The selected cells (CD49b- CD45- CD90+) were cultured under basic defined media for additional 2-3 passages. The passed cells were induced to differentiate into the beta cell lineage using the induction media described in Example 2. The resulting differentiated cells also stained positive for PDX-1 using indirect immunofluorescence, and showed expression for PDX-1 and ngn-3 using realtime PCR. .

Claims

WHAT IS CLAIMED IS:

1. A composition for differentiating adipose stromal cells into cells bearing at least one marker characteristic of pancreatic beta cell lineage, comprising a basic defined culture medium and at least one factor in an amount sufficient to induce the differentiation of adipose stromal cells into cells bearing at least one marker characteristic of pancreatic beta cell lineage.

2. The composition of claim 1 , wherein said basic defined medium is selected from the group consisting of Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL-1066, RPMI 1640, M199 medium, Ham's F10 nutrient medium, and DMEM/F12.

3. The composition of claim 2, wherein said basic defined medium is DMEM/F12.

4. The composition of claim 2 or 3, wherein basic defined medium comprises fetal calf or bovine serum (FCS), bovine serum albumin (BSA), penicillin and streptomycin.

5. The composition of claim 1, comprising serum in an amount of less than 2%.

6. The composition of claim 1 , wherein said factor is selected from the group consisting of nicotinamide, members of TGF-β family, members of bone morphogenic proteins (BMP), fibroblast growth factor- 1 (FGF-1), fibroblast growth factor-2 (FGF-2), platelet-derived growth factor- AA (PDGF-AA), and platelet-derived growth factor-BB (PDGF-BB), platelet rich plasma, insulin growth factor-I (IGF-I), insulin growth factor-II (IGF-II), members of growth differentiation factor (GDF), glucagon like peptide-I (GLP-I), glucagon like peptide-II (GLP-II), Exendin-4, retinoic acid, parathyroid hormone, epidermal growth factor (EGF), gastrin I and II, copper chelators, TGF-α, forskolin, Na- Butyrate, activin, betacellulin, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), and islet neogenesis- associated protein (INGAP).

7. The composition of claim 1 , comprising a basic defined culture medium, nicotinamide, bFGF, EGF, GLP-1 and IGF-1.

8. The composition of claim 1 , comprising a basic defined culture medium and a BMP protein.

9. A method of differentiating adipose stromal cells into cells bearing at least one marker characteristic of pancreatic beta cell lineage, comprising culturing adipose stromal cells in a composition, wherein said composition comprises a basic defined medium and at least one factor in an amount sufficient to induce differentiation of adipose stromal cells.

10. The method of claim 9, wherein said marker characteristic of pancreatic beta cell lineage is the expression of a transcription factor selected from the group consisting of PDX-1 (pancreatic and duodenal homeobox gene-1), NGN-3 (neurogenin-3), Hlxb9, Nkx6, Ml, Pax6, Neurod, Hnfla, and Hnf6.

11. The method of claim 9, wherein said basic defined medium is selected from the group consisting of Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL-1066, RPMI 1640, M199 medium, Ham's F10 nutrient medium, and DMEM/F12.

12. The method of claim 11, wherein said basic defined medium is DMEM/F12.

13. The method of claim 12 or 13, wherein basic defined medium comprises fetal calf serum (FCS), bovine serum albumin (BSA), penicillin and streptomycin.

14. The method of claim 9, wherein said composition comprises serum in an amount of less than 2%.

15. The method of claim 9, wherein said factor is selected from the group consisting of nicotinamide, members of TGF-β family, members of bone morphogenic proteins (BMP), fibroblast growth factor- 1 (FGF-1), fibroblast growth factor-2 (FGF-2), platelet-derived growth factor-AA (PDGF-AA), and platelet-derived growth factor-BB (PDGF-BB), platelet rich plasma, insulin growth factor-I (IGF-I), insulin growth factor- II (IGF-II), members of growth differentiation factor (GDF), glucagon like peptide-I (GLP-I), glucagon like peptide-II (GLP-II), Exendin-4, retinoic acid, parathyroid hormone, epidermal growth factor (EGF), gastrin I and II, copper chelators, TGF-α, forskolin, Na- Butyrate, activin, betacellulin, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), and islet neogenesis- associated protein (INGAP).

16. The method of claim 9, wherein said composition comprises a basic defined culture medium, nicotinamide, bFGF, EGF, GLP-1 and IGF-1.

17. The method of claim 16, wherein said composition further comprises a BMP protein.

18. The method of claim 9, wherein said adipose stromal cells are a selected population of cells which express CD90 and do not express CD49b or CD45.

19. A cell produced by the method of any one of claims 9- 12 or 14- 18.

20. The cell of claim 19, having two or more markers characteristic of pancreatic beta cell lineage.

21. The cell of claim 20, which expresses both PDX- 1 and NGN-3.

22. The cell of claim 19, wherein said cell is a fully differentiated beta cell or a partially differentiated cell having two or more markers characteristic of pancreatic beta cell lineage.

23. A cell derived from the cell of claim 19 by way of further differentiation or transformation.

24. An implantation device comprising the cell of claim 19.

25. The implantation device of claim 24, wherein said device comprises a biocompatible degradable polymeric scaffold or a porous non-degradable device or encapsulation.

26. The implantation device of claim 24, wherein the cell included in the device said cell is a fully differentiated beta cell or a partially differentiated cell having two or more markers characteristic of pancreatic beta cell lineage.

27. The implantation device of claim 25, further comprising at least one factor which supports the survival, growth or differentiation of the cell included in the device.

28. A method of treating a diabetic patient comprising administering to the patient, cells produced by the method of any one of claims 9-12 or 14-18.

29. The method of claim 28, wherein said cells are produced by differentiating autologous, allogenic or xenogenic adipose stromal cells.

30. The method of claim 28, wherein said cells are provided in a device which is implanted at a site in the patient , wherein said device comprises a biocompatible degradable polymeric scaffold or a porous non-degradable device or encapsulation.

31. The method of claim 30, wherein said site is selected from the group consisting of the liver, the natural pancreas, the renal subcapsular space, the mesentery, the omentum, a subcutaneous pocket, or the peritoneum.