JP2001348398A - 5-pyrimidine containing nucleic acid, and reversibly binding method by using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide nucleic acids having a new base capable of reversibly binding the nucleic acids to each other by light irradiation, the nucleic acids immobilizing a nucleic acid, a method for readily producing a branched nucleic acid and a capped nucleic acid by using the nucleic acids, and to provide a method for immobilizing the nucleic acids on a solid carrier by light and a purifying, collecting isolating, detecting and determinating by the nucleic acids by using the method. SOLUTION: This method for readily, efficiently and reversibly binding the nucleic acids comprises utilizing the photoreactivity of a pyrimidine base having a substituted vinyl group at the 5-position of the pyrimidine. The nucleic acids therefor, and the method for inactivating a DNA by using the same are also provided. Further, the nucleic acids having the pyrimidine base having the substituted vinyl group at the 5-position of the pyrimidine, immobilized on the solid carrier, the method for immobilizing the nucleic acids having a specific base sequence by using the nucleic acids, the purification and recovery method, and the identification, detection and determination method are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for reversibly linking nucleic acids simply and efficiently utilizing the photoreactivity of a pyrimidine base having a substituted vinyl group at the 5-position of pyrimidine, a nucleic acid therefor, The present invention relates to a method for inactivating DNA using the same. According to the method of the present invention, capped nucleic acids and nucleic acids having a branched structure can be easily and efficiently synthesized. Further, the present invention provides nucleic acids having a pyrimidine base having a substituted vinyl group at the 5-position of pyrimidine immobilized on a solid support, and a method for immobilizing nucleic acids having a specific base sequence using the nucleic acids , Purification, recovery methods, and identification, detection, or quantification methods.

[0002]

2. Description of the Related Art As a method of linking nucleic acids such as DNA and PNA (peptide nucleic acid), the basic chains of these nucleic acids have been linked. According to such a method, it has been difficult to synthesize nucleic acids having capped ends and nucleic acids having a branched structure. As a method for synthesizing such a nucleic acid having a capped end and a nucleic acid having a branched structure, a method of introducing a linker and linking them was required. Further, when the basic strands of nucleic acids are different, such as DNA and PNA, these could not be directly linked. Further, such a conventional method lacks specificity after ligation, and cannot specifically perform ligation and cleavage. The present inventors have previously applied for a patent on a method for linking and cleaving nucleic acids by light irradiation, but the conventional methods have the drawbacks that the yield is low and the treatment requires a long time.

[0003] Nucleic acids immobilized on a solid phase are used by affinity chromatography for selecting nucleic acids of interest or for nucleic acids evolved in a test tube, and are widely used as tools for genetic engineering. I have. As a method for immobilizing a nucleic acid on a solid phase, there are a method of immobilizing a nucleic acid having biotin on a solid support by a biotin-avidin interaction, a method of immobilizing the nucleic acid using magnetic beads, and a method of immobilizing a nucleic acid previously immobilized. For example, a method of immobilizing a target nucleic acid by linking the target nucleic acid with an enzyme is known. In addition, as a method for purifying a nucleic acid, affinity column purification using the above-described nucleic acid having biotin or immobilized nucleic acid using magnetic beads is generally used. As described above, various methods for immobilizing a nucleic acid for purification or identification of the nucleic acid are known.Each method immobilizes a target nucleic acid using affinity by hydrogen bonding with the immobilized nucleic acid. There is no known method for immobilizing target nucleic acids by covalent bonding.

[0004]

SUMMARY OF THE INVENTION The present invention provides a nucleic acid having a novel base capable of reversibly linking nucleic acids by light irradiation. The present invention also provides a novel method that can easily synthesize a branched nucleic acid and a cap nucleic acid. further,
The present invention provides a method for immobilizing nucleic acids on a solid support by light without using an enzyme or a chemical reaction reagent, and is not based on hydrogen bond interaction, but is more strongly covalently bonded. It is intended to provide a method which can be immobilized on a solid support, a method for purifying and recovering nucleic acids using the method, and a method for identification, detection and quantification.

[0005]

Means for Solving the Problems The present inventors can reversibly link nucleic acids by utilizing the photoreactivity of a pyrimidine base having a substituted vinyl group at the 5-position of pyrimidine. It has been found that nucleic acids capped or nucleic acids having a branched structure can be easily synthesized using the above method. In addition, the present inventors immobilize nucleic acids having a substituent having a vinyl group at the 5-position of pyrimidine on a solid support, and immobilize the nucleic acids of interest by covalently linking them using light as a trigger. I succeeded in doing it. In addition, it was found that not only the quantitative recovery of the target nucleic acid can be achieved by irradiation with light of different wavelengths, but also the recovery and reuse of the solid phase carrier containing the photo-linked nucleic acid is possible. That is, the present invention provides the following formula as a base moiety:

[0006]

Embedded image

(Where Z represents O or NH, X and Y
Represents an electron-withdrawing group, and the remaining groups of X and Y represent a hydrogen atom. ) And nucleic acids having the nucleic acids immobilized on a solid support. Further, the present invention, the above-described nucleic acids of the present invention, a carbon-carbon double bond, preferably irradiating light to a nucleic acid having a base having a carbon-carbon double bond of a non-fused ring system,
The present invention relates to a method for reversibly photoligating or cleaving nucleic acids.
Furthermore, the present invention relates to the nucleic acids of the present invention described above, and a nucleic acid having cytosine as a base is irradiated with light to link the bases to each other, and an amino group of cytosine is present in the presence of an oxygen-containing substance such as oxygen or water. And then irradiating with shorter wavelength light to cleave the linkage between the bases to selectively convert cytosine to uracil.

[0008] The present invention also relates to the above-mentioned 5'-terminal and 3'-terminal nucleic acids of the present invention for specific bases of DNA.
The present invention relates to a method for inactivating the DNA, which comprises arranging a nucleic acid of the present invention having a base sequence having a base sequence complementary to a base sequence around a specific base of the DNA and irradiating light thereto. Further, the present invention provides a method for immobilizing a specific target nucleic acid, a method for purifying and / or recovering a specific target nucleic acid, using the above-described immobilized nucleic acid of the present invention, and It relates to a method for identification and / or detection and / or quantification. That is, the present invention provides a system in which a nucleic acid mixture containing the immobilized nucleic acids of the present invention and a nucleic acid having a base having a carbon-carbon double bond is irradiated with light, and the nucleic acid mixture is exposed to light. The present invention relates to a method for immobilizing nucleic acids formed by covalently linking specific nucleic acids to be targeted by immobilization, and the present invention relates to the immobilized nucleic acids of the present invention,
A system in which a nucleic acid mixture containing a nucleic acid having a base having a carbon-carbon double bond is present, and a specific nucleic acid to be targeted in the nucleic acid mixture is photolinked by covalent bond by irradiating light to the nucleic acid. The present invention relates to a method for identifying, detecting or quantifying a specific nucleic acid in a nucleic acid mixture, which comprises immobilizing a specific nucleic acid in a mixture and separating or recovering the immobilized nucleic acid. A system in which a nucleic acid mixture containing the immobilized nucleic acids of the invention and a nucleic acid having a base having a carbon-carbon double bond is exposed to light, and a specific nucleic acid of interest in the nucleic acid mixture is irradiated with light. Immobilized specific nucleic acids in the nucleic acid mixture by photocoupling by covalent bonds,
The present invention relates to a method for purifying and recovering specific nucleic acids, which comprises purifying or recovering immobilized nucleic acids, and further irradiating light to photocleave the immobilized nucleic acids.

As described above, the nucleic acids of the present invention are reversibly linked to nucleic acids such as DNA and PNA by irradiation with light,
It can be cleaved and is useful as a reversible photoligating agent for nucleic acids such as DNA and PNA. In addition, the nucleic acids of the present invention can be subjected to a photoreaction using double-stranded DNA as a template. By linking the nucleic acids of the present invention at a specific base sequence of a gene by such a method, Third, a third nucleic acid in which a base is linked to a base by a photoreaction by a method of the present invention can be introduced into a portion of a specific base sequence of double-stranded DNA by the method of the present invention.
As a result, transcription or the like of the double-stranded DNA is suppressed,
Since it inactivates DNA, the nucleic acids of the present invention are also useful as a DNA inactivating agent.

[0010] PNA (peptide nucleic acid) is a natural DNA.
It has been used as an antigene or antisense in gene therapy because it can bind more strongly to the complementary strand of DNA. However, it has been a problem that PNA has low solubility in water and low transport efficiency into cells and nuclei. In order to improve this, a chimeric PNA-DNA complex utilizing the hydrophilicity and membrane affinity of DNA has been attracting attention. However, since DNA and PNA have different basic chains, their synthesis methods have been focused on. Was complicated. The present inventors have proposed a pyrimidine base having a vinyl group substituted with an electron withdrawing group at the 5-position of pyrimidine, for example, the following formula (X):

[0011]

Embedded image

By using a nucleic acid having a nucleic acid having 5-carboxyvinyluracil as a base at the terminal represented by the above formula, reversible ligation of nucleic acids was performed by utilizing this photoreactivity. First, PNA which is a complementary strand thereof is arranged on a DNA serving as a template, and then a nucleic acid of the present invention having the above-mentioned base is arranged at a terminal portion of PNA.
m was irradiated for 3 hours to obtain a PNA-DNA chimera complex linked at the base. This reaction formula is shown by the following formula.

[0013]

Embedded image

[0014] The PNA (P
NA A) and the nucleic acid of the present invention (ODN B)
By irradiating light of 66 nm, the PNA-DNA complex (PN
A-DNA Hybrid E) is obtained. In this scheme, the template (ODNC) is not directly involved in the reaction, but for convenience the product template is designated as the template (ODND).

FIG. 1 shows the result. FIG. 1 is a photograph replacing a drawing. The left side (-) in FIG. 1 shows a spot before light irradiation, which is the nucleic acid of the present invention labeled with ³² P. The one after irradiation with light is shown on the right (+). It can be seen that the PNA and the nucleic acid of the present invention are linked by light irradiation, and the spot has moved to a higher molecular weight position. FIG. 2 shows this result in H
It is a chart of PLC. The horizontal axis of FIG. 2 is the retention time (minutes), the upper part of FIG. 3 is a chart before light irradiation, and the lower part of FIG. 3 is a chart after light irradiation. The leftmost peak in FIG. 3 is the peak of the template (ODNC), and there is no change before and after light irradiation. 2 from the left of (a)
The third and third peaks are the nucleic acids of the present invention (ODN B)
Is the peak of PNA (PNA A) linked to. In the lower part of FIG. 2, it can be seen that the peaks of the two nucleic acids as the raw materials have almost disappeared, and the peak of a higher molecular weight product has appeared. Thus, the double bond of the substituted vinyl group at the 5-position of pyrimidine, which is the base of the nucleic acid of the present invention, and the carbon-carbon double bond of the adjacent base are directly bonded by light. Thus, even if the basic chains are different, it is possible to connect the bases with each other. Furthermore, the connection by light is a photoreversible reaction, and it is possible to reversibly cleave by irradiation with light of a different wavelength. Further, by applying this method, it is possible to easily synthesize a nucleic acid whose end is capped by light. In gene therapy, the gene must be provided with enzyme resistance in order to be transferred to the nucleus, and such enzyme resistance can be provided by photo-capping the nucleic acid of the present invention.

Next, a photoreaction with cytidine (cytosine base) was carried out using a nucleic acid having 5-carboxyvinyluracil represented by the formula (X) as a base.
The target ligated DNA was obtained in a yield of 93% by irradiating with ultraviolet light of nm for 30 minutes. As a comparative example, when a nucleic acid based on 5-vinyluracil having no carboxyl group substituted was used, 80%
Was the yield. Thus, it was found that by substituting the hydrogen atom of the vinyl group with an electron withdrawing group such as a carboxyl group, the reaction can be performed in a short time and with high yield.

In the ligation reaction of the present invention, it is preferable to use DNA or RNA as a template. That is, as shown in the above-mentioned reaction formula with PNA, a nucleic acid to be ligated to a complementary strand thereof is placed on the DNA as a template, and the nucleic acid of the present invention is placed adjacently so that the linking portions are adjacent to each other. It is preferable to arrange and irradiate light. By using such a template, connection can be selectively performed at a target position. The present inventors have examined whether double-stranded DNA can be used as such a template. 3 more for double-stranded DNA
The fact that nucleic acids such as real DNAs form base pairs is known as Hoogsteen base pairs. Therefore, a nucleic acid having a base of 5-carboxyvinyluracil represented by the formula (X) at one end of the nucleic acid and a cytosine base (Py) at the other end is prepared. Partial bases were paired with base pairs of double-stranded DNA. The reaction formula is shown below.

[0018]

Embedded image

By irradiating this with light of 366 nm, a circular DNA was obtained with a yield of 89%. Fig. 3 shows the results.
Shown in FIG. 3 is a photograph replacing a drawing. Lane 1 in FIG. 3 shows a 12-mer nucleic acid as a control, and lane 2 shows a case without light irradiation, and spots of non-circular nucleic acids are seen. Lane 3
Is a result of irradiation with 366 nm light, and a circular nucleic acid spot is observed. Lane 4 has 3 more
The light was irradiated with light of 02 nm, and it can be seen that spots of the original chain appeared after ring opening.
The obtained DNA is a double-stranded DNA in which a base portion is formed by a DNA cyclized by a photocyclization reaction to form a base pair. In this portion, enzymes such as RNA polymerase and other proteins are contained. It cannot bind, resulting in suppression of gene expression in this region. Therefore, it becomes possible to inhibit the expression of the gene whose expression is to be suppressed by this method, and the nucleic acid of the present invention can be used for gene therapy. In addition, 30
By irradiating with 2 nm light, the ring can be reversibly opened, and the suppression of gene expression can be released.

Next, a method for producing a branched nucleic acid was examined. FIG. 4 shows the outline. For example, a template having the base sequence of ACACG and AGCCAC (OD
The N I), wherein the distal formula (5-carboxyvinyl uracil represented by X) base (nucleic acids of the present invention having a UGCGTG · · · of the base sequence having a ^VC U) is in FIG. 4 (ODN H) Arranged and in the adjacent position ... T
Nucleic acid having partial sequence of GTGC (ODNG)
Place. These base sequences are complementary to the template, and the base sequence of the template can be selected according to the base sequence of the target nucleic acid. This is 366n
When light of m is irradiated for 1 hour, the base portion of 5-carboxyvinyluracil and the adjacent cytosine (C) are linked to obtain the branched nucleic acid shown in FIG.

FIG. 5 is an HPLC chart showing the results. The horizontal axis in FIG. 5 is the retention time (minutes), FIG. 5 a) (upper row in FIG. 5) is a chart before light irradiation, and FIG. 5 b) (lower row in FIG. 5) is the chart after light irradiation. It is a chart. The leftmost peak in FIG. 5 is the peak of the template, and there is no change before and after light irradiation. The second and third peaks from the left in (a) are the peaks of the nucleic acid linked to the nucleic acid of the present invention. In FIG. 5B, it can be seen that the peaks of the two nucleic acids as the raw materials disappear, and a large peak of a higher molecular weight product has appeared. The molecular weight of this peak was 5250.12, and the calculated value was 5249.90.
And matched.

Further, according to the method of the present invention, any cytosine on a target gene can be mutated to uracil. That is, in the same manner as in the production of the branched nucleic acid described above, up to the base of cytosine (C) of the target gene is immobilized on the template, and the nucleic acid of the present invention is arranged adjacent to the cytosine and irradiated with light. Then, the target gene and the nucleic acid of the present invention are linked. In this linked state, the amino group at the 4-position of cytosine can be replaced with a hydroxyl group in the presence of an oxygen-containing substance such as oxygen or water. For example, when the temperature is gently increased in the air in a linked state, air oxidation occurs, and the amino group at the 4-position of the pyrimidine ring of cytosine is replaced with a hydroxyl group. When light is again irradiated to cleave the linkage, cytosine is converted into uracil.

FIG. 6 shows this reaction formula. It is the same as described above up to the point where the nucleic acid having the branched structure is produced. That is, for example, ACACG and the template (ODN I) having the nucleotide sequence of ACGCAC, ^CV U is the terminated formula (X) 5-carboxyvinyl uracil represented by at ^VC U (following description in base (Fig. 6 The nucleic acid (ODNH) of the present invention having a base sequence of UCGGTG.
A nucleic acid (ODNG) having a partial sequence of TGTGC is arranged at the adjacent position. These base sequences are complementary to the template, and the base sequence of the template can be selected according to the base sequence of the target nucleic acid. When this is irradiated with light of 366 nm for 1 hour, the base portion of 5-carboxyvinyluracil and the adjacent cytosine (C) are linked to obtain a branched nucleic acid shown in FIG. After heat treatment, the substrate is irradiated with light of 302 nm for 1 hour to be cleaved, whereby a nucleic acid (ODNM) in which cytosine is converted to uracil can be obtained.

FIG. 7 is an HPLC chart showing the results. The horizontal axis of FIG. 7 is the retention time (minutes), the upper part of FIG. 7 is a chart before light irradiation, and the lower part of FIG. 7 is a chart after light irradiation. The second peak from the left in FIG. 7 is the peak of the template, and there is no change before and after light irradiation. The first and third peaks from the left in the upper part of FIG. 7 are the peaks of the nucleic acid (ODNG) linked to the nucleic acid (ODN H) of the present invention. In the lower part of FIG. 7, it can be seen that in addition to the peaks of the two kinds of nucleic acids as the raw materials, the peak of the nucleic acid converted into uracil (ODNM) has appeared.

DNA in which cytosine is converted to uracil
Can be specifically cleaved at the position of this uracil when treated with uracil DNA glycosylase. Therefore, the DNA can be specifically cleaved at any position by uracilating any cytosine position in the DNA by the method of the present invention. FIG. 8 shows the nucleic acid (O) converted to uracil obtained by the method described above.
3 shows an HPLC chart of the result of enzymatic treatment of DNM). A dU peak could be confirmed on the left side. In a similar manner, cytosine on mRNA can be converted to uracil. By specifically converting cytosine on mRNA to uracil by the method of the present invention,
The encoded amino acids can be specifically changed. As described above, by utilizing the nucleic acids of the present invention, a) optical gene therapy, b) genetic diagnosis such as mismatch detection, and c) enzymatic resistance can be imparted by capping the nucleic acid. , D) light mutagenesis and the like can be performed. Next, the immobilized nucleic acids of the present invention will be described. A typical example of the immobilized nucleic acids of the present invention is represented by the following chemical formula.

[0026]

Embedded image

(Where Z represents O or NH, X and Y
Represents an electron-withdrawing group, and the remaining groups of X and Y represent a hydrogen atom. Wavy lines are DNA, PNA, RN
A indicates a nucleic acid portion such as A, a thick line indicates a linker portion,
A circle shown as a sphere indicates a solid support. The immobilized nucleic acid of the present invention is reversibly linked to a nucleic acid such as DNA or PNA by a covalent bond and cleavable by light irradiation as described above. It is bonded to a solid support such as glass beads or polystyrene, and preferably bonded to a solid support via a linker such as a nucleic acid or a polyethylene glycol group.

FIG. 10 is a schematic diagram showing an example of using the immobilized nucleic acids of the present invention. The example shown in FIG. 10 is an example in which the above-described nucleic acid serving as a template is used as a nucleic acid for a template. The nucleic acids linked by dotted lines to the circles in FIG. 10 are the immobilized nucleic acids of the present invention. This nucleic acid has a base sequence complementary to a part of the template DNA shown on the right side of FIG. Nucleic acids having various base sequences are present in a container surrounded by a frame at the top of FIG. In the container, there is a nucleic acid having a base sequence complementary to a part of the template DNA. When the immobilized nucleic acids of the present invention and the above-described template DNA are placed in this container, the immobilized nucleic acids of the present invention and the template D as shown in the second row from the top in FIG.
A part of NA hybridizes, and the remaining part of the template DNA hybridizes with a nucleic acid having a specific base sequence present in the container. At this time, as described above, the template DNA is designed such that the base that can be reversibly linked to the nucleic acids by the light irradiation of the present invention by a covalent bond and the linked base are adjacent to each other. By light irradiation, both nucleic acids are covalently linked as shown in the second row from the top in FIG.

Next, the template DNA was dissociated, and the solid phase carrier was separated and washed. As shown in the third row from the top in FIG. 10, the solid phase carrier was covalently linked to the immobilized nucleic acids of the present invention. A nucleic acid having a specific base sequence can be immobilized on a solid support to separate it from other nucleic acids. When the thus obtained immobilized nucleic acid is irradiated with light again, the immobilized nucleic acids of the present invention and the nucleic acid having the specific base sequence of interest can be reversibly cleaved. In this manner, a target nucleic acid having a specific base sequence can be selectively separated and purified from a mixture of nucleic acids having various base sequences. In addition, the immobilized nucleic acids of the present invention used at this time are linked and cleaved by a reversible reaction by light, so that after being cleaved, the nucleic acid returns to its original state and can be reused.
According to this method of the present invention, a nucleic acid having a specific target base sequence can be specifically and selectively separated and purified from a mixture of nucleic acids having various base sequences. The nucleic acid having a specific base sequence in the nucleic acid mixture can be identified, detected, and quantified.

FIG. 11 shows the results of an experiment using this method according to the present invention. FIG. 11 is a chart of MALDI-TOF MS, and the top row of FIG. 11 is a chart of a mixture of nucleic acids before irradiation with light. The peaks of nucleic acid A1, nucleic acid A2, nucleic acid A3, and nucleic acid A4 are shown from the left (see Example 12 described later). The second row from the top in FIG. 11 shows that only the nucleic acid A0 was selected from the above-mentioned mixture of nucleic acids by this method of the present invention. Similarly, the third row from the top in FIG. 11 shows that only the nucleic acid A1 was selected from the above-mentioned mixture of nucleic acids by this method of the present invention. Further, the fourth row from the top in FIG. 11 shows that only the nucleic acid A2 was selected from the above-mentioned mixture of nucleic acids by this method of the present invention. The bottom row of FIG. 11 shows that only the nucleic acid A3 was selected from the above-mentioned mixture of nucleic acids by this method of the present invention.

The photoligating nucleic acid immobilized on a solid phase according to the present invention is capable of photoligating only a target nucleic acid onto a solid phase carrier using a template DNA. That is, unlike ordinary affinity chromatography, only the target nucleic acid can be immobilized on a solid phase by covalent bonding. Therefore, efficient purification / separation of the target nucleic acid becomes possible. It is also possible to recover the target nucleic acid by irradiating light of different wavelengths. Since such highly efficient gene selection and recovery can be controlled by light, a) purification of target DNA, RNA and protein, b) gene diagnosis / gene therapy, etc., c) selection of functional nucleic acid, etc. In addition to use, it is expected to be used for d) DNA-computing, e) immobilization of nucleic acids to a solid support by covalent bonding, and f) chemical modification of nucleic acids on a solid support.

[0032]

BEST MODE FOR CARRYING OUT THE INVENTION The nucleic acids of the present invention have the following formula at the base moiety:

[0033]

Embedded image

(Where Z represents O or NH, X and Y
Represents an electron-withdrawing group, and the remaining groups of X and Y represent a hydrogen atom. ). Examples of the electron-withdrawing group for the substituents X and Y include a carboxyl group, an alkoxycarbonyl group, a cyano group, and a nitro group, but are not limited to these exemplified ones. The electron-withdrawing group can be selected as appropriate. Preferred electron withdrawing groups include a carboxyl group, an alkoxycarbonyl group, a cyano group and the like. As the alkyl group in the alkoxycarbonyl group, one having 1 carbon atom
To 10, preferably 1 to 5 lower alkyl groups. The substituents X and Y may both be the same or different electron-withdrawing groups at the same time, or only one of the substituents X and Y may be an electron-withdrawing group and the other may be a hydrogen atom.

The nucleic acids of the present invention include DNA, RN
Any of A and PNA may be used, and those capable of forming a base pair with natural or synthetic DNA or RNA are preferable. The nucleic acids of the present invention may be mononucleotides having only the bases of the present invention, but are preferably oligonucleotides together with other nucleic acids. The number of bases in the oligonucleotide is not particularly limited, but is preferably about 1 to 150, more preferably about 1 to 50, and still more preferably about 1 to 20. In the case of an oligonucleotide, the nucleic acid having the above-mentioned base of the present invention may have one, preferably one terminal portion, but may have two or more such bases.

The nucleic acids of the present invention can be produced according to a conventional method for producing nucleic acids. For example, the DMTr derivative of 5-substituted vinyluridine can be amididated by the action of an amididizing agent, and then the protecting group can be cleaved, and this can be converted into an oligonucleotide by a conventional DNA synthesis method. The 5-substituted vinylcytosine derivative or 5-substituted vinyluracil derivative may be produced by the method of the specific examples shown below, but can also be produced by other ordinary organic synthesis methods.

In the method for reversibly photolinking or cleaving nucleic acids of the present invention, the base having a carbon-carbon double bond is not preferably a carbon-carbon double bond forming a condensed ring. A cyclic carbon-carbon double bond or a carbon-carbon double bond substituted on a ring is preferred. Preferred bases having a carbon-carbon double bond include natural ones such as cytosine, thymine or uracil. Nucleic acids having a base having a carbon-carbon double bond may be any of DNA, RNA, PNA and the like.

The nucleic acid having a base having a carbon-carbon double bond may be a nucleic acid different from the above-described nucleic acid of the present invention. The nucleic acids of the present invention may be used. In the latter case, a nucleic acid having a base portion of the present invention and a base having a carbon-carbon double bond are present in one nucleic acid, and a circular nucleic acid may be obtained by linking these. it can. The light in the method of the present invention may be any light having a wavelength having energy necessary for the reaction, and ultraviolet light is preferable. In general, when connecting, light having a relatively long wavelength may be used, and when being cleaved, light having a relatively short wavelength is preferable. More specifically, the wavelength at the time of coupling is preferably 330 nm or more, preferably 350 nm or more, more preferably 360 nm or more. The wavelength at the time of cleavage is preferably 320 nm or less, more preferably 310 nm or less. Preferred wavelengths include a case where the wavelength for coupling is 366 nm and the wavelength for cleavage is 302 nm.

The method of the present invention can be carried out in a state where it can freely flow as in a solution. However, in order to increase the selectivity, a method in which the reaction is carried out by fixing to a template is preferable. DNA, RNA, PN
Any material capable of forming a base pair such as A may be used. The length of the template is not particularly limited, but is preferably a length of 3 bases or more, preferably 5 bases or more that can form a base pair on the template. The template may be single-stranded, but double-stranded DNA may be used as the template as described above.

In the method of the present invention for selectively converting cytosine to uracil, any nucleic acid having cytosine as a base may be used as long as it can be immobilized on the template described above. A base sequence of about 3 to 10 bases upstream or downstream from the position of the target cytosine can be examined, and a base sequence complementary thereto can be used as a template. Further, in this method, as an oxygen-containing substance such as oxygen or water,
Oxygen in the air or water for water content can be used. Uracylated D obtained by this method
NA can be treated with uracil DNA glycosylase by a conventional method.

D in the DNA inactivation method of the present invention
The NA may be natural or synthetic, but may be a gene. A base sequence of about 3 to 30 bases each upstream and downstream of the base to be inactivated by this method is examined, and the 5 ′ end and 3 ′ end are the same or complementary base sequences to the base sequence. A nucleic acid of the invention is prepared. One end of the nucleic acid of the present invention has the above-described base of the present invention, and the other end is prepared so as to be a base having a carbon-carbon double bond connectable thereto. And a DN for inactivating the nucleic acid of the present invention.
By irradiating light at the position A, the circularized nucleic acid of the present invention is immobilized at a target position of DNA (photopadlock method). When it is desired to release the inactivation, the inactivation can be released by irradiating a shorter wavelength light to cleave the connection. The specific base of the DNA to be inactivated is preferably a promoter region, but is not limited thereto.

As described above, the nucleic acids of the present invention are DNA,
Nucleic acids such as RNA and PNA can be reversibly linked by light irradiation, and a branched structure or a cap structure can be introduced into the nucleic acids by this method. It can be used as a reversible optical coupling agent. In addition, the nucleic acids of the present invention include 2
Since it can react with the main strand and inactivate it, the nucleic acids of the present invention can be used as a DNA inactivating agent.

As the solid phase carrier in the immobilized nucleic acids of the present invention, a solid phase carrier used in the field of biochemistry can be used. For example, porous glass beads (PC
Inorganic substances such as G), resins such as polystyrene (PS), and metals such as gold. Preferred solid-phase carriers include solid-phase carriers having adenosine residues (such as oligo-affinity support (OAS) (trade name)).
Is mentioned. More specifically, as described in Example 11 described later, polystyrene (PS) (OAS-P) via an amino group bonded to the ring of an adenosine residue.
S) or a solid support bound to porous glass beads (OAS-CPG) is preferred, and the immobilized nucleic acids of the present invention can be produced by binding a linker moiety from the amino group. Although the nucleic acids of the present invention may be directly bound to the above-described solid support, it is preferred that both are bound via a linker moiety. The linker moiety may be any preferably a linear molecular species that is inert to the chemical reaction of nucleic acids and has 5 or more, preferably 10 or more atoms. DNA, RNA, PN
Nucleic acids such as A and polyethylene glycol represented by the following formula are preferred.

[0044]

Embedded image

As a method for producing the immobilized nucleic acids of the present invention, the nucleic acid of the present invention can be produced by bonding a terminal phosphate group to a linker moiety. The linker moiety and the nucleic acids may be bound and then bound to the solid support, or conversely, the solid support and the linker moiety may be bound first and then the linker moiety and the nucleic acids may be bound. . It is generally preferable to use a terminal phosphate group as the position for binding to nucleic acids, but the present invention is not limited thereto. For example, you may couple | bond with the functional group of the base part in the middle of nucleic acids. In the method of the present invention using immobilized nucleic acids, it is preferable to use a nucleic acid as a template together. Generally, DNA is preferable as the nucleic acid used as a template, but RNA or PNA may be used. The nucleic acid serving as the template includes, as a part thereof, a complementary base sequence capable of hybridizing with the immobilized nucleic acids of the present invention and a complementary base sequence capable of hybridizing to the target nucleic acid. Then, a nucleic acid serving as a template is designed so that a base capable of reversibly linking and cleaving by light irradiation of the present invention and a base capable of photoreacting with the base are adjacent to each other. As the nucleic acid serving as a template in this method of the present invention, a nucleic acid that can serve as a template in the above-described experimental examples can be used.

[0046]

Next, the present invention will be described in more detail with reference to examples, but the present invention is not limited to these examples. The reaction formula of a production example of a nucleic acid containing 5-cyanovinyldeoxyuridine is shown below. In the following description,
The compound number shown in this reaction formula is used.

[0047]

Embedded image

Example 1 Preparation of 5-cyanovinyldeoxyuridine (4) (1) Preparation of compound (2) 5-iodo-deoxyuridine (IDU) (1) was azeotroped with 5 mL of pyridine three times to give TBDMS- Cl (1.71
(7 g, 11.40 mmol) and replaced with nitrogen, and 5 mL of pyridine was added to obtain a homogeneous solution. A pyridine solution (5 mL) of imidazole (0.776 g, 11.39 mmol) was added thereto, and the mixture was stirred at room temperature for 12 hours. After confirming the disappearance of the raw materials by thin layer chromatography (TLC), pyridine was distilled off under reduced pressure, and the residue was extracted with ethyl acetate (20 mL × 3) and water (20 mL). The obtained organic layer was dried over magnesium sulfate, and after removing the solvent, the target compound (2) was subjected to column chromatography (silica gel, elution solvent hexane / ethyl acetate = 4: 1) to give a white solid (1.661 g, 96.5%). ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.04-0.14 (m, 12H, CH3Six4), 0.88 (s, 9H, t-BuSi), 0.93 (s, 9H, t-BuSi), 1.96 (m, 1H, H-2β '), 2.28 (m, 1H,
H-2α '), 3.74 (dd, J = 11.2Hz, J = 2.4Hz, 1H, H-5'), 3.87 (dd, J = 11.2Hz, J = 2.4Hz, 1H, H-5 '), 3.97 (m, 1H, H-4 '), 4.38 (m, 1H, H-3'), 6.25 (t, 1H, H-
1 '), 8.07 (s, 1H, H-6), 8.09 (br, 1H, NH)

(2) Preparation of Compound (3) Pd (OAc) ₂ (0.019 g, 0.085 mmol)
l), PPh ₃ (0.045 g, 0.170 mmol)
Was added to DMF (2.5 mL) under a nitrogen atmosphere, and then NEt ₃ (0.93 mL, 6.672 mmol) was added.
l) was added and the mixture was stirred in a water bath at 60 ° C. After the solution turned dark red, the compound (2) (0.4) obtained in the above (1) was obtained.
98 g, 0.854 mmol) and acrylonitrile (0.7 mL, 10.63 mmol) were added as a DMF solution and stirred overnight. After removing DMF under reduced pressure, the mixture was extracted with ethyl acetate (15 mL × 3) and water (15 mL), and the obtained organic layer was dried over magnesium sulfate and the solvent was removed again. Column chromatography on the residue (silica gel, elution solvent hexane / ethyl acetate = 4: 1)
To give the desired compound (3) as a yellow solid (0.434 g,
53.7%). ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.03-0.14 (m, 12H, CH3Six4), 0.88 (s, 9H, t-BuSi), 0.91 (s, 9H, t-BuSi), 2.00 (m, 1H, H-2'β), 2.39 (m, 1
H, H-2'α), 3.76 (dd, 1H, H-5 '), 3.87 (dd, 1H, H-5'), 4.00 (m, 1H, H
-4 '), 4.37 (m, 1H, H-3'), 6.23 (t, 1H, H-1 '), 6.67 (dd, J = 16.4Hz, 1H, vinylic H-1''), 6.85 ( dd, J = 16.2Hz, 1H, vinylic H-2 ''), 7.96 (s, 1H, H-
6), 7.98 (br, 1H, NH)

(3) Production of Compound (4) The compound (3) obtained in the above (2) (0.233 g,
0.459 mmol) in TBAF (in THF, 1 mm
ol / l) 2.0 mL and stirred at room temperature for 45 minutes.
The solvent was removed. Column chromatography (silica gel, elution solvent 5% MeOH in CH)
Cl ₃ ) to give the desired compound (4) as a pale yellow solid (0.
128 g, 75%). ¹ H NMR (400 MHz, DMSO-d ₆ ) δ: 2.15 (m, 2H, H-2′αβ), 3.57 (m, 1H, H-5 ′), 3.65 (m, 1
H, H-5 '), 3.80 (m, 1H, H-4'), 4.23 (m, 1H, H-3 '), 5.10 (t, 1H, OH-
5 '), 5.26 (d, 1H, OH-3'), 6.08 (t, J = 6.4Hz, 1H, H-1 '), 6.50 (dd, J = 1.6Hz, J = 14Hz, 1H, vinylic H -1 ''), 7.22 (dd, J = 1.6Hz, J = 14Hz, 1H, vinylic H-2 ''), 8.33
(s, 1H, H-6), 11.72 (br, 1H, NH)

Example 2 Preparation of nucleic acid (7) containing 5-cyanovinyldeoxyuridine (1) Preparation of compound (5) Compound (4) (0.096) obtained in Example 1 described above
g, 0.344 mmol) with 2 mL of pyridine three times, and then DMTr-Cl (0.133 g,
0.392 mmol), DMAP (0.025 g, 0.
203 mmol) together with a nitrogen atmosphere. Pyridine (1 mL) was added and stirred to obtain a homogeneous solution. NEt ₃ (0.05 mL, 0.359 mmol) was further added thereto, and the mixture was stirred at room temperature for 20 hours. After removing pyridine under reduced pressure, extraction was performed with chloroform (10 mL × 3) and water (10 mL). The obtained organic layer was dried over sodium sulfate, and the solvent was removed. Column chromatography on the residue (silica gel, eluent 3% MeOH in CHCl ₃ )
To give the desired compound (5) as a yellow solid (0.096 g,
47.9%). ¹ H NMR (400 MHz, CDCl ₃ ) δ: 2.38 (m, 1H, H-2′β), 2.49 (m, 1H, H-2′α), 3.43 (dd, J = 10.4 Hz, J = 2.4 Hz) , 1H, H-5 '), 3.52 (dd, J = 2.4Hz, J = 10.4Hz, 1H, H-5'), 3.80 (s, 6H, OCH
3x2), 4.11 (m, 1H, H-4 '), 4.68 (m, 1H, H-3'), 6.50 (d, J = 14Hz, 1H, vinylic H-1 ''), 6.08 (t, J = 6.4Hz,
1H, H-1 '), 7.22 (d, J = 14Hz, 1H, vinylic H-2''), 6.84-6.87 (m, 4H, H-β to OCH3x4), 7.20-7.33 (m, 9H, p
henyl), 7.98 (br, 1H, NH), 8.00 (s, 1H, H-6)

(2) Production of Compound (7) The compound (5) obtained in the above (1) was transferred to a rubber shield bottle using acetonitrile, the pressure was reduced, and the solvent was removed. . Acetonitrile (1
mL) to dissolve the solid, and then amiditizing agent (5
0uL) and tetrazole (0.5M, 360uL) were added in that order and stirred for 90 minutes. An extraction operation was performed using ethyl acetate previously washed with an aqueous NaHCO ₃ solution and a saturated aqueous NaHCO ₃ solution, and the obtained organic layer was dried over sodium sulfate to remove the solvent. The obtained solid was transferred to a rubber shield bottle using acetonitrile, and the pressure was reduced to remove the solvent. Further, a boiling operation with acetonitrile was performed twice. No further purification was carried out, and the product was directly attached to a DNA synthesizer to perform oligomer synthesis. Oligomers (5'- ^CN UGC GTG) were synthesized using a DNA synthesizer,
Purification was performed using PLC. Mass spectrum: calculated value C ₆₁ H ₇₄ N ₂₃ O ₃₆ P ₅ 1859.3354 found value 1859.4003

Compounds (9) to (11) represented by the following reaction formulas were produced in the same manner as in Example 2 described above. In the following description, the compound numbers shown in this reaction formula will be used.

[0054]

Embedded image

Example 3 Production of Compound (9) A commercially available amidite (7) was attached to an automatic DNA synthesizer, and DNA was synthesized by the phosphoramidite method. The DNA was cut out and deprotected by performing ammonia treatment from the solid support at 65 ° C. for 4 hours. After distilling off ammonia, purify by HPLC,
(5′- ^VC UGCGTG-3 ′) was obtained.

Example 4 Production of Compound (10) A commercially available amidite (7) was attached to an automatic DNA synthesizer.
DNA was synthesized by the phosphoramidite method using an amidite that can be deprotected under mild conditions. The DNA was cut out and deprotected by performing ammonia treatment from the solid support at 37 ° C. for 1 hour. After the ammonia was distilled off, purification was performed by HPLC, and the target DNA (5′-
^VM UGCGTG-3 ′) was obtained.

Example 5 Production of Compound (11) A commercially available amidite (7) was attached to an automatic DNA synthesizer.
DNA was synthesized by the phosphoramidite method. By heating at 65 ° C for 4 hours in a sealed condition with a 2N methanol solution of trimellidiamine from the solid support, DNA
Was modified, excised and deprotected. After neutralization with 1N acetic acid, methanol and water were distilled off, purification was performed by HPLC, and the target DNA (5′- ^VA UGCGTG-
3 ′) was obtained.

Example 6 Preparation of PNA-DNA Chimera Complex 20 μM peptide nucleic acid N-TGTGCC-C (PNA
A) and 20 μM of 5′- ^CV UGCGTG-3 ′
(ODN B) was replaced with 20 μM of template DNA 5′-CA.
In the presence of CGCAGGCACA-3 '(ODNC),
Light irradiation at 366 nm for 6 hours at 0 ° C.
-The PNA hybrid was obtained in 90% yield. HPLC
Identification was performed by measuring the molecular weight of the DNA-PNA hybrid isolated by the above method. The results are shown in FIGS. MALDI-TOF MASS: Calculated value 3512.96 Actual value 3512.24

Example 7 Production of DNA Catenane A circular DNA (DNA catenane) passing through the circular DNA was produced according to the following reaction formula.

[0060]

Embedded image

90 μM plasmid M13mp18ss
DNA and 30 μM 5′- ^V CGTGGCAGCT-T ₄₀ -GGAAACC labeled with ³² P at the end
TGT (ODNF) was irradiated with light of 366 nm at 0 ° C. for 3 hours. After the photoreaction, an electrophoresis analysis was performed using a 5% polyacrylamide gel (PAGE), and it was confirmed that the target photocatlocked DNA catenane was obtained in a yield of 30%. In addition, 3 more
It was confirmed by PAGE that DNA catenane was cleaved quantitatively by irradiating light of 02 nm for 30 minutes.
FIG. 9 shows the results. By irradiating 366 nm light, DNA
A catenane spot was observed, but it was confirmed that the spot disappeared when irradiated with light of 302 nm.

Example 8 Cyclization Using Double-Stranded DNA as Template Cyclization was performed using double-stranded DNA as a template according to the following reaction formula.

[0063]

Embedded image

Note that S in the reaction formula represents a polyethylene glycol spacer. 20 μM 5′- ^CV U
TTCCCCTCTTSSSSSSSSCCTCTTC
20 μM GTACTGAAT against -3 ′ (ODN J) (S is a polyethylene glycol spacer)
TCGGAGAAGAAAGGGGAGAATTCTA
CTC-3 ′ (ODNK) and 20 μM 5′-G
AGTAGAATTCTCCCCCTTTCTTCTCC
Light irradiation at 366 nm was performed for 1 hour in the presence of GAATTCAGTAC-3 ′ (ODNL) to obtain the desired cyclized DNA in a 97% yield. Identification was performed by PAGE analysis. In addition, recovery of the raw material ODNJ was confirmed by irradiation with light at 302 nm for 30 minutes. The results are shown in FIG.

Example 9 Preparation of Branched Structure 20 μM of 5′-TGTGCAAAAAAA-3 ′ (OD
NG) and 20 μM of 5′- ^CV UGCGTG-
3 ′ (ODN H) was replaced with 20 μM of template DNA 5′-C
Light irradiation at 366 nm was performed at 0 ° C. for 1 hour in the presence of ACGCAGGCACA-3 ′ (ODN I) to obtain a target DNA having a branched structure in a yield of 98%. HP
Identification was performed by measuring branched DNA isolated by LC. The results of HPLC are shown in FIG. MALDI-TOF MASS: Calculated 5249.90 Found 5250.12

Example 10 Conversion of cytosine to uracil Cytosine was converted to uracil according to the reaction route shown in FIG. 20 μM 5′-TGTGCAAA
AAA-3 ′ (ODNG) and 20 μM 5′-
^CV UGCGTG-3 ′ (ODN H) was replaced with 20 μM of template DNA 5′-CACGCAGGCACA-3 ′ (O
In the presence of DN I), light irradiation at 366 nm was performed at 0 ° C., 1
After a long time, DNA having a branched structure was obtained in a yield of 98%. The yield was calculated by HPLC. Then 90 ° C
Heating for 1 hour, and then irradiate with 302 nm light for 30 hours.
Minutes, DN converted from cytosine to uracil
A (ODN M) could be obtained with a yield of 60%.
Identification of the converted DNA was performed by enzymatic digestion. The results are shown in FIGS.

Example 11 DN immobilized on a solid support
Synthesis of A Solid support (Oligo Affinity Support) represented by the following formula

[0068]

Embedded image

Using 25 mg, an automatic DNA synthesizer was used to synthesize a sequence in which 1 molecule of hexaethylene glycol was inserted as a linker between a solid support and DNA on a 1 μmol scale. The obtained DNA was dissolved in aqueous ammonia in 65
Deprotection was achieved by heating at 4 ° C. for 4 hours.

Example 12 Sequence-Selective Detection of Oligomers Using Photoligation / Cleavage (1) Run0 Oligodeoxynucleotide (ODN) B0 (5′- ^CV UCCAATT) was placed in a 1.5 ml Eppendorf tube.
CG-3 ′) was immobilized on 1 mg of the solid support, and 1 mM sodium chloride and sodium cacodylate buffer solution (p
H = 7.0) 50 mM, template DNA C0 (5′-CG)
AATTGGAAGTTGAAGC-3 ') 120 µ
M, natural ODN A0 to A3 (A0: 5'-TTGCT
TCAACT-3 ', A1: 5'-GCTTTCTCT
-3 ', A2: 5'-GCTTGAAGT-3', A
3: 5′-TGCTTAGGAT-3 ′) is 100 μm each
At a concentration of M, the total volume of the solution was adjusted to 5 μl. After leaving the tube at 0 ° C. for 15 minutes, irradiate it with 366 nm light for 30 minutes using a transilluminator, add 1 ml of pure water, heat at 65 ° C., stir, centrifuge, and remove only the liquid. The process was repeated five times, and a small amount of remaining water was removed by a speed bag. Next, 5 μl of pure water was added thereto, and irradiated with light of 302 nm by a transilluminator for 30 minutes at room temperature. 1 μl of the liquid was taken out and measured by MALDI-TOF MS using THAP as a matrix. The results are shown in FIG. By the above operation, only the nucleic acid of A0 could be selectively detected.

(2) Run1 Immobilized oligodeoxynucleotide (ODN) B1 in place of immobilized oligodeoxynucleotide (ODN) B0 in the case of RUN0 described in (1) above
(5′- ^CV UAGAGTTCG-3 ′) and C1 (5′-CGAACTCTA) instead of template DNA C0
AGAGAAAGC-3 ′) was used, except that RUN0 in the above (1) was used. Figure 1 shows the results
It is shown in FIG. By the above operation, only the nucleic acid of A1 could be selectively detected.

(3) Run2 In the case of RUN0 described in the above (1), the immobilized oligodeoxynucleotide (ODN) B2 is used instead of the immobilized oligodeoxynucleotide (ODN) B0
(5′- ^CV UGCATTTCG-3 ′) and C2 (5′-CGAATTGCA) instead of template DNA C0
Except that ACTTCAAGC-3 ′) was used, the treatment was performed in the same manner as in the case of RUN0 in the above (1). Figure 1 shows the results
It is shown in FIG. By the above operation, only the nucleic acid of A2 could be selectively detected.

(4) Run3 Immobilized oligodeoxynucleotide (ODN) B3 in place of immobilized oligodeoxynucleotide (ODN) B0 in the case of RUN0 described in (1) above
(5′- ^CV UAGCTTCG-3 ′) and C3 (5′-CGAAGCATA) in place of template DNA C0
Except that ATCCTAAGC-3 ′) was used, the treatment was the same as in the case of RUN0 in (1) above. Figure 1 shows the results
It is shown in FIG. By the above operation, only the nucleic acid of A3 could be selectively detected.

FIG. 11 shows the results. The top row of FIG.
Before light irradiation, each peak is A1,
A2, A3 and A0. FIG.
The second row from the top of 1 is for run 0 (RUN0),
A peak of only the nucleic acid of A0 was observed, and it can be confirmed that only the nucleic acid of A0 was selected. The third row from the top in FIG. 11 is for run 1 (RUN1), and a peak of only the nucleic acid of A1 is observed, confirming that only the nucleic acid of A1 has been selected. The fourth row from the top in FIG. 11 is for run 2 (RUN2), and a peak of only the nucleic acid of A2 is observed, confirming that only the nucleic acid of A2 has been selected. The fifth row (bottom) from the top in FIG. 11 is for run 3 (RUN3), and a peak of only the nucleic acid of A3 is observed, confirming that only the nucleic acid of A3 has been selected. MALDI-TOF MS Nucleic acid A0 (M-H) Calculated 3281.2 Actual 3281.58 Nucleic acid A1 (M-H) Calculated 2654.8 Actual 265.67 Nucleic acid A2 (M-H) Calculated 2752.8 Obtained 275.65

[0075]

The present invention provides a novel nucleic acid capable of reversibly linking nucleic acids in a short time and efficiently. By using the nucleic acids of the present invention, nucleic acids can be optically linked to each other at a target position, and a cap structure or a branched structure can be easily and efficiently constructed using light. By subjecting a nucleic acid to photo-capping by the method of the present invention, resistance to a degrading enzyme can be imparted. In addition, since light is used to synthesize a nucleic acid having a unique structure, the method is environmentally friendly. Further, by using the method of the present invention, any cytosine on the target gene can be mutated to uracil. This can be specifically cleaved at any position by performing uracil DNA glycosylase treatment. Such a conversion specifically converts cytosine on mRNA as well as DNA to uracil, and can specifically change genetic information of mRNA. Furthermore, the specific position of the double-stranded DNA can be reversibly inactivated by the method of the present invention, and the method can be applied to gene diagnosis such as gene therapy and mismatch detection. In addition, the photoligating nucleic acid immobilized on the solid phase of the present invention allows only the target nucleic acid to be photolinked to the solid phase carrier by using a template DNA. That is, unlike ordinary affinity chromatography, only the target nucleic acid can be immobilized on a solid phase by covalent bonding. Therefore, efficient purification / separation of the target nucleic acid becomes possible. It is also possible to recover the target nucleic acid by irradiating light of different wavelengths. Since such highly efficient gene selection and recovery can be controlled by light, a) Objective D
NA, RNA, protein purification, b) gene diagnosis, gene therapy, etc., c) selection of functional nucleic acids, etc.
It is also expected to be used for d) DNA-computing, e) immobilization of nucleic acid to a solid support by covalent bond, and f) chemical modification of nucleic acid on solid support.

[Brief description of the drawings]

FIG. 1 is a photograph instead of a drawing showing the result of producing a PNA-DNA chimera complex by the method of the present invention.

FIG. 2 shows that PNA-DNA is prepared by the method of the present invention.
5 is an HPLC chart showing the result of producing a complex.

FIG. 3 is a photograph instead of a drawing showing the result of inactivating double-stranded DNA by the method of the present invention.

FIG. 4 illustrates a method for introducing a branched structure into a nucleic acid of the present invention.

FIG. 5 is an HPLC chart showing the result of producing a nucleic acid having a branched structure by the method of the present invention.

FIG. 6 illustrates a method for converting cytosine to uracil of the present invention.

FIG. 7 is an HPLC chart showing the results of the method for converting cytosine to uracil of the present invention.

FIG. 8 is a HPLC chart showing the results of enzymatic treatment of uracil-containing nucleic acids produced by the method of the present invention for converting cytosine to uracil.

FIG. 9 shows DNA produced by the method of the present invention.
It is a photograph in place of a drawing showing the production result of catenane.

FIG. 10 is a schematic diagram showing a method for specifically selecting only a target nucleic acid from a nucleic acid mixture using the immobilized nucleic acids of the present invention.

FIG. 11 is a MALDI-TOF MS chart showing the results of a method for specifically selecting only a target nucleic acid from a nucleic acid mixture using immobilized nucleic acids according to the present invention. The uppermost row in FIG. 11 is before irradiation with light, and each peak is for each of the nucleic acids SA1, A2, A3, and A0 from the left. The second row from the top in FIG. 11 is for Run 0 of Example 12, the third row is for Run 1, the fourth row is for Run 2, and the fifth row (bottom). Is for Run 3.

 ──────────────────────────────────────────────────続 き Continued on front page (72) Inventor Hideaki Yoshino 74 Kurone Maki 401 F-term (Reference) 4B063 QA01 QA13 QQ42 QQ52 QR38 QR63 QR82 QS36 QS39 QX10 4B064 AF27 CB30 DA13 4C057 AA18 LL10 LL14 LL21 MM02 MM04 MM05 MM09

Claims (34)

[Claims] 1. A base moiety represented by the following formula: (Wherein, Z represents O or NH, at least one of X and Y represents an electron-withdrawing group, and the remaining groups of X and Y represent hydrogen atoms). 2. The nucleic acids according to claim 1, wherein the electron-withdrawing group is a carboxyl group, a lower alkoxycarbonyl group, a substituted amide group or a cyano group. 3. The nucleic acids according to claim 1, wherein Z is O, X is a hydrogen atom, and Y is a carboxyl group, a lower alkoxycarbonyl group, a substituted amide group or a cyano group. 4. The nucleic acids according to claim 1, wherein the nucleic acids are mononucleotides. 5. The nucleic acids according to claim 1, wherein the nucleic acids are oligonucleotides. 6. The nucleic acid according to claim 5, wherein the nucleic acid is DNA or RNA. 7. The nucleic acid according to claim 1, wherein the nucleic acid is PNA. 8. The method according to claim 1, which is immobilized on a solid support.
8. The immobilized nucleic acids according to any one of 7. 9. The method according to claim 9, wherein the solid phase carrier is a porous glass bead (CP).
The nucleic acid according to claim 8, which is G), polystyrene (PS), or gold. 10. The nucleic acids according to claim 7, further comprising a linker between the solid phase carrier and the nucleic acids for keeping a distance between the two. 11. The nucleic acids according to claim 10, wherein the linker moiety comprises a nucleic acid or a derivative thereof. 12. The nucleic acids according to claim 10, wherein the linker moiety comprises polyethylene glycol. 13. A nucleic acid according to any one of claims 1 to 12 and a nucleic acid having a base having a carbon-carbon double bond are irradiated with light to reversibly photoligate or cleave the nucleic acid. How to let. 14. A base having a carbon-carbon double bond,
14. The method according to claim 13, which is cytosine, thymine or uracil. 15. The method according to claim 13, wherein the nucleic acids having a base having a carbon-carbon double bond are DNA or RNA. 16. The method according to claim 13, wherein the nucleic acids having a base having a carbon-carbon double bond are PNA. 17. The nucleic acid according to any one of claims 13 to 16, wherein the nucleic acid according to any one of claims 1 to 12 and the nucleic acid having a base having a carbon-carbon double bond are the same nucleic acid. the method of. 18. The method according to claim 13, wherein the light is ultraviolet light. 19. The method according to claim 13, wherein the wavelength at the time of cleavage is light having a shorter wavelength than the wavelength at the time of coupling. 20. A wavelength for coupling is 366 nm.
The wavelength at the time of cleavage is 302 nm.
10. The method according to 9. 21. The method according to claim 13, wherein the nucleic acids are immobilized on a template. 22. The method according to claim 21, wherein the template is double-stranded DNA. 23. A nucleic acid according to any one of claims 1 to 12 and a nucleic acid having cytosine as a base are irradiated with light to link the bases to each other, in the presence of an oxygen-containing substance such as oxygen or water. A method of selectively converting cytosine to uracil, which comprises decomposing an amino group of cytosine and then irradiating a shorter wavelength light to cleave the linkage between the bases. 24. The method according to claim 23, wherein the nucleic acids having cytosine are DNA or RNA. 25. A base whose 5 ′ end and 3 ′ end of the nucleic acids according to claim 1 are complementary to a base sequence around the specific base of the DNA, for a specific base of DNA. 13. The method for inactivating DNA, comprising arranging the nucleic acids according to claim 1 having a sequence and irradiating the nucleic acids with light. 26. The DNA according to claim 2, wherein the DNA is double-stranded DNA.
5. The method according to 5. 27. A DNA inactivating agent comprising the nucleic acids according to claim 1. 28. A reversible photoligating agent for nucleic acids comprising the nucleic acids according to claim 1. 29. A system comprising a nucleic acid mixture containing the immobilized nucleic acids according to any one of claims 8 to 12 and nucleic acids having a base having a carbon-carbon double bond,
A method for immobilizing nucleic acids obtained by irradiating light to light-link specific nucleic acids in the nucleic acid mixture. 30. A system comprising a nucleic acid mixture containing the immobilized nucleic acids according to claim 8 and nucleic acids having a base having a carbon-carbon double bond,
The specific nucleic acid in the nucleic acid mixture is immobilized by irradiating light to specific nucleic acids in the nucleic acid mixture, and the immobilized nucleic acids are separated or recovered. A method for identifying, detecting or quantifying nucleic acids of the invention. 31. The specific nucleic acid mixture according to claim 30, which further comprises, after separating or recovering the immobilized nucleic acids, further irradiating light to photocleave the immobilized nucleic acids. A method for identifying, detecting or quantifying nucleic acids. 32. A system comprising a nucleic acid mixture containing the immobilized nucleic acids according to any one of claims 8 to 12 and nucleic acids having a base having a carbon-carbon double bond,
Immobilize the specific nucleic acids in the nucleic acid mixture by irradiating light to specific nucleic acids in the nucleic acid mixture and immobilize the specific nucleic acids in the nucleic acid mixture, and purify or recover the immobilized nucleic acids, and further irradiate light. A method for purifying or recovering specific nucleic acids, which comprises photocleaving the immobilized nucleic acids. 33. A base having a carbon-carbon double bond,
33. It is cytosine, thymine or uracil.
The method according to any of the above. 34. The nucleic acid having a base having a carbon-carbon double bond is DNA or RNA.
3. The method according to any one of 3.