WO2004101818A1

WO2004101818A1 - Detecting method of the schizophrenia susceptible gene and use

Info

Publication number: WO2004101818A1
Application number: PCT/CN2003/000367
Authority: WO
Inventors: Dai Zhang; Jianzhong Yang
Original assignee: Institute Of Mental Health, Peking University
Priority date: 2003-05-19
Filing date: 2003-05-19
Publication date: 2004-11-25
Also published as: CN100342032C; AU2003231562A1; CN1771332A

Abstract

The invention relates to a detecting method of the schizophrenia susceptible gene FZD3 gene polymorphism and detecting method of the tester schizophrenia susceptible in vitro and the schizophrenia susceptible gene FZD3 gene and use. The invention relates to a detecting method of the schizophrenia susceptible gene by polymerase chain reaction - direct sequencing and /or polymerase chain reaction - restriction fragment length polymorphism analytical method detecting FZD3 gene sequence in vitro, which include the rs2241802 polymorphism site, rs2323019 polymorphism site and /or rs352203 polymorphism site. The invention fulfil the need of recognition schizophrenia susceptible gene in correct, for going deep into study the schizophrenia.

Description

Method for detecting susceptibility genes of schizophrenia, susceptibility genes and uses

The present invention relates to a method for detecting susceptibility genes of schizophrenia, a method for detecting susceptibility to schizophrenia in a tester, and a schizophrenia susceptibility gene and use in vitro. Specifically, the present invention relates to a schizophrenia susceptibility gene FZD3 gene polymorphism Methods for detecting sexual loci, methods for in vitro detection of schizophrenia susceptibility in test subjects, and schizophrenia susceptibility gene FZD3 gene and uses. Background technique

According to the statistics of the Ministry of Health of China at the end of 1999, according to the life years index adjusted by disability, the proportion of various diseases in the social burden of diseases in China is evaluated. Mental illness accounts for about one-fifth of the total disease burden. It has surpassed cardiovascular, respiratory and malignant diseases, ranking first. The incidence of schizophrenia is second only to depression, and it ranks second in overall mental illness. Symptoms of schizophrenia include: disordered thinking, fantasies, and changes in mood and action. Over the past century, people have observed the physiology, biochemistry, imaging, drug treatment, social family, environment and other aspects of mental illness, and made various hypotheses and inferences about the pathogenesis of mental illness. With the advancement of science and technology, people increasingly realize that genetic defects are an important cause of many serious mental illnesses. When people encounter psychological and social environmental stress, those who carry disease-susceptible genes are more likely than those who do not. Of people are more likely to suffer from mental health disorders. The genetic factors are also basically supported by the epidemiological survey results of pedigrees, twins and fosters. In the late 1980s, the large-scale survey of the genetic epidemiology of mental illness more fully showed the genetic basis of mental illness. With the development of science and technology today, how to detect susceptible genes and individual disease susceptibility from a genetic perspective on mental disorders, especially schizophrenia, so that further risk prediction and diagnosis can be performed, which has become a problem facing the majority of scientific and technical personnel and medical and health personnel. Serious problem. Although research on disease susceptibility genes has been carried out for many years at home and abroad, Breakthroughs and few valuable research results. For the identification of genetic susceptibility genes and the genetic susceptibility of testers, there has been a lack of a comprehensive, systematic and effective identification method in the field, and there are fewer research results on susceptibility to schizophrenia. Recent genome scan results suggest that 8p22-21 is one of the susceptible areas for schizophrenia.

FZD3 gene is located at 8p21, genbank accession number: GI: 22047956, with a total length of 70187bp, and is an important receptor in the signaling system. Summary of the Invention

In view of the above problems, the present invention provides a method for detecting susceptibility genes in schizophrenia, thereby satisfying the need in the art for correctly identifying susceptibility genes in schizophrenia, for in-depth research and prevention of schizophrenia, and even in diagnosis and treatment. Provides new ideas.

The invention also provides a method for detecting susceptibility to schizophrenia in a test subject in vitro. The invention also provides a kit for detecting susceptibility genes of schizophrenia.

In another aspect, the present invention further provides a schizophrenia susceptibility gene.

The invention further provides the application of a method for in vitro detection of schizophrenia-susceptible genes in the prevention, diagnosis and treatment of schizophrenia.

The invention also provides the application of a method for detecting susceptibility to schizophrenia in a tester in vitro in the risk prediction, diagnosis and treatment of schizophrenia.

The invention also provides the application of a kit for detecting susceptibility to schizophrenia in the prevention, diagnosis and treatment of schizophrenia.

'Finally, the present invention also provides the use of the schizophrenia susceptibility gene of the present invention in the prevention, diagnosis and treatment of schizophrenia. Through statistical analysis of large samples, the present invention studies the allele frequencies of rs 2241802, rs 2323019, and rs 35 ² 203 polymorphic loci in the FZD3 gene sequence in the core pedigree of schizophrenia. Transmission in children, test for transmission imbalances (TDT) and haplotype analysis. It was found that the genotype distribution and allele frequency of all samples accorded with Hardy-Weinburg equilibrium; after correction by Bonferroni method, TDT analysis of three polymorphic sites still had significant statistical significance; single haplotype Analysis also showed that GAT haplotypes were transmitted too much in patients, and the differences were significant; thus it was experimentally proven that the rs2241802, rs2323019, and / or rs 352203 polymorphisms of the FZD3 gene sequence affect the susceptibility to schizophrenia Among the subjects in the FZD3 gene sequence, the rs2241802 polymorphism site was G, and the rs2323019 polymorphism site was A and / or the rs 352203 polymorphism site was T. Those who had a high susceptibility to schizophrenia.

Therefore, the present invention provides a method for detecting susceptibility genes in schizophrenia, which method comprises using a polymerase chain reaction-direct sequencing method and / or a polymerase chain reaction-restriction fragment length polymorphism analysis method in vitro The FZD3 gene sequence was detected, including rs2241802 polymorphism site, rs2323019 polymorphism site and / or rs 352203 polymorphism site.

The so-called "gene polymorphism" refers to the differences in the nucleotide sequences of individual genes in a population. Those of ordinary skill in the art know that the polymorphism site in the present invention is a single nucleotide polymorphism (SNP) site, that is, a single nucleotide in a genomic sequence is changed; the difference in the nucleotide sequence can be It is reflected at the DNA level or the RNA level, so polymorphisms can be detected by detecting DNA and RNA, preferably DNA, and more preferably genomic DNA.

Those skilled in the art know that a variety of techniques can be used to detect polymorphic sites of the FZD3 gene sequence in vitro at the DNA level. Point polymorphisms can be identified by hybridization with radiolabeled antisense RNA or DNA probes to the amplified DM sequence. It is also possible to synthesize normal and polymorphic PCR primers based on changes in the known nucleotide sequence, and add fluorescently labeled nucleotides to the substrate of the polymerase chain reaction (PCR reaction). With or without the presence of fluorescence, determine if there are any base changes in the primers used for amplification, and thus detect polymorphisms. Direct sequencing of DNA can directly reveal sequence differences between control genes and polymorphic genes. When combined with PCR, the sensitivity of this method is greatly improved. For example, sequencing primers are used with double-stranded PCR products or single-stranded template molecules produced by asymmetric amplification methods. Various DNA and DNA The nucleotide sequence of the fragment can also be determined by conventional methods such as dideoxy chain termination (Sanger et al., PNAS, 1977, 74: 5463-5467). In addition, nucleotide sequencing can also be performed using commercial sequencing kits or automated sequencers. Conventional automated sequencing methods use radioactive or fluorescent labels to determine nucleic acid sequences.

Due to gene polymorphisms, restriction endonuclease restriction sites change, disappear or generate new sites. If genomic DNA is digested with a restriction enzyme, the digestion results in a different length from the normal genome. The position and size of these DM fragments can be detected by hybridization detection with appropriate probes. The principle of the polymerase chain reaction-restriction fragment length polymorphism analysis (PCR-RFLP) method is: When designing a PCR amplification experiment, the primers are located on both sides of the gene polymorphism site, and the target gene is now amplified. It makes it easy to detect. Because the existing restriction endonuclease sites change due to the polymorphism, you can first digest the amplified product with the corresponding restriction enzyme, and then observe it by agarose gel electrophoresis. Judge the size or number of fragments with normal controls. In the present invention, a polymer chain reaction-direct sequencing method and a polymerase chain reaction-restriction fragment length polymorphism analysis method are preferably used. The polymerase chain reaction-restriction fragment length polymorphism analysis method is more preferred. In one embodiment of the present invention, a method for detecting a schizophrenia susceptible gene using a polymerase chain reaction-restriction fragment length polymorphism analysis method, the polymorphism analysis method includes:

A: After extraction, design PCR primers near the rs2241802, rs2323019 and / or rs352203 polymorphic sites to perform PCR reactions;

'B: Restriction endonuclease digestion for the above polymorphic sites;

C: gel electrophoresis separation and identification of digestion results;

Among them, the rs2241802 polymorphism site, the rs2323019 polymorphism site and the rs352203 polymorphism site are susceptibility alleles of schizophrenia.

The method for detecting susceptibility genes in schizophrenia according to the present invention may further include After morphological analysis, transmission disequilibrium test was used to analyze the transmission frequency of FZD3 allele and haplotype transmission frequency. Significant differences were susceptibility genes for schizophrenia. As described in Example 1, the present invention haplotypes 3 single nucleotide polymorphism sites in 246 families (each of which contains blood relatives, parents and 1 affected child / female). Frequency analysis. The results showed that after Bonferroni correction, the TDT analysis of the three polymorphic loci was still statistically significant (Rs 2241802: X ² = 18. 028, P = 0. 00002; Rs 2323019: X ² = 13 018, P = 0. 0003; Rs 352203: X ² = 20. 260, P = 0. 000007) ₀

The present invention also provides a method for detecting genetic susceptibility to schizophrenia in a test subject in vitro. The method is to detect a test subject's FZD3 gene sequence rs2241802, rs2323019 and / or rs 352203 polymorphism site, among which rs2241802 polymorphism site Subjects with a G and / or rs2323019 polymorphism locus of k and / or an rs 352203 polymorphism locus of T were subjects with high susceptibility to schizophrenia.

The "genetic susceptibility" referred to here refers to the genetically determined suscept ibi li ty that is susceptible to a certain type of disease, which is often called "dia shield" in the past, (dia thes is) The existence of genetic susceptibility genes is the basis of genetic susceptibility. When people encounter psychological and social environmental stress, those who carry the susceptibility gene for schizophrenia are more likely to suffer from schizophrenia than those who do not. Illness.

Samples containing the FZD3 gene sequence to be tested can be obtained from cells from subjects, such as cells from blood, urine, saliva, gastric juice, hair, biopsies and autopsy materials. Preferably from blood.

Through the statistical analysis of the large sample of the present invention, the method of the present invention can be used alone, that is, detecting the test-risk person FZD3 gene sequence polymorphism to detect the genetic susceptibility of related schizophrenia. At the same time, those skilled in the art know that schizophrenia The occurrence and development of the disease are the result of the combined effect of multiple factors, and genetic susceptibility has its own complexity. Therefore, the present invention can also be used in combination with other methods to achieve the purpose of detecting susceptibility to schizophrenia.

The method for detecting genetic susceptibility to schizophrenia in a tester provided by the present invention in vitro The methods for detecting the polymorphisms of the FZD3 gene sequences rs2241802, rs2323019, and rs 352203 can use the methods for detecting the polymorphic loci of the gene sequence, such as a direct sequencing method and a restriction fragment length polymorphism analysis method. A polymerase chain reaction-direct sequencing method, a polymerase chain reaction-restriction fragment length polymorphism analysis method are preferred, and a polymerase chain reaction-restriction fragment length polymorphism analysis method is more preferred.

In one embodiment of the present invention, a polymerase chain reaction-restriction fragment length polymorphism analysis method is used to detect susceptibility to schizophrenia in a test subject, wherein the polymorphism analysis method includes:

A: This is the DNA of the test taker. Design PCR primers near the rs2241802, rs2323019, and / or rs 352203 polymorphism sites to perform PCR reactions.

B: Aiming at the above polymorphic sites, restriction enzymes are used for digestion;

c: Separation and identification of digestion results by cross-electrophoresis. The present invention also provides a kit for detecting susceptibility to schizophrenia. The kit contains one or more containers containing one or more components for detecting the FZD3 gene sequence rs2241802, rs2323019 and / or rs 352203 polymorphism loci. Depending on the specific detection method and detection of polymorphic sites, the kit may contain different components. It can also provide information about the manufacture, use, and sale of drugs or biological products that have been reviewed by government drug regulatory agencies. Components containing polymorphic chain-restriction fragment length polymorphism analysis methods to detect FZD3 gene sequences rs2241802, rs2323019 and / or rs 352203 polymorphism sites are preferred:

'1) Primers that amplify rs2241802, rs2323019 and / or rs 352203 polymorphic sites;

2) PCR amplification enzymes, restriction enzymes corresponding to the digested polymorphic sites, and corresponding buffers;

3) dNTP;

4) a map of the polymorphic site.

Those of ordinary skill in the art know that the primers for amplifying polymorphic sites can be based on Known nucleotide sequence design, usually 15-30 bases, GC content is 45% -50 ° /. Left and right, and specifically bind to the template at an appropriate temperature, which can be designed using a special computer program, for example (0LIG0. 04 primer analysis software). As shown in Example 1 of the present invention, an amplification primer is provided:

The Tag DNA polymerase may be Klenow fragment, Tth DNA polymerase, VENT DNA polymerase and other enzymes that can be used for PCR amplification. Restriction enzymes corresponding to restriction enzyme polymorphism sites can be designed by those skilled in the art according to known techniques. For example, the restriction enzymes Alul, Sspl, Nlall as described in Example 1 can be used. l. After the restriction enzyme is determined, the corresponding endogram is also determined accordingly. The present invention also proposes a schizophrenia susceptibility gene, which is a FZD3 gene sequence and has an rs2241802 polymorphism site and / or an rs2323019 polymorphism site and / or an rs 352203 polymorphism site. The polymorphism of the FZD3 gene of the present invention can be expressed at the MA level or the RNA level. DNA is preferred, and genomic DNA is more preferred.

The invention also provides the application of a method for detecting the susceptibility of schizophrenia in vitro in the prevention and diagnosis of schizophrenia.

The invention also provides a method for in vitro detection of schizophrenia susceptibility genes in test subjects, and its application in prediction, diagnosis and treatment of schizophrenia risk.

The invention also provides the application of a kit for detecting susceptibility to schizophrenia in the prevention, diagnosis and treatment of schizophrenia. Finally, the present invention also provides the application of the schizophrenia susceptibility gene of the present invention in the prevention, diagnosis and treatment of schizophrenia. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the gene schematic diagram of the FZD3 gene, where the black bars represent exons, the white bars represent introns, and the arrows indicate the locations of the single nucleotide polymorphism sites (SNPs).

Figure 2 shows a flow chart for detecting susceptibility to schizophrenia in a test subject using a polymerase chain reaction-restriction fragment length polymorphism analysis method.

Figure 3 illustrates the restriction map of polymorphic site rs2241802, where 1 is a 100bp molecular weight standard (marker), 2 is a 307 homozygote, 3 is a 124/183 homozygote, and 4 is a 124/183/307 heterozygote. .

Figure 4 shows the restriction map of polymorphic site rs 2323019, where 1 is 321 homozygotes, 2 is a 100bp molecular weight marker (3), 3 is 131/190/321 heterozygotes, and 4 is 131/190 homozygotes. .

Figure 5 shows the restriction map of polymorphic site rs 352203, where 1 is a 100bp molecular weight marker (2), 120/294/414 heterozygotes, 3 is 120/294 homozygotes, and 4 is 414 homozygotes. . detailed description

'' Example 1

Research object

The study objects at this stage were all patients treated in the outpatient and inpatient department of the Institute of Mental Health of Peking University from 2001 to 2002. After combining the samples from the previous stage, there were 246 core families of schizophrenia (each of which contains blood) The parents of the relationship and 1 sick child / female) were Han. All patients meet the spirit of the International Classification of Diseases Manual 10th Edition (ICD-10) The diagnostic criteria for schizophrenia and structured clinical interviews. Among the patients, there were 138 males (56 ° / °) and 108 females (44%). The average age was 29 years. The average course of disease was 5 years.

All subjects signed informed consent. The study was approved by the ethics committee of the Peking University School of Medicine.

Method

Polymorphic alcohol chain reaction-restriction fragment length polymorphism (PCR-based RFLP) analysis was used to detect the genotypes of rs 2241802, rs 2323019 and / or rs 352203 polymorphisms in all subjects. The process is shown in Figure 2.

2.1 Collection and processing of blood samples

All patients took 5-1 Oml of peripheral venous blood, placed them in anticoagulation tubes, and stored them in a refrigerator at 4 ° C. Genomic DNA was extracted within 1 week.

2.2 Extraction and identification of genomic DNA

2.2.1 Extraction of genomic DNA

In the previous stage of genomic DNA extraction, 5 ml of blood was required, and some blood was not stored frozen. In order to reduce the amount of blood, genomic DNA extraction and purification kit (Shanghai Huashun Biological Engineering Co., Ltd., blood genomic DNA extraction and purification kit) was used for extraction at this stage. The method is as follows: 1ml of fresh whole blood containing anticoagulant is added to a 5ml centrifuge tube, and 3ml of pre-chilled 1 * BP (erythrocyte lysate) solution is added, and the centrifuge tube is inverted upside down to thoroughly mix the hooks. After 10 minutes in an ice bath, centrifuge at 4500g for 2 minutes, completely aspirate the upper liquid, and add 1 ml of pre-chilled 1 * BP (erythrocyte lysate) solution to the centrifuge tube. After thoroughly mixing the hooks, centrifuge at 4500g for 2 minutes to completely aspirate the upper liquid. Add 200 μ1 of DT (suspension) solution to the pellet and shake thoroughly. Add 400μ1 DL (lysate) solution and 25μ1 protease K, quickly shake and mix, incubate at 65 ° C for 15 30 minutes, invert the centrifuge tube several times during the period. Add 400 μ1 isopropanol, and invert the centrifuge tube vigorously to mix the solution. Transfer 600 μ1 to the adsorption column, centrifuge for 30 seconds, discard the liquid in the collection tube, place the adsorption column in the same collection tube, and place the remaining Transfer all to the adsorption column and centrifuge for 30 seconds. Discard the liquid in the collection tube and place the adsorption column in the same collection tube. Add 500 μl of Wl (washing solution), leave it for 1 minute, and centrifuge for 30 seconds. Transfer the adsorption column to another clean collection tube, add 500 μl of Wl solution, and centrifuge for 15. seconds. Discard the liquid in the collection tube, place the adsorption column in the same collection tube, and centrifuge for 1 minute. Transfer the adsorption column to a clean 1.5ml centrifuge tube, add 100μ1 T1 (eluent) solution to the center of the adsorption membrane, let it stand at 65 ° C for 5 minutes, and centrifuge for 1 minute. Add 60 μ1 T1 solution and centrifuge for 1 minute. Store 1.5ral centrifuge tubes (DNA) at -20 ° C.

2.3 Amplification of the target fragment

2.3.1 polymerase chain reaction (PCR)

The 25-μ1 PCR amplification reaction system is as follows: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM magnesium chloride, 200 μM dNTP, 0.4 μM primer, 1.0 U Taq DNA polymerase, 30-50 ng genomic DNA. The PCR amplification reaction conditions are: denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 57 ° C-62 ° C for 30 seconds, extension at 72 ° C for 40 seconds, 32 cycles, and extension at 72 ° C for 7 minute.

2.3.2 Primers

Through bioinformatics search, three single nucleotide polymorphism sites on the FZD3 gene were selected: rs2241802, rs2323019, and / or rs352203. See Table 1 for details.

Sequence and related information of 3 SNPs primers

SNP primer sequence (5, → 3 ') Product annealing within • allele

(bp) Temperature cut (bp)

CO enzyme

rs2241802 CTATGAAATAGCGAGCAAATGACA 307 Alul A G

(SEQ ID No 4) 124/183 307 GGAAATCCAAACTGTTAGATCGTG

(SEQ ID No 5)

rs2323019 AGCCACTGCTCCCACCAAAG 321 Sspl A G

(SEQ ID No 6) 131/190 321 CAAAAACCCAGGGATACCCAAAC

(SEQ ID No 7)

rs352203 ATGACTTCCTAGGGCCAAACCTC 414 Nlalll C T

(SEQ ID No 8) 120/294 414 GCAAAAACTAATGGCCAGCAATGT

(SEQ ID No 9) 2.3.3 Full Sequence of PCR Product

rs2241802: (SEQ ID No 1)

rs2323019: (SEQ ID No 2)

rs352203: (SEQ ID No 3)

2.4 Polymorphic loci on genes

See Figure 1 for specific locations.

2.5 restriction fragment length polymorphism analysis

2.5.1 Restriction enzyme digestion reaction

15 μ1 of the PCR product was placed in a 5 μ1 endonuclease and digestion buffer system, and reacted in a 37 ° C incubator overnight.

2.5.2 Agarose gel electrophoresis separation and identification

Take 6-8μ1 of the digested product, separate the target fragment by 3% agarose gel electrophoresis, and scan the gel phase system to read the genotype.

in conclusion:

As shown in Figure 3, it is 3 ° /. Digestion map of polymorphic site rs2241802 after agarose gel electrophoresis, where 1 is 10 (^ molecular weight standard (6):), 2 is 307 homozygotes, 3 is 124/183 homozygotes, and 4 is 124 / 183/307 heterozygotes.

As shown in Figure 4, it is a digestion map of polymorphic site rs2323019 after 3% agarose gel electrophoresis, where 1 is 321 homozygote, 1 is 100bp molecular weight marker (marker), and 3 is 131/190 / 321 heterozygotes, 4 are 131/190 homozygotes.

As shown in Figure 5, it is a restriction map of polymorphic site rs352203 after 3% agarose gel electrophoresis, where 1 is a 100bp molecular weight marker (marker), 2 is a 120/294/414 heterozygote, and 3 is 120/294 homozygotes, 4 is 414 homozygotes.

2.6 Statistical analysis

Genetic Statistics and Mathematical Analysis

Use the transmission disequilibrium test (TDT) The relationship between alleles and disease in all core schizophrenic families was analyzed, and the analysis process was the same as in the first phase of the study. In association studies based on linkage disequilibrium, since the haplotype is more accurate than a single SNP site and has higher statistical power, the inventors performed the study with three single nucleotide polymorphism sites Analysis of haplotype frequencies. Haplotype frequencies were analyzed using TRANSMIT software (2.5.2). After several statistical analyses, the Bonferroni method was used for correction.

Results:

1. Three SNPs genotype distribution and allele frequency

The genotype distribution and allele frequency are shown in Table 2.

Table 2 Genotype distribution and allele frequencies of the three polymorphic loci of the FZD3 gene

2. TDT test of three SNPs

According to the transmission of parents' genotypes in sick children, the transmission imbalance test (TDT) was performed in 246 families. See Table 3 for TDT analysis. As shown in Table 3, after the Bonferroni correction, the TDT analysis of the three polymorphic sites was still statistically significant (RS2241802: X ² = 18. 028, P = 0. 00002; Rs2323019: X ² = 13 018, P = 0. 0003; Rs 352203: X ² = 20. 260, P = 0. 000007). FZD3 gene allele transmission imbalance face detection

3. Haplotype analysis of FZD3 gene

The overall test of haplotype transmission showed that the FZD3 gene was strongly associated with schizophrenia (X ² = 48.84, degrees of freedom = 7, p <0.000001). Analysis of single haplotypes also showed GAT haplotypes in patients Too many passes, the difference is significant (X ² = 34.21, degrees of freedom = 1, p <0.000001) (see Table 4).

Analysis of Haplotype Transmission Frequency of FZD3 Gene

Note: GGT is Rs2241802 G + Rs2323019 G + Rs352203 T; AGT is Rs2241802 A + Rs2323019 G + Rs352203 T; GAT is Rs2241802 G + Rs2323019 A + Rs352203 T ;; AAT is Rs2241802 A + Rs2323019 A + Rs352203 T; GGC is Rs2241802 G + Rs2323019 G + Rs352203 C; AGC is Rs2243521802 Gs + Rss G + Rs2323019 A + Rs352203 C; AAC is Rs2241802 A + Rs2323019 A + Rs352203 C. in conclusion:

From the above test, it can be concluded that the rs2241802, rs2323019 and / or rs352203 polymorphic loci of the FZD3 gene sequence affect the susceptibility to schizophrenia, among which the rs2241802 polymorphic locus in the FZD3 gene sequence is G and the rs2323019 polymorphism Site A and / or rs352203 polymorphism site T is those with high susceptibility to schizophrenia.

Example 2 Method for detecting susceptibility to schizophrenia in a test subject

Method:

The polymerase chain reaction-restriction fragment length polymorphism (PCR-based RFLP) analysis method was used to detect the genotype of the rs2241802, rs2323019, and / or rs352203 polymorphism loci. .

The main methods are as follows:

1 Collection and processing of blood samples:

2 Genomic DNA extraction and identification

3 Amplification of the target fragment

4 Restriction fragment length polymorphism analysis

For specific methods, refer to 2.1-2.5 in Example 1.

The subjects whose rs2241802 polymorphism site was G and rs2323019 polymorphism site A and / or rs35 ²² 03 polymorphism site T were those who were highly susceptible to schizophrenia. Example 3 Kit for in vitro detection of schizophrenia-susceptible genes

1) Primers that amplify polymorphic sites

2) PCR amplification enzymes and restriction enzymes Alul, SspI, .NlaIII and corresponding buffers;

3) dNTP;

4) The restriction map of the polymorphic site:

And explain how to use it as follows:

1 Collection and processing of blood samples

2 Genomic DNA extraction and identification

3 Amplification of the target fragment

4 Restriction fragment length polymorphism analysis

For the specific method, refer to the method 2.1-2.5 in Example 1. It should be understood that after reading the foregoing description of the present invention, those skilled in the art can make various changes or modifications to the present invention, but equivalent forms of the changes or modifications also fall within the scope defined by the claims of the present application.

Claims

Rights request

1. A method for detecting susceptibility genes in schizophrenia, the method comprising detecting FZD3 gene sequence in vitro by polymerase chain reaction-direct sequencing method and / or polymerase chain reaction-restriction fragment length polymorphism analysis method Among them, there are rs2241802 polymorphic loci, rs2323019 polymorphic loci and / or rs 352203 polymorphic loci.

1. The method for detecting a susceptibility gene for schizophrenia according to claim 1, which is a polymerase chain reaction-restriction fragment length polymorphism analysis method, wherein the polymorphism analysis method comprises:

A: DNA is extracted, and PCR primers are designed near the rs2241802, rs2323019 and / or rs 352203 polymorphism sites for PCR reaction;

C: gel electrophoresis separation and identification of digestion results;

Among them, the rs2241802 polymorphism site, the rs2323019 polymorphism site and the rs 352203 polymorphism site are susceptibility alleles of schizophrenia.

3. The method for detecting susceptibility genes for schizophrenia according to claim 2, further comprising analyzing the transmission frequency and monomer of the allele of the FZD3 gene using a transmission imbalance risk analysis after the polymorphism analysis There is a significant difference in the type of transmission frequency for schizophrenia susceptibility genes.

4. An in vitro method for detecting genetic susceptibility to schizophrenia in a test subject, the method comprising detecting a test subject's FZD3 gene sequence rs2241802, rs2323019 and / or rs 352203 polymorphism site, wherein the rs2241802 polymorphism site is G Subjects with rs2323019 polymorphic locus A and / or rs 352203 polymorphic locus T had high susceptibility to schizophrenia.

5. The method for detecting genetic susceptibility to schizophrenia in a tester in vitro according to claim 4, wherein the FZD3 gene sequence is rs2241802, rs2323019 and / or rs 352203 polymorphism The method of the sex site is a polymerase chain reaction-direct sequencing method and / or a polymerase chain reaction-restriction fragment length polymorphism analysis method. '

6. The method for detecting genetic susceptibility to schizophrenia in a tester according to claim 5, wherein the method for detecting the polymorphic site of the FZD3 gene sequence rs2241802, rs2323019 and / or rs 352203 is a polymerase chain reaction-restriction Sex fragment length polymorphism analysis method, the polymorphism analysis method includes:

A: Extract the bandits, design PCR primers near the rs2241802, rs2323019 and / or rs 352203 polymorphism sites, and perform the PCR reaction;

C:; 11 cross-electrophoresis separation and identification of digestion results.

7. A kit for detecting susceptibility to schizophrenia, comprising:

1) primers for amplifying the FZD3 gene sequence rs2241802, rs2323019 and / or rs352203 polymorphism sites;

2) PCR amplification enzymes, restriction enzymes corresponding to the digested polymorphic sites, and corresponding buffers; 3) dDTP;

4) a digestion map of the polymorphic site.

8. The kit for detecting susceptibility to schizophrenia according to claim 7, comprising: 1) a primer:

Primers that amplify the rs2241802 polymorphic site (5'-3 '):

CTATGAAATAGCGAGCAAATGACA (SEQ ID No 4)

GGAAATCCAAACTGTTAGATCGTG (SEQ ID No 5);

Primer that amplifies the rs2323019 polymorphic site (5 '→ 3,):

AGCCACTGCTCCCACCAAAG (SEQ ID No 6)

CAAAAACCCAGGGATACCCAAAC (SEQ ID No 7);

Primer (5, → 3,) for amplifying rs 352203 polymorphic site: ATGACTTCCTAGGGCCAAACCTC (SEQ ID No 8)

GCAAAAACTAATGGCCAGCAATGT (SEQ ID No 9);

2) PCR amplification enzymes, restriction enzymes Alul, Sspl, Nlalll and corresponding buffers;

3) dNTP;

4) a map of the polymorphic site.

9. A schizophrenia susceptibility gene, which is a sequence of the FZD3 gene and has an rs2241802 polymorphism site, an rs2323019 polymorphism site and / or an rs352203 polymorphism site.

10. The schizophrenia-susceptible gene according to claim 9, which is genomic DNA.

11. Use of the method for detecting susceptibility to schizophrenia in vitro according to any one of claims 1-3 in the prevention, diagnosis and treatment of schizophrenia.

12. Use of the method for detecting a schizophrenia susceptibility gene in a tester in vitro according to any one of claims 4 to 6 in the prediction, diagnosis and treatment of schizophrenia risk.

13. Use of a kit for detecting susceptibility to schizophrenia according to claim 7 or 8 in the prevention, diagnosis and treatment of schizophrenia.

14. Use of the schizophrenia susceptibility gene according to claim 9 or 10 in the prevention, diagnosis and treatment of schizophrenia.