WO2005001086A1

WO2005001086A1 - IMMOBILIZED mRNA-PUROMYCIN CONJUGATE AND USE THEREOF

Info

Publication number: WO2005001086A1
Application number: PCT/JP2004/009396
Authority: WO
Inventors: Naoto Nemoto; Jun-Ichi Yamaguchi
Original assignee: Genefield, Inc.
Priority date: 2003-06-27
Filing date: 2004-06-25
Publication date: 2005-01-06
Also published as: JPWO2005001086A1

Abstract

It is intended to provide an immobilized mRNA-puromycin conjugate; an mRNA bead or an mRNA chip containing this conjugate; a protein chip produced from the mRNA chip; a diagnosis kit with the use of the mRNA bead or the mRNA chip; a method of immobilizing an mRNA or a protein on a solid phase; a solid phase method of synthesizing a protein; a method of analyzing an interaction between a protein and a molecule by using the immobilized mRNA-puromycin conjugate as described above; and so on.

Description

Description Immobilized mRNA-puromycin conjugate and uses thereof

The present invention relates to an immobilized mRNA-puromycin conjugate, an immobilized mRNA / DNA-puromycin-protein conjugate, and uses thereof. More specifically, the present invention uses an immobilized mRNA-pure mycin conjugate, an mRNA bead or an mRNA chip containing the conjugate, a protein chip, an mRNA bead or an mRNA chip prepared from the mRNA chip. Diagnostic kit, immobilized mRNA / DNA-puromycin monoprotein conjugate, solid-phase immobilization of mRNA or protein, solid-phase synthesis of protein, interaction between protein and molecule using the immobilized mRNA-puromycin conjugate The present invention relates to a method of analyzing an action and the like. Background art

In the field of recent genomics, the research theme has shifted from “structural analysis”, which clarifies gene sequences, to “functional analysis” using gene expression products. Basically, the functions of genes are realized by expression products such as proteins. Therefore, protein analysis is essential for functional analysis of genes. Functional analysis of proteins is performed through, for example, biochemical functional analysis based on analysis of protein-protein interaction and protein-nucleic acid interaction.

The yeast-to-hybrid method (Chien, C., et al., Proc. Natl. Acad. ScI. USA, 88, 9578-9582 (1991)) was used as an analysis method for protein-protein interaction. The phage display method (Smith, GP, Science, 228, pp. 1315-1317 (1985)), the GST-fusion protein pull-down method, the co-immunoprecipitation method and the like are known. As a method for analyzing protein-nucleic acid interaction, electrophoretic mobility shift assay (Re vz in, A., et al., Anal. Biochem., 153, 172 (1986)), DNasel footprint method (Calas, D., et al., Nucleic Acids Res., 5, 3157 (1978)) ), The methylation buffer method and the like are known.

Also, the //? 7? Virus method utilizing the specific properties of puromycin (Nemoto et al., FEBS Let t. 414, 405 (1997); Tabuchi et al., FEBS Let t. 508, 309 (2 001) ) Etc.), a method for analyzing protein interaction has also been developed (see W001 / 016600).

On the other hand, a DNA chip in which DNA is synthesized on a glass substrate and a protein chip in which proteins are arranged on a substrate are extremely important as tools for genome analysis and gene function analysis. In addition, immobilized proteins, including antibodies, on a substrate without losing their functions are expected to have a wide range of uses as sensor chips in the future. However, proteins are unstable compared to DNA and cannot be stored for a long period of time. Disclosure of the invention

As described above, various gene function analysis methods have been developed, but even today, there is a need for tools for more efficient and faster gene function analysis. In particular, development of an expression method and an immobilization method while stably retaining the function of the protein is desired.

The present inventors have intensively studied to solve the above problems. First, the present inventors have developed a tool that can easily determine the interaction between a protein composed of various amino acid sequences and a target substance. That is, the present inventors have proposed a conjugate of a nucleic acid molecule (mRNA) encoding a test protein whose interaction with a target substance is to be determined, and puromycin, which plays a role as a connecting portion when synthesizing the protein. Prepared an “immobilized mRNA-purominsin conjugate” having a structure immobilized on a solid phase.

Contacting the immobilized mRNA-purominsin conjugate with a translation system Thus, it is possible to synthesize a protein on a solid phase. The synthesized protein is immobilized on the solid phase via puromycin.

As a preferred embodiment of the above immobilized mRNA-purominsin conjugate, a microarray chip (mRNA chip) immobilized on a substrate such as a chip can be exemplified. By using the chip and bringing it into contact with a translation system, a protein chip can be appropriately prepared. Usually, protein (protein) chips have problems in storage or handling due to instability of the protein. In a preferred embodiment of the present invention, it is possible to convert the chip into a protein chip by forming a chip in the form of a relatively stable mRNA instead of a protein, for example, by bringing it into contact with a translation system immediately before use. is there. That is, the present invention provides a protein interaction analysis tool which is immobilized on a solid phase in the form of a relatively stable mRNA instead of an unstable protein.

The “immobilized mRNA-puromycin-protein conjugate” in which the protein of the translation product of the mRNA synthesized by providing the immobilized mRNA-puromycin conjugate to the translation system is bound to the puromycin is a protein It can be used for analysis or screening of molecules that can interact with and is very useful. Furthermore, the present inventors provide the above-described “immobilized mRNA-puromycin-protein conjugate” to a reverse transcription reaction system to thereby obtain a complementary DN of a reverse transcript of the mRNA.

We succeeded in producing an “immobilized DNA-puromycin-protein conjugate” to which A was linked. Usually, DNA is more stable than RNA, and therefore, when the conjugate is brought into contact with a test molecule in protein interaction analysis, the “immobilized DNA-puromycin-protein conjugate” is extremely Useful.

The present invention has been made to solve the above-mentioned problems of the prior art, and includes the following: an immobilized mRNA-puromycin conjugate; an mRNA bead or an mRNA chip containing the conjugate; Protein chip, mRNA bead, or diagnostic kit using mRNA chip, immobilized DNA-puromycin-tamper A solid phase immobilization method of a protein conjugate, mRNA or protein, a solid phase synthesis method of a protein, and a method of analyzing the interaction between a protein and a molecule using the immobilized mRNA-puromycin conjugate. . More specifically, the present invention provides

[1] Immobilized by immobilizing a conjugate of mRNA and puromycin or a puromycin-like compound on a solid phase, nRNA-puromycin conjugate,

[2] the immobilized mRNA-puromycin according to [1], wherein the mRNA-puromycin conjugate is obtained by linking puromycin or a puromycin-like compound to the 3 ′ end of the mRNA via a spacer; Concatenation,

[3] The immobilized mRNA-puro according to [1] or [2], wherein the mRNA-puromycin conjugate is bound to a solid phase via a solid phase binding site provided on the spacer. Mycin conjugate,

(4) the immobilization according to any one of (1) to (3), wherein the spacer comprises a polynucleotide, polyethylene, polyethylene glycol, polystyrene, peptide nucleic acid, or a combination thereof as a main skeleton. MRNA-pure bitemycin conjugate,

(5) The solid phase is selected from styrene beads, glass beads, agarose beads, sepharose beads, magnetic beads, glass substrates, silicon substrates, plastic substrates, metal substrates, glass containers, plastic containers, and membranes. 1) the immobilized mRNA-pure mouth mycin conjugate according to any one of-

[6] a protein of a translation product of the immobilized mRNA-puromycin conjugate according to any one of [1] to [5], which is synthesized by providing the conjugate to a translation system, An immobilized mRNA-puromycin-protein conjugate, which is linked via a mycin or puromycin-like compound, [7] The immobilized mRNA-puromycin-protein conjugate according to [6] is reverse-transcribed. The complementary DNA of the mRNA synthesized for the system is linked to the ligated product. An immobilized DNA-puromycin-protein conjugate comprising the immobilized mRNA-puromycin conjugate according to any one of [8] [1] to [5], which is immobilized on a microarray substrate. , MRNA chip,

(9) a protein chip prepared using the mRNA chip according to (8), (10) an mRNA bead in which a conjugate of mRNA and puromycin or a puromycin-like compound is immobilized on a bead,

(11) an mRNA chip according to (8) or an mRNA bead according to (10), and a kit for protein interaction analysis comprising a cell-free translation system,

[1 2] (a) a step of preparing an mRNA-puromycin conjugate by linking the mRNA and puromycin through a sensor provided with a solid-phase binding site; and

(b) a step of immobilizing the mRNA-puromycin conjugate on a solid phase by binding the solid phase binding site of the supplier to a solid phase;

A method of immobilizing mRNA on a solid phase,

[13] (a) a step of linking mRNA and puromycin through a spacer provided with a solid-phase binding site to prepare an mRNA-puromycin conjugate;

(b) fixing the mRNA-puromycin conjugate to a solid phase by binding the solid phase binding site of the spacer to a solid phase; and

(c) a step of synthesizing a protein by bringing the mRNA-puromycin conjugate into contact with a translation system;

A method for immobilizing a protein on a solid phase,

[14] (a) a step of linking mRNA and puromycin through a spacer provided with a solid phase binding site to prepare an mRNA-puromycin conjugate;

(c) contacting the mRNA-puromycin conjugate with a translation system; The process of synthesizing proteins

A method for synthesizing a protein in a solid phase,

[15] a method for analyzing the interaction between a protein and a molecule,

(a) a step of contacting the immobilized mRNA-pikumycin conjugate of any one of [1] to [5] and a translation system to synthesize a protein on a solid phase;

(b) contacting the protein synthesized in step (a) with one or more target substances; and

(c) a step of determining whether the protein and the target substance interact with each other;

The above analysis method comprising:

[16] A method for analyzing the interaction between a protein and a molecule,

(a) contacting the immobilized mRNA-puromycin conjugate according to any one of [1] to [5] above with a translation system to synthesize a protein on a solid phase;

(b) contacting the mRNA-puromycin-protein conjugate synthesized in step (a) with a reverse transcription reaction system to prepare a DNA-puromycin-protein conjugate;

(c) contacting the DNA-puromycin overnight protein conjugate prepared in step (b) with one or more target substances; and

(d) determining whether the protein in the conjugate interacts with the target substance;

The above analysis method comprising:

[17] The method according to [15] or [16], further comprising the step of identifying a protein and / or a target substance determined to have interacted with the protein. It is. Hereinafter, the present invention will be described in detail based on its embodiments.

1. Immobilized mRNA-puromycin conjugate

A first embodiment of the present invention relates to an immobilized mRNA-puromycin conjugate (hereinafter referred to as “immobilized mRNA-PM”) comprising a conjugate of mRNA and puromycin or a puromycin-like compound immobilized on a solid phase. Also referred to as "linkage").

The mRNA used in the present invention includes both those of unknown sequence and those of known sequence. That is, when a substance that binds to a protein with a known sequence is searched or quantified using the mRNA-PM conjugate of the present invention, an mRNA having a nucleic acid sequence encoding a protein with a known sequence is used. Conversely, when analyzing the function of a protein of unknown sequence using the mRNA-PM conjugate of the present invention, an mRNA having a nucleic acid sequence encoding a protein of unknown sequence can be used. The mRNA used here is, for example, transcribed from mRNAs encoding various receptor proteins with known sequences, mRNAs encoding various antibodies or their fragments, mRNAs encoding various enzymes, and DNAs from various gene libraries. The sequence is selected from mRNAs having unknown sequences, mRNAs having random sequences transcribed from DNAs having sequences randomly synthesized by organic synthesis, and the like.

The mRNA-PM conjugate of the present invention is generally one in which pure mouth mycin is ligated to the 3 ′ end of the mRNA via a spacer. Here, puromycin or puromycin-like compound is a hinge that connects mRNA and translated protein when a mRNA-PM conjugate immobilized on a solid phase is introduced into a translation system to synthesize a protein. Or it acts as a connection. In other words, when the translation system is brought into contact with mRNA that is linked to puromycin via a spacer, an in vitro virus virion is generated in which the mRNA is linked to a protein translated through puromycin. (See Nemo to et al., FEBS Lett. 414, 405 (1997)). Puromycin has a chemical structural skeleton similar to aminoacyl-tRNA at its 3 'end. The following formula (I): (Chemical 1)

(I)

It has the ability to bind to the C-terminus of the synthesized protein when the protein is synthesized in the translation system. In the present specification, the term "puromycin-like compound" means that the 3 'end of the compound has a similar chemical structural skeleton to aminoacyl-tRNA and is synthesized at the C-terminus of the synthesized protein when the protein is synthesized by the translation system. A compound that has the ability to bind.

Examples of puromycin-like compounds include 3'-N-aminoacylpuromycin aminonucleoside (3'-N-Aminoacylpuromyc in aminonucleoside, PANS-amino acid), for example, PANS_Gly in which the amino acid part is glycine and PANS_Gly in the amino acid part PAN S-VaK PANS-Ala in which the amino acid portion corresponds to alanine, and other PANS-amino acid compounds in which the amino acid portion corresponds to all amino acids. In addition, 3'-N-aminoacyl adenosine aminonucleoside (3'-amino-acyl adenosine amino amino acid) is linked by an amide bond formed by dehydration-condensation of the amino group of 3'-aminoadenosine and the amino group of amino acid. , AANS—amino acids), for example, AANS-Gly with amino acid portion of glycine, AANS-Val with amino acid portion of palin, AANS_Al a with amino acid portion of alanine, and other amino acids whose amino acid portions correspond to all amino acids of all amino acids —Amino acid compounds can be used. In addition, nucleosides or nucleosides and ester bonds of amino acids can also be used. In addition to the above puromycin, Puromycin-like compounds that are preferably used include lipocitidyl puromycin (rCpPur), deoxydilpuromycin (dCpPur), and deoxyperidylbile single-mouthed mycin (dUpPur). Is shown.

(Chemical 2)

rCpPur dCpPur

(Chemical 3)

dUpPur Fluoropur 0-

(Chemical 4)

Lurothiopur In the mRNA-PM conjugate of the present invention, the mRNA and the puromycin or puromycin-like compound (hereinafter, simply referred to as "puromycin") are usually linked via a spacer. You. The conjugate is usually immobilized on a solid phase via a solid phase binding site provided on the probe. Spiral is mainly used to efficiently incorporate piuromycin into a site called ribosome A site. Accordingly, the spacer is not particularly limited as long as it has such properties, but a spacer having a skeleton having flexibility, hydrophilicity and a simple structure with few side chains is preferable. Specifically, examples of the spacer used herein include, but are not limited to, polynucleotides (including DNA), polyalkylenes such as polyethylene, polyalkylene glycols such as polyethylene glycol, and peptide nucleic acids (PNA) And those containing a linear substance such as polystyrene or a combination thereof as a main skeleton. When the above linear chain substances are used in combination, they may be appropriately connected to a suitable linking group (-NH-, -CO-, -0-, -NHC0-, -C0NH-, -NHNH-,-(C¾) _n- [n is, for example, 1 to 10, preferably 1 to 3,] -S-, -SO-and the like.

The connection between the mRNA and the spacer can be performed directly or indirectly using a known method. Can be performed chemically or physically. For example, when DNA is used as a spacer, both can be linked by providing a sequence complementary to the end of the DNA spacer at the 3 ′ end of the mRNA. In addition, when the spacer and the puromycin are connected, they are usually connected by a known chemical method.

When it is necessary to separate the mRNA-PM-protein complex from the solid phase after protein synthesis, it is preferable to provide a cleavable site in the spacer. When DNA is used as a part of a supplier, a restriction enzyme recognition site can be provided in the DNA chain as such a cleavable site. When a spacer having such a restriction enzyme recognition site is used, a restriction enzyme (for example, Alul, BamHL EcoRL HindI L Hindl I L PvuI, etc.) is introduced at a desired time such as after protein synthesis. Thus, the mRNA-PM-protein complex can be separated from the solid phase. Combinations of restriction enzyme recognition sites and enzymes that cleave the sites are known (see New Engl and BioLabs 2000-01 Catalog & Technical reference, etc.).

The mRNA-PM conjugate of the present invention can be labeled by binding a labeling substance as necessary. Such a labeling substance is appropriately selected from a fluorescent substance, a radioactive labeling substance and the like. The fluorescent substance has a free functional group (for example, a hydroxyl group that can be converted to an active ester, a hydroxyl group or an amino group that can be converted to a phosphoramidide), and has a spacer or puromycin or puromycin-like compound. Various fluorescent dyes that can be linked to are used. Suitable target識物quality, for example, full-O fluorescein isothiocyanate Xia sulfonates, Fikopiritan Park, rare earth metal chelate, fluorescent material such as Danshiruku port chloride or tetramethylammonium loader Mi emissions isothiocyanate Xia sulfonates; ¾, ^1, ^'25 ¹ or the like radioisotopes ¹³¹ 1 or the like. 2. Method for solid phase immobilization of mRNA

According to another aspect of the present invention, using the above mRNA-PM conjugate, A method for immobilization is provided. That is, the solid phase immobilization method of mRNA of the present invention,

(a) linking mRNA and puromycin through a spacer provided with a solid phase binding site to prepare an mRNA-PM conjugate; and

(b) immobilizing the mRNA-PM conjugate on a solid phase by binding the solid phase binding site of the spacer to a solid phase;

including.

The solid phase to which the mRNA-PM conjugate is immobilized is not particularly limited, and is appropriately selected depending on the purpose for which the conjugate is used. As the solid phase used in the present invention, those which can be used as a carrier for immobilizing biomolecules can be used. For example, beads such as styrene beads, glass beads, agarose beads, sepharose beads, and magnetic beads; Substrates such as silicon substrates, silicon (quartz) substrates, plastic substrates, and metal substrates (eg, gold foil substrates); containers such as glass containers and plastic containers; made of materials such as nitrocellulose and polyvinylidene fluoride (PVDF) Membrane etc. are mentioned. In the present specification, the mRNA-PM conjugate immobilized on beads is referred to as “mRNA beads”. In a preferred embodiment of the present invention, there is provided an mRNA bead comprising a conjugate of mRNA and puromycin or a puromycin-like compound immobilized on the bead.

The immobilization means of the mRNA-PM conjugate of the present invention is not particularly limited as long as the mRNA is immobilized on a solid phase so as not to hinder translation when the mRNA comes into contact with the translation system. Normally, a solid phase binding site is provided in the spacer connecting the mRNA and the PM, and the solid phase binding site is connected to the solid phase by a `` solid phase binding site recognition site '', and the mRNA is bound to the solid phase binding site. Immobilize PM conjugate on solid phase. The solid phase binding site is not particularly limited as long as it can bind the mRNA_PM conjugate to a desired solid phase. For example, a molecule (eg, a ligand, an antibody, etc.) that specifically binds to a specific polypeptide is used as such a solid phase binding site, and in this case, the solid phase surface has a solid phase binding site recognition site. In particular, a specific polypeptide that binds to the molecule is bound. Solid phase binding site Z Solid phase binding site Recognition site Examples of the combination of the above include, for example, a biotin-binding protein such as avidin and streptavidin, nopiotin, a maltose-binding protein Z maltose, a G protein Z guanine nucleotide, a polyhistidine peptide Z, a metal ion such as nickel or cobalt, and glutathione. S-transferase Z dalyuthione, DNA binding protein / DNA, antibody Z antigen molecule (epitope), calmodulin / force lumodiulin binding peptide, ATP binding protein ZATP, or estradio receptor protein / estradio And various receptor proteins Z and their ligands. Among these, combinations of solid-phase binding sites and solid-phase binding site recognition sites include biotin-binding proteins such as avidin and streptavidin, maltose-binding protein / maltose, polyhistidine peptide nickel or cobalt, etc. Preferred are a metal ion, dalhythion-S-transferrase / dalhythione, an antibody-antigen molecule (epitope), and most preferably a combination of streptapidine Z-biotin.

A known method can be used for binding the protein to the solid phase surface. Such known methods include, for example, tannic acid, formalin, darthal aldehyde, pyrvicaldehyde, benzodiazobis benzodizone, toluene-1,2,4-diisocyanate, amino group, carboxylic acid group, or hydroxyl group or amino. (PM Abdella, PK Smith, GP Royer, A New Cleavable Reagent for Cross-Linking and Reversible Immobi lizaion of Proteins, Biochem. Biophys. Res. Commun , 87, 734 (1979), etc.). The above combination can be used with the solid phase binding site and the solid phase binding site recognition site reversed. The above-mentioned immobilization method is an immobilization method using two substances having mutual affinity. If the solid phase is a plastic material such as styrene beads or a styrene substrate, if necessary, a publicly known method may be used. A part of the spacer can also be directly covalently bonded to the solid phase by using the method described in (1) (see Qiagen, LiduiChip Appliance Handbook, etc.). In the present invention, the fixing means is as described above. Without limitation to the method, any fixing means known to those skilled in the art can be used.

3. Solid phase immobilization method of protein and solid phase synthesis method of protein

According to another aspect of the present invention, there is provided a solid phase immobilization or solid phase synthesis method for a protein, wherein after the step (b), (c) contacting the mRNA-PM conjugate with a translation system (For example, introducing a translation system into the conjugate or introducing the conjugate into the translation system) provides a method for solid-phase immobilization or synthesis of a protein, comprising a step of synthesizing a protein. In step (b), the mRNA-PM conjugate is immobilized on the solid phase, and when this conjugate is introduced into the translation system, the above-mentioned //? The synthesized protein is immobilized on the solid phase via puromycin.

In the above step (c), protein synthesis is performed by bringing the mRNA-PM conjugate into contact with the translation system. Examples of the translation system that can be used here include a cell-free translation system and living cells. As the cell-free translation system, a cell-free translation system composed of a prokaryotic or eukaryotic extract, for example, Escherichia coli, Egret reticulocytes, wheat germ extract, etc. can be used (Lamiroiii Grunberg-Manago M. Ambiguit). ies of trans lat ion of poly U in the rabbi tret iculocyte system. Biochem Biophys Res Commun. 1967 27 (1): 1-6, etc.). Prokaryotic or eukaryotic organisms, such as E. coli cells, can be used as a live cell translation system. In the present invention, it is preferable to use a cell-free system from the viewpoint of easy handling.

Here, the immobilization of a protein using the mRNA-puromycin conjugate of the present invention will be briefly described based on FIG. Figure 1a shows the immobilized mRNA-PM conjugate during storage, Figure 1b shows the cell-free translation system is inserted and the protein is being synthesized, and Figure 1c shows the completion of protein synthesis. FIG. As shown in Figure 1a, the immobilized mRNA-puromycin conjugate 1 The solid-phase phase-coupled joint was formed by connecting the 11-port Mamaishishin ll bb to the DDNNAA via a 11 cc connection. It is bound to the solid-phase phase 22 via the site 11 dd. . The solid-phase phase 22 is designed to allow for the later introduction of a cell-free cell-free translation system. It has a shape and shape. . As shown in Fig. Ll bb, solid-fixed and normalized mmRRNN AA- When the translation system 33 was introduced and introduced, it was due to the mmRRNNAA and the non-cellular cell vesicles 55 due to the translation reaction using the translation system. As a result, a protein 44 corresponding to the nuclear nucleic acid sequence of mmRRNNAA is synthesized. . After completion of the translation, the unnecessary components of the cell-free cell-free translation system 33 are removed and removed, and the protein protein 44 is released. The mmRRNNAA—Pipum-llomai-issin-tin-protein complex complex bound to the Puro-roma-maisin-shin 11 bb is a solid-solid phase It is formed in a state fixed to 22. . In addition, like the mmRRNNAA 11-pipuro-romamaiisinshin-tantan-protein complex complex ((continuously linked body)), for example, For example, the target substance may be brought into contact with the target substance by contacting with the synthetic protein, thereby forming a bond with the synthetic protein protein. The target material that is to be obtained can be created. .

44 .. mmRRNNAA tips and prototyping tips

According to another aspect of the present invention, there is provided a solid-fixed stabilized mmRRNNAA as described above, wherein The mmRRNNAA tip ((mmRRNNAA Mamayik chloroa alley)), which contains a plurality of . In other words, the invention of the present invention is a fixed solidification of the invention of the present invention. MmRRNNAA—Pipuro-Romamaiisin Provide the mmRRNNAA chip, which is fixed and fixed to the base substrate plate for use. . The mmRRNNAA chip here is obtained by solidifying and stabilizing the mmRRNNAA-PPMM linked body described above on a plurality of base plates. . . It should be noted that the above-mentioned "multiple number" means that the value of the upper and lower limits is restricted, especially in particular. Good, but

A practical number that can be fixed to 20. By introducing this mRNA chip into the translation system, or by introducing the translation system into the mRNA chip, the protein synthesis described above occurs on the chip, and a so-called protein chip in which each protein is bound to a solid phase is obtained. It is made. Protein chips produced in this manner are also included in the present invention.

25 In the mRNA chip of the present invention, a plurality of mRNAs encoding proteins with known functions may be immobilized on a solid phase as mRNA-PM conjugates, A plurality of encoded mRNAs may be immobilized on a solid phase as mRNA-puromycin conjugate. For example, when mRNA encoding a protein with a known function involved in a disease is immobilized on a plurality of chips, for example, an mRNA chip for diagnosing a disease, an mRNA chip for protein interaction analysis, or the like can be used. When used as a diagnostic chip, mRNA encoding a protein that binds to the diagnosis of a particular disease is fixed to a predetermined position on each plate. A cell-free translation system is put into this plate immediately before diagnosis, and a protein that binds to a desired diagnostic marker is synthesized and fixed at a predetermined position on the plate. In this way, a protein chip can be prepared immediately before diagnosis. Protein chips have problems in storage or handling. One of the features of the present invention is that the chip is formed in the form of a stable mRNA instead of an unstable protein. Therefore, techniques other than solid-phase immobilization of mRNA and protein synthesis / immobilization (for example, material of plate to be used, size of protein to be used, arrangement, protein function analysis method using protein chip, etc.) ) Can use the known protein chip technology as it is (Kukar T, Eckenrode S, Gu Y, Lian W, Megginson M, She JX, Wu D. Prote in microarrays to detect prote in-prote in interact ions) us in g red and green fluorescent prote ins. Anal Biochem. 2002: 306 (1): 50-4 etc.). Note that a diagnostic kit including the above-described mRNA beads or the above-described mRNA chip and a cell-free translation system, or a kit for analyzing protein interaction is also within the scope of the present invention. By using such an mRNA chip, it can be used for protein-protein interaction, DNA-protein interaction, ligand search, disease marker search, disease diagnosis, drug efficacy evaluation, pharmacokinetic evaluation, etc. Can be.

Further, a protein synthesized by bringing the immobilized mRNA-puromycin conjugate of the present invention into contact with a translation system is converted to a conjugate having a structure added to the above conjugate (“immobilized mRNA-puromycin”). —Protein conjugate ”) is also included in the present invention. That is, the present invention relates to the “immobilized mRNA-puromycin” of the present invention. Immobilized mRNA-puro, wherein a protein (polypeptide) of a translation product of the mRNA synthesized by providing the “conjugate” to a translation system is linked via puromycin or a puromycin-like compound in the conjugate. Related to mycin-protein conjugate. The conjugate can be suitably used, for example, in the “method for analyzing the interaction between a protein and a target molecule” described below. As one embodiment of the above-mentioned conjugate, a protein chip having a structure in which an immobilized mRNA-puromycin-protein conjugate is fixed to a microarray substrate as described above can be exemplified. In a preferred embodiment of the present invention, the above “immobilized mRNA-puromycin-protein conjugate” is subjected to a reverse transcription reaction system (contacted with the reverse transcription reaction system) to obtain a reverse transcription product of the mRNA. It is possible to synthesize a certain complementary DNA (a DNA that hybridizes with the mRNA). For example, when a DNA spacer containing a sequence complementary to the 3 ′ terminal sequence of mRNA is used as the above-mentioned spacer of the present invention, the complementary sequence serves as a primer in a reverse transcription reaction of the mRNA. It is expected to work. That is, by providing the mRNA-puromycin-protein conjugate to a reverse transcription reaction system, a DNA synthesis reaction using the primer as a synthesis starting point is started, and a DNA having a sequence complementary to the mRNA is synthesized. . A conjugate containing DNA synthesized in this manner (described as “DNA-puromycin-protein conjugate”) is also included in the present invention. That is, the present invention relates to a method wherein the “immobilized mRNA-pieuromycin-protein conjugate” of the present invention is subjected to a reverse transcription reaction system, and a complementary DNA of the mRNA is bound to the conjugate. An immobilized DNA-puromycin-protein conjugate is provided.

The nucleic acid molecule linked to puromycin in the above-described conjugate of the present invention is usually a double-stranded nucleic acid molecule of mRNA and a complementary DNA of the mRNA, but the mRNA in the nucleic acid molecule is subsequently nucleated. It may be digested by a reaction such as zeolitic reaction. That is, the “immobilized DNA-puromycin-protein conjugate” comprising a structure in which a single-stranded (complementary to mRNA) DNA molecule is linked to puromycin is also a linking agent of the present invention. One embodiment of the body. Furthermore, in the above-described conjugate of the present invention, the nucleic acid molecule linked to puromycin may be a double-stranded DNA consisting of a DNA having complementarity with the DNA.

In the present invention, the “reverse transcription reaction system” refers to a reaction system that controls so-called “reverse transcription” for synthesizing DNA using mRNA as type II, and the reaction system usually contains a reverse transcriptase. Those skilled in the art can appropriately carry out the reverse transcription reaction of the present invention. More specifically, it can be carried out by the method described in Examples described later.

5. How to analyze the interaction between protein and molecule

According to another aspect of the present invention, there is provided a method for analyzing an interaction between a protein and a molecule using the above-described mRNA-PM conjugate. This analysis method

(a) introducing one or more of the immobilized mRNA-puromycin conjugates of the present invention into a translation system to synthesize a protein on a solid phase;

(c) determining whether the protein and the target substance interact with each other.

This analysis method includes, for example, (i) when screening for a substance that acts on a protein whose sequence is known, (ii) screening for a protein whose sequence is unknown to which a specific substance (for example, a ligand) binds. It can be used in such cases. For example, in the case of (i), a plurality of conjugates of puromycin and mRNA having a nucleic acid sequence encoding a protein having a known sequence (for example, orphan receptor protein) are prepared (that is, a plurality of conjugates are prepared). Prepare a plurality of mRNA-PM conjugates each having mRNA corresponding to the fan receptor protein), and put them into the translation system. Then, a plurality of orphan receptor proteins are synthesized from the mRNA of each mRNA-PM conjugate. Each orphan receptor protein is composed of mRNA- It is immobilized by attaching the C-terminus to puromycin of the PM conjugate. If necessary, perform a binding experiment by washing and removing unnecessary components, adding a target substance and a buffer to the target substance, and binding the target substance to the protein receptor. In the case of (ii), for example, a plurality of mRNAs are obtained from one gene library, a conjugate of a plurality of mRNAs and puromycin is prepared, and immobilized on a solid phase. Hereinafter, a protein is synthesized in the same manner, and a binding experiment is performed by bringing a target substance into contact with the protein.

In the step (b), the protein synthesized in the step (a) is brought into contact with the target substance described above. As used herein, the term “target substance” refers to a substance for examining whether or not it interacts with the protein synthesized in the present invention, and specifically includes proteins, nucleic acids, sugar chains, and low-molecular compounds. And the like.

The protein is not particularly limited, and may be a full-length protein or a partial peptide containing a binding active site. The protein may be a protein whose amino acid sequence and function are known, or may be an unknown protein. These can be used as target molecules even with a synthesized peptide chain, a protein purified from a living body, or translated from a cDNA library or the like using an appropriate translation system, and a purified protein or the like can be used as a target molecule. The synthesized peptide chain may be a glycoprotein having a sugar chain bonded thereto. Among these, preferably, a purified protein having a known amino acid sequence, or a protein translated and purified from a cDNA library or the like using an appropriate method can be used.

The nucleic acid is not particularly limited, and DNA or RNA can also be used. Further, the nucleic acid may have a known nucleotide sequence or function, or may have an unknown nucleic acid. Preferably, those having a known function as a nucleic acid capable of binding to a protein and having a known nucleotide sequence, or those which have been cut and isolated from a genomic library or the like using a restriction enzyme or the like can be used.

There is no particular limitation on the sugar chain, and even if the sugar sequence or function is a known sugar chain. An unknown sugar chain may be used. Preferably, a sugar chain which has already been separated and analyzed and whose sugar sequence or function is known is used.

The low-molecular compound is not particularly limited and may be a compound having an unknown function or a compound having a known ability to bind to a protein. The “interaction” between the target substance and the protein is usually defined as at least one of a covalent bond, a hydrophobic bond, a hydrogen bond, a van der Waals bond, and an electrostatic force bond between the protein and the target molecule. It refers to the action of the forces acting between the molecules resulting from each other, but this term should be interpreted in the broadest sense and not in any way limited. The covalent bond includes a coordinate bond and a dipole bond. The coupling by electrostatic force includes not only electrostatic coupling but also electric repulsion. The interaction also includes a binding reaction, a synthesis reaction, and a decomposition reaction resulting from the above action. Specific examples of the interaction include binding and dissociation between an antigen and an antibody, binding and dissociation between a protein receptor and a ligand, binding and dissociation between an adhesion molecule and a partner molecule, and binding and dissociation between an enzyme and a substrate. Binding and dissociation between nucleic acids and proteins that bind to them, binding and dissociation between proteins in the signal transduction system, binding and dissociation between glycoproteins and proteins, or binding between sugar chains and proteins And dissociation.

The target substance used here can be labeled with a labeling substance as necessary. Labeling can be performed by binding a labeling substance as necessary. Such a labeling substance is appropriately selected from a fluorescent substance, a radioactive labeling substance and the like. As the fluorescent substance, it is possible to use various fluorescent dyes which have a free functional group (for example, a hydroxyl group which can be converted into an active ester, a hydroxyl group which can be converted into a phosphoramidide, or an amino group) and can be linked to a target substance. it can. Suitable labeling substances include, for example, fluorescent substances such as fluorescein isothiocyanate, phycopyriprotein, rare earth metal chelates, dansyl chloride or tetramethylrhodamine isothiocyanate; ¾, “ ^1M I or ¹³¹ 1st radioisotope Body and the like. As these labeling substances, those suitable for a method for measuring or analyzing a change in signal generated based on the interaction between the target substance and the immobilized protein are appropriately used. The binding of the labeling substance to the target substance can be performed based on a known technique.

Next, according to the present analysis method, in the step (c), it is measured whether or not the protein and the target substance interact. The measurement of whether or not the protein and the target substance are interacting is performed by measuring and detecting a change in a signal generated based on the interaction between the two molecules. Examples of such measurement methods include surface plasmon resonance (Cullen, DC, et al., Biosensors, 3 (4), 211-225 (187-88)), evanescent field molecular imaging (Funatsu, T., et al., Nature, 374, 555-559 (1995)), Fluorescence imaging analysis, Enzyme Linked Immunosorbent Assay (ELISA): Crowther, JR, Methods in Molecular Biology, 42 (1995)), fluorescence depolarization (Perran, J., et al., J. Ph ys. Rad., 1, 390-401 (1926)) and fluorescence correlation spectroscopy (Fluorescence Correl at ion Spectroscopy (FCS ): Eigen, M., et al., Pro Natl. Acad. Sci. USA, 91-5740-5747 (1994)).

In the analysis method of the present invention, if necessary, the protein and / or the target substance in the protein-target substance conjugate determined to have an interaction in the step (c) are identified. The protein can be identified using a normal amino acid sequencer or by reverse transcription of MA from mRNA bound to the protein and analyzing the nucleotide sequence of the obtained DNA. . Identification of the target substance can be performed by NMR, IR, various types of mass spectrometry, and the like. When analyzing the protein-protein interaction using the mRNA chip and the protein chip of the present invention, the time-of-flight mass spectrometer (MALDI-TOF MS) can be used in the same manner as in the analysis of a sample on a normal protein chip. Can be used.

The method of the present invention further comprises the step of: synthesizing the step (a) following the step (a). By providing the mRNA-puromycin-protein conjugate to the reverse transcription reaction system, a conjugate containing DNA complementary to the mRNA in the conjugate (DNA-puromycin-protein conjugate) is prepared. However, the subsequent steps described above may be performed. That is, a preferred embodiment of the present invention provides a method for analyzing the interaction between a protein and a molecule, comprising the following steps.

(a) —contacting the immobilized mRNA-puromycin conjugate according to any of the present invention with a translation system to synthesize a protein on a solid phase;

(c) contacting the DNA-puromycin-protein conjugate prepared in step (b) with one or more target substances; and

(d) a step of measuring whether or not the protein in the conjugate interacts with the target substance;

FIG. 1 is a schematic diagram showing a method for synthesizing and immobilizing a protein using the immobilized mRNA-puromycin conjugate of the present invention.

FIG. 2 is a diagram showing the types of genes used in Examples 1 and 2.

FIG. 3 is a diagram showing a schematic diagram of a protein A B_domain or GFP mRNA to which a spacer DNA with a puromachine is covalently bound.

FIG. 4 is a photograph showing the result of SDS-PAGE in Example 1.

FIG. 5 is a photograph obtained by observing the fluorescence of GFP translated on the beads in Example 2 under a microscope.

[Explanation of symbols]

1: Immobilized mRNA-puromycin conjugate, 1a: mRNA, 1b: puromycin, 1c: DNA spacer,

1 d: solid phase binding site, 2: solid phase, 3: cell-free translation system,

4: Protein. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described more specifically based on examples. Note that the present invention is not limited to these examples.

(Example 1)

1. Synthesis of spacer BioLoop-Puro (hereinafter abbreviated as "spacer DNA with PM") Puro-FS [Sequence; 5 '-(S) -TC (F)-(Specl8)-(Specl8)-( Specl8)-(Specl8) -CC- (Puro) -3 ', purchased from BEX] lOnmol, 100x1 50mM phosphate buffer (pH7.

0), added lOOmM TCEP (final lmM), and allowed to stand at room temperature for 6 hours to reduce Thio of Puro-F-S. Immediately before performing the crosslinking reaction, add 50 phosphate buffer (pH 7.

TCEP (Tris (2-carbo xyethyDphosphine hydrochloride)) was removed using NAP5 (Amersham, 17-0853-02) equilibrated in (0), where (S) was 5, 5 in the Puro-FS sequence. -Thiot Modifier C6, (F) is Fluorescein_dT, (Puro) is Puromycin CPG,

Spacerl8 is a product (18-0-dimethoxytritylhexaethyleneglycol, 1-[(2-cyanoetyl)-(N, N-diisopropyl)]-phosphoramidite) manufactured by Glen Research Search and has the following chemical structure.

(Chemical 5)

DMTO- (CH2) 2-0-[(CH2) 2-0] 4- (CH2) 2-0

(Pr) 2N-P-OCH2CH2CN

In 100 l of 0.2 M phosphate buffer (pH7.0), 500 pmol / il Biotin-loop [(56mer) sequence; 5'-CCCGG TGCAG CTGTT TCATC (TB) CGGA AACAG CTGCA CCCCC CGCCG CC CCC CG (T) CCT- 3 '(SEQ ID NO: 1, purchased from BEX), (Τ): Amino-Modifier C6 dT, (TB): Biotin-dT (Underline indicates the site of restriction enzyme PvuII)] 20 1, Add 20 zl of lOOmM cross-linking agent EMCS (344-05051; 6-Male imidohexanoic acid N-hydroxysucc inide ester, Doj indo), stir well, leave at 37 ° C for 30 minutes, and then unreact EMCS Was removed. After the precipitate was dried under reduced pressure, it was dissolved in 10 il of 0.2 M phosphate buffer (PH 7.0), and the reduced Puro-FS (〜10 nmol) described above was added thereto, and the mixture was allowed to stand at 4 ° C. overnight. After TCEP was added to the sample to a final concentration of 4 mM and left at room temperature for 15 minutes, unreacted Puro-FS was removed by ethanol precipitation, and the following conditions were used to remove unreacted Biotin loop. HPLC purification was performed.

Column; nacalai tesque CS0M0SIL 37918-31 10x250 Marauder C18-AR-300 (Waters) BuiferA; 0.1 M TEAA, Buf ferB; 80% acetonitrile (diluted with ultrapure water) Flow rate: 0.5 ml / min (B¾: (15-35% 33min)

The HPLC fraction was analyzed on an 18% acrylamide gel (8 M urea, 62 ° C), and the target fraction was dried under reduced pressure and dissolved in DEPC-treated water to 10 pmol / U.

2. Translation on solid phase (Prote in A B-domain)

2-1 Synthesize mRNA of gene used in experiment

ProteinA B-domain (371 bp; SEQ ID NO: 2) with T7, Cap, Omega sequence, Kozak sequence at the 5 'end, 6x histidine tag at the 3' end, and a stop codon, and T7, Cap, Mutation described in GFP (Green Fluorescent prote in) (717 bp; SEQ ID NO: 3, I to, et al., Biochem Biophys Res Commun. 1999: 264 (2): 556-60 having Kozak sequence and having a termination codon deleted) Was cloned and used. Both primers are designed to contain a tag sequence (5'-aggacggggggcggggaaa (SEQ ID NO: 4), which is complementary to a part of the spacer DNA, and the underline is a part complementary to the spacer sequence). By performing a PCR reaction in one step, DNA having a tag sequence at the 3 ′ end was obtained. PCR reaction was performed by adding 1 unit of Ta KaRa ExTaa (TakaraBio) to 501 PCR reaction solutions, adding im imol for 錡 type MA, and using the following primers under the following conditions.

Forward primer: GATCCCGCGAAATTAATACGACTCACTATAGGG (SEQ ID NO: 5) Reverse primer: TTTCCCCGCCCCCCGTCCTgcttccgccgtgatg (SEQ ID NO: 6)

[Conditions] After heat denaturation at 95 ° C for 2 minutes, heat denaturation at 95 ° C for 30 seconds,

Annealing 69 ° C 15 seconds, extension reaction 72 ° C 45 seconds

Cycle 30 times

Fig. 2 shows the structure of the obtained DNA. Later, mRNA was synthesized in in vitro ears (Promega, P1300). Transcription was performed as follows on a DNA lug, 201 scale according to the protocol attached to the kit of Promega. That is, after leaving at 37 ° C for 1 hour, 1 unit of DNase (RQ1 DNase) included in the kit was added, and the mixture was further left at 37 ° C for 15 minutes. During the synthesis, m7G Cap Analog (Promega, P1711) was added according to the protocol of Promega. The mRNA with the 5 'cap analog was treated with DNase and phenol-chloroform, and then purified and quantified with DS Primer Remover (Edge Biosystems).

2-2 Binding of mRNA to a spacer DNA with PM

To 300 pmol of mRNA with a tag sequence at the 5 'cap and 3', add 300 pmol of a DNA with PM and lOxLigation Buf fer (TaKaRa) 6 / x K DMS0 2.Add DEPC to 55 1 Treated water was added. Anneal in hot water from 85 ° C to 35 ° C for 20 minutes, and add 15unit T4 Plynucleotide Kinase (TaKaRa, 2.5 l) and lOOunitt T4 RN A Ligase (TaKaRa, 2.5 1). The reaction was carried out at 25 ° C for 45 minutes. Samples were treated with RNeasy Mini Kit (Quiagen, 74104) and further purified with DS Primer Remover.

FIG. 3 shows a schematic diagram of a protein AB-domain or GFP mRNA covalently linked to a PM-attached spacer MA. In Fig. 3, P indicates puromycin, F indicates FIT (, B indicates biotin, ATCGu indicates DNA and RNA sequences. The upper case indicates DNA containing the restriction enzyme PvuII site (enclosed in a square frame). The part shown in lowercase letters is mRNA, and the part that forms a complementary strand with the DNA at the 3 'end is linked to the Tag sequence. I agree. The 3 'end of the RNA and the 5' end of the DNA are ligated with the "T4 RNA Ligase".

2-3 Binding of spacer DNA-mRNA complex with PM onto beads

Based on the attached protocol, the complex of PM-attached DNA and mRNA synthesized as described above was applied to avidin beads (MAGNOTEX-SA, TaKaRa, 9088) with a diameter of 2.3 m ± 0. As described above.

The 60 xl avidin beads were washed twice with 200 xl 1X Binding Buffer (attached) using a magnetic stand to precipitate the avidin beads and replacing the supernatant. After washing, add 48 pmol of the complex of spacer DNA and mRNA with PM synthesized in 2-2 above to the precipitated beads, and add 1 x Binding Buffer (attached) to a total of 120 zl. In addition, it was left still at room temperature for 10 minutes. Thereafter, as described above, the beads were washed with 1X Binding Buffer (supplied) to remove the complex of PM-attached spacer DNA and mRNA that did not bind to the beads. Further, 190 l of 20 × Translation Mix (Amion) 10 × K DEPC-treated water was added, and the beads were washed in the same manner.

2-4 translation

The beads were sedimented on a magnet stand, and a cell-free translation system (Retic Lysate IVT Kit, Ambion, 1200) was added for 300_U, and a translation reaction was performed at 30 ° C for 15 minutes. Thereafter, MgCl ₂ and KC1 were added to the final concentrations of 63 mM and 750 mM, respectively, and left at 37 ° C. for 1.5 hours. The sample was gently agitated approximately every hour. The beads were precipitated as above and washed twice with 200 l of 1x Binding Buffer (attached) containing 20 units of SUPERase-In (Ambion, 2694).

2-5 Reverse transcription After washing, reverse transcription of beads precipitated in the same manner as above using reverse transcriptase M-MLV (TaKaRa, 264 OA) at 42 ° C for 10 minutes according to the protocol attached to TaKaRa BIOMEDICALS. The reaction was performed. Thereafter, the beads were washed with 1 × Binding Buf fer (attached) 200 xl in the same manner as described above.

2-6 Recover DNA-protein from beads

According to the attached protocol, the precipitated beads are left to stand at 37 ° C for 1 hour with 24 units of restriction enzyme PvuI I (TaKaRa) on a scale of, and the DNA-protein on the beads is separated from the beads. Was. Here, in particular, BSA was added to a final 0.1 mg / ml to avoid nonspecific adsorption of beads and DNA-protein. Thereafter, the beads were precipitated as described above, and the supernatant was transferred to a new sample tube. At the time of reverse transcription, the template mRNA still forms a complementary strand with the DNA-DNA portion of the protein, so add 2 units of Ribonuclease H (Promega, M4281) to the supernatant, and add The remaining mRNA after reverse transcription was degraded by reaction for 20 minutes.

2-7 Purification of His tag

According Quiagen Inc. protocol, samples of equal volume Lys IS buffer _{(Na¾P0 4 50mM, NaCl 300mM,} imidazole lOmM, Tween20 0. 05%, pH8. 0) was diluted to 20 1 of Ni- NTA beads (Ni-NTA Magnetic AgaroseBeads, QIAGEN, 36111) was added, and the mixture was left at room temperature with stirring for 40 minutes. Precipitating the N i-NTA beads in a magnetic stand in the same manner as described above, 100 1 of Wash buffer one _{(Na¾P0 4 50mM, NaCl 300m M} , imidazole 20mM, Tween20 0. 05%, pH8. 0) and washed lightly with. After precipitating the beads, Elute buffer one _{(Na¾P0 4 50mM, NaCl 300mM,} imidazole 250 Twee n20 0. 05%, pH8. 0) was left for 15 1 added at room temperature for 1 min to elute the DNA- protein . Precipitate the beads in the same manner and take the supernatant from which the DNA-protein eluted. That is, analysis was performed by 5% SDS-PAGE containing 6M urea. The gel band was quantified by visualizing the fluorescence of FITC using Molecular Imager FX (Bio RAD co.). Figure 4 shows the obtained results. 3. Results of protein synthesis (ProteinA B-domain) on solid phase

Figure 4a shows the results of adding a complex of PM-based spacer DNA and iiRNA to a cell-free translation system to form an mRNA-protein complex in solution (as usual). Is visualized. Lane 1 is before translation and 2 is after translation. Judging from the molecular weight, the band at the position indicated as “RNA virus” that appeared after the translation reaction showed that mRNA and the protein encoded by that mRNA were mediated by puromycin in the splicer DNA. It is thought to be a covalently bound complex. The band at the position marked "genome" is a complex of spacer DNA and mRNA to which no protein is bound.

Similarly, two bands were observed in the sample that had been translated and reverse-transcribed on the beads, cut off from the beads with a restriction enzyme, and recovered (lane 1), and the high-molecular-weight band (arrowhead) was the target DNA. —The covalent complex of the protein and the thick band of low molecular weight are considered to be those without protein (Fig. 4b). This is confirmed by the fact that only the high molecular weight band was eluted as a result of purification with 6XHis-tag introduced at the C-terminal side of the protein (lanes 2, 3). In addition, this result indicates that the protein portion of the DNA-protein complex synthesized and immobilized here was synthesized in full length, similarly to the protein normally synthesized in a liquid phase.

From these results, it was found that the mRNA encoded on the solid phase was immobilized immediately after translation by immobilizing the mRNA via PM-attached spacer DNA and adding a cell-free translation system to the mRNA. Showed that it can be immobilized on a solid phase.

The amount of DNA-protein complex recovered was measured based on the band visualized by the fluorescence of FITC in SDS-PAGE. As a result, it was synthesized on the solid phase and separated with the restriction enzyme. At the time of recovery, the DNA-protein (Fig. 4b arrowhead) was added at 0.4% of the added mRNA, and the His-tag purified and extracted (Fig. 4b "DNA virus") was added. It was 0.1% of mRNA. [Execution line 2] Detection of function of protein synthesized on solid phase (GFP)

1. Immobilize mRNA with spacer on beads

In the same manner as in 2-3 of Example 1, the complex of the PM-attached spacer DNA and mRNA was immobilized on avidin beads. In order to observe the fluorescence of GFP, the spacer DNA was different from that used in 2 above, and Puro-S [sequence; 5,-(S) -TC (F)-(Specl8)-(Specl8 )-(Specl8)-(S pecl8) -CC- (Puro) -3 \ (S): 5 '-Thioto Modi fier C6, (Puro): Puromycin CPG, purchased from BEX] What was used was used. Avidin beads with a diameter of 460 nm from Bangs were used and immobilized on the beads as follows.

The beads were washed twice with 100 1 of 0.5 X Binding buf fer (50 mM Tris HC1 pH 8.0, 0.05% Tween 20, 500 mM NaCl). Washing was performed by centrifuging the solution containing the beads at 15, OOOrpm for 5 minutes at 4 ° C, and exchanging the supernatant. To the precipitate of the washed beads, 8 pmol of a complex of a probe DNA with PM and a GFP mRNA synthesized in the same manner as in 2-2 of Example 1 was added, and the mixture was added to a 40 x 40 μg binding buffer. and allowed to stand at room temperature for 15 minutes to bind to the beads. Washing was performed once with 100 l of 0.5 X Binding buf fer as described above to remove mRNA not bound to the beads. Further, 10 X / L of 20 × TransLationMix (Ambion) and 1901 of DEPC-treated water were added, and the beads were washed in the same manner.

2. Translation

Add a cell-free translation system (Retic Lysate IVT Kit, Ambion, 1200) to the beads precipitated by centrifugation for 20 minutes, react at 30 ° C for 30 minutes, and add MgCl ₂ and KC1 respectively. The temperature was adjusted to 750, and the mixture was left at 25 ° C for 2 hours. Sample is about 1 Lightly stirred every hour. The beads were precipitated by centrifugation at 15, OOOrpm for 6 minutes, and washed once with NaCl phosphate buffer (50 mM sodium phosphate PH 7.0, 100 mM NaCl) by centrifugation as described above. The precipitated beads were suspended in Na 2 phosphate phosphate buffer and stored on ice.

3. Observation under a microscope

The suspension containing the above beads was further diluted to 1/5 with 50 mM phosphate buffer pH 7.0, and an enzyme system for removing active oxygen (25 glucose, 2.5 ^ M glucose oxidase, ΙΟηΜ microscopic observation was performed in the presence of catalase, lOmM ditiothreitol). The microscope was excited by 473nm 0.35mW objective evanescent illumination using Nicon, TE2000, and the fluorescence of GFP was photographed with a cooled CCD camera 0RCA-ER (Hamamatsu Photonics) for 1.04 second exposure. As a negative control, only spacer DNA was bound to beads in the same manner as in Examples 3-1 and 3-2 in the same manner, and observation was performed under the same conditions. Figure 5 shows the observation results. Figure 5 is a photograph of the fluorescence of GFP translated on the beads observed under a microscope. The fluorescence image when excited with a 473 nm laser was superimposed on the bright-field image of the beads (460 nm in diameter). Figure 5a shows a translation reaction performed by binding 8 pmol of a complex of spacer DNA with PM and GFP mRNA to avidin beads at 10 z for 1 min.Figure 5b shows a DNA spacer with PM. A microscopic observation image of the result of performing a translation reaction under the same conditions with 8 pmol of only one bound to 10 l of avidin beads is shown. The fluorescent image was confirmed by a green pseudo color.

4 Results

To further confirm the results of Example 1, we attempted to translate GFP on beads in the same way and look directly under the evanescent microscope for the fluorescence of GFP on the translated beads. As a result, the GFP mRNA was linked to the PM-attached spacer DNA, as compared to the case where only the PM-attached spacer DNA was bound to the beads and observed. After that, the fluorescence of GFP could be observed on the beads fixed and translated on the beads. Therefore, it was again confirmed that the target protein was synthesized and immobilized on the solid phase. Industrial potential

As described above, according to the present invention, a method for solid-phase immobilization of mRNA and protein, an immobilized mRNA-puromycin conjugate, an mRNA bead or an mRNA chip containing this conjugate, and an mRNA chip prepared from this mRNA chip Can be provided. Since such an mRNA chip is easy to store, there is an advantage that handling is extremely easy as compared with an existing protein chip.

In addition, the present invention relates to a "fixed mRNA-puromycin-protein linkage" in which a protein of a translation product of the mRNA synthesized by providing the immobilized mRNA-puromycin conjugate to a translation system is bound to the puromycin. The body. The conjugate can be used for analysis or screening of a molecule that can interact with a protein.

Further, the present invention provides the above-described “immobilized mRNA-puromycin-protein conjugate” to a reverse transcription reaction system, whereby the “immobilized DNA-puromycin” has a structure in which complementary DNA of a reverse transcript of the mRNA is linked. And a "mycin-protein conjugate". Generally, DNA is more stable than RNA, and therefore, the conjugate is very useful when the conjugate is brought into contact with a test molecule in protein interaction analysis.

Further, the mRNA chip of the present invention can be used for diagnosis of various diseases by fixing mRNA used for synthesis of a protein recognizing a diagnostic marker for various diseases. Furthermore, the method for immobilizing or synthesizing a protein of the present invention can be suitably used for analyzing the interaction between protein and molecules.

Claims

The scope of the claims

1. An immobilized mRNA-puromycin conjugate comprising a conjugate of mRNA and puromycin or a puromycin-like compound immobilized on a solid phase.

2. The immobilized mRNA-puromycin according to claim 1, wherein the mRNA-puromycin conjugate is obtained by linking puromycin or a puromycin-like compound to the 3 'end of the mRNA via a spacer. Concatenation.

3. The immobilized mRNA-puromycin conjugate according to claim 1 or 2, wherein the mRNA-puromycin conjugate is bound to a solid phase via a solid phase binding site provided on the spacer. .

'4. The immobilization according to any one of claims 1 to 3, wherein the spacer includes a polynucleotide, a polyethylene, a polyethylene glycol, a polystyrene, a peptide nucleic acid, or a combination thereof as a main skeleton. mRNA—Pew mouth mycin conjugate.

5. The solid phase is selected from styrene beads, glass beads, agarose beads, cepharose beads, magnetic beads, glass substrates, silicon substrates, plastic substrates, metal substrates, glass containers, plastic containers and membranes. 5. The immobilized mRNA-puremycin conjugate according to any one of claims 4 to 4.

6. The protein of the translation product of the immobilized mRNA-puromycin conjugate according to any one of claims 1 to 5, which is synthesized by providing the conjugate to a translation system, is puromycin or puromycin in the conjugate. Immobilized mRNA-puromycin-protein conjugate linked via a similar compound.

7. An immobilized DNA obtained by subjecting the immobilized mRNA-puromycin-protein conjugate according to claim 6 to a reverse transcription reaction system and binding a complementary DNA of the mRNA to the conjugate. —Puromycin—protein conjugate.

8. The immobilized mRNA-pure mycin conjugate according to any one of claims 1 to 5, An mRNA chip fixed to a microarray substrate.

9. A protein chip produced using the mRNA chip according to claim 8.

10. mRNA beads in which a conjugate of mRNA and puromycin or a puromycin-like compound is immobilized on a bead.

1 1. A kit for protein interaction analysis comprising the mRNA chip according to claim 8 or the mRNA beads according to claim 10, and a cell-free translation system.

1 2. (a) a step of preparing an mRNA-puromycin conjugate by linking mRNA and puromycin through a sensor provided with a solid-phase binding site; and (b) Immobilizing the mRNA-puromycin conjugate on the solid phase by binding the solid phase binding site of the probe to the solid phase;

A method for immobilizing mRNA on a solid phase.

1 3. (a) connecting mRNA and puromycin through a spacer provided with a solid-phase binding site to prepare an mRNA-puromycin conjugate;

(b) fixing the mA-puromycin conjugate to a solid phase by binding the solid phase binding site of the spacer to a solid phase; and

A method for immobilizing a protein on a solid phase.

14. (a) linking mRNA and puromycin through a spacer provided with a solid-phase binding site to prepare an mRNA-puromycin conjugate;

A method for synthesizing a protein in a solid phase, comprising:

1 5. A method for analyzing the interaction between a protein and a molecule, (a) contacting the immobilized mRNA-pure mycin conjugate according to any one of claims 1 to 5 with a translation system to synthesize a protein on a solid phase;

(b) contacting the protein synthesized in fe (a) with one or more target substances; and

(c) measuring whether the protein and the target substance interact with each other;

The analysis method described above.

6. A method for analyzing the interaction between a protein and a molecule,

(a) a step of bringing the immobilized mRNA-pure mycin conjugate according to any one of claims 1 to 5 into contact with a translation system to synthesize a protein on a solid phase;

(d) measuring whether or not the protein in the conjugate interacts with the target substance;

The analysis method described above.

7. The analysis method according to claim 15 or 16, further comprising a step of identifying a protein and / or a target substance determined to have an interaction.