WO2004106513A1 - Cellules hotes deficientes pour la reparation des appariements - Google Patents

Cellules hotes deficientes pour la reparation des appariements Download PDF

Info

Publication number
WO2004106513A1
WO2004106513A1 PCT/US2003/014657 US0314657W WO2004106513A1 WO 2004106513 A1 WO2004106513 A1 WO 2004106513A1 US 0314657 W US0314657 W US 0314657W WO 2004106513 A1 WO2004106513 A1 WO 2004106513A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
cell
bacterial
host cell
stranded
Prior art date
Application number
PCT/US2003/014657
Other languages
English (en)
Inventor
Donald L. Court
Xin-Tian Li
Jian-Dong Huang
Nina Costantino
Depei Liu
Original Assignee
The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services
The University Of Hong Kong
Chinese Academy Of Medical Sciences (Cams) & Peking Union Medical College (Pumc)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, The University Of Hong Kong, Chinese Academy Of Medical Sciences (Cams) & Peking Union Medical College (Pumc) filed Critical The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services
Priority to AU2003228972A priority Critical patent/AU2003228972A1/en
Priority to PCT/US2003/014657 priority patent/WO2004106513A1/fr
Priority to US10/841,125 priority patent/US7521242B2/en
Publication of WO2004106513A1 publication Critical patent/WO2004106513A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Definitions

  • the present disclosure relates to methods to induce homologous recombination in cells in cells deficient for mismatch repair. It also relates to methods for modifying genomic DNA in bacterial artificial chromosomes (BACs) and to subcloning of genomic DNA from BACs into multi-copy plasmids. Cells of use for recombineering are disclosed that that are deficient for mismatch repair, and thus exhibit an increased frequency of homologous recombination.
  • BACs bacterial artificial chromosomes
  • restriction endonucleases and DNA ligases allows in vitro recombination of DNA sequences.
  • the recombinant DNA generated by restriction and ligation may be amplified in an appropriate microorganism such as E. coli, and used for diverse purposes including gene therapy.
  • the restriction-ligation approach has two practical limitations: first, DNA molecules can be precisely combined only if convenient restriction sites are available; second, because useful restriction sites often repeat in a long stretch of DNA, the size of DNA fragments that can be manipulated is limited, usually to less than about 25 kilobases.
  • Homologous recombination generally defined as an exchange between homologous segments anywhere along a length of two DNA molecules, provides an alternative method for engineering DNA.
  • a microorganism such as E. coli, or a eukaryotic cell such as a yeast or vertebrate cell, is transformed with exogenous DNA.
  • the center of the exogenous DNA contains the desired transgene, whereas each flank contains a segment of homology with the cell's DNA.
  • the exogenous DNA is introduced into the cell with standard techniques such as electroporation or calcium phosphate- mediated transfection, and recombines into the cell's DNA, for example with the assistance of recombination-promoting proteins in the cell.
  • a recombination system (termed “recombineering) has been developed for efficient chromosome engineering in Escherichia coli using electroporated linear DNA (see published PCT Application No. WO 00/214495 A2, which is herein incorporated by reference).
  • a defective prophage supplies functions ( ⁇ Red) that protect and recombine an electroporated DNA substrate in the bacterial cell.
  • This system can be used with single-stranded DNA, as well as with linear double- stranded DNA (dsDNA).
  • dsDNA linear double- stranded DNA
  • a temperature-dependent repressor tightly controls prophage expression, such that recombination functions can be transiently supplied by shifting cultures to 42°C.
  • the efficient prophage recombination system does not require host RecA function and depends primarily on exo, bet, and gam functions expressed from the defective prophage.
  • the defective prophage can be moved to other strains and can be easily removed from any strain.
  • recombination in this system is proficient with DNA homologies as short as 30-50 base pairs, making it possible to use PCR-amplified fragments as the targeting cassette.
  • This prophage system has been adapted for use in bacterial artificial chromosome (BAC) engineering by transferring it to DH10B cells, a BAC host strain. Fragments as large as 80 kb can be subcloned from BACs by gap repair using this recombination system, obviating the need for restriction enzymes or DNA ligases.
  • BACs can be modified with this recombination system in the absence of drug selection (Lee et al., Genomics 73:56-65, 2001). It has been suggested that recombineering in BACs allows modification or subcloning of large fragments of genomic DNA with precision. This ability facilitates many kinds of genomic experiments that were difficult or impossible to perform previously and aid in studies of gene function. It has been suggested that this system is of use in generating mouse models and providing a refined analysis of the mouse genome (Copland et al., Nat. Rev. Genet. 2:169-119, 2001).
  • Recombineering uses the exo and bet functions of the prophage lambda under the control of a temperature sensitive repressor.
  • the lambda functions When the lambda functions are turned on, cells become more "recombinogenic," that is they take up DNA and recombination of the DNA occurs with a target sequence in the cell.
  • This system has been adapted for use in bacterial artificial chromosome engineering, wherein inducible recombinases (e.g. ere or flpe) are introduced into host cells and BAC modification is accomplished using recombination sites (e.g. loxP or frt, respectively).
  • This system can be used to generate Cre-expressing transgenic mice for use in conditional knock-out studies.
  • This system utilizes a targeting vector to introduce recombination sites (e.g. loxP) into a gene of interest.
  • recombination sites e.g. loxP
  • Expression of a recombinase from a specific promoter results in recombination at the recombination sites, leading to a "conditional knock-out.”
  • SSOs synthetic single-stranded oligonucleotides
  • recombineering using SSOs provides a method for introducing homologous DNA into a target nucleic acid sequence, the frequency of recombination can be improved.
  • methods for increasing recombination frequency using recombineering, and strains which produce recombinants at a high frequency are disclosed herein.
  • This disclosure provides methods for inducing homologous recombination using single-stranded or double-stranded oligonucleotides in host cells.
  • Host cells are of use in increasing the efficiency of recombination using the bet (and optionally exo and gam) functions of the prophage lambda under the control of a de-repressible promoter, and are deficient for mismatch repair.
  • the promoter is lambda PL promoter, which is under the control of a temperature sensitive repressor.
  • the nucleic acid nucleic acid is single-stranded.
  • the host cell is a bacterial cell that is deficient for mismatch repair.
  • the host cell is a bacterial cell that is deficient for mismatch repair.
  • bacterial cells that have reduced or absent function of the polypeptides encoded by mutS, mutH, mutL, uvrD, and/or or dam, such that the bacterial cell is deficient for mismatch repair.
  • the methods include introducing a single-stranded or double-stranded homologous nucleic acid of sufficient homology to a target sequence into a host cell deficient for mismatch repair.
  • the homologous nucleic acid is of sufficient length to undergo homologous recombination with the target sequence, and can optionally include a mutation as compared to the target sequence.
  • the host cell includes a de- repressible promoter operably linked to a nucleic acid encoding Beta.
  • the de-repressible promoter is also operably linked to a nucleic acid encoding Exo and or Gam.
  • the host cell is a bacterial cell, a yeast cell, or a mammalian cell.
  • FIG. 1 is a schematic diagram of single stranded DNA at the replication fork.
  • a single stranded nucleic acid is utilized for recombination that includes a mismatch.
  • the annealing of the single- stranded nucleic acid, mediated by Beta, is indicated on the replication fork.
  • MutS, MutH, MutL, and dam are shown at the replication fork. If present, these proteins will correct the mismatch.
  • a strain that is deficient for MutS, MutH, MutL, dam (or uvrD) will not repair the mismatch, and thus an increased recombination frequency will be detected.
  • Fig. 2 is a schematic diagram of the use of a double stranded DNA including a 3' overhang.
  • Two single stranded oligonucleotides are generated that are homologous to each other over a portion of their sequence, and thus can form an intermediate that is a double-stranded nucleic acid with 3' overhangs.
  • the overhangs are single stranded.
  • Beta (bet) binds the single-stranded ends of the intermediate, and can mediate recombination of this molecule into a target sequence. The annealing of intermediate to the replication fork at the lagging strand is shown.
  • Fig. 3 is a schematic diagram of branch migration at a replication fork that occurs following the step shown in Fig. 2. A region of mismatch is indicated. The mismatch repair proteins will correct the mismatch. Thus, recombination frequency will be increased in a host cell that is deficient for mismatch repair.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822.
  • double-stranded nucleic acids only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. However, for single-stranded nucleic acids, the complementary strand is not included.
  • BAC bacterial artificial chromosome ddH 2 O: double distilled water
  • DNA deoxyribonucleic acid ds: double-stranded
  • IPTG isopropyl-beta-D-thiogalactopyranoside
  • Kan kanamycin
  • MMR mismatch repair ng: nanograms nt: nucleotide NT oligo: non-template oligonucleotide
  • Oligo oligonucleotide
  • SSO or ss oligo single-stranded oligonuceotide
  • T oligo template oligo
  • YAC yeast artificial chromosome
  • 3' overhang two nucleic acid sequences which when annealed are partially double-stranded and partially single-stranded.
  • the single-stranded end or ends extend away from the double-stranded segment in a 5' to 3' direction.
  • 5' overhang two nucleic acid sequences which when annealed are partially double-stranded and partially single-stranded.
  • the single-stranded end or ends extend away from the double-stranded segment in a 3' to 5' direction.
  • Bacterial artificial chromosome Bacterial artificial chromosomes (BACs) have been constructed to allow the cloning of large DNA fragments in E. coli, as described in O'Conner et al., Science 244:1307-1312, 1989; Shizuya et al., Proc. Natl. Acad. Sci. USA 89:8794-8797, 1992; Hosoda et al., Nucleic Acids Res. 18:3863-3869, 1990; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-friterscience, New York, 1987 (with periodic updates).
  • a BAC carries the F replication and partitioning systems that ensure low copy number and faithful segregation of plasmid DNA to daughter cells. Large genomic fragments can be cloned into F-type plasmids, making them of use in constructing genomic libraries.
  • Beta The 28 kDa lambda Beta ssDNA binding polypeptide (and nucleic acid encoding lambda Beta) involved in double-strand break repair homologous recombination. DNA encoding Beta (bet) and polypeptide chains having lambda Beta activity are also referred to herein as bet (see published PCT Application No.
  • the lambda Beta protein binds to single-stranded DNA and promotes renaturation of complementary single- strand regions of DNA (see Karakousis et al, J. Mol. Biol. 276:721-733, 1998; Li et al., J. Mol. Biol. 276:721-733, 1998; Passy et al, PNAS 96:4279-4284, 1999).
  • Beta Functional fragments and variants of Beta include those variants that maintain their ability to bind to ssDNA and mediate the recombination function of lambda Beta as described herein, and in the publications referenced herein. It is recognized that the gene encoding Beta may be considerably mutated without materially altering the ssDNA binding function or homologous recombination function of lambda Beta. First, the genetic code is well-known to be degenerate, and thus different codons encode the same amino acids. Second, even where an amino acid mutation is introduced, the mutation may be conservative and have no material impact on the essential functions of lambda Beta. See Stryer, Biochemistry 3rd Ed., (c) 1988.
  • part of the lambda Beta polypeptide chain may be deleted without impairing or eliminating its ssDNA binding protein function, or its recombination function.
  • insertions or additions may be made in the lambda Beta polypeptide chain ⁇ for example, adding epitope tags — without impairing or eliminating its essential functions (Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1987 (with periodic updates)).
  • Biolistics Insertion of DNA into cells using DNA-coated micro-projectiles. Also known as particle bombardment or microparticle bombardment. The approach is further described and defined in U.S. Patent No. 4,945,050.
  • cDNA complementary DNA
  • cDNA may be synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
  • Cosmid Artificially constructed cloning vector containing the cos gene of phage lambda. Cosmids can be packaged in lambda phage particles for infection into E. coli; this permits cloning of larger DNA fragments (up to 45 kb) than can be introduced into bacterial hosts in plasmid vectors.
  • De-repressible Promoter When a repressor is bound to a de-repressible promoter transcription is substantially decreased as compared to transcription from the de-repressible promoter in the absence of repressor. By regulating the binding of the repressor, such as by changing the environment, the repressor is released from the de-repressible promoter, and transcription increases. In this definition, a de- repressible promoter does not require an activator for transcription.
  • One specific, non-limiting example is the PL promoter, which is regulated by the repressor cl, but is not activated by an activator. (The arabinose promoter is not a simple de- repressible promoter as arabinose inactivates the repressor AraC and converts it to an activator).
  • the de-repressible promoter is a temperature sensitive de-repressible promoter.
  • the repressor is released from the promoter, or can no longer bind to the promoter with a high affinity, and transcription is increased from the promoter.
  • One specific, non-limiting example is the induction of PL promoter activity by increasing the temperature of the cell. Increased temperature inactivates a temperature-sensitive repressor cl, allowing genes that are operably linked to the PL promoter to be expressed at increased levels.
  • a de-repressible promoter can readily identify a de-repressible promoter.
  • a de-repressible promoter is auto-regulated. For example, if only one copy of a gene encoding cl is present, yet many copies of the PL promoter are present, expression of cl is upregulated such that transcription is blocked from any of the PL promoters.
  • Double-strand break repair recombination A type of homologous recombination exemplified by the lambda recombination proteins Exo, Beta and Gam, and shared by numerous other recombinase systems.
  • a double-strand break is the initiation point for concerted action of recombination proteins.
  • an exonuclease degrades processively from the 5' ends of these break sites, and ssDNA binding polypeptide binds to the remaining 3' single-strand tail, protecting and preparing the recessed DNA for homologous strand invasion (Szostak et al., Cell 33:25-35, 1983; Little, J. Biol. Chem.
  • ssDNA binding polypeptides which bind to either ssDNA and/or dsDNA with 3' overhangs and promote double-strand break repair recombination include lambda Beta, RecT of E. coli, Erf of phage p22, and Rad52 in various eukaryotic cells including yeast and mammalian cells.
  • Electrocompetent cells capable of macromolecular uptake upon treatment with electroporation.
  • Electroporation a method of inducing or allowing a cell to take up macromolecules by applying electric fields to reversibly permeabilize the cell walls.
  • Various methods and apparatuses used are further defined and described in: U.S. Patent No. 4,695,547; U.S. Patent No. 4,764,473; U.S. Patent No. 4,882,28; U.S. Patent No. 4,946,793; U.S. Patent No. 4,906,576; U.S. Patent No. 4,923,814; and U.S. Patent No. 4,849,089.
  • Eukaryotic cell a cell having an organized nucleus bounded by a nuclear membrane.
  • tissue types such as: endothelial cell, smooth muscle cell, epithelial cell, hepatocyte, cells of neural crest origin, tumor cell, hematopoietic cell, immunologic cell, T cell, B cell, monocyte, macrophage, dendritic cell, fibroblast, keratinocyte, neuronal cell, glial cell, adipocyte, myoblast, myocyte, chondroblast, chondrocyte, osteoblast, osteocyte, osteoclast, secretory cell, endocrine cell, oocyte, and spermatocyte.
  • tissue types such as: endothelial cell, smooth muscle cell, epithelial cell, hepatocyte, cells of neural crest origin, tumor cell, hematopoietic cell, immunologic cell, T cell, B cell, monocyte, macrophage, dendritic cell, fibroblast, keratinocyte, neuronal cell, glial cell, adipocyte, myoblast, myocyte, chondroblast,
  • Beta a lambda protein (and nucleic acid encoding Gam) involved in double-strand break repair homologous recombination. It is believed to inhibit cellular nuclease activity such as that encoded by the recBCD and sbcC system of E. coli. See published PCT Application No. WO 00/214495 A2 for discussion. Over- expression of Gam function, when expressed in the cell, is extremely toxic to the cell, and prevents growth. For this reason tight controls over its expression are always required. PL and cl 857 are able to regulate Gam expression. Functional fragments and variants of Exo and Gam: As discussed for Beta
  • extrachromosomal indicates a DNA oligonucleotide that is not covalently inco ⁇ orated into the chromosome or chromosomes of a cell.
  • Intrachromosomal refers to material such as an oligonucleotide that is inco ⁇ orated into the chromosome or chromosomes of a cell, such as a DNA oligonucleotide covalently inco ⁇ orated into the chromosomal DNA of a cell.
  • Homologous arm nucleotides at or near 5' or 3' end of a polynucleotide which are identical or similar in sequence to the target nucleic acid in a cell, and capable of mediating homologous recombination with the target nucleic acid.
  • Homologous arms are also referred to as homology arms.
  • a homology arm includes at least 20 bases of a sequence homologous to a nucleic acid of interest.
  • the homology arm includes at least 30 base pairs of a sequence homologous to a nucleic acid of interest.
  • a homology arm includes at least 40 base pairs of a sequence homologous to a nucleic acid of interest.
  • a homology arm includes from about 50 to about 100 base pairs of a sequence homologous to a nucleic acid of interest.
  • Homologous recombination an exchange of homologous polynucleotide segments anywhere along a length of two nucleic acid molecules.
  • Homologous nucleic acids include nucleic acids that are 100% identical, as well as nucleic acids with limited differences in their nucleic acid sequence.
  • homologous recombination can occur between two nucleic acid sequences that are at least 90% identical, such as nucleic acid sequences that are at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical.
  • Host cell a cell that is used in laboratory techniques such as DNA cloning to receive exogenous nucleic acid molecules.
  • a host cell is used to maintain or allow the reproduction of a vector, or to facilitate the manipulation of nucleic acid molecules in vitro.
  • a host cell can be a prokaryotic or a eukaryotic cell.
  • a host cell is a bacterial cell, such as, but not limited to, an E. coli cell (e.g. DH10B, DY330, HME6, HME41, or DY380).
  • HVJ-mediated gene transfer a method of macromolecular transfer into cells using inactivated hemagglutinating virus of Japan and liposomes, as described in Morishita et al., J. Clin. Invest. 91 :2580-2585, 1993; Morishita et al., J. Clin. Invest. 94:978-984, 1994.
  • Inducible promoter a promoter whose activity may be increased by some change in the environment of the cell. Examples of inducible promoters abound in nature, and a broad range of environmental or hormonal changes may activate or repress them. One specific, non-limiting example of an inducible promoter is the arabinose promoter.
  • Isolated An "isolated" biological component (such as a nucleic acid or protein) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins.
  • nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods.
  • the term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
  • Lagging and Leading Strand of a double-stranded (ds) DNA the leading strand is the strand of a double-stranded DNA that is synthesized continuously during replication.
  • the lagging strand is the strand of a double-stranded DNA that is synthesized discontinuously.
  • Okazaki fragments are short segments of newly synthesized DNA produced during replication. All the known DNA polymerases only synthesize DNA in one direction, the 5' to 3' direction. However, as the strands separate, the replication fork moves along one parental strand in the 3' to 5' direction and 5' to 3 ' on the other parental strand. On the former, the leading strand, DNA is synthesized continuously in the 5' to 3' direction. On the other, the lagging strand, DNA synthesis only occurs when a length of single-stranded (ss) DNA has been exposed and proceeds in the direction opposite to the movement of the replication fork (5' to 3).
  • ss single-stranded
  • Linear plasmid vector a DNA sequence (1) containing a bacterial plasmid origin of replication, (2) having a free 5' and 3' end, and (3) capable of circularizing and replicating as a bacterial plasmid by joining its free 5' and 3' ends.
  • linear plasmid vectors include the linearized pBluescript vector and linearized pBR322 vectors.
  • Lipof ection the process of macromolecular transfer into cells using liposomes. See U.S. Patent No. 5,651,981.
  • Mini lambda a derivative of lambda ( ⁇ ) wherein most of the viral lytic genes, including those required for replication and lysis, are deleted.
  • a mini-lambda maintains the Red functions (Beta, with, or without, Exo and/or Gam) for homologous recombination and maintains the integration/excision functions (e.g. att, integrase (int). and excisionase (xis)) to insert and excise its DNA from the chromosome.
  • Mismatch a base-pair in a double-stranded nucleic acid that does not mate via normal Watson-Crick binding (e.g., G/C, A/T).
  • normal Watson-Crick binding e.g., G/C, A/T.
  • Base pair mismatches include any homologous pairing of nucleotides (A/ A, T/T, G/G, and C/C), as well as some heterologous pairings (G/A, G/T, C/A, C/G) of nucleotides. Mismatch is also a small insertion/deletion loop in double-stranded DNA.
  • A represents a base inserted into the bottom stand that is a "mismatch" as there is no corresponding base with which it forms Watson-Crick base pairs within the upper strand.
  • the a mismatch can be for a longer length of nucleic acid, such as but not limited to, a mismatch of about one, two, three, four, five, or ten nucleotides.
  • Mismatch Repair and Polypeptides Involved in Mismatch Repair the endogenous pathway in cells response for the repair of a mismatch.
  • prokaryotes e.g., E. coli
  • the MutS, MutL, MutH, dam, and uvrD proteins are involved in mismatch repair, amongst others.
  • the MutS protein recognizes and binds to mismatches in DNA duplexes.
  • a mismatch existing in the form of a base- base mispair of a small insertion deletion loop in double-stranded DNA is bound by a MutS protein homodimer (e.g., see Genbank Accession No. NP_417213).
  • MutS homodimers can bind to form a multimer complex until a hemi- methylated GATC site is encountered.
  • the MutL (e.g. see GenBank Accession No. NP_418591) protein binds to MutS, and the MutH protein (e.g. see GenBank Accession No. NP_417308) binds to hemimethylated dam methylation sites (which are methylated by dam, see, for example, GenBank Accession No. NP_417846).
  • the MutS-MutL-DNA complex stimulates MutH to cleave the unmethylated DNA strand at the GATC sequence (the GATC site can be either 5' or 3' of the recognized mismatch).
  • Eurkaryotes have proteins with sequence similarity to MutS and MutL that are involved in a similar repair pathway.
  • the eucaryotic MutS is a dimer of MSH2 and GTBP (now known as MSH3 or MSH6) proteins.
  • Eucaryotic MutL also consists of two polypeptides, MLH1 and PMS2.
  • Table 2 describing exemplary proteins is provided in the disclosure herein.
  • Nucleic acid a deoxyribonucleotide or ribonucleotide polymer in either single or double-stranded form, including known analogs of natural nucleotides unless otherwise indicated.
  • Oligonucleotide a single-stranded nucleic acid ranging in length from 2 to about 500 bases, for example, polynucleotides that contain at least 20 or 40 nucleotides. Oligonucleotides are often synthetic but can also be produced from naturally occurring polynucleotides.
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
  • Phagemid artificial chromosome also referred to as PI artificial chromosome.
  • a type of artificial chromosome allowing for stable cloning of very large DNA fragments. Further described in Shepherd et al., Proc. Natl. Acad. Sci. USA 92:2629, 1994; Iannou et al, Nature Genetics 6:84-89, 1994.
  • Phage-based recombination systems bacteria such as E. coli encode their own homologous recombination systems, which are used in repair of DNA damage and to maintain a functional chromosome.
  • the viruses or phages that inhabit bacteria often carry their own recombination functions.
  • Phage ⁇ carries the Red recombination system. These phage systems can work with the bacterial recombination functions or independently of them.
  • PL promoter the major leftward promoter of bacteriophage lambda. Once the lambda DNA is inco ⁇ orated into the bacterial chromosome, transcription from this promoter is tightly repressed by the cl repressor. Upon inactivation of the cl repressor, for example by heat shock of a temperature sensitive mutant, transcription from the PL promoter is activated, leading to expression of lambda genes. See Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Oppenheim et al., Prog. Nucleic Acid Res. Mol. Biol. 46:37-49, 1993. Plasmid: autonomously replicating, extrachromosomal DNA molecules, distinct from the normal bacterial genome and nonessential for bacterial cell survival under nonselective conditions.
  • Polynucleotide a double-stranded or single-stranded nucleic acid sequence of any length. Therefore, a polynucleotide includes molecules which are 15, 50, 100, 200 nucleotides long (oligonucleotides) and also nucleotides as long as a full length cDNA.
  • Polypeptide any chain of amino acids, regardless of length or post- translational modification (e.g., glycosylation or phosphorylation).
  • Prokaryote cell or organism lacking a membrane-bound, structurally discrete nucleus and other subcellular compartments.
  • Prokaryotes include Archaea, and Bacteria.
  • Bacterial include hydrogenobacteria, Thermotogales, green non-sulfur bacteria, the deioncoccus group, Cyanobacteria, plancotmyces, spirochetes, spirilla, myxobacteria, lithotrophs, pseudomonads, enteric bacteria, vibrios, green sulfur bacteria, cytophagas, pyogenic cocci, and Gram Positive bacteria.
  • prokaryotes include both gram positive and gram negative bacteria (e.g.
  • a prokaryote is a bacteria, such as a gram-negative bacteria, such as an enteric bacteria (e..g., E. coli).
  • a nucleic acid probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule.
  • Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various pu ⁇ oses are discussed, e.g., in Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1987 (with periodic updates)).
  • Primers are short nucleic acids, preferably DNA oligonucleotides 15 nucleotides or more in length. Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand. The 3' hydroxyl end of the primer may be then extended along the target DNA strand through the use of a DNA polymerase enzyme. Primer pairs (one on either side of the target nucleic acid sequence) can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
  • PCR polymerase chain reaction
  • probes and primer pairs can be derived from a known sequence, for example, by using computer programs intended for that pu ⁇ ose such as Primer (Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). Under appropriate conditions, the specificity of a particular probe or primer increases with its length. Thus, in order to obtain greater specificity, probes and primers maybe selected that comprise 20, 25, 30, 35, 40, 50 or more consecutive nucleotides of related cDNA or gene sequence.
  • a purified lambda Beta preparation or ssDNA binding polypeptide is one in which the protein is more enriched than the protein is in its natural environment within a cell.
  • a preparation of lambda Beta is purified such that the polypeptide represents at least 50% of the total protein content of the preparation.
  • RecA the RecA protein is a central protein that has an activity as in the recombination function of E. coli. Homologues are found in all other organisms. RecA protein allows two homologous DNAs to find each other among non- homologous DNAs and then trade or transfer strands with each other.
  • Recombinases proteins that, when included with an exogenous targeting polynucleotide, provide a measurable increase in the recombination frequency between two or more oligonucleotides that are at least partially homologous.
  • Recombineering the use of a recombinase to mediate homologous recombination between linear DNA introduced into a living cell and a replicon in the cell.
  • the linear DNA can be either single or double stranded.
  • a recombineering system is described in published PCT Application No. WO 00/214495 A2, which is herein inco ⁇ orated by reference.
  • recombineering uses the bet functions (and optionally exo and gam) of the prophage lambda under the control of a de-repressible promoter, such as but not limited to, a promoter regulated by a temperature sensitive repressor.
  • Selection markers or selectable markers nucleic acid sequences which upon intracellular expression are capable of being detected, such a nucleic acid sequence that confers either a positive or negative selection marker or phenotypic characteristic for the cell expressing the sequence.
  • selection marker or “selectable marker” includes both positive and negative selection markers.
  • a "positive selection marker” is a nucleic acid sequence that allows the survival of cells containing the positive selection marker under growth conditions that kill or prevent growth of cells lacking the marker. Examples of a positive selection marker is a nucleic acid sequence which promotes expression of the neomycin resistance gene, ampicillin resistance gene, and kanamycin resistance gene.
  • a "negative selection marker” is a nucleic acid sequence that kills, prevents growth of or otherwise selects against cells containing the negative selection marker, usually upon application of an appropriate exogenous agent.
  • An example of a negative selection marker is the sacB gene, which encodes a function causing sensitivity to the addition of sucrose to the culture.
  • Another example of a negative marker is a nucleic acid sequence which promotes expression of the thymidine kinase gene of he ⁇ es simplex virus (HSV-TK).
  • Sequence identity the similarity between two nucleic acid sequences, or two amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar are the two sequences. Methods of alignment of sequences for comparison are well known in the art.
  • BLAST Basic Local Alignment Search Tool
  • Homologues of lambda Beta, Exo and Gam, and ssDNA binding proteins typically possess at least 60% sequence identity counted over full-length alignment with the amino acid sequence of the protein being evaluated (that is, lambda Beta, Exo or Gam, or ssDNA binding protein such as P22 Erf, RecT, and Rad52) using the NCBI Blast 2.0, gapped blastp set to default parameters.
  • the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1).
  • the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequence will show increasing percentage identities when assessed by this method, such as at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs will typically possess at least 75% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI website.
  • BLAST NCBI Basic Local Alignment Search Tool
  • sequence identity ranges are provided for guidance only; sequences of sufficient identity to provide homologous recombination activity could be obtained that fall outside of the ranges provided.
  • Single-stranded DNA ssDNA
  • dsDNA double-stranded DNA
  • ssDNA is DNA in a single polynucleotide chain; the DNA bases are not involved in Watson-Crick base pairing with another polynucleotide chain.
  • dsDNA involves two or more complementary polynucleotide chains, in which the two polynucleotide chains are at least partially Watson-Crick base-paired to each other.
  • Double- stranded DNA can also include a segment of DNA that is partially ssDNA and partially dsDNA, for example if there are gaps in one polynucleotide chain of a segment of dsDNA, such as a DNA including 5' or 3' overhangs.
  • ssDNA and dsDNA may contain nucleotide analogs, nonnaturally occurring or synthetic nucleotides, biotin, or epitope or fluorescent tags.
  • ssDNA or dsDNA may be labeled; typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes.
  • Site-specific recombinase a recombinase whose activity is limited to DNA of a specific sequence. Examples include the Cre, FLP and FLPE recombinases. Lambda Int is specific for its att site. Cre recombinases are site-specific for loxp recombination sites in a DNA sequence, whereas FLP and FLPE recombinases are site-specific for FRT recombination sites.
  • a recombination site is a nucleic acid sequence specifically recognized by a recombinase. For example, the Cre recombinase specifically binds a loxp recombination site, and thereby induces recombination.
  • a polynucleotide or polypeptide which is substantially free of other nucleotides, proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • a polypeptide may be at least 50%, 80% or 90% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • a polynucleotide may be isolated from the nucleotide sequences found 5' and 3' from the sequence in a wild-type cell.
  • Target nucleic acid sequence the nucleic acid segment which is targeted for homologous recombination. Typically, this is a segment of chromosomal or extracliromosomal DNA in a cell. Extrachromosomal DNA harboring target nucleic acid sequences may include episomal DNA, plasmid DNA, bacterial artificial chromosome, phagemid artificial chromosomes, yeast artificial chromosomes, cosmids, and the like. In one embodiment, the target nucleic acid sequence harbors a gene or gene fragment which will be mutated in some fashion upon homologous recombination.
  • target nucleic acid sequences include DNA sequences surrounding the tyr 145 UAG amber mutation of galK, as described in Yu et al., Proc. Natl. Acad. Sci. 97:5798-5983, 2000, and in Example 3 of this application; the second exon of mouse hox 1.1 gene, as described in U.S. Patent No. 5,464,764; the human hemoglobin S gene mutation as described in Example 15 of published PCT Application No. WO 00/214495 A2, which is herein inco ⁇ orated by reference.
  • Targeting frequency the frequency with which a target nucleic acid sequence undergoes homologous recombination.
  • extrachromosomal DNA is introduced into a eukaryotic cell.
  • the extrachromosomal DNA has sequences capable of undergoing homologous recombination with a target intrachromosomal DNA sequence.
  • the total number of cells may be determined, and the number of cells having the target DNA sequence altered by homologous recombination may be determined.
  • the targeting frequency is the number of cells having the target DNA sequence altered, divided by the total number of cells.
  • the targeting frequency is 1 in 1,000, or 10 " .
  • transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of DNA (including DNA linked to Beta protein) by electroporation, lipofection, and biolistics.
  • Upstream nucleic acid sequences 5' to a nucleic acid sequence of interest.
  • upstream refers to nucleic acid sequences that precede the codons that are transcribed into a RNA of interest.
  • downstream refers to nucleic acid sequences 3' of a nucleic acid of interest, such as, but not limited to, a nucleic acid sequence that follows codons that are transcribed into a RNA of interest.
  • Variants of Amino Acid and Nucleic Acid Sequences can be accomplished in a variety of ways.
  • DNA sequences which encode for the protein, or a fragment of the protein, can be engineered such that they allow the protein to be expressed in eukaryotic cells, bacteria, insects, and/or plants, hi order to accomplish this expression, the DNA sequence can be altered and operably linked to other regulatory sequences.
  • the final product, which contains the regulatory sequences and the nucleic acid encoding the therapeutic protein, is operably linked into a vector, allowing stable maintenance in a cell. This vector can then be introduced into the eukaryotic cells, bacteria, insect and/or plant. Once inside the cell, the vector allows the protein to be produced.
  • DNA can be altered in numerous ways without affecting the biological activity of the encoded protein.
  • PCR may be used to produce variations in the DNA sequence which encodes lambda Beta, Exo or Gam, or other ssDNA binding proteins.
  • Such variants may be variants that are optimized for codon preference in a host cell that is to be used to express the protein, or other sequence changes that facilitate expression.
  • cDNA sequence variant Two types may be produced.
  • the variation in the cDNA sequence is not manifested as a change in the amino acid sequence of the encoded polypeptide. These silent variations are simply a reflection of the degeneracy of the genetic code.
  • the cDNA sequence variation does result in a change in the amino acid sequence of the encoded protein.
  • the variant cDNA sequence produces a variant polypeptide sequence.
  • amino acid substitutions are ideally conservative in highly conserved regions. Conservative substitutions replace one amino acid with another amino acid that is similar in size, hydrophobicity, etc. Outside of highly conserved regions, non-conservative substitutions can more readily be made without affecting function of the protein. Examples of conservative substitutions are shown in Table 1 below.
  • Val He Leu Variations in the cDNA sequence that result in amino acid changes, whether conservative or not, should be minimized in order to preserve the functional and immunologic identity of the encoded protein.
  • the immunologic identity of the protein may be assessed by determining whether it is recognized by an antibody to the protein; a variant that is recognized by such an antibody is immunologically conserved.
  • Particular examples of cDNA sequence variants introduce no more than 20, and fewer than 10 amino acid substitutions, into the encoded polypeptide.
  • Variant amino acid sequences may, for example, be at least 80, 90 or even 95% identical to the native amino acid sequence.
  • Yeast artificial chromosome a vector used to clone DNA fragments (up to 400 kb); it is constructed from the telomeric, centromeric, and replication origin sequences needed for replication in yeast cells (see Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley- Interscience, New York, 1987 (with periodic updates)). Wild-type: the genotype or phenotype that is found in nature or in the standard laboratory stock for a given organism.
  • Recombineering or the use of a recombinase to mediate recombination using homology sufficient to induce recombination, as disclosed herein, can be performed using single-stranded oligonucleotides (oligos) as the targeting cassette.
  • oligos single-stranded oligonucleotides
  • Single stranded oligos have also been used to effect genetic modifications in yeast (Moerschell et al., Proc. Natl Acad Sci USA 85:524-528, 1988; Liu et al, Mol. Cell. Biol. 22:3852-3863, 2002; Liu et al., Nucleic Acids Res 29:4238-4250, 2001) and in mammalian cells (Gamper et al., Nucleic Acids Res 28:4332-4339, 2002; Igoucheva et al, Gene Ther., 8:391-399, 2001).
  • Recombineering can also be performed using double-stranded nucleic acid, or double stranded nucleic acid with a 5' and or a 3' overhang (see published PCT Application No. WO 00214495A2, which is herein inco ⁇ orated by reference).
  • WO 00214495A2 which is herein inco ⁇ orated by reference.
  • This disclosure provides methods and host cells can be used to increase the efficiency of recombineering.
  • the recombineering methodology utilizes recombination functions (e.g. phage recombination functions) under control of a de-repressible promoter to generate recombination products using homologies of at least 20 base pairs.
  • recombineering uses a cell including Beta under the control of a de-repressible promoter.
  • expression of Beta alone is under the control of the de-repressible promoter (e.g. the nucleic acid encoding Beta is operably linked to the de-repressible promoter).
  • expression of Beta, in addition to Gam and/or Exo is under the control of the de-repressible promoter.
  • RecT, P22 Erf, or Rad52 is operably linked to a de-repressible promoter.
  • DNA bound to a Beta protein is introduced into a host cell.
  • phage recombination functions can be used to introduce recombination into a target nucleic acid sequence in a host cell.
  • the host cell can be eurkaryotic or prokaryotic.
  • the host cell is a mammalian cell, a yeast cell, or a bacterial cell (e.g. E. coli).
  • the target can be on the chromosome, or can be on an extra-chromosomal element.
  • the target nucleic acid can be included in a plasmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome, a cosmid or a vector, including but not limited to a viral vector.
  • BAC bacterial artificial chromosome
  • yeast artificial chromosome a cosmid or a vector, including but not limited to a viral vector.
  • recombination is induced in a BAC strain or a BAC DNA is introduced into strain carrying recombination functions.
  • the length of the homologous sequence can be varied, hi several embodiments, the homology is at least 20, at least 25, at least 30, at least 40, at least 50, at least 75 or at least 100 nucleotides in length. However, larger regions of homology can also be utilized. Thus, in one embodiment, between about 20 and about 1,000 nucleotides of homologous sequence is utilized, or between about 40 and about 1,000 nucleotides of homologous sequence is utilized, h one specific, ⁇ on-limiting example, the ssDNA is about 20, about 25, about 30, about 40, about 50, about 75 or about 100 nucleotides in length.
  • the homologous nucleic acid is a single-stranded nucleic acid.
  • the homologous nucleic acid is a double stranded nucleic acid.
  • Double stranded nucleic acids include molecules that are completely double stranded, as well as nucleic acid molecules that have a 5' or a 3' overhang.
  • a single-stranded nucleic acid or double-stranded nucleic acid including sufficient homology to the target sequence is introduced into the host cell. "Sufficient homology" is any region of sufficient identity to the target sequence such that recombination can occur.
  • sufficient homology includes a sequence of at least 20 nucleotides in length, wherein at most five, at most three, at most two, at most one nucleotide, or no nucleotides differ from the target nucleic acid sequence. In additional embodiments, sufficient homology includes a sequence of at least 25 nucleotides in length, wherein at most five, at most three, at most two, at most one nucleotide, or no nucleotides differ from the target nucleic acid sequence. Similarly, sufficient homology can readily be determined for a nucleic acid of at least 30, at least 40, at least 50, or at least 100 nucleotides in length.
  • the single-stranded nucleic acid or double-stranded nucleic acid differs from the target nucleic acid, these differences can be clustered (i.e. at one area in the target nucleic acid) or can be scattered in the sequences (e.g. two nucleotide differences from the target sequence, wherein each difference is located at different area in the sequence.
  • sufficient homology includes about a 100%, 99%, 98%, or 97% sequence identity between the homolgous nucleic acid (e.g., the single-stranded or the double-stranded nucleic acid) and the target nucleic acid sequence.
  • sufficient homology includes at least 90% sequence identity between the single-stranded or double- stranded nucleic acid and the target nucleic acid, such as nucleic acid sequences that are at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical. It should be noted that a homologous nucleic acid sequence can differ from a target nucleic acid by substitutions, deletions, and/or additions of nucleotides.
  • the single stranded nucleic acid (or double-stranded nucleic acid) is labeled, such as with a biotinylated nucleotide, a methylated nucleotide, or a DNA adduct.
  • the homologous nucleic acid (e.g., the single-stranded nucleic acid or double-stranded nucleic acid) can be introduced into the host cell by any means known to one of skill in the art. As disclosed herein, it is advantageous that the host cell is deficient in mismatch repair.
  • a host cell "deficient" for mismatch repair can repair mismatched nucleotides at a reduced frequency as compared to a wild-type cell, such as at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% reduction in mismatch repair as compared to a wild-type cell, hi one specific, non-limiting example, mismatch repair is reduced at least 90% as compared to a wild-type cell.
  • a host cell deficient for mismatch repair can include a mutation in a nucleic acid sequence encoding a protein involved in mismatch repair, such that the protein has reduced function (or its function is eliminated).
  • the function of one or more mismatch repair proteisn can be reduced at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% as compared to the function of the protein in a wild-type cell.
  • the function of one or more mismatch repair proteins is decreased at least 80%, such as 90%, 95%, 96%, 97%, 98%, 99%, or is completely absent in the host cell deficient for mismatch repair as compared to a wild-type cell.
  • a wild-type cell is a cell of the same species that does not include a mutation in the gene encoding the protein involved in mismatch repair.
  • mismatch repair can be constitutively reduced in the host cell.
  • a cell that is deficient for mismatch repair can have a mutation in one or more nucleic acids encoding mutS, mutH, mutL, uvrD, or dam.
  • the mutS, mutH, mutL, uvrD, or dam protein produced from the mutated gene has a substantially reduced (or no) function in mismatch repair.
  • a corresponding wild-type cell does not have a mutation in the nucleic acid encoding MutS, MutH, MutL, uvrD, or dam, respectively.
  • a cell deficient for mismatch repair can also have more than one mutation or the nucleic acid encoding MutS, MutH, MutL, uvrD, or dam, or can have mutations in more than one of these genes.
  • the mutation can be an insertion, deletion, or a point mutation.
  • a prokaryotic cell deficient for mismatch repair has a mutation in a nucleic acid encoding Mut S (mutS-, or ⁇ mutS), MutH (mutH- or ⁇ mutH), MutL (mutL- or ⁇ mutL), UvrD (uvrD- or ⁇ uvrD), or Dam , (dam- or ⁇ dam), or a combination (e.g.
  • mutS-mutH- ( ⁇ mutS ⁇ mutH), mutS-mutL- ( ⁇ mutS ⁇ mutL), mutH-mutL-( ⁇ mutH ⁇ mutL), mutH-uvrD- ( ⁇ mutH ⁇ uvrD), etc.).
  • the proteins involved in mismatch repair are also known for eurkaryotic cells. Eurkaryotes have proteins with sequence similarity to MutS and MutL that are involved in a similar repair pathway.
  • the eukaryotic MutS is a dimer of MSH2 and GTBP (now known as MSH3 or MSH6) proteins.
  • Eucaryotic mutL also consists of two polypeptides, MLH1 and PMS2. Eukaryotes lack homologs of MutH and uvrD.
  • Exemplary genes encoding mismatch repair proteins are disclosed in the table shown below: Table 2 Genes encoding enzymes of mismatch repair
  • S. pornbe also has two genes encoding MutS functions (MSH2, SW14, and MSH6), two genes encoding MutL functions (MLHl and PMSl), and an EXOl gene.
  • C. eleg ⁇ ns has two genes encoding MutS function (MSH2 and MSH6), and two genes encoding MutL functions (MLHl and PMSl).
  • D. melanogaster has two genes encoding MutS function (SPELl and MSH6) and two genes encoding MutL functions (MLHl and PMS2), and the TOSCA gene.
  • thaliana has four genes encoding MutS functions (MSH2, MHS3, MSH6, MSH7), three genes encoding MutL functions (PMSl and MLH3), and two additional genes involved in mismatch repair (Q9C7N8 and AAK913436, which may be homologous to EXOl) (for review see Marti et al., J. Cell. Physiol. 191:28- 41, 2002).
  • eukaryotic host cell deficient for mismatch repair can have one or more mutations in a gene encoding mismatch repair, or can have mutations in more than one gene involved in mismatch repair.
  • the method utilizes a cell that is transiently deficient in mismatch repair.
  • a cell deficient for mismatch repair can also be a cell treated to inactivate mismatch repair for a specified period of time, hi one specific, non-limiting example, a prokaryotic cell (e.g., E. coli) can be treated with a compound, such as 2-aminopurine, to induces a reversible phenotype of DNA mismatch repair deficiency (see Matic et al., J. Bacteriol. 185:1459-1461, 2003). In another specific, non-limiting example, a cell can be treated with an effective amount of multi-copy single-stranded DNA (see Maas et al., Molec. Microbiol 19:505-509, 1996).
  • Multi-copy single-stranded DNA is a single-stranded DNA covalently linked to DNA that forms stem-loop structures. Treatment with multicopy single-stranded DNA with mismatched base pairs is known to inhibit mismatch repair. Without being bound by theory, this effect is believed to be due to a titration of MutS (see Maas et al, supra, 1996).
  • antisense, small inhibitory RNAs, ribozymes, or other nucleotide based strategies are used to induce a decrease in mismatch repair.
  • Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific American
  • nucleic acid encoding a protein involved in mismatch repair.
  • the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule.
  • the antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double- stranded.
  • Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target cell.
  • the use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal.Biochem. 172:289, 1988).
  • triplex strategy Use of an oligonucleotide to stall transcription is known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, these triplex compounds can be designed to recognize a unique site on a chosen gene (Maher et al., Antisense Res. and Dev. 1:227, 1991; Helene, Anticancer Drug Design 6:569, 1991), such as a gene encoding a protein involved in mismatch repair.
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cecil, J. Amer. Med. Assn. 260:3030, 1988). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated. There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, Nature 334:585, 1988) and "hammerhead ⁇ -type.
  • Tetrahymena-type ribozymes recognize sequences which are four bases in length, while Ahammerhead ⁇ -type ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species and 18-based recognition sequences are preferable to shorter recognition sequences.
  • a "transfected cell” or a "transformed cell” is a cell into which has been introduced, by means of recombinant DNA techniques, a nucleic acid molecule.
  • the nucleic acid molecule can be single-stranded or double-stranded (including a double-stranded nucleic acid with an overhang).
  • the introduction of a nucleic acid molecule into a host cell can be carried out by conventional techniques as are well known to those skilled in the art.
  • the host is prokaryotic, such as E. coli
  • competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method using procedures well known in the art.
  • MgCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired, or by electroporation.
  • Eukaryotic cells can also be cotransformed with DNA sequences including sequence of interest, and a second foreign DNA molecule encoding a selectable phenotype, such as neomycin resistance (see for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).
  • viral vectors include adenoviral vectors, lentiviral vectors, retro viral vectors, and pseudorabies vectors.
  • the homologous nucleic acid (e.g. the single-stranded nucleic acid or double-stranded nucleic acid) is introduced into the host cell deficient for mismatch repair, the de-repressible promoter is activated, and recombinants are generated in vivo.
  • the de-repressible promoter is PL
  • the host cell is treated with heat to induce the expression of Beta (see Copeland et al, Nature Reviews 2:769, 2001, and Ellis et al., Proc. Natl. Acad. Sci. 98:6742- 6746, 2001, which are herein inco ⁇ orated by reference).
  • the homologous nucleic acid differs from the target nucleic acid by at least one nucleotide, but is sufficiently homologous to undergo recombination with the target sequence (see above).
  • Recombinants can be detected by any means known to one of skill in the art. If recombination has occurred in a nucleic acid encoding a marker, such as a nucleic acid encoding a polypeptide involved in antibiotic resistance, detection can be performed by selection or counterselection. However, detection can also be performed by direct screening (e.g. colony hybridization or sequencing). Detection can also be performed by detecting a label on the nucleic acid (e.g. when D ⁇ A includes a D ⁇ A adduct or a marker such as biotin).
  • Fig. 1 shows is a schematic diagram of repair of a mismatch when single- stranded nucleic acid is utilized.
  • double-stranded DNA that does not include 3' or 5' overhangs is used for linear recombination, exo, bet, and gam gene products are required.
  • single stranded nucleic acid or when double-stranded nucleic acid with a 3' and/or 5' overhang is utilized, only Beta is required.
  • a DNA structure is suggested that is shown in the top of Fig. 2. In this model, a linear double-stranded DNA with flanking 3 ' single-stranded DNA overhangs is generated as an annealing intermediate with Beta bound.
  • Cells of Use Isolated host cells of use in the methods disclosed herein include a de- repressible promoter operably linked to a nucleic acid encoding a recombinase. These cells are also deficient for mismatch repair.
  • the cell is constitutively deficient for mismatch repair.
  • the cell can be a eukaryotic cell or a prokaryotic cell.
  • the cell is a bacterial cell, such as a gram positive or a gram negative bacterial cell.
  • the bacteria is a gram negative bacteria, such as an enteric bacteria (e.g. E. coli).
  • the cell is a eukaryotic cell.
  • the cell can be a yeast cell or a mammalian cell, other specific, non-limiting examples, the cell can be a S. cerevisiae cell, and S. pornbe cell, a C. elegans cell, a D. melanogaster cell, an A. thaliana cell, a murine cell, or a human cell.
  • the cell has a mutation in a gene encoding a protein of mismatch repair (see Table 2), in addition to including a de-repressible promoter operably linked to a nucleic acid encoding a recombinase.
  • Mutations in a gene encoding the mismatch repair protein can be made or selected by any means known to one of skill in the art. Methods for introducing a mutation in a gene, or for "knocking out" a gene are known for both prokaryotic and eurkaryotic cells (see for example, Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed.
  • transgenic ⁇ includes any transgenic technology familiar to those in the art which can produce a cell or an organism carrying an introduced transgene or one in which an endogenous gene has been rendered non-functional or knocked out.
  • a specific mutation is introduced into a mismatch repair gene in the host cell.
  • the entire gene may be deleted.
  • a disruption or deletion in a gene encoding a protein involved in mismatch repair may be accompanied by insertion of or replacement with other DNA sequences, such as a nucleic acid encoding a selectable marker (such as, but not limited to, an nucleic acid conferring resistance to an antibiotic).
  • the host cell includes a DNA antisense to the coding sequence for the nucleic acid encoding the mismatch repair protein, or a ribozyme that specifically targets the nucleic acid encoding a mismatch repair protein.
  • a gene encoding mismatch repair is disrupted by homologous targeting in a eurkaryotic cell.
  • a eurkaryotic cell include lower organisms such as yeasts, slime molds, and the like, as well as cells from multicellular organisms such as invertebrates, vertebrates, and mammals.
  • Suitable cells include, but are not limited to, stem cells such as hematopoietic progenitor cells, hematopoietic stem cells, and embryonic stem cells. Suitable cells also include differentiated cells, including tumor cells and cell lines.
  • the cell can be a terminally differentiated cell, such as a differentiated cell from any organ, including but not limited to cells from the circulatory system, respiratory system, reproductive system, lymphoid organs, excretory system. These include cells in a variety of tissue types, such as: endothelial cell, smooth muscle cell, epithelial cell, hepatocyte, cells of neural crest origin, tumor cell, hematopoietic cell, lymphoid cell, T cell, B cell, monocyte, macrophage, dendritic cell, fibroblast, keratinocyte, neuronal cell, glial cell, adipocyte, myoblast, myocyte, chondroblast, chondrocyte, osteoblast, osteocyte, osteoclast, secretory cell, endocrine cell, oocyte, and spermatocyte.
  • tissue types such as: endothelial cell, smooth muscle cell, epithelial cell, hepatocyte, cells of neural crest origin, tumor cell, hematopoi
  • the cell is a prokaryotic cell.
  • the cell is a gram negative bacteria, such as, but not limited to, an enteric bacteria.
  • the cell is an E. coli cell that is deficient for mismatch repair and includes a nucleic acid encoding a single-stranded binding protein, operably linked to a de-repressible promoter.
  • the single-stranded binding protein is Beta.
  • the cell can optionally also include a nucleic acid sequence encoding Exo and/or Gam.
  • the bacterial cell can be generated using a mini-lambda (see PCT WO 00/214495 A2, which is herein inco ⁇ orated by reference).
  • the host cell is deficient for mismatch repair and includes a mini- lambda.
  • the cell is an isolated bacterial cell comprising a defective lambda prophage of genotype ⁇ cI857 ⁇ (cro-bioA), wherein the bacterial cell further comprises a mutation in at least one nucleic acid ⁇ sequence encoding a mismatch repair polypeptide.
  • a de-repressible promoter operably linked to a nucleic acid encoding a recombinase e.g.
  • the bacterial cell also includes a mutation in one or more of MutS, MutH, MutL, uvrD, and/or dam.
  • Methods for introducing mutations in a bacterial cell are well known in the art (e.g. see Yu et al. Proc. Natl Acad. Sci. USA 97:5978-5983, 2000, herein inco ⁇ orated by reference), and exemplary methods are disclosed in the examples section below).
  • the isolated bacterial cell can have mutations in two or more of these genes.
  • a prokaryotic cell deficient for mismatch repair has a mutation in two or more of MutS (MutS-), MutH (mutH), MutL (mutL-), uvrD (uvrD-), or dam (dam-), for example, the cell is an isolated bacterial cell having a MutS-MutH-, MutS-MutL-, MutH-MutL-, or a MutH-uvrD-, genotype.
  • suitable host cells can also include mutations in additional genes that encode polypeptides with a dam methylase function.
  • the host cell includes mutation in a gene encoding a polypeptide with a dam methylase function (that is not dam), one or more mutations in MutS, MutH, MutL, or uvrD, and/or dam.
  • the host cell includes a mutation gene encoding a polypeptide with a dam methylase function that is not dam, and a mutation in dam.
  • the bacterial cell can be derived from HME6, DY380 or a DY330 cell, such that a mutation is introduced into a gene encoding a protein involved in mismatch repair.
  • One of skill in the art can readily produce these cells using known methods. The generation of several exemplary cells, and the genotype of these cells, is disclosed in the Examples section below (e.g., see Tables 3 and 7).
  • Exemplary bacterial strains have been deposited as ATCC NO. (HME6)
  • HME62 MotL
  • HME64 uvrD
  • the lambda Red recombination system has been extensively used to modify the bacterial chromosome with single-strand oligonucleotides (ss oligo). As shown previously, a strand bias of the ss oligo can be demonstrated with regards to chromosome replication but not to transcription direction. Both the host MMR system and sequence of the single-strand oligonucleotide play an important role when a single base change is repaired.
  • Single-strand DNA oligonucleotides have been used to modify the chromosome in both yeast and E. coli (Ellis et al., Proc. Natl. Acad. Sci. USA
  • the lambda Red recombination system has been used with ss oligos to create mutations, to correct single base mutations, to create deletions, and to remove large heterologies from the E. coli chromosome.
  • the ⁇ Red system includes the Beta, Exo and Gam proteins.
  • recombination with ss oligos requires only the Beta function. Oligos with homologies as short as 20 bases can be used to recombine in E. coli and as little as 10 ng of oligo yields saturating levels of recombinants (Ellis et al., supra).
  • the oligo corresponding to either of the two complementary strands carrying that allele can be used to initiate recombination.
  • there was a marked strand bias for one of the two complementing oligos used as a recombination substrate (Ellis et al., supra). This strand preference appeared to be correlated to the direction of DNA replication through the region being recombined; the direction of transcription through the allele did not appear to cause the bias.
  • the primary bias observed is not caused by transcription but is determined by the direction of DNA replication.
  • Beta-mediated recombination with a ss oligo is likely to be directed to a single-strand region of the chromosome.
  • a DNA replication fork provides an ideal area of the chromosome with exposed single- strand regions. The strand bias observed for oligo recombination is dependent upon replication direction. The oligo that corresponds in sequence to Okazaki fragments generates the highest efficiency. Such oligos are referred to herein as the lagging strand oligo and their complement as the leading strand oligo with reference to the replication fork.
  • HME6 is HME5 galKtyrl45UAG
  • HME31 is HME5 galKOcat-sacB
  • HME41 is HME6 with the entire gal operon inverted without inverting the adjacent genes. These strains have previously been described (Ellis et al., supra). HME6, HME31, and HME41 were made recA ' by PI transduction to move in ⁇ srl- recA::TnlO.
  • Host MMR genes mutH, mutL, mutS, uvrD, and darn were inactivated by inserting PCR generated antibiotic resistant cassettes in place of the coding region of each gene (see Table 3 below).
  • Either a kanamycin or ampicillin resistance cassette was amplified by PCR using oligos that contained at their 5' ends 45-55 bases of homologies to the target MMR gene.
  • the PCR cassettes with flanking homologies were used for recombination (Yu et al., Proc. Natl. Acad. Sci. USA 97:5978-5983, 2000); recombinants were selected for antibiotic resistance and tested by analytical PCR. Once the substitution was confirmed, it was moved by PI transduction into the appropriate strains.
  • the cell pellets were then resuspended in sterile water (50 ⁇ l) and transformed with DNA by electroporation at 1.75 kV, 25 mF using the E. coli Pulser (BIO-RAD).
  • LB-media (1 ml) was added then the cells were incubated at 32°C for 1.5 hours with shaking, before being spread onto the appropriate selective LB-agar media plates or minimal galactose (see Ellis et al., Proc. Natl Acad. Sci. USA 98:6742-6746, 2001).
  • Materials Oligonucleotides and PCR primers were supplied by Invitrogen as salt free but otherwise not purified. All ss oligos used to correct the galK mutations were 70 bases in length.
  • Oligo 100 which corrects the TAG stop to a T rtyrosine codon is: 5' AAGTCGCGGTCGGAACCGTATTGCAGCAGCTT 4ICATCTGCCGCTGGAC GGCGCACAAATCGCGCTTAA 3 ' (SEQ ID NO: 11 ).
  • Oligo 101 is the complementary strand to 100.
  • Oligos 144 and 145 were identical to 100 and 101 respectively except that they correct the TAG stop to a T AC tyrosine codon.
  • the detailed sequence of these ss oligos around the g ⁇ lK amber stop is shown in Example 2.
  • Taq polymerase HiF and Concert Rapid PCR purification kits were supplied by Invitrogen.
  • Plasmid construction, p(+)mKan and p(-)mKan DNA inserts for the plasmid constructs were amplified by PCR with Expand High-fidelity polymerase using primers containing restriction enzyme sites suitable for cloning. All inserts were sequenced to check for possible mutations introduced by PCR.
  • Primers mKan- 1 : 5'-GGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTAGGACTG-3', SEQ ID NO: 12 and mKan-2 5'-TATTCGGCAAGCAGGCATCG-3', SEQ ID NO: 13 were used to amplify a 559 bp fragment from plasmid pGK-frt.
  • the Eagl-Nc ⁇ l digested 559 bp PCR fragment was then ligated into the 4,287 bp Eagl-Ncol fragment from pGK-frt to form pmKan.
  • the purified EcoRl-Cl ⁇ l fragment from pmKan was ligated to the 2942 bp EcoRl-Cl ⁇ l fragment of pBSKS and pBSSK to form p(+)mKan and p(-)mKan , respectively.
  • the purified PCR fragment which contained the mKan gene and an Amp selectable marker flanked by two regions homologous to the chromosomal target, was inserted into DY380 via Red-mediated homologous recombination as described previously (Yu et al. Proc. Natl Acad. Sci. USA 97:5978-5983, 2000; Ellis et al., Proc. Natl Acad. Sci. USA 98:6742-6746, 2001).
  • the recombination event inserts the drug cassettes between the ⁇ prophage cro gene and the bioA gene adjacent to the prophage (see Lee et al., Genomics 73:56-65, 2001).
  • ⁇ > indicates a replacement generated by recombineering technology.
  • (cro- bio A) ⁇ > tet indicates the substitution of cro- bio A with tet.
  • b mKan-Amp r and Amp r -mKan indicates that the mKan gene has been inserted in opposite directions in the two DY380 or DY330 strains.
  • c JNgal indicates that the gal gene has been inserted in opposite directions in the HME6 strain.
  • Oligo 100 and its complement 101 are designed to correct the galK, yr i 45am to the original T r tyrosine codon. Two other oligos are also made to correct the galK mutation but to a different tyrosine codon; Oligo 144 and its complement 145 create a TAC tyrosine codon (see below).
  • the frequency of Gal+ recombinants with Oligo 144 was 4.7x10 7 , approximately 100-fold greater than for Oligo 100, which is identical except for the one base difference in the tyrosine codon.
  • the frequency recombinants with Oligo 145 was similar to that of Oligo 101.
  • Oligo 144 and Oligo 145 correct galKOcat-sacB with the same efficiency as Oligo 100 and Oligo 101, respectively.
  • Oligo 144 yields a dramatic increase in recombinant yield with the point mutant but the same enhanced effect is not provided during recombination with the c ⁇ t-s ⁇ cB heterology containing the 3.3kbp insertion in g ⁇ lK.
  • This result suggests that the pairing difference of Oligo 100 and Oligo 144 with the complementary strand of the g ⁇ lKty r i 45 ⁇ m mutation might generate the differences in recombination efficiency observed.
  • the Oligo 100 TAT sequence generates a T/C mismatch whereas the Oligo 145 TAC sequence generates a C/C mismatch.
  • the MutS protein of the methyl- directed mismatch repair (MMR) system binds and corrects T/C as well as most other single base mismatches but does not bind and correct C/C mismatches. This suggests that C/C mismatch can be used to generate changes in a target nucleic acid sequence by homologous recombination using this system.
  • the MMR system does not recognize mismatches created between large heterologies like those expected for c ⁇ t-s ⁇ cB repair by the oligos.
  • a Dam methylase mutant was also tested that was created (damOamp).
  • damOamp In the HME6 damOamp strain only a 10-fold increase in recombination efficiency was observed relative to HME6. In other mismatch repair mutants there is a 100- fold effect. This suggests that there is a redundancy in recognizing the parental strand. Additional mutations in proteins involved in this recognition could also be used to increase recombination frequency. Comparable increases in efficiency were also seen when the complementary Oligo 101 was used. However, the MMR deficient strains did not show a difference in recombination frequency when either Oligo 100 or 101 was used to remove the large heterology, cat-sacB.
  • Example 4 Replication bias is independent of oligo sequence and deletion of mutS gene product eliminates oligo sequence bias
  • each oligo gives a higher recombination frequency when it acts as the lagging strand oligo irrespective of the presence or absence of the MMR system.
  • Beta alone in a strain defective for the exo and gam genes gave the same number of recombinants in both mut+ and mutS strains when the ssDNA corresponded to the lagging strand, whereas the when the ssDNA corresponded to the leading strand slightly lower recombination levels for Beta without Exo and Gam were detected.
  • MMR mismatch repair
  • An ss oligo is capable of correcting either the galKty r i 45mn or galK ⁇ >cat- sacB.
  • the lagging strand oligo (Oligo 100) was used to correct the galK t y rl45am of HME6, there were 3.5xl0 5 recombinants per 10 8 cells surviving the electroporation.
  • This same oligo was also capable of removing a 3.3kb cat-sacB heterology, from HME31with nearly the same rate - 8.6xl0 4 recombinants per 10 8 survivors.
  • the ability of a leading strand oligo (Oligo 101) to correct the same lesions was tested. The efficiency of recombination was reducedl 0-fold for both HME6 and HME31.
  • strains can be utilized that include one or more mutations in the MMR system, such as, but not to mutS, mutH, uvrD, dam, and/or mutL genes. These strains are disclosed herein, as are methods to maximize recombination frequency using SSO or double stranded DNA in these strains.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des méthodes permettant d'induire une recombinaison homologue dans une cellule hôte qui comprend un acide nucléique cible, au moyen d'une molécule d'acide nucléique à brin unique. Ladite molécule présente un nombre suffisant de nucléotides homologues à l'acide nucléique cible, de façon à permettre une recombinaison homologue avec l'acide nucléique cible. Ladite cellule hôte comporte un promoteur dé-répressible lié fonctionnellement à un acide nucléique codant une protéine de liaison à brin unique et elle est déficiente pour la réparation des appariements. Cette invention a aussi trait à des cellules hôtes isolées utilisées avec cette méthode.
PCT/US2003/014657 2003-05-09 2003-05-09 Cellules hotes deficientes pour la reparation des appariements WO2004106513A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU2003228972A AU2003228972A1 (en) 2003-05-09 2003-05-09 Host cells deficient for mismatch repair
PCT/US2003/014657 WO2004106513A1 (fr) 2003-05-09 2003-05-09 Cellules hotes deficientes pour la reparation des appariements
US10/841,125 US7521242B2 (en) 2003-05-09 2004-05-07 Host cells deficient for mismatch repair and their use in methods for inducing homologous recombination using single-stranded nucleic acids

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2003/014657 WO2004106513A1 (fr) 2003-05-09 2003-05-09 Cellules hotes deficientes pour la reparation des appariements

Publications (1)

Publication Number Publication Date
WO2004106513A1 true WO2004106513A1 (fr) 2004-12-09

Family

ID=33488745

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/014657 WO2004106513A1 (fr) 2003-05-09 2003-05-09 Cellules hotes deficientes pour la reparation des appariements

Country Status (2)

Country Link
AU (1) AU2003228972A1 (fr)
WO (1) WO2004106513A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020013956A1 (en) * 1996-04-01 2002-01-31 Rhona Harriet Borts Meiotic recombination in vivo of partially homologous dna sequences
WO2002014495A2 (fr) * 2000-08-14 2002-02-21 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Renforcement de la recombinaison d'homologues par médiation des protéines de recombinaison $g(l)
US20020151059A1 (en) * 1995-07-26 2002-10-17 Te Riele Henricus Petrus Joseph Homologous recombination in mismatch repair inactivated eukaryotic cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020151059A1 (en) * 1995-07-26 2002-10-17 Te Riele Henricus Petrus Joseph Homologous recombination in mismatch repair inactivated eukaryotic cells
US20020013956A1 (en) * 1996-04-01 2002-01-31 Rhona Harriet Borts Meiotic recombination in vivo of partially homologous dna sequences
WO2002014495A2 (fr) * 2000-08-14 2002-02-21 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Renforcement de la recombinaison d'homologues par médiation des protéines de recombinaison $g(l)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZAHRT ET AL.: "Barriers to recombination between closely related bacteria: MutS and RecBCD inhibit recombination between Salmonella typhimurium and Salmonella typhi", PROC. NATL. ACAD. SCI. USA, vol. 94, September 1997 (1997-09-01), pages 9786 - 9791, XP002974224 *

Also Published As

Publication number Publication date
AU2003228972A1 (en) 2005-01-21
AU2003228972A8 (en) 2005-01-21

Similar Documents

Publication Publication Date Title
JP6839082B2 (ja) 環状ポリヌクレオチド修飾鋳型と組み合わせてガイドｒｎａ／ｃａｓエンドヌクレアーゼ系を用いるｅ．コリ（ｅ．ｃｏｌｉ）での効率的な遺伝子編集のための組成物および方法
JP7423520B2 (ja) Ｃａｓ９ベースノックイン方針の効力を改善するための組成物及び方法
JP4139561B2 (ja) 新規ｄｎａクローニング方法
Ao et al. A multiplex genome editing method for Escherichia coli based on CRISPR-Cas12a
Court et al. Mini-λ: a tractable system for chromosome and BAC engineering
CN109072207A (zh) 用于修饰靶核酸的改进方法
WO2016205623A1 (fr) Méthodes et compositions pour l'édition de génome dans des bactéries à l'aide de systèmes cas9-crispr
JP7308380B2 (ja) 遺伝子編集技術を用いたインビトロ部位特異的変異導入のための方法
AU2001283377A1 (en) Enhanced homologous recombination mediated by lambda recombination proteins
EP1311661A2 (fr) Renforcement de la recombinaison d'homologues par m diation des prot ines de recombinaison $g(l)
CN106995813A (zh) 基因组大片段直接克隆和dna多分子组装新技术
US7521242B2 (en) Host cells deficient for mismatch repair and their use in methods for inducing homologous recombination using single-stranded nucleic acids
WO2011116184A2 (fr) Procédés et compositions pour mutagenèse ciblée dans des bactéries
JP7250349B2 (ja) 細胞の有する二本鎖ｄｎａの標的部位を改変する方法
US20030017594A1 (en) RecT or RecET cloning and subcloning method
WO2004106513A1 (fr) Cellules hotes deficientes pour la reparation des appariements
WO2001009351A1 (fr) Nouveaux vecteurs et systeme d'integration ciblee selectionnable de transgenes dans un chromosome sans marqueurs de resistance aux antibiotiques
Penewit et al. Recombineering in Staphylococcus aureus
AU2002313350B2 (en) Novel DNA cloning method
Kabir et al. Transformation of signal sequence in Escherichia coli by reporter gene fusion

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP