WO2004074485A1 - Nouvelles proteines et adn codant pour ces proteines - Google Patents

Nouvelles proteines et adn codant pour ces proteines Download PDF

Info

Publication number
WO2004074485A1
WO2004074485A1 PCT/JP2004/002133 JP2004002133W WO2004074485A1 WO 2004074485 A1 WO2004074485 A1 WO 2004074485A1 JP 2004002133 W JP2004002133 W JP 2004002133W WO 2004074485 A1 WO2004074485 A1 WO 2004074485A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
dna
amino acid
seq
sequence
Prior art date
Application number
PCT/JP2004/002133
Other languages
English (en)
Japanese (ja)
Inventor
Takao Isogai
Tomoyasu Sugiyama
Ai Wakamatsu
Ryotaro Irie
Shizuko Ishii
Kunji Kawai
Jun Kondo
Takahide Kaji
Midori Nakajima
Naoko Miyama
Toshimitsu Kishimoto
Original Assignee
Research Association For Biotechnology
Zoegene Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Association For Biotechnology, Zoegene Corporation filed Critical Research Association For Biotechnology
Publication of WO2004074485A1 publication Critical patent/WO2004074485A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/485—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Definitions

  • the present invention relates to a novel protein, a DNA encoding the protein, a full-length cDNA encoding the protein, a recombinant vector having the DNA, an oligonucleotide comprising a partial sequence of the DNA,
  • the present invention relates to a transgenic cell into which NA has been introduced, an antibody that specifically binds to the protein, and the like. Background art
  • genomic sequences of various organisms are being elucidated and analyzed on a global level.
  • the purpose of clarifying the genome sequence is to understand the complex life phenomena as a network of interactions and functions among all genes, between proteins, between cells, and even between individuals. Elucidating life phenomena from the genomic information of various species is not only important as a research topic in the academic field, but also how to develop the research results obtained therefrom into industrial applications. In that respect, its social significance is also great.
  • Such information is used from various angles, such as elucidation of the human gene structure, prediction of the exon region in the genome sequence, and estimation of its expression profile.
  • human EST information is concentrated near the 3 'end of cDNA, information on the mRNA, especially near the 5' end, is extremely insufficient.
  • cDNAs have been identified as a result of analyzes conducted at research institutions around the world (Helix Research Institute, Kazusa DNA Research Institute, The University of Tokyo Medical Research Institute, German Cancer Research Center, MGC Project, etc.) Thousands of them are considered to cover most of the 30,000 thousands of loci, but the percentage of cDNAs obtained as full-length clones is around 80%, ⁇ Considering that splicing variants are included, it is considered that there are many cDNAs that have not yet been obtained.
  • the transcription start point of the mRNA on the genomic sequence can be estimated from the 5 'terminal sequence, and it is involved in the stability of mRNA contained in the sequence and the regulation of expression at the translation stage. Factor analysis is possible. Also, since the translation initiation codon atg is included on the 5 side, translation into protein can be performed in the correct frame. Therefore, by applying an appropriate gene expression system, it becomes possible to mass-produce the protein encoded by the cDNA or to express the protein and analyze its biological activity. Thus, analysis of full-length cDNA provides important information that complements genomic sequence analysis. In addition, the total length that can be expressed cDNA clones are of great importance in empirical analysis of the function of their genes and their application to industrial applications.
  • splicing variant mRNA a plurality of similar proteins (hereinafter sometimes referred to as “splicing variants”) produced by translating these mRNAs have been identified in vivo. Splicing variants are expressed in a tissue-specific, developmental-stage or disease-specific manner, and are thought to have different functions.
  • the JAK3 gene which is a tyrosine kinase, has three types of splicing variants, S-type, B-type, and M-type.
  • S-type is expressed in hematopoietic cells
  • S-type is expressed in hematopoietic cells.
  • the type is expressed on hematopoietic cells and epithelial cells.
  • Antibodies co-precipitate S-type and M-type and express them in the same cell, allowing multiple splicing variants to work together, further increasing the complexity of intracellular cytokine signaling. (See, for example, Lai KS et al., J. Biol. Chem., 270: 25028-25036 (1995)).
  • the mRNA or cDNA of such a splicing variant is also difficult to obtain from a conventional cDNA library or EST, and is a clone that is likely to be obtained from a full-length cDNA library including the transcription start site. (See, for example, WO 98Z2250 7 (SEQ ID NO. 1 and NO. 2)).
  • protein kinase is an enzyme that phosphorylates serine, threonine, or tyrosine residues of a protein as a substrate, and an extremely large number of families are known.
  • protein kinases are known to be involved in the control of various life phenomena by regulating intracellular signal transduction systems via protein phosphorylation. Many (for example, Hunter, T., Cell, 50: 823-829 (1987)).
  • human genes are said to be protein kinase genes, and it is estimated that about 1,000 different protein kinases exist in the human body, and there are still many protein kinase genes. Are left uncloaked.
  • protein kinases can be expected to be useful as therapeutic target molecules and proteins themselves as pharmaceuticals. Therefore, it is of great significance to determine the full length of the cDNAs encoding these proteins. Disclosure of the invention
  • the present invention analyzes the nucleotide sequence of a cDNA clone contained in a full-length cDNA library, and analyzes and identifies the physiological activity of a protein encoded by a cDNA having a novel full-length sequence including a splicing variant.
  • An object of the present invention is to propose a protein based on the physiological activity and a method of using DNA encoding the protein.
  • the present inventors have proposed the oligocap method (Maruyama, K., et al., Gene, 138: 171-174 (1994); Suzuki, Y. et al., Gene, 200: 149-156 (1997)).
  • a database containing the splicing variant obtained using the novel cDNA was searched in a database based on the homology of the nucleotide sequence of the cDNA clone, a sequence specific to a protein having kinase activity was found in the sequence. And identified that the protein encoded by these cDNAs was a protein kinase.
  • the present invention has been accomplished based on these findings.
  • a protein consisting of the amino acid sequence of any one of SEQ ID NOs: 13 to 24,
  • a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted, or added to the amino acid sequence of any one of SEQ ID NOs: 13 to 24, and which has kinase activity.
  • a sense oligonucleotide having the same sequence as 5 to 100 consecutive nucleotides in the nucleotide sequence of DNA according to any one of (2) to (4), and an antisense having a sequence complementary to the sense oligonucleotide.
  • An oligonucleotide selected from the group consisting of an oligonucleotide and an oligonucleotide derivative of the sense or antisense oligonucleotide.
  • a method for screening a substance that regulates the expression of DNA characterized in that:
  • At least one or more amino acid sequence information selected from the amino acid sequence of the protein according to (1) and / or at least one selected from the nucleotide sequence of DNA according to any of (2) to (4) A computer-readable recording medium that stores one or more base sequence information.
  • FIG. 1 is a diagram comparing the structure of a protein having the amino acid sequence of SEQ ID NO: 15 with the structure of a known protein BC010640.
  • FIG. 2 is a diagram comparing the exon structures obtained by mapping and analyzing the DNA having the nucleotide sequence of SEQ ID NO: 3 and the cDNA encoding the known protein BC 010640 to the human genomic sequence.
  • FIG. 3 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 16 with the structure of the known protein AX405737.
  • FIG. 4 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 4 and the cDNA encoding the known protein AX405573 to the human genome sequence and analyzing them.
  • FIG. 5 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 17 with the structure of the known protein AX262516.
  • FIG. 6 is a diagram comparing the exon structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 5 and the cDNA encoding the known protein AX262516 to the human genome sequence and analyzing them.
  • FIG. 7 is a diagram comparing the structure of a protein having the amino acid sequence of SEQ ID NO: 18 with the structures of known proteins AAV32449, AAW48841, and AAW48842.
  • FIG. 8 is a diagram comparing the exon structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 6 and the cDNA encoding the known protein AAV32449 to human genomic sequences, respectively.
  • FIG. 9 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 19 with the structure of the known protein cdk10.
  • FIG. 10 is a diagram comparing exon structures obtained by mapping and analyzing the DNA having the nucleotide sequence of SEQ ID NO: 7 and the cDNA encoding the known protein cdk10 to the human genome sequence, respectively.
  • FIG. 11 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 20 with the structure of the known protein AX327993.
  • FIG. 12 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 8 and the cDNA encoding the known protein AX327993 to human genomic sequences, respectively.
  • FIG. 13 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 21 with the structure of the known protein SGK040.
  • FIG. 14 is a diagram comparing exon structures obtained by mapping a DNA having the nucleotide sequence of SEQ ID NO: 9 and a cDNA encoding the known protein SGK040 to a human genome sequence and analyzing them, respectively (a). In addition, a diagram comparing the structure of both proteins as seen from the exon structure is shown (b).
  • FIG. 15 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 22 with the structure of the known protein ACK1.
  • FIG. 16 is a diagram comparing the etason structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 10 and the cDNA encoding the known protein ACK1 to the human genome sequence and analyzing them.
  • FIG. 17 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 23 with the structure of the known protein MAP KK4.
  • FIG. 18 is a diagram comparing the exon structures analyzed by mapping the DNA encoding the nucleotide sequence of SEQ ID NO: 11 and the cDNA encoding the known protein MAPKK4 to the human genome sequence, respectively.
  • FIG. 19 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 24 with the structure of the known protein PKACa.
  • FIG. 20 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 12 and the cDNA encoding the known protein PKAC a to the human genome sequence and analyzing them.
  • Figure 21 shows the standard polypeptides (Cdc2, Arg2-OH PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, The peak of Syntide2) is shown.
  • Figure 23 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate
  • the figure shows the results obtained by adding a protein having an amino acid sequence and causing a reaction to proceed, and then measuring peaks on reversed-phase HPLC.
  • Figure 24 shows the standard polypeptides as substrates (Cdc2, Arg2—OH, PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, The results obtained by adding a protein having the amino acid sequence of SEQ ID NO: 7 to Syntide 2) and reacting the resulting mixture, and measuring the peak on a reverse-phase HPLC.
  • Figure 25 shows that the standard polypeptides (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as substrates are the amino acids of SEQ ID NO: 8.
  • the figure shows the results of peaks measured on reversed-phase HPLC after a protein having a sequence was added and reacted.
  • Figure 26 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2 N MLCKS, CaMKII, Syntide2) as a substrate has the amino acid of SEQ ID NO: 9.
  • the figure shows the results of peaks measured on reversed-phase HP LC after a protein having a sequence was added and reacted.
  • Figure 27 shows that the standard polypeptide (C dc2, Arg2—OH, PKA, PKC, DNA—PK1, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate has the amino acid of SEQ ID NO: 10.
  • the figure shows the results of peaks measured on reversed-phase HP LC after a protein having a sequence was added and reacted.
  • FIG. 28 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA_PK, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate has the amino acid sequence of SEQ ID NO: 11.
  • the figure shows the results of peaks measured on reversed-phase HP LC after protein addition and reaction.
  • Figure 29 shows the amino acid sequence of SEQ ID NO: 1 in the standard polypeptide (Cdc2, Arg2—OH, PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate.
  • the figure shows the results of peaks measured on a reversed-phase HPLC after a protein having the above-mentioned property was added and reacted.
  • Figure 30 shows the amino acid sequence of SEQ ID NO: 2 in the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate.
  • the figure shows the results of peaks measured on reversed-phase HPLC after a protein having the above was added and reacted.
  • Figure 31 shows c-testi siRNA with target gene 2053667 (testi 205366 7-964 alone, testi 2053667-1-190 alone, and testi 2053667-964 and test 1 20553667-1190 (Equivalent mixture) was introduced into HEK293 cells and HeLa cells, and the results of measuring the expression level of c-testi 2053667 gene in the cells are shown.
  • Figure 32 shows that c-siRNA (testi 2053667-964 alone, a mixture of equal amounts of testi 2053667-964 and testi 2053667-1190) with testi 2053667 as the target gene was introduced into HEK293 cells and HeLa cells.
  • 3 shows the results of quantifying the proliferation of the cells into which the cells were introduced, using the intracellular ATP content as an index.
  • Fig. 33 shows that c-siRNA (testi 2053667-964 alone, a mixture of testi 2053667-964 and testi 2053667-1 190 in the same amount) with testi 2053667 as the target gene was introduced into HEK293 cells and HeLa cells. 5 shows the results of quantifying the cell death of the cells into which the siRNA was introduced, using the LDH activity released into the culture supernatant as an index.
  • the DNA of the present invention may be a protein comprising the amino acid sequence of any one of SEQ ID NOs: 13 to 24, or one or several amino acids in the amino acid sequence of any of SEQ ID NOs: 13 to 24 (here, The term “several” means, for example, 5 amino acids or less, preferably 3 amino acids or less, and more preferably 2 amino acids or less. Any substance may be used as long as it can encode a protein having kinase activity. Specifically, the It may be only the translation region encoding the amino acid sequence, or may include the full length of its cDNA.
  • examples of the DNA containing the full-length cDNA include a DNA having the nucleotide sequence of any one of SEQ ID NOS: 1 to 12, and the like.
  • the translation regions include nucleotide numbers 39 to 2159 of SEQ ID NO: 1, nucleotide numbers 36 to 1454 of SEQ ID NO: 2, nucleotide numbers 401 to 1960 of SEQ ID NO: 3, nucleotide numbers 42 to 1733 of SEQ ID NO: 4, Nucleotide numbers 371 to 3874 of SEQ ID NO: 5, Nucleotide numbers 81 to 2720 of SEQ ID NO: 6, Nucleotide numbers 1744 to 2685 of SEQ ID NO: 7, Nucleotide numbers 254 to 2554 of SEQ ID NO: 8, Nucleotide numbers 32 to 3898 of SEQ ID NO: 9, Examples include those having the sequences represented by base numbers 146 to 3406 of SEQ ID NO: 10, base numbers 55 to 1287 of SEQ ID NO: 11, and base numbers 407 to 1690 of SEQ ID NO
  • those containing the above-mentioned translation region and a portion adjacent to the 3 ′ and Z or 5 ′ end thereof, which is the minimum necessary for the expression of the translation region, are also included in the DNA of the present invention. included.
  • the DNA of the present invention may be obtained by any method as long as it can be obtained, and specifically, for example, can be obtained by the method described below.
  • mRNA is prepared from human tissues or cultured cells by a method known per se and commonly used.
  • the oligo cap method is prepared from human tissues or cultured cells by a method known per se and commonly used.
  • RNA ligase for the RNA molecule having no cap structure at the 5 'end, the phosphate group existing at the 5' end in advance is not removed from the 5 'cap so that the oligocap linker will not bind, 5. It is effective to remove using a phosphatase that has the activity to remove only the phosphate group at the end.
  • RNA molecule as type III, as a primer on the 3 side After reverse transcription is performed with reverse transcriptase using oligo dT primer, the RNA strand is degraded and removed.
  • a full-length cDNA library can be prepared by performing PCR (PCR).
  • the 5 'primer and the 3 primer are not complementary to the full length of the synthetic oligonucleotide and the reverse transcription primer, and it is preferable to use a sequence shifted by 3 to 10 bases on the 3 side.
  • the chain length of the primer is usually 15 to 100 nucleotides, preferably 15 to 30 nucleotides. If the length of the cDNA to be amplified is long, it is preferably 25 to 35 nucleotides.
  • Long and Accurate PCR (LA PCR: Takeshi Hayashi, Separate Volume on Experimental Medicine ⁇ The latest technology in PCR, Yodosha; Cheng, S., et al., Nature 369: 684-685 (1994)) Is preferred.
  • the cDNA thus obtained is inserted into an appropriate cloning vector and cloned.
  • a protein expression vector that can express the protein encoded by the cDNA by introducing the obtained cDNA clone into a cell is preferably used.
  • the host is a mammalian cell or the like
  • pME18SFL3 Genebank AB O09864
  • E. coli E. coli
  • pET3 and pETll manufactured by Stratagene
  • PGEX Amersham Pharmacia Biotech
  • yeast pESP-I expression vector (Stratagene) and the like.
  • Bac PAK6 (Clontech) And the like are used.
  • ZAP Express manufactured by Stratagene
  • SVK3 manufactured by Amersham Pharmacia Biotech
  • the nucleotide sequence of the thus obtained cDNA library is analyzed by a commonly used method known per se.
  • the DNA of the present invention analyzes the nucleotide sequence at the 5, 5 or 3 ends of the obtained cDNA and converts it to NCBI (National Center for Biotechnology Information; http: // www. Ncbi. Nlm. Nih. Gov).
  • BLAST Basic local alignment search tool; Altschul, SF, et al., J. Mol.
  • Examples of the DNA having such a full-length cDNA nucleotide sequence include those having the nucleotide sequence of SEQ ID NOS: 1 to 12.
  • base numbers 146 to 3406 of SEQ ID NO: 10 base numbers 55 to 1287 of SEQ ID NO: 11, and base numbers 407 to 1690 of SEQ ID NO: 12.
  • the novel nucleotide sequence obtained as the full-length cDNA obtained in this manner is used for homology search (homology search) using BLAST or HMMER (sequence analysis method using hidden Markov model; Eddy, SR, Bioinformatics 14: 755-763 (1998) HMM PF AM, one of the functions of))
  • ttp // pf am. wustl. edu), etc., to estimate the function of the protein encoded by the nucleotide sequence.
  • the function of the clone to be analyzed can be estimated from various annotation information accompanying the hit sequence whose homology is sufficiently significant as a result of the search.
  • a sufficiently significant hit sequence is T / JP2004 / 002133 Whether the identity between the catalytic domain portion of the registered sequence and the corresponding portion of the DNA of the present invention is 30% or more, e-value (query sequence as the expected value) present accidentally in the database showing the 1 0-4 or less.
  • HMMP FAM is an analysis based on the method of identifying whether the amino acid sequence encoded by the nucleotide sequence to be analyzed has the characteristics of the amino acid sequence of an entry in a database that integrates protein profiles called P fam. . Profiles are extracted from a series of proteins with the same characteristics. Even if a function cannot be clearly identified by comparing the full length of one sequence to one sequence, if the characteristic region is present in the sequence, the function can be identified and predicted. . Thus, the cDNA activity of a cDNA which is predicted to have the kinase activity of the protein encoded thereby can be confirmed by a biochemical experiment described later.
  • clone determined to be novel as the full-length cDNA above include those having the nucleotide sequence shown in any one of SEQ ID NOS: 1 to 12.
  • amino acid sequences encoded by these nucleotide sequences include those shown in any of SEQ ID NOS: 13 to 24.
  • the DNA of the present invention thus obtained, whose base sequence is determined, and whose function is estimated, is the base sequence described in any one of SEQ ID NOS: 1 to 12, or the base sequence shown above as its translation region.
  • the term "number" means, for example, 15 or less, preferably 9 or less, more preferably 6 or less
  • a DNA encoding a protein having a base sequence in which Z or an additional base or Z has been added and having a kinase activity, and a DNA which hybridizes with these under stringent conditions, and DNAs encoding proteins having activity are also included.
  • amino acid sequence of any of SEQ ID NOS: 13 to 24 is added to the DNA.
  • the sequences include amino acid sequences in which one or several amino acid sequences have been deleted, substituted, and / or added, and include those encoding proteins having kinase activity.
  • hybridization under stringent conditions refers to a reaction in a normal hybridization buffer at a temperature of 40 to 70 ° C, preferably 60 to 65 ° C, and the like. Washing can be performed according to a method of washing in a washing solution having a salt concentration of 15 mM to 300 mM, preferably 15 mM to 60 mM.
  • DNA of the present invention may be obtained by the above-described method or may be synthesized.
  • the DNA base sequence can be easily replaced with a sales kit such as a site-directed mutagenesis kit (Takara Shuzo) or a quick change site-directed mutagenesis kit (Stratagene). it can.
  • the translation region of the protein encoded by the DNA of the present invention is, for example, the nucleotide sequence of the DNA which is converted into amino acids by three reading frames and the range encoding the longest polypeptide of the present invention is
  • the amino acid sequence can be deduced as a protein translation region. Examples of such an amino acid sequence include those described in any of SEQ ID NOS: 13 to 24.
  • the protein of the present invention is not limited to the above amino acid sequence, but comprises an amino acid sequence in which one or several amino acids have been substituted, deleted, Z or added in the amino acid sequence. And those having kinase activity.
  • the method of transcribing and translating the DNA of the present invention described in (1) by an appropriate method is preferably used. Specifically, it was inserted into an appropriate expression vector or an appropriate vector together with an appropriate promoter. It can be obtained by producing a recombinant vector, transforming a suitable host microorganism with this recombinant vector, or introducing it into a suitable cultured cell, expressing it, and purifying it.
  • the protein of the present invention also includes a protein that is inserted into a vector or the like designed to fuse an appropriate tag to the N-terminus or C-terminus and has a tag added thereto.
  • a tag include glutathione-1S-transferase, polyhistidine, F1ag, and the like.
  • the protein produced by the transformant can be modified by incorporating an amino acid substituted / modified with a heavy atom or the like during protein synthesis.
  • a protein can be converted into a modified protein by arbitrarily modifying the protein or partially removing the polypeptide by applying an appropriate protein modifying enzyme before or after purification.
  • an appropriate protein modifying enzyme for example, N-terminal acetylation, terminal modification such as C-terminal amidation, glycosylation, lipid addition, acylation, methylation, sulfonation, carboxylation, hydroxylation, phosphorylation, ADP-ribosylation, etc.
  • modified proteins are also included in the scope of the present invention as long as they have the kinase activity described above.
  • the protein produced by the above transformant may be modified by arbitrarily modifying the protein before or after purification by the action of an appropriate protein modifying enzyme or by partially removing the polypeptide. It can be a protein. These modified proteins are also included in the scope of the present invention as long as they have the kinase activity described above.
  • the vector used for the production of the recombinant vector containing the DNA of the present invention is not particularly limited as long as the DNA is expressed in the transformant. Any of phage vectors. Of these, usually, a commercially available protein expression vector into which an expression control region DNA such as a promoter suitable for a host into which the DNA is introduced has already been inserted is used. As such a protein expression vector, specifically, for example, the host is Escherichia coli In the case of yeast, ET3, pETll (manufactured by Stratagene), GEX (manufactured by Amersham Pharmacia Biotech) and the like.
  • pESP-I expression vector manufactured by Stratagene
  • Bac PAK6 Bac PAK6 (Clontech) or the like is used.
  • ZAP Express Java Pharmacia Biotech
  • SVK3 Amersham Pharmacia Biotech
  • the host is a mammalian cell, ⁇ 18 SFL 3 (Ge nb nk AB 009864) and the like.
  • a promoter possessed by a host microorganism or a cultured cell can be used, but is not limited thereto.
  • the host is Escherichia coli, T3, T7, tac, 1ac promoter and the like can be used, and in the case of yeast, nmt1 promoter, Ga11 promoter and the like can be used.
  • a polyhedrin promoter or the like can be used.
  • the host is an animal cell, SV40 promoter, CMV promoter and the like are preferably used.
  • a promoter specific to the gene of the present invention can also be used. Insertion of the DNA of the present invention into these vectors may be performed by connecting the DNA or a DNA fragment containing the DNA to the amino acid sequence of the protein encoded by the gene DNA downstream of the open motor in the vector.
  • the recombinant vector thus prepared can be used to transform a host described below by a method known per se to prepare a DNA-introduced form.
  • Examples of the method for introducing the vector into a host include a heat shock method (J. Mol. Biol., 53: 154 (1970)), a calcium phosphate method (Science, 221: 551 (1983)), DEAE Dextran method (Science, 215: 166 (1982)), in vitro packaging method (Pro atl. Acad. Sci. USA, 72: 581 (1975)), virus vector method
  • the host for producing the DNA-introduced host is not particularly limited as long as the DNA of the present invention is expressed in the body.
  • Escherichia coli, yeast, baculovirus for example, Escherichia coli, yeast, baculovirus
  • BL21 and XL-2B 1 ue (Stratagene) for E. coli, SP-Q01 (Stratagene) for yeast, and AcN PV (J. Biol. Chem., 263) for baculovirus. : 7406 (1988)) and its host Sf9 (ATC C CRL-17111; J. Biol. Chem., 263: 7406 (1988)).
  • mouse fibroblast cell line C127 ATCC CRL-1804; J. Viol., 26: 291 (1978)
  • Chinese hamster ovary cell line CHO-K1 (ATC C CCL-61; Proc Natl.
  • African green monkey kidney-derived cell line COS-7 (ATCC CRL 1651: American type culture) because of its expression level and simple screening. Collection follicle cells), human fetal kidney-derived cell line HEK293 (ATCC CRL 1573; hereinafter sometimes referred to as “HEK293 cells”) transformed with human adenovirus type 5, or cells derived from human cervical cancer. Strain HeLa (ATCC CCL-12; hereinafter sometimes referred to as "HeLa cell”) is used.
  • a homologous recombination technique for directly inserting a DNA fragment of the present invention linked to a promoter directly into the chromosome of a host microorganism (Vertes, AA et al., Biosci. Biotec nol. Biochem., 57: 2036 (1993)), or transposon or inserted rooster (Vertes, AA et al., Molecular Microbiol., 11: 739 (1994)), etc. You can also.
  • the culture obtained above is obtained by collecting cells or cells by a method such as centrifugation, suspending the cells or cells in a suitable buffer, and sonicating, lysozyme, and Z or freeze-thawing or other suitable method. After the disruption by a suitable method, a crude protein solution is obtained by centrifugation, filtration, or the like, and further purified by a combination of appropriate purification methods.
  • the protein of the present invention is obtained.
  • the DNA of the present invention obtained in (1) above may be used in a cell-free transcription / translation system (also referred to as a “cell-free protein synthesis system”).
  • a cell-free transcription / translation system also referred to as a “cell-free protein synthesis system”.
  • the cell-free transcription / translation system used in the present invention is a system containing all elements necessary for transcription from DNA to mRNA and translation of mRNA to protein, and by adding DNA thereto, It refers to any system in which the protein encoded by the DNA is synthesized.
  • the cell-free transcription / translation system include a transcription / translation system prepared on the basis of an extract from a eukaryotic cell, a bacterium, or a part thereof.
  • Specific examples of the cell-free protein synthesis system include known ones such as Escherichia coli, plant seed embryos, and cell extracts such as egret reticulocytes. These can be used commercially, or a method known per se, specifically, an E. coli extract can be obtained from Pratt, JM, Transcription and Translation (Ed. By Hames, BD and Higgins, SJ), 179-209. , IRL Press, Oxford (1984).
  • Examples of commercially available cell-free protein synthesis systems or cell extracts include those derived from Escherichia coli such as E. coli S30 extract system (manufactured by Promega) and RTS500 Rapid Translation System (manufactured by Roche). Those derived from Rabbit Reticulocyte Lysate System (Promega) and those derived from wheat germ include PR0TEI0S TM (T0Y0B0).
  • concrete 3 includes epitope peptides (for example, polyhistidine peptide, daltathione
  • a DNA region encoding S-transferase (GST), maltose binding protein, etc.) is introduced into the above-mentioned DNA to be transcribed and translated, expressed as described above, and subjected to affinity with a substance having affinity for the protein. It can be purified using two teas.
  • the expression of the target protein is separated by SDS-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (manufactured by Sigma) or by using an antibody that specifically binds to the protein of the present invention described later. It can be confirmed by the detection method. It is generally known that the expressed protein is cleaved (processed) by a proteolytic enzyme present in the living body.
  • the protein of the present invention is naturally included in the protein of the present invention as long as it has a kinase activity, even if it is a partial fragment of the cleaved amino acid sequence.
  • the protein of the present invention is produced as a recombinant protein as described in (2) above, and by analyzing this, it can be confirmed that it has the activity estimated in (1). . Furthermore, analysis can also be performed by combination with the antibodies and the like described in (4) below.
  • Whether the protein of the present invention has kinase activity can be confirmed by a conventional method known per se.
  • a substrate is brought into contact with the recombinant protein, and the amount of ATP and the amount of product consumed when the substrate is phosphorylated by the kinase activity of the recombinant protein are measured. The method and the like will be described below.
  • the phosphorylation site of the substrate is serine Z-threonine.
  • magnesium ion for example, 5 to 10 OmM magnesium chloride or magnesium acetate, and Neutral to weakly basic buffer solution containing 1 to 10 OmM 2-mercaptoethanol or 1 to 10 mM dithiothreitol as a reagent, in the absence of phosphate ions, such as 5 OmM Tris monohydrochloride or HE PES Buffer (pH 7.0-8.
  • the purified protein of the present invention was added, and the mixture was reacted at room temperature to 37 ° C for about 24 hours, and then consumed by the kinase reaction of the protein. Measure the amount of ATP or the product of the kinase reaction performed by the protein.
  • cyclic nucleotide-dependent protein kinase that is a serine / threonine protein kinase
  • cyclic AMP cyclic AMP
  • cGMP cyclic GMP
  • phospholipid-dependent protein kinase a phospholipid is added to the reaction solution.
  • C-kinase phosphatidylserine is added and histone is used as a substrate.
  • calmodulin is added to the reaction solution, and myosin light chain is used as a substrate. This includes myosin light chain kinase and calmodulin kinase.
  • tyrosine protein kinase tubulin, histone, casein, myosin L chain, gastrin, angiotensin, tyrosine monoglutamic acid (1: 4) polymer, etc. are used as substrates.
  • kinase activity In the measurement of kinase activity, the hydrolysis of ATP to ADP by the kinase occurs before the transfer of the phosphate group to the substrate.
  • the kinase activity can be defined by measuring the amount of hydrolyzed ATP here. In this case, the substrate The amount of ATP in the reaction solution performed in the absence of the enzyme was measured, and the amount of ATP consumed was defined as the kinase activity (Whitehoouse, S., et al., J. Biol. Chem., 258: 3693-3701 (1983) ).
  • luciferin and luciferase are added to the above-mentioned kinase reaction solution, and after reacting for a certain period of time, the fluorescence intensity is measured at the fluorescence wavelength specific to the added luciferin, and the amount of fluorescence due to residual ATP is determined.
  • the value obtained by subtracting the above fluorescence intensity from the total ATP fluorescence intensity present in the reaction solution measured in the absence of protein kinase and substrate is defined as the amount of ATP consumed by the kinase activity, and is defined as the kinase activity of the enzyme. .
  • the reaction solution after the completion of the kinase reaction can be separated by chromatography, and the activity can be measured by changing the elution position of the phosphorylated substrate and the amount of change It is.
  • the chromatography ion exchange chromatography or reverse phase chromatography can be used. It is also possible to measure the activity by measuring the change in mass due to phosphorylation of the substrate with a mass spectrometer. In this case, the measurement accuracy is further increased by using the above-mentioned chromatography separation in combination.
  • Such a kinase activity analysis system can also be used to evaluate agonists and antagonists of the protein having the kinase activity of the present invention.
  • the confirmation of the activity of the protein of the present invention is not limited to the method described above. (4) Functional analysis of the protein of the present invention
  • novel proteins including those identified as splicing variants thus obtained, and having kinase activity,
  • Proteins to be analyzed are referred to as “proteins to be analyzed.” ”).
  • the protein of the present invention includes a splicing variant of a known protein, it is important to identify what functions this variant has with the known variant.
  • Specific methods for analyzing functions include, for example, (1) a method for comparative analysis of the expression state at each tissue, disease, or developmental stage, and (ii) a method for analyzing interactions with other proteins and DNA. (Iii) a method of analyzing a phenotypic change by introducing the protein into an appropriate cell or individual, and (iv) a method of analyzing a phenotypic change by inhibiting the expression of the protein in an appropriate cell or individual. No.
  • expression of the protein of the present invention can be analyzed at the mRNA or protein level.
  • the expression level is analyzed at the mRNA level, for example, the in situ hybridization method (3 ⁇ 4 situ
  • Hybridization Application to Developmental Biology & Medicine (Ed. by Harris, N. and Wilkinson, D.G.), Cambridge University Press (1990)), a hybridization method using a DNA chip, a quantitative PCR method, and the like are used.
  • the protein to be analyzed is a splicing variant in which a known variant is present
  • the method is performed by selecting primers that can generate amplified fragments of different lengths between the target variant and the known variant.
  • the protein Tissue staining using an antibody that binds specifically when analyzing at the protein level, the protein Tissue staining using an antibody that binds specifically. In this case, it is preferable to use an antibody that reacts only with the target protein and does not react with a known variant.
  • the function of the protein of the present invention can be analyzed by examining the presence or absence of interaction between the protein of the present invention and a known protein or DNA.
  • a conventional method known per se can be used. Specifically, for example, yeast two-hybrid method, fluorescence depolarization method, surface plasmon method, phage display method, liposomal The display method is an example.
  • the protein to be analyzed is a splicing variant in which a known variant is present, the known variant is similarly analyzed for interacting substances, and a substance that specifically interacts with the target protein is identified. It is preferable.
  • the cells into which the cDNA of the present invention is introduced are not particularly limited, but human cultured cells and the like are particularly preferably used. Methods for introducing DNA into cells include those described in (2) above.
  • the phenotype of the transfected cells can be observed with a microscope, such as cell viability, cell growth rate, cell differentiation, neurite elongation, localization and migration of intracellular proteins, etc. And those that can be analyzed by biochemical experiments, such as changes in the expression of specific proteins in cells.
  • the known phenotype in the case of a splicing variant in which a known variant exists, the known phenotype is also introduced into cells, and the phenotype associated with the variant to be analyzed is identified by comparative analysis. Can be.
  • the protein of the present invention since it is known that the protein of the present invention has kinase activity, it is also preferable to analyze by paying attention to the phenotype and the like found in diseases associated with kinase.
  • the method (iv) can be efficiently performed by a method using an oligonucleotide described below or an RNA interference method.
  • the target protein to be analyzed is a splicing variant in which a known variant exists, the same applies to the known variant and other variants. 2004/002133 By performing analysis and comparative analysis, it is possible to identify the function specific to the target protein.
  • oligonucleotides having a partial sequence of the DNA of the present invention can be prepared by a conventional method.
  • the oligonucleotide include DNA having the same sequence as 5 to 100 consecutive nucleotides in the nucleotide sequence of DNA, or DNA having a sequence complementary to the DNA.
  • Specific examples include a DNA having the same sequence as the consecutive 5 to 100 bases in the base sequence represented by any of SEQ ID NOS: 1 to 12, or a DNA having a sequence complementary to the DNA.
  • the target protein is a splicing variant in which a known variant DNA is present, it is preferable to select a base sequence different from that of the known variant.
  • the above-mentioned oligonucleotides whose melting temperature (Tm) and number of bases do not extremely change are preferred.
  • the length of the sequence is generally 5 to 100 bases, preferably 10 to 60 bases, and more preferably 15 to 50 bases.
  • oligonucleotide derivatives of these oligonucleotides can also be used as the oligonucleotide of the present invention.
  • the oligonucleotide derivative include an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and a phosphodiester bond in an oligonucleotide in which an N 3, 1 P 5 ′ phosphoramidate bond is used.
  • Oligonucleotide derivative in which ribose and phosphodiester bond in oligonucleotide are converted to peptide nucleic acid bond Oligonucleotide in which peracyl in oligonucleotide is substituted by C-15 propynyl peracyl Derivatives, oligonucleotide derivatives in which peracyl in the oligonucleotide is substituted with C-15 thiazoleperacyl, Oligonucleotide derivatives in which cytosine in the oligonucleotide is substituted with C-5-propynylcytosine, oligonucleotide derivatives in which cytosine in the oligonucleotide is substituted with phenoxazine-modified cytosine, and ribose in the oligonucleotide are Oligonucleotide derivatives substituted with 2,1-O-propylribose, or oligonucle
  • the oligonucleotide of the present invention can be applied to the RNA interference method by preparing it as a double-stranded RNA.
  • the method for preparing double-stranded RNA and the RNA interference method for example, the method described in Elbashir, S., et al., Nature, 411: 494-498 (2001) can be used.
  • the double-stranded RNAs need not all be RNAs. Specifically, as a part of which is a DNA, those described in WO 02/10374 can be used.
  • the gene to be targeted in the RNA interference method may be any DNA as long as it is the DNA of the present invention.
  • a gene predicted to be an ortholog of the gene DNA can also be a target gene.
  • a double-stranded oligonucleotide consisting of RNA having a sequence substantially identical to at least a part of the base sequence of these DNAs (hereinafter, may be referred to as “double-stranded oligonucleotide”)
  • double-stranded oligonucleotide a sequence substantially the same as a sequence of 15 bp or more, which may be any part of the base sequence of the target gene, is obtained.
  • substantially the same means having 80% or more homology with the sequence of the target gene.
  • the double-stranded oligonucleotide sequence can be set at the insertion site where the insertion is present.
  • the sequence spanning the deletion should be By arranging the sequences, it is possible to select a sequence that is effective specifically for the protein. Furthermore, by selecting a nucleotide sequence specific to the DNA encoding the protein to be analyzed by comparison with the nucleotide sequence of the DNA encoding each of the protein to be analyzed and the known protein, Its expression can be inhibited.
  • the nucleotide length may be any length from 15 bp to the entire length of the open reading frame (ORF) of the target gene, but a length of about 15 to 500 bp is preferably used.
  • ORF open reading frame
  • mammalian-derived cells have a signal transduction system that activates in response to a long double-stranded RNA of 30 bp or more.
  • a double-stranded oligonucleotide of 15 to 30 bp, preferably 19 to 24 bp, more preferably 21 bp is used. But preferred.
  • the double-stranded oligonucleotide does not need to be entirely double-stranded, and includes those whose 5 'or 3' ends are partially protruded, but those whose 3 'ends are protruded by 2 bases are preferably used.
  • the double-stranded oligonucleotide refers to a double-stranded oligonucleotide having complementarity, but may be a self-annealed single-stranded oligonucleotide having self-complementarity.
  • Single-stranded oligonucleotides having self-complementarity include, for example, those having inverted repeat sequences.
  • the method for preparing the double-stranded oligonucleotide is not particularly limited, but a known chemical synthesis method is preferably used.
  • Chemical synthesis is complementary single-stranded Ligonucleotides can be separately synthesized and assembled into a double strand by associating them by an appropriate method. Examples of the method of association include a method in which the above oligonucleotides are mixed, heated to a temperature at which the double strand dissociates, and then gradually cooled.
  • the associated double-stranded oligonucleotide is confirmed using an agarose gel or the like, and the remaining single-stranded oligonucleotide is removed by, for example, decomposing with a suitable enzyme.
  • the transfectant into which the double-stranded oligonucleotide prepared in this manner is introduced may be any as long as the target gene can be transcribed into RNA or translated into protein in the cell.
  • Good, but specific examples include those belonging to plants and animals.
  • the plant can be a monocotyledonous, dicotyledonous or gymnosperm
  • the animal can be a vertebrate or invertebrate.
  • vertebrates include mammals, including fish, sea lions, goats, stags, sheep, hamsters, mice, rats, and humans
  • invertebrates include nematodes, mosquitoes, Drosophila) and other insects.
  • the cells are vertebrate cells.
  • the transfectant means a cell, tissue or individual.
  • the cells may be germline cells or somatic cells, and may be totipotent or pluripotent, divided or undivided, parenchymal or epithelial, immortalized or transformed, and the like.
  • the cell may be a gamete or an embryo, in the case of an embryo, a single cell embryo or a constitutive cell, or a cell from a multicellular embryo, including fetal silk tissue.
  • it may be an undifferentiated cell such as a stem cell, or a differentiated cell such as a cell of an organ or tissue including fetal tissue, or any other cell present in an organism.
  • Differentiating cell types include fat cells, fibroblasts, muscle cells, cardiomyocytes, endothelial cells, nerve cells, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, Includes basophils, mast cells, leukocytes, granulocytes, keratinocytes, osteoblasts, osteoclasts, hepatocytes and cells of the endocrine or exocrine glands.
  • a method for introducing a double-stranded oligonucleotide into a recipient when the recipient is a cell or tissue, calcium phosphate method, electoral poration method, lipofection method, virus infection, double-stranded polynucleotide. Immersion in a solution, Alternatively, a transformation method or the like is used. Examples of the method for introduction into an embryo include a microphone-injection, an elect-portation method, and a virus infection.
  • a method of injecting or perfusing the plant into the body cavity or stromal cells, or spraying is used.
  • an animal individual in the case of an animal individual, it is introduced systemically by oral, topical, parenteral (including subcutaneous, intramuscular and intravenous administration), vaginal, rectal, nasal, ocular, intraperitoneal administration, etc.
  • a method such as electrophoresis or virus infection is used.
  • the double-stranded oligonucleotide can be mixed directly with the food of the organism.
  • it when introduced into an individual, it can be administered, for example, by administration as an implanted long-term release preparation or by ingesting an introduced body into which a double-stranded oligonucleotide has been introduced.
  • the amount of the double-stranded oligonucleotide to be introduced can be appropriately selected depending on the transductant and the target gene, but it is preferable to introduce an amount sufficient to introduce at least one copy per cell. Specifically, for example, when the transfectant is a cultured human cell and the double-stranded polynucleotide is introduced by the calcium phosphate method, 0.1 to 100 nM is preferable.
  • the function of the protein encoded by the DNA of the present invention can be confirmed, or a new function can be analyzed.
  • an antibody that specifically binds to the protein of the present invention As a method for preparing an antibody that specifically binds to the protein of the present invention, a commonly used known method can be used.
  • the polypeptide used as an antigen also has a high antigenicity according to a known method and is used for epitope ( An appropriate sequence can be selected and used as the antigenic determinant.
  • An appropriate sequence can be selected and used as the antigenic determinant.
  • commercially available software such as Epitope Adviser (manufactured by Fujitsu Kyushu System Engineering Co., Ltd.) can be used.
  • the target protein is a splicing variant in which a known variant exists, only the target protein reacts. However, by using an antibody that does not react with a known or other variant, a function specific to the target protein can be identified.
  • an epitope of such an antibody for example, when there is an amino acid sequence in which the target protein is missing as compared with a known variant, an amino acid sequence before and after the deleted portion (junction portion) is preferable.
  • the target protein has an amino acid sequence to which a known variant is added with the N-terminal or C-terminal, it is preferable to use the added amino acid sequence as an epitope.
  • an antibody that reacts only with the target protein can be obtained by removing an antibody that reacts with a known or other variant from the polyclonal antibody obtained with respect to the target protein. .
  • affinity chromatography in which a known or other variant is immobilized as a ligand, or immunoprecipitation using a known or other variant is used.
  • polypeptide used as the antigen a synthetic peptide synthesized according to a known method or the protein of the present invention itself can be used.
  • a polypeptide serving as an antigen may be prepared in an appropriate solution or the like according to a known method and immunized to a mammal, for example, a heron, a mouse, a rat, or the like.
  • the route of administration of the antigen upon immunization is not particularly limited, and any route such as subcutaneous, intraperitoneal, intravenous, or intramuscular route may be used. Specifically, for example, a method of inoculating a BALB / c mouse several times every several days to several weeks with an antigen polypeptide is used.
  • the antigen intake is preferably about 0.3 to 0.5 mg / l when the antigen is a polypeptide, but is appropriately adjusted depending on the type of the polypeptide and the animal species to be immunized.
  • a polyclonal antibody can be obtained by subjecting this to an appropriate treatment used for the preparation of the antibody. Specifically, for example, there is a method of obtaining a purified antibody obtained by purifying an antibody component from serum according to a known method. For purification of the antibody component, methods such as salting out, ion exchange chromatography, and affinity chromatography can be used.
  • Monoclonal antibodies can also be prepared by using a hybridoma fused with spleen cells and myeloma cells of the animal according to a known method (Milstein, et al., Ature, 256: 495 (1975)). it can.
  • a monoclonal antibody can be obtained, for example, by the following method.
  • antibody-producing cells are obtained from an animal whose antibody titer has been raised by immunization with the above-mentioned antigen.
  • the antibody-producing cells are plasma cells and lymphocytes which are precursor cells thereof, which may be obtained from any of individuals, but preferably obtained from spleen, lymph nodes, peripheral blood and the like.
  • the myeloma to be fused with these cells is generally a cell line obtained from a mouse, for example, P3X63-Ag8.653 (ATCC: CR L-1580), P 3-NS 1/1 Ag 4.1 (RIKEN cell punk: RCB 009 5) and the like are preferably used.
  • antibody-producing cells and myeloma cells are mixed at an appropriate ratio, and mixed in an appropriate cell fusion medium, such as RPMI 1640, Iscove's modified Dulbecco's medium (IMDM), or Dulbecco's modified Eagle's medium (DMEM).
  • cell fusion medium such as RPMI 1640, Iscove's modified Dulbecco's medium (IMDM), or Dulbecco's modified Eagle's medium (DMEM).
  • % By dissolving polyethylene glycol (PEG). It can also be performed by the electrofusion method (Zi ermann, U. et al., Naturwissenschaften, 68: 577 (1981)).
  • High Priestess dormer is normal medium (HAT medium) in 5% C0 2 containing an appropriate amount of hypoxanthine 'aminopterin' thymidine (HAT) solution by utilizing the myeloma cell line is a 8-Azaguanin resistant strain used, It can be selected by culturing at 37 ° C for an appropriate time. This selection method can be appropriately selected and used depending on the myeloma cell line to be used.
  • Antibodies produced by the selected hybridomas The antibody titer is analyzed by the method described above, the hybridoma producing an antibody with a high antibody titer is separated by a limiting dilution method or the like, and ammonium sulfate is obtained from a culture supernatant obtained by culturing the separated fused cells in an appropriate medium.
  • a monoclonal antibody can be obtained by purification by an appropriate method such as fractionation and affinity chromatography. For purification, a commercially available monoclonal antibody purification kit can also be used.
  • a human-derived protein When a human-derived protein is obtained as the protein of the present invention, the polypeptide or a partial peptide thereof is used as an antigen, and Severe combined immune deficiency (a method adapted to SCID mice) transplanted with human peripheral blood lymphocytes.
  • a humanized antibody can also be prepared by immunization in the same manner as described above and preparing a hybridoma of antibody-producing cells of the immunized animal and human myeloma cells.
  • RNA is extracted from the obtained hybridoma producing the human antibody, the gene encoding the target human antibody is cloned, and this gene is inserted into an appropriate vector.
  • a human antibody By introducing the protein into a host and expressing it, a larger amount of a human antibody can be produced.
  • an antibody with low binding to an antigen can be obtained as an antibody with even higher binding by using an evolutionary engineering technique known per se.
  • a partial fragment such as a transient antibody can be prepared by, for example, cleaving the Fab and Fc portions using papain or the like, and collecting the Fab portion using an affinity column or the like.
  • the thus-obtained antibody that specifically binds to the protein of the present invention can also be used as a neutralizing antibody that specifically binds to the protein of the present invention and thereby inhibits the kinase activity or the like of the protein.
  • the method selected in (2) above Methods include contacting or introducing an antibody into a DNA transfectant, and analyzing whether or not the function of the target protein in the transfectant is inhibited.
  • Such a neutralizing antibody can be used alone when the clinical application is used, or can be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • Such drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups for oral administration, or injections, infusions, ribosomes, Parenteral administration with suppositories and the like can be mentioned. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like.
  • the screening method of the modulator may be any method as long as it can obtain a substance that specifically binds to the protein of the present invention and has an activity of inhibiting, antagonizing or enhancing the activity of the protein. Good.
  • the protein of the present invention is brought into contact with a substance to be subjected to screening (hereinafter, this may be referred to as “test substance”), and after selection using the binding property to the protein as an index, A method for selecting a test substance using the change in the activity of the protein of the present invention as an index can be used.
  • test substance may be any substance as long as it can interact with the protein of the present invention and affect the activity of the protein.
  • examples thereof include peptides, proteins, non-peptidic compounds, low-molecular compounds, synthetic compounds, fermentation products, cell extracts, animal tissue extracts, and the like. These substances may be novel substances or known substances.
  • Test object As a method for analyzing the interaction between the protein and the protein of the present invention, a conventional method known per se can be used. Specifically, for example, a yeast two-hybrid method, a fluorescence depolarization method, a surface plasmon method, Examples include the phage display method, the liposomal display method, and the competition analysis method with the antibody described in the above (6).
  • a substance found to bind to the protein of the present invention is then analyzed by analyzing how the activity of the protein of the present invention is affected in the presence of the substance. Whether it is used as a modulator or not is identified.
  • the target protein is a splicing variant in which a known variant is present
  • the ability to analyze the effect of a substance that binds only to the target protein and does not bind to a known or other variant or a known substance is used.
  • it is possible to analyze the effect of the substance on the target protein by identifying whether or not it binds to the same or another variant, and analyzing the difference in the effect of the binding when binding.
  • the effect on the target protein and known or other variants can be analyzed.
  • a protein serving as a substrate is introduced into the DNA-introduced gene described in (2) in the same manner.
  • the phosphorylation of the substrate protein in the presence / absence of the selected substance of this transductant is analyzed by a commonly used method known per se. Specifically, it can be performed using the method described in the above (3). If the phosphorylation of the substrate protein is increased as compared to the absence of the substance, the substance may function as a kinase activator and may be reduced or inhibited. Can be identified as having the potential to function as a kinase inhibitor.
  • the DNA of the present invention when using the DNA of the present invention or a recombinant protein used for screening a regulatory substance for the purpose of obtaining a pharmaceutically active ingredient, it is preferable to use human DNA or a protein.
  • the leaked substance may be further selected as a drug candidate by screening in vivo.
  • the evaluation of the function regulating substance of the protein of the present invention is not limited to the above-described method.
  • the kinase activity of the protein of the present invention includes, for example, signaling functions on pathways related to cancer, signaling functions on pathways related to myocardial development, signaling on pathways controlling sperm motility. Functions, signaling on pathways that regulate germ cell differentiation, signaling on pathways that regulate cell differentiation, signaling on pathways that regulate sperm differentiation, pathways that regulate the onset of Alzheimer's disease Signal transduction function, Glycerol 3-phosphate generating function, Signal transduction function on pathways controlling brain cortex development, migration of nerve cells, etc., Function related to fatty acid sterol synthesis, Pathway related to cell death Signal transduction function, insulin signaling, immune and inflammatory disease Is a function, etc. related to the answer.
  • compounds that can be identified by this screening method include anticancer drugs, therapeutic agents for heart disease, therapeutic agents for infertility, regenerative tissue inducers, therapeutic agents for Alzheimer's disease, therapeutic agents for neurodegenerative diseases, therapeutic agents for diabetes, and therapeutics for immune and inflammatory diseases. It can be used as an agent.
  • the DNA encoding the protein of the present invention may be a cDNA constructed from RNA derived from tissues or organs such as the adrenal gland, uterus, testis, and brain (whole brain, caudate nucleus, amygdala, thalamus, and cerebellum). Since the obtained protein of the present invention, which is cloned from the NA library, may have a specific function in the above-mentioned tissues or organs, the function-regulating substance of the protein of the present invention is It can be used as a therapeutic agent for diseases specific to the tissue or organ.
  • modulators can be used alone as the active ingredient when applied to clinical applications, but can also be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • the drug can be administered in various forms, such as tablets, capsules, granules, powders, or syrups. Or parenteral administration by injection, infusion, ribosome, suppository and the like. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like.
  • Examples of the screening method include a method of analyzing the expression level of the protein of the present invention or the mRNA encoding the same in the presence of a test substance.
  • a method of analyzing the expression level of the protein of the present invention or the mRNA encoding the same in the presence of a test substance Specifically, for example, cells expressing the protein of the present invention described in (2) are cultured in an appropriate medium containing a test substance, and the amount of the protein of the present invention expressed in the cells is determined by ELISA. Or by analyzing the amount of mRNA encoding the protein of the present invention in the cells by quantitative reverse transcription PCR, Northern blotting, or the like. .
  • test substance those described in (7) can be used. According to this analysis, if the amount of the protein or mRNA expressed in the cells cultured in the absence of the test substance increases as compared with the amount of the mRNA, the test substance of the present invention It may function as a DNA expression promoting substance, and when it decreases, it can be determined that this test substance can be used as a DNA expression inhibiting substance of the present invention.
  • the above-mentioned active ingredient can be used alone for clinical application, but can also be used as a pharmaceutical composition by blending it with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • powerful drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups, orally, injections, drops, Parenteral administration with ribosomes, suppositories and the like can be mentioned.
  • the dose can be appropriately selected depending on the condition, age, weight, and the like.
  • the introduced DNA containing the DNA of the present invention described in the above (1) is constructed, introduced into a fertilized egg of a mammal other than a human, and transplanted into a female individual oviduct to generate it.
  • a non-human mammal into which the DNA of the present invention has been introduced can be produced. More specifically, for example, a female individual is superovulated by hormone administration, then mated with a male, a fertilized egg is removed from the oviduct on the first day after mating, and DNA is introduced into the fertilized egg by microinjection. And so on. After culturing by an appropriate method, the surviving fertilized eggs are transplanted into the oviduct of a pseudopregnant female individual (foster parent) to give birth.
  • Non-human mammals include, for example, mice, rats, guinea pigs, hamsters, rabbits, goats, pigs, dogs, cats, and the like.
  • the thus-obtained DNA-introduced animal of the present invention is used to breed this individual and subculture them in a normal breeding environment while confirming that the introduced DNA is stably maintained, thereby obtaining the offspring. Obtainable. It is also possible to obtain offspring by repeating in vitro fertilization and maintain the strain.
  • the non-human mammal into which the DNA of the present invention has been introduced can be used as an analysis of the function of the DNA of the present invention in a living body, or as a screening system for a substance that regulates the function.
  • the protein of the present invention can be used as a carrier on which it is bound.
  • a nucleotide sequence encoding the protein of the present invention for example, a DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12 and a partial fragment thereof can be used as a carrier obtained by binding them on a substrate.
  • proteins proteins
  • DNA chips DNA arrays
  • DNA microarrays and DNA macroarrays DNA microarrays and DNA macroarrays.
  • the target protein is a splicing variant in which a known variant exists
  • the amino acid sequence partial fragment specific to the target protein can be used for the step
  • the full length of the amino acid sequence fragment may be used because it may have a steric structure different from other variants.
  • a resin substrate such as a nylon film or a polypropylene film, a nitrocellulose film, a glass plate, a silicon plate, or the like is used as a substrate for binding proteins and DNA, but the detection of hybridization is non-RI.
  • a glass plate or a silicon plate containing no fluorescent substance is preferably used.
  • the binding of the protein or DNA to the substrate can be easily carried out by a commonly used method known per se.
  • These protein chips, DNA chips, or DNA arrays are also included in the scope of the present invention.
  • the amino acid sequence of the protein of the present invention and the nucleotide sequence of the DNA can also be used as sequence information.
  • the base sequence of this DNA includes the base sequence of the corresponding RNA. That is, by storing the obtained amino acid sequence or base sequence in an appropriate recording medium in a predetermined format readable by a computer, a database of the amino acid sequence or base sequence can be constructed. This database may contain the nucleotide sequences of other types of proteins and the DNA that encodes them. Further, in the present invention, the database also means a computer system that writes the above-mentioned sequence on an appropriate recording medium and performs a search according to a predetermined program.
  • Suitable recording media include, for example, magnetic media such as flexible disks, hard disks, and magnetic tapes; optical disks such as CD-ROM, MO, CD-R, CD-RW, DVD-R, and DVD-RAM; and semiconductors. Examples include a memory. Example Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited by these Examples. The results of the following experiments performed on each of the obtained cDNA clones are summarized in Example 7.
  • RNA extracted from human tissues as total RNA (Clontech: adrenal gland (# 640 16-1), uterus (# 640 29-1), testis (# 640 27-1), cerebellum (# 6403 5-1) and whole brain (# 64020-1)), and extracted from human tissues as poly (A) + RNA 'Purified commercial mRNA (Clontech: Caudate) Poly (A) + RNA oligo d T from whole RNA to whole nucleus (# 6575-1), amygdala (# 6574-1), thalamus (# 65882-1) From the RNA mixed with poly (A) -RNA prepared by removing with cellulose, the cDNA library was obtained by the oligocap method (Maruyama, K., et al., Gene, 138: 171-174 (1994)). Each was produced.
  • oligocaplinker-1 SEQ ID NO: 25 was ligated using RNA ligase.
  • the first strand cDNA was synthesized by reverse transcription using oligo dT primer (SEQ ID NO: 26), and the RNA strand was degraded and removed (Suzuki et al., Protein Nucleic Acid Enzyme, 41: 603- 607 (1996); Suzuki, Y. et al., Gene, 200: 149-156.
  • pME18SFL3 (GenBank ABO09864), which is an expression vector, to prepare a cDNA library.
  • the pME18SFL3 vector used above contains the SR ⁇ promoter and SV40 sma11t intron upstream of the cloning site, and the SV40 poly (A) downstream. An attached signal sequence is inserted.
  • the cloning site of pME18SFL3 is an asymmetric DraIII site, and a complementary SfiI site is added to the end of the cDNA fragment. Is unidirectionally inserted downstream of the SRa promoter. Therefore, in a clone containing full-length cDNA, the gene can be transiently expressed by directly introducing the obtained plasmid into COS cells. In other words, it is very easy to experimentally analyze proteins as gene products or their biological activities.
  • the nucleotide sequence of the 5 'end or the 3' end of the cDNA was converted to a DNA sequencing reagent (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine_Terminator Cycle).
  • the nucleotide sequence at the 5 'end of the human cDNA library prepared in Example 1 was compared with the sequence of the known human mRNA in the public database. If the 5 'end is longer than the known mRNA sequence, or if the 5' end is shorter but has a translation initiation codon, it is judged as "full length”. Full length ".
  • EST iMate FL was used by Helix Research to select clones with a high probability of full-length cDNA by comparing them with the EST 5, 5 or 3 terminal sequences in public databases. This is a method developed by Nishikawa Ota et al. The sequence of the 5, 5 and 3 'ends of the cDNA clone analyzed in Example 1 was compared with the base sequence registered in the EST database, and the sequence of the obtained cDNA clone was found to be 5, 5 or 3, If ESTs extending to the side were present, the clone was determined to be "possibly not full length".
  • the length is longer if the end of the EST sequence is 5 or shorter than the EST sequence in the public database, or if the difference is within 50 bases, and if the difference is shorter than 50 bases, the non-full length if the difference is shorter than 50 bases. It was.
  • Example 3 Analysis of base sequence and amino acid sequence of cDNA clone
  • the present DNA c-adrgl 200 155 54
  • the protein encoded by the DNA is referred to as “the present protein”
  • SEQ ID NO: 1 from 2168 bases.
  • the open reading frame (including the stop codon) is composed of nucleotides 39 to 219.
  • the amino acid sequence predicted from the open reading frame consists of 706 amino acid residues (SEQ ID NO: 13).
  • SWISS- (I) Database registration symbols AXO 40998 and the amino acid sequence described in WOO 0/65040 in PROT, PIR, TREMBL, GENPEPT, and PDB Was.
  • the amino acid sequence described in AX040998 and WO 00/65040 consists of 626 amino acids, and the amino acid number 17 to 616 in the amino acid sequence is the amino acid sequence described in SEQ ID NO: 13. with 32% degree of coincidence over 3 X 10- 82 and 655 amino acid residues (identity): value (expected value query sequence is present by chance in a database) - amino acid numbers 25 to 66 1 of SEQ, e It was recognized that. (Ii) Database registration gd- ⁇ -P 50528 and Serine / threonine-protein kinase plol (Fission yeast) were hits.
  • P50528 is composed of 683 amino acids, wherein amino acid numbers 47 to 674 in the amino acid sequence correspond to amino acid numbers 45 to 695 of the amino acid sequence described in SEQ ID NO: 13, and e-value: 6 X it has been found that with a 32% degree of coincidence over 10 _75 Chikaratsu 670 amino acid residues.
  • Serine / threonine-protein kinase (reproduced by foot force. Its content is that Q9R011 consists of 615 amino acids, and amino acid numbers 31 to 558 in the amino acid sequence are the same as those in SEQ ID NO: 13. and amino acid numbers 39-645 No. amino acid sequence, e- value:. 7 X 1 ( ⁇ 71 Chikaratsu 6 13 to have an ⁇ 30% over amino acid residues was observed sequences from these results The protein consisting of the amino acid sequence shown in No. 13 was presumed to be a novel serine / threonine protein kinase.
  • PROS I TE (Nucleic Acids Res., 30: 235-8 (2002)) is a database of amino acid patterns that classify the domain structure ⁇ family according to the similarity of protein functions and search for functionally important sites. According to), amino acids 45-69 are the ATP region (ATP binding site), and amino acids 158-171 are the ST region (the site that phosphorylates the serine-threonine substrate). Yes, it possesses a functionally important site for serine threonine protein kinase, and is considered to have kinase activity.
  • HMMPFAM search also found a sequence that shows the characteristics of the POLO box duplicated region in the amino acid sequence represented by amino acid numbers 511 to 585 (the amino acid sequence entered as POLO-box in P fam).
  • POLO box is known to be a sub-gnorape of serine Z-threonine protein kinase involved in cell cycle, especially G2ZM phase transition and cytokinesis (cytokinesis). Further analysis by P SORT II (Trends Biochem.
  • c-testi 2053667 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) comprises 2135 bases, as shown in SEQ ID NO: 2, of which base number Nos. 36 to 1454 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 472 amino acid residues (SEQ ID NO: 14).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 14 using BLAST.
  • AYO61183 is composed of 790 amino acids, and the amino acid numbers 325 to 788 in the amino acid sequence correspond to the amino acid numbers 7 to 468 of the amino acid sequence described in SEQ ID NO: 14; value: It was found to have 52% identity over 5X10 135 and 471 amino acid residues.
  • the protein consisting of the amino acid sequence shown in SEQ ID NO: 14 was a protein kinase.
  • the protein of the above (ii) is considered to be involved in the function of shortening mRNA polyA in vivo from the literature information in the database (Mol. Cell. Biol., 16: 5744-5753 (1996)).
  • the above-mentioned protein (iii) has been revealed to be involved in the regulation of mitosis, respectively, from literature information in the database (Genomics, 68: 187-196 (2000)). All show involvement in the cell cycle.
  • cu teru 200801 9 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) comprises 3165 bases as shown in SEQ ID NO: 3, of which base number 401 Numbers 1 to 1960 are open reading frames (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 519 amino acid residues (SEQ ID NO: 15).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 15 using BLAST.
  • BC010640 was composed of 491 amino acid residues. Amino acid numbers 9 to 491 in the amino acid sequence corresponded to amino acid numbers 37 to 519 in the amino acid sequence described in SEQ ID NO: 15. The difference between the two sequences is the N-terminal 36 residues of this protein and the N-terminal 8 residues of BC010640 (Fig. 1).
  • a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 15 using HMMPFAM.
  • PRO SITE Nucleic Acids Res., 30: 235-8. (2002)
  • sim4 Gene Res., 8: 967-74 (1998)
  • this DNA is mapped to 13 exons on human chromosome 8, and BC010640 shares its 4th to 13th exons, but has another 3rd and 3rd exons. It was found that the exon containing the translation initiation site differs between this DNA and BC010640, resulting in a difference in the terminal amino acid sequences of both proteins. This difference may lead to differences in enzyme activity, binding interaction with other proteins, and expression tissues. Based on the above, this protein is a splicing variant of BC010640, serine / threonine kinase 3 (Ste 20, yeast homolog) (Human).
  • BC010640 is a member of the human Ste20-like kinase (MST), a homolog of the budding yeast Ste20, which is a substrate for caspase and increases susceptibility to apoptosis (J. Biol. Chem., 276: 19276-19285 (2001)). Based on the above, this protein is considered to be a Ste20-like serine-threonine protein kinase involved in apoptosis.
  • the location of the mapped DNA on chromosome 8 (Q 22.2), and q 22 -q 23 contain cohen's syndrome, and q 22.2 contains Talippel-Fail syndrome (with laryngeal malformation) causative loci. It was speculated that these genes may be the causative genes of these diseases and that the mutations of this DNA, including splicing variants, can be applied to diagnostics for these diseases.
  • db EST (Nature Genetics, 4: 332-3 (1993)) performed B LA ST searched for, e - value: 1 where X 10- 50 Dehi Tsu preparative human EST were extracted 5 more than a certain tissue, normal bone marrow, Kidney ⁇ prostate ⁇ placenta 'whole brain, cancerous uterus was obtained. In addition, this DNA was cloned from a library derived from a child.
  • This protein is a function or disease specific to these tissues and cells, such as uterine cancer, prostate cancer, brain tumor, myeloma, leukemia, malignant lymphoma, and other neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease.
  • Diseases depression, central diseases such as schizophrenia, autoimmune diseases, inflammatory diseases, allergic diseases, glomerulonephritis, nephrotic syndrome, kidney diseases such as renal failure, bone marrow diseases such as Gaucher's disease, etc. It can be used as a target for diagnostics and therapeutics. ⁇
  • present DNA the protein encoded by the DNA is referred to as “present protein”
  • SEQ ID NO: 4 the protein encoded by the DNA is referred to as “present protein”
  • SEQ ID NO: 4 consisting of 2817 bases, of which base number 42 Numbers 1 to 733 are open reading frames (including a stop codon).
  • Amino acid sequence predicted from open reading frame consists of 563 amino acid residues
  • SEQ ID NO: 16 A homology search was performed for the amino acid sequence of SEQ ID NO: 16 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). Database registration symbol AX 405737
  • this protein lacks the amino acid corresponding to amino acid Nos. 35 to 51 of AX405737 and 1 residue of No. 489, and amino acid No. 510 of AX405737. , 51 Nos. 5, 512, and 51 No substitution of Glycine Zalanine, Isoleucine / Lanine, Serine Zleucine, and Alanine Z glycine at amino acids ( Figure 3).
  • this DNA has the base number of AX405737 of 209 to 2
  • HMMPFAM was used to perform a protein feature search on the amino acid sequence of SEQ ID NO: 16, and the amino acid sequence represented by amino acids 132 to 379 showed a protein kinase domain characteristic sequence (Pfam! As kiIIase. Amino acid sequence to be entered).
  • PX domain an amino acid sequence entered as PX in Pfam
  • the PX domain is a phosphoinositide binding domain and is known to be involved in intracellular signal transduction. Since this protein lacks a part of the PX domain compared to AX405737, it may have a different interaction from AX405737.
  • the cD ⁇ sequence of the D D and AX405737 was mapped to the genomic sequence.
  • this DNA was aligned to 18 exons, and AX405737 was aligned to 19 exons on the database registration code AC135507, clone RP11-1-80203 of human chromosome 3 (Fig. 4).
  • the exons corresponding to the 2nd to 16th exons of this DNA are also present in AX405405737, but this DNA lacks one exon between the 1st and 2nd exons.
  • the 17th exon of this DNA is deleted in AX405737, but this region is composed of 34 bases, so the frame is shifted, and the C-terminal amino acid sequence of both is different.
  • the present DNA of SEQ ID NO: 4 is AX405737 and WO02 / 226
  • No. 60 is a splicing variant of the nucleotide sequence described in It turned out that I was coding Ize. Both have different amino acid sequences at the N-terminal and C-terminal, and therefore may have different binding, interaction, and expression tissues with other proteins.
  • p21-14 always contains the position (pl4.3) on chromosome 3 where this DNA was mapped. It is found that there is a locus that causes chromosomal recessive hearing loss, suggesting that this DNA may be the causative gene of these diseases, and that mutations of this DNA including splicing variants may be applied to diagnostics for these diseases Was done.
  • This protein is used for functions and diseases unique to these tissues and cells, for example, cancer such as lymphoma, leukemia, brain tumor, testicular cancer, muscular dystrophy 'myopathy' tetany, skeletal muscle disease such as myasthenia gravis, immunity It can be speculated that it may be related to systemic diseases, infertility, autosomal recessive hearing loss, etc., and is expected to be useful as a target for diagnostics and therapeutics for these diseases.
  • cancer such as lymphoma, leukemia, brain tumor, testicular cancer, muscular dystrophy 'myopathy' tetany, skeletal muscle disease such as myasthenia gravis, immunity It can be speculated that it may be related to systemic diseases, infertility, autosomal recessive hearing loss, etc., and is expected to be useful as a target for diagnostics and therapeutics for these diseases.
  • cb race 3003920 (hereinafter, referred to as “present DNA” and a protein encoded by the DNA is referred to as “present protein”) is represented by SEQ ID NO: 5. As shown, it consists of 5342 bases, of which bases 371 to 3874 are the open reading frame (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 1167 amino acid residues (SEQ ID NO: 17). A homology search was performed for the amino acid sequence of SEQ ID NO: 17 using BLAST, and it was found in the NRDB protein database (a database of non-redundant amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB).
  • the amino acid sequence described in AX 26251 6 (unnamed 0RF) and WO 01/73050 has an e-value of 0.0, and 99% identity over 1160 amino acid residues. Hit in degrees. From this BLAST search alignment, this protein shows that amino acids corresponding to amino acid numbers 309, 456, and 557 of AX 262516 have substitutions for threonine Z isoleucine, threonine alanine, and lysine Z asparagine, respectively. It was found that the N-terminal 3 residues differ from the N-terminal 72 residues of AX262516, and the C-terminal 4 residues of this protein and the C-terminal 12 residues of AX262516 differ (Fig. 5).
  • this DNA lacks the base corresponding to 148 bases of base numbers 386 to 533 of AX262516.
  • a protein characteristic search by HMMP FAM was performed on the amino acid sequence of SEQ ID NO: 17, and the amino acid sequence represented by amino acid numbers 1-221 was found to be a sequence exhibiting the characteristics of a protein kinase domain.
  • PRO SITE According to Nucleic Acids Res., 30: 235-8 (2002), of the protein kinase domain of AX262516, amino acids 27 to 51 were ATP regions (ATP binding sites). It corresponds to the 3 'hexon of AX 262516, and is deleted in this DNA.
  • AX 26251 6 starts near the center of the third exon of this DNA, and the reading frame at the N-terminal of both is different . Since AX262516 has an insertion consisting of 148 bases not present in this DNA immediately after the third exon equivalent, a frame shift occurs, and the translation frames after the fourth exon correspond to both. Also, AX2
  • this protein is a function or disease specific to these tissues or cells, for example, cancer such as lymphoma, leukemia, myeloma, lung cancer, brain tumor, spinal cerebellar degeneration, inflammatory disease, allergic disease, autoimmune disease, muscle atrophy It may be related to sex lateral sclerosis, congenital erythrocyte dysplasia anemia, etc., and is expected to be useful as a diagnostic or therapeutic target for these diseases.
  • cancer such as lymphoma, leukemia, myeloma, lung cancer, brain tumor, spinal cerebellar degeneration, inflammatory disease, allergic disease, autoimmune disease, muscle atrophy It may be related to sex lateral sclerosis, congenital erythrocyte dysplasia anemia, etc., and is expected to be useful as a diagnostic or therapeutic target for these diseases.
  • present DNA cb race 3038687
  • present protein protein encoded by the DNA
  • the gene for human LMR 1-h (GENE SEQ database nucleotide sequence registration code AA V32449) described as SEQ ID NO. 2 in WO 98Z22507 consists of 5267 bases and is open reading at base numbers 515 to 4138 The frame may encode a protein of 1207 amino acids (LMR1-h).
  • the amino acid sequence described in the publication (GENESEQ database amino acid sequence registration code AAW48842) discloses a protein consisting of 1383 amino acids by virtually synthesizing a protein sequence linked to the rat upstream sequence 176 amino acid. (This is called LMR 1— r + h) ( Figure 7).
  • the rat LMR1-r gene (AAV32448) described as S EQ ID NO. 1 in WO 98/22507 consists of 2572 bases and takes the largest open reading frame, base numbers 13 to 2571. There is no stop codon, and the number of amino acid residues in this part is 853.
  • the publication describes a protein (LMR11r) consisting of 848 amino acids derived from base numbers 13 to 2556 of this base sequence (AAW48841).
  • Rat LMR 1-r (AA W48841) has a short C-terminus, indicating an incomplete length due to an unknown stop codon. As described above, human LMR1-h has an incomplete N-terminus, and rat LMR1-r has an incomplete C-terminus. It's just The amino acid sequence of SEQ ID NO: 18 differs from the amino acid sequence of LMR1-r + h in the following points.
  • This protein lacks the N-terminal 9 amino acids of LMR1-r + h, but the sequence difference in this region is considered to reflect the species difference between human and rat. From the genomic mapping described below, the sequence near the translation initiation site of the cDNA corresponds to the human genome sequence.
  • LMR1 is a membrane receptor tyrosine kinase with little extracellular domain. Analysis of this protein with the transmembrane domain prediction software TMp red (Biol. Chem. Hoppe-Seyler, 374: 166 (1993)) reveals that the transmembrane domain consisting of LAVVAVS FSG LFAV I VLMLA CL at amino acids 32 to 53 It was hit. In addition, when the HMMP F AM search, to amino acid number 12 No. 5-395 of the protein e- value: protein kinase domain was hit by 3. 3 X 10- 47. Since this protein and LMR1-h have a difference on the C-terminal side from the intracellular protein kinase domain, this protein may be involved in signal transduction different from LMR1-h.
  • NRNEE nucleotide sequence database a non-overlapping nucleotide sequence database excluding ESTs created from EMB L GenBank and DDB J
  • it is derived from human chromosome 17 Mapped to RPCI-13 Human Female BAC (database registration code AC 1 299 9). Therefore, on the sequence of AC1299919, which is the genome sequence, the DNA encoding this DNA and the DNA encoding LMR1-h (WO 98/98) were obtained using sim4 (Genome Res. 8: 967-74 (1998)). No. 22507) (Fig. 8).
  • LMR 1-h had a long exon, including exons 11, 12, and 13 of this DNA.
  • this DNA has a deletion of 108 bases and 36 amino acids by splicing between bases 11 and 12 (base No. 1481Z1482) and a splice of 263 bases between bases 12 and 13 (base No. 1481Z1482).
  • 2660 2661 causes a deletion of 88 amino acids and a frame shift, and ends the translation by adding 19 amino acids at the 13th exon (base Nos. 266 1-3344) after splicing.
  • LMR1-h continues translation and produces a long C-terminal protein.
  • LMR1 LMR1 restricted to nerve cells.
  • This DNA is a full-length LMR1 isolated from a cerebellar cDNA library and having a different sequence in its intracellular domain. From this fact, this protein is used for cancers such as brain tumors, neuroblastomas and melanomas, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, spinocerebellar degeneration, central diseases such as depression, anxiety, and schizophrenia. It may be involved in endocrine diseases such as diabetes, inflammation, etc., and can be used as targets for diagnostics and therapeutics for these diseases. (7) c ⁇ brace 3050764 (SEQ ID NOs: 7, 19)
  • cb race 3050764 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3346 bases as shown in SEQ ID NO: 7, of which base number 1744
  • the open reading frame (including the stop codon) is from No. 2685 to No. 2685.
  • the amino acid sequence predicted from the open reading frame consists of 313 amino acid residues (SEQ ID NO: 19).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 19 using BLAST.
  • Cell division kinaselO / PISSLRE (cdk 10, Human) registered under database registration code Q15131, with a S e-value: 5 X 10 179 with a 99% match over 306 amino acids
  • the cdk10 protein is a cyclin dependent kinase consisting of 360 amino acid residues and having a protein kinase domain at amino acids 39-323. At amino acids 80 to 86 there is a PIS SLR E sequence to which a growth inhibitory factor binds. Since amino acid sequence numbers 55 to 360 of cdk10 correspond to amino acid numbers 8 to 313 of this protein, this protein was considered to be a variant that differs from cdk10 at the N-terminus.
  • HMMPF AM search was performed on the amino acid sequence of SEQ ID NO: 19, and a protein kinase domain was found at amino acids 8 to 276. It is shorter on the N-terminal side than the protein kinase domain of cdk10 (amino acids 39-323).
  • the difference between the N-terminal amino acid sequences of the two proteins is due to the difference in the ethasons that encode them.
  • This DNA is a splicing variant of cdk10.
  • This protein and cdk10 may differ in substrate specificity and activity due to differences in the N-terminal part of the protein kinase domain.
  • cdk10 protein is involved in the progression of the cell cycle from G2 to M, and that overexpression suppresses growth (Cancer Res., 55: 3992-3995 (1995)). Although its protein is expressed ubiquitously in adult fibroblasts, it is expected to be a tumor suppressor because it is particularly high in cells that have undergone terminal differentiation, but no mutation has been observed in breast cancer ( Genomics, 56: 90-97 (1999)), but details of its function are unknown. However, this protein has an N-terminal sequence (derived from the first exon) that is different from cdk10, and may be under different expression control. Therefore, this protein has an important role in cell proliferation, differentiation, carcinogenesis, and tumor suppressor function. It can be used as a target for diagnostics and therapeutics for involvement, immuno-inflammation, and neurodegenerative diseases.
  • c-bra my 3018357 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3576 bases as shown in SEQ ID NO: 8, of which base number Nos. 254 to 2554 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 766 amino acid residues (SEQ ID NO: 20).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 20 using BLAST.
  • SWISS a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB
  • Serine / threonine protein kinase 29 (human; listed as registration code Q 8 I WQ 3 also hits higher with 93% identity over e-value: 0 and 749 amino acids.
  • This sequence is composed of 736 amino acids, whose amino acid numbers 3 to 736 correspond to the amino acid numbers 34 to 766 of this protein. It seems that the C-terminal variant is different.
  • the ORF derived from this DNA is present in the 1st to 20th exons, and the ORF of AX327993 is present in the 1st, 2nd to 18th and 18th exons.
  • the difference in N-terminus is due to the initiation of translation from a different exon
  • the difference in C-terminus is that this DNA skips the 18th and 18th exons and continues translation downstream from the 19th exon.
  • the translation ends at the 18th ⁇ xon. From the above, it was found that this DNA and AX327993 are splicing variants from the same gene.
  • AX327993 is composed of 2219 bases, and their base numbers are 141 to 1992, 2084 to 2219, and 99% and 100%, which correspond to the 480 to 2331 and 2328 to 2463 of the present DNA, respectively.
  • the registration number A X 7 66346 (DNA described as SEQ ID NO. 42 in Patent WOO 2Z18557) is higher than AX 327993.
  • AX 766 346 consists of 2647 bases, whose base numbers 77 to 1975 and 1975 to 2647 correspond to 100% and 99% of 480 to 2378 and 2800 to 3470 of the present DNA, respectively.
  • the registration number AX661191 (DNA described as SEQU ID NO.1 in Patent WO 02/059287) is higher than AX327993.
  • AX661191 is composed of 2007 bases, and base numbers 89 to 1987 correspond 100% to 480 to 2378.
  • This DNA was isolated from tonsils of the brain, but a homology search was performed on human dbEST (Nature Genetics, 4: 332-3 (1993)) to examine its expression distribution. 10 1M 1 clone a ratio of 3 clones and derived from fetal brain from the eye to the following I did it. Based on the above, this DNA and this protein function in the development and differentiation of the brain, diagnostic and therapeutic drugs for anxiety, depression, schizophrenia, neurodegenerative diseases, cancer, inflammation, diabetes, and ophthalmology. (Glaucoma, cataract, retinopathy, etc.) can be used as a diagnostic or therapeutic target.
  • present DNA cb r awh 3022866
  • present protein consists of 4547 bases as shown in SEQ ID NO: 9; Nos. 3898 to 3898 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 1288 amino acid residues (SEQ ID NO: 21).
  • a homology search was performed on the amino acid sequence of SEQ ID NO: 21 using BLAST. Sequence database) In the Chuo patent database GENESEQ (amino acid sequence), a human protein kinase (SGK040, 909 amino acids) described as SEQ ID NO.
  • diagnosis and treatment of diseases related to cell division such as cancer, and use as target of diagnostics and therapeutics for immunoinflammation (eg, autoimmune diseases, nephritis, etc.), hypertension, neurodegenerative diseases, etc., based on the tissue information of the expression Conceivable.
  • present DNA cb r awh 3043827
  • present protein consists of 4222 bases, as shown in SEQ ID NO: 10, of which base number 146 Numbers 3406 are open reading frames (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 1086 amino acid residues (SEQ ID NO: 22).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 22 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWISS-PROTs PIR, TREMBL, GENPEPT, and PDB).
  • ACK1 Homo sapiens activated p21cdc42Hs kinase (ACK1) of 1036 amino acids registered in the database registration code L1378 was hit with e-value: 0 and 953 concordance over 1053 amino acids.
  • amino acid numbers 64 to 577 correspond to amino acid numbers 1 to 513 of ACK1
  • amino acid numbers 578 to 592 It has the insertion and insertion of 55 amino-amino acids
  • ((cc)) amino-amino acid number 559933 ⁇ 11004422 is the amino-amino acid number of AACCKK 11 551144 ⁇ 996622 And ((dd)) aaminominonic acid number no.
  • 11004422ZZ110044 having no deletion of 3300 aaminominonic acid between number 33, ((ee ))
  • the number of aminoaminoic acid number 11004433 ⁇ 11008866 is identical to the number of aminoaminoic acid number 999933 ⁇ 11003366 of AACCKK11 ((Fig. 1155)). .
  • This DNA has a 15 amino acid insertion by having the first exon not present in ACK1.
  • ACK 1 has another insertion of the first 2 'ethathon between twelfth and thirteenth exons of the present DNA. This is a 30 amino acid deletion for this protein.
  • ACK1 contains the tyrosine protein kinase domain, SH3 domain, and cdc42Hs binding domain ⁇ clathrin binding domain from the N-terminus.
  • hMMP F AM of the protein kinase domain is amino acid number 180 to 450 No., 45 No. 4 to 509 SH3 domain amino acid number, also paper information (Nature, 363: 364-367 (1993))
  • the cdc42Hs binding region was found at amino acids 509-552
  • the clathrin binding region was found at amino acids 639-723.
  • ACK1 is an activated p21cdc42Hs kinase that phosphorylates the activated small G protein and inhibits its conversion to the inactivated form, keeping the G protein in the activated form.
  • Rho family of low molecular weight G proteins GTP binding protein p2l
  • RACI Rho
  • Rho Cdc42Hs
  • GTP-bound type active form
  • GDP-bound type active form
  • GEF guanine nucleotide exchange factor
  • ACK1 is a tyrosine kinase that binds to activated Cdc42Hs and inhibits its GTPase activity, and is involved in cytoskeleton, cell differentiation, cell proliferation and the like. Further, ACK1 will accumulate the Db 1 phosphorylates active small G protein is a GEF (cdc 42H S) induces Akuchin fibers cytoskeletal. ACK1 is known to have a short C-terminal variant, ACK2.
  • phosphoric acid is phosphorylated by epidermal growth factor and bradykinin, and regulates cytoskeletal formation in response to extracellular signals.
  • ACK 1 also binds to clathrin and fc) exerts it on receptor mediated endocytosis by clathrin-coated vehicles.
  • Clathrin is an organelle-backed protein called coated vehicle or coated pit in which receptors form clusters. Involved in Itsis. Endocytosis of receptors into cells is known for many receptors that also function as HIV receptors, including chemokine receptors, adrenergic receptors, insulin receptors, and LDL receptors. Incorporation of the ligand-bound receptor regulates extracellular signaling or recycles the receptor.
  • This protein has a 15 amino acid insertion between the cdc42 binding region and clathrin binding region, and its binding and interaction with cdc42 and clathrin may be different from ACK1. Based on the above, this protein can be used to diagnose cancer, arteriosclerosis, diabetes, HIV, inflammation, diseases related to receptor uptake, diseases related to neurotransmission disorders, dementia such as Alzheimer's disease, hypertension, glaucoma, etc. Drugs ⁇ They can be used as targets for therapeutic drugs.
  • c—brtha 2034874 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) is composed of 3857 bases as shown in SEQ ID NO: 11; Nos. 55 to 1287 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 410 amino acid residues (SEQ ID NO: 23).
  • a homology search was performed using the BLAST for the amino acid sequence of SEQ ID NO: 23.
  • MAP kinase kinase 4 Dual specincity mitogen-activated protein kinase kinase 4, MAP kinase kinase 4 (MAP KK 4), JNK activating kinase 1, c-Jun N-terminal kinase kinase 1 ( J NKK) and SAPK / ERK kinase 1 (SEK1)) hit 97% of e-value: 0 and 410 amino acids with 97% agreement.
  • MAP KK4 is 399 amino acids in length. This protein is a variant with an insertion of 11 amino acids between amino acids 39 and 40 of MAP KK4 (amino acids 40-50 of this protein) (Fig. 17).
  • HMMP FAM search of the amino acid sequence of SEQ ID NO: 23 reveals a protein kinase domain at amino acid number 113 to 378, and amino acid number 236 to ST region (characteristic sequence of serine / threonine protein kinase) at No. 249 ATP region (ATP binding site of protein kinase) was detected at amino acids 119-143.
  • the nucleotide sequence was compared to determine whether the insertion of 11-amino acid in this protein was due to splicing (Fig. 18).
  • this DNA and L36870cDNA encoding MAPKK4 were mapped to the genome using sim4 (Genome Res., 8: 967-74 (1998))
  • this DNA was found to be on human chromosome 17 Although it has 12 exons, ⁇ A ⁇ 4 lacks its second exon (base Nos. 170-203 of this DNA, corresponding to 11 amino acids). This indicates that the present DNA has 11 amino acids that are not present in MAP KK4 by adding an exon.
  • the nucleotide sequence of cDNA including EST) having homology with this specific etason portion was searched, but was not found. This suggests that this exon is a rare molecule, and that this DNA is a novel molecule.
  • MAPKK4 is a dual specificity protein kinase belonging to serine / threonine protein kinase.
  • MAPK Serine Z threonine of K4 is phosphorylated and activated by MAP3K / MEKK, and J NK1 (MAPK 8), J NK2 corresponding to MAPK (MAPK 9),]]] ⁇ 3 is activated in the same way as 1) 38 (MAPK 14).
  • transcription factors downstream thereof are activated, and genes involved in apoptosis are expressed. Analysis of MAPKK4 knockout mice has been shown to be involved in T cell differentiation, survival signals and liver organogenesis.
  • MAPKK 4 is highly expressed in skeletal muscle, but is also found in other tissues. MAP KK4 also phosphorylates JNK3, which associates with and binds to ⁇ -arrestin2, a protein involved in receptor internalization (related to GPCR desensitization). 133 This results in crosstalk between GPCR signaling and the MAPK signaling cascade.
  • This protein is used for apoptosis against immune, liver, brain and other stress, cell proliferation, cancer, abnormal signal transduction by GPCR, elongation of nerve cells, dementia, liver regeneration, diabetes, blood pressure regulation, amyotrophic lateral sclerosis Or, it is presumed to be involved in self-immune diseases, immuno-inflammatory diseases such as allergies, etc., and it can be used as a diagnostic or therapeutic drug target for these diseases.
  • the present DNA c-test 1 40 5 2 1 9 7
  • the protein encoded by the DNA is referred to as “the present protein”
  • SEQ ID NO: 12 It consists of 05 bases, of which base numbers 407 to 1690 are the open reading frame (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 427 amino acid residues (SEQ ID NO: 24).
  • a homology search was performed for this protein using BLAST, and the database was registered in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMB L, GENPEPT, and PDB).
  • ⁇ ⁇ is a serine Z-threonine pruiten kinase consisting of two regulatory subunits (R) and two catalytic subunits (C) .
  • the tetramer (R 2 C 2) exists in the cytoplasm as an inactive form, but Gs-coupled.
  • adenylyl cyclase Upon receipt of a signal from the receptor, adenylyl cyclase is activated and cAMP is generated from ATP, which binds to the PKA Regulatory subunit (R) to release the catalytic subunit (C) and activates it.
  • R is a protein that stays in the cytoplasm and anchors C to the cytoplasm. When C moves away from R, it interacts with PKI (protein kinase inhibitor) through another region (PRS1 domain; arginine at position 134, glutamic acid at position 204, and tyrosine at position 236) to enter the cytoplasm. Anchored.
  • PKI protein kinase inhibitor
  • the RI type (RIa, RI ⁇ ) involved in cell proliferation and the RII type (RII ⁇ , RII) involved in differentiation are known, and for the C subunit, C and C ⁇ are known.
  • Literature sources report that C ⁇ translocation to the nucleus when inhibition of C anchored in the cytoplasm by R by antisense oligonucleotides of RI ⁇ .
  • Substrates for PKA include Glycogen phosphorylase kinase (GPK) and cAMP responisible element binding protein (CREB).
  • Glycogen is hydrolyzed by Glycogen phosphorylase, which is activated by phosphorylation by PKA, and glycogen degradation proceeds.
  • CREB binds two molecules to the cAMP responsible element, phosphorylates serine No. 133 by proteinase such as PKA, and activates genes such as somatostatin and SF-I (steroid genie factor-1). .
  • amino acid numbers 1 to 91 are a novel sequence. It may have a function different from that of the original PKA catalytic subunit ⁇ by a protein that specifically binds to this region or by subjecting it to specific expression regulation.
  • this DNA was isolated from testis, and it was estimated from experiments on knockout mice of PKA catalytic subunit that this protein is involved in sperm maturation, regulation of liver and kidney protein expression, regulation of glycogen synthesis, and IGF Use as a target for diagnosis and treatment of cancers such as liver cancer, kidney cancer, testicular cancer, hepatitis, cirrhosis, nephritis, diabetes, inflammatory diseases, infertility, diseases related to GPCR signaling, etc. Can be considered.
  • Example 4 Measurement of kinase activity
  • Example 3 For the cDNA clone presumed to have kinase activity in Example 3, the protein that it encodes was synthesized using a cell-free protein synthesis system, and it was determined whether the protein had kinase activity. was analyzed by the following biochemical experiments.
  • the open reading frame (ORF) fragment of the cDNA clone presumed to have kinase activity in Example 3 was used as a primer on the 5 side and the following primers specific to each clone. Obtained by PCR using primers.
  • This is used to cleave the translation control region containing the SP6 promoter, glutathione, S-transferase gene, PreScission Protease (Amersham Pharmacia Biotech), cleavage site, DNA closing site (Sma.I, Sf_iI) It was inserted into the clonindustite of a vector (pEU-SS4) having a poly (A) signal sequence.
  • RNA polymerase manufactured by Promega
  • the resulting RNA was extracted with phenolic clonal honolem, precipitated with ethanol and precipitated with Nick Column (Amersham Pharmacia Biotech).
  • the method of cell-free protein synthesis using a wheat germ extract by a dialysis method followed the method described previously (Endo, Y. et al., J. Biotech., 25: 221-230 (1992)).
  • the reaction solution contains 24% of the wheat germ extract by volume, and has the following composition according to the method of Erickson et al.
  • the above reaction solution was placed in a floater riser (Spectra / Float-A-Lyzer (Biotech RC), molecular weight cut off: 10 kDa, volume: 1 ml), and the dialysis solution was 40 times as large as the reaction solution.
  • the reaction was performed in a dialysis system against 2 mM ATP, 0.25 mM GTP, and 16 mM creatine phosphate at 26 ° C for 48 hours.
  • the dialysate was centrifuged at 16,000 rpm for 5 minutes, and the supernatant was separated.
  • This supernatant is diluted 5-fold with 50 mM Tris-HCl buffer (pH 8.5) containing 15 OmM sodium chloride and 1 OmM dithiothreitol, and Darfin, an affinity resin equilibrated with the same buffer, is used.
  • the affinity resin half the amount of the obtained centrifugal supernatant was used as the affinity resin.
  • the column was washed with 2 units of sZ1 concentration of PreScission protease (manufactured by Amersham Biosciences) in the same buffer. An equal volume of the double-diluted solution was added to the affinity resin, and a cleavage reaction was performed at 4 ° C. for 40 hours. Then, the target protein was eluted with the buffer solution.
  • PreScission protease manufactured by Amersham Biosciences
  • the target protein isolated in (1) above was quantified using serum albumin as a standard. 0.1 g of the target protein was diluted with 0.1 mM SrngZm 1 ⁇ serum albumin and 8 mM magnesium chloride in 5 OmM Tris.HCl buffer (pH 7.4) to a final concentration of 1 to 1 OmM. After adding threitol, 1] ⁇ After incubation at room temperature for 24 hours, luciferase / luciferin kit
  • B430206E18 (SEQ ID NO: 57, Nature, 420: 563-573 (2002)), which is a mouse full-length cDNA encoding the serine protease in the system of (1) above, was used as a negative control.
  • 0.1 ⁇ g of isolated protein was used. Those that did not perform the experiment are denoted as rrt. table 1
  • the target protein isolated in (1) above was quantified using serum albumin as a standard.
  • 0.1 Zg of target protein is converted to a standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK, PTK1, PTK2) as a substrate: Promega, MLCKS, Ca MK II: Sigma, Syntide2: BACHEM
  • the peptides were separated at a flow rate of 1 m 1 / min by a linear concentration gradient of / 0 acetonitrile over 60 min. Peptide elution was measured by absorbance at 215 nm. As a control, the reaction solution without addition of the target protein was similarly separated, and the absorbance at 215 ⁇ was measured (FIG. 21).
  • Polypeptides in which a decrease in peak and a change in elution position are detected can be determined to be substrates for kinase activity of the target protein.
  • Human cervical cancer cell line HeLa (ATCC CCL-2), human fetal kidney cell line HEK293 (ATCC CRL 1573), neuroblastoma cell line SH-S Y5 Y (ATCC CRL-2266), promyelocytic leukemia-derived cell line HL 60 (ATCC CCL-240), liver cancer-derived cell line Hep G 2 (ATCC HB-8065), astrocytoma-derived cell line KI NGS-1
  • RNA was extracted from strain SW620 (ATCC CCL-227), breast cancer-derived cell line BT-474 (ATCC HT B-20) and metastatic ovarian adenocarcinoma-derived cell line AsPC_l (ATCC CRL-1682).
  • Type II cDNA was synthesized using random primers.
  • cDNAs derived from human tissues were purchased from Clontech (normal breast, breast cancer, normal colon, colon cancer, normal kidney, kidney cancer, normal liver, lung cancer, normal rectum, rectum cancer, normal small intestine, small intestine cancer, normal Stomach, gastric cancer and placenta).
  • Clontech normal breast, breast cancer, normal colon, colon cancer, normal kidney, kidney cancer, normal liver, lung cancer, normal rectum, rectum cancer, normal small intestine, small intestine cancer, normal Stomach, gastric cancer and placenta.
  • the following human tissue-derived cDNA was purchased from Biochain (fetal brain, normal brain, normal frontal lobe, Alzheimer's disease frontal lobe, normal hippocampus, Alzheimer's disease hippocampus, normal thalamus, normal kidney, lupus disease kidney, normal liver, cirrhosis liver , Normal spleen, normal skeletal muscle, normal fat, normal spleen, heart and leukocytes).
  • Double labeled probe AACATCGGCATCCTGTTCMCGAC (SEQ ID NO: 42)
  • Double-labeled probe TGCTCCCTGGATTGACCTCAGTC (SEQ ID NO: 45)
  • the mRNA level of ca drgl 2001554 is very low overall, but it is a gastrointestinal tissue such as gastric cancer, normal small intestine, normal rectum, and colon cancer. , And weak expression was observed in the neuroblastoma-derived cell line SH-SY5Y and the like.
  • the mRNA of c-testi 2053667 is expressed in all cells and tissues as far as it is examined. High expression was also observed in the cell line SW 620 derived from cervix and colorectal adenocarcinoma, the cell line derived from metastatic knee adenocarcinoma As PC-1 and the cell line derived from neuroblastoma SH-SY5Y. From these results, the above cDNA and the protein encoded by the cDNA can be applied to the treatment and diagnosis of cancer, immunity, inflammatory diseases, neurodegenerative diseases, respiratory diseases, diabetes and the like. In addition, the protein encoded by the cDNA may be involved in the above-mentioned diseases involving tissues with high mRNA expression levels.
  • Example 6 Inhibition of Expression by Introducing s ⁇ RNA into Cells and Effects on Cell Death and Cell Proliferation
  • siRNA designed to target c-testi 2053667 into HEK293 cells and HeLa cells After introducing siRNA designed to target c-testi 2053667 into HEK293 cells and HeLa cells, and confirming the effect of introducing the siRNA into c-testi 205 3667 mRNA, the proliferation of HEK293 cells and HeLa cells And the effect of inducing cell death were examined.
  • those designed corresponding to the sequence of lucif erase 3 ⁇ 4f ⁇ (P. pyralis luc gene: SEQ ID NO: 55) of the negative control siRNA (Photinus pyralis) were used. The synthesis was outsourced to Proligo or Qiagen.
  • sequences shown in SEQ ID NO: 49 and SEQ ID NO: 51 correspond to the target gene c-testi 2053667 (translation region is 1419 base pairs in full length from base number 36 in SEQ ID NO: 2), counted from the translation start site of the sense strand 966 to 966. These correspond to bases 986 and 1192-1212, respectively.
  • sequences shown in SEQ ID NO: 50 and SEQ ID NO: 52 correspond to the bases at positions 984 to 964 and 1210 to 1190 of the antisense strand, respectively, counted from the translation initiation site of c-testi 2053667.
  • sequences shown in SEQ ID NO: 53 and SEQ ID NO: 54 correspond to the P.
  • pyralis luc gene (the translation region is 1653 base pairs in full length from nucleotide number 1 to 1653 of SEQ ID NO: 55) counted from the translation initiation site of the sense strand.
  • the 58th to 58th bases correspond to the 56th to 36th bases of the antisense strand, respectively.
  • siRNA of testi 205366 7-964 was prepared.
  • siRNA of c-testi 20 53 66 7-190 can be obtained by combining the siRNA of SEQ ID NO: 53
  • a negative control siRNA was prepared by associating the sense strand with the antisense strand of SEQ ID NO: 54.
  • siRNA For the production of siRNA, for the contract of Proligo, sense single-stranded RNA and antisense single-stranded RNA were each received as a single item, and they met themselves.
  • the company commissioned a meeting. When his meeting, a mixture of the sense strand RNA and antisense strand RNA 10 ⁇ ⁇ Tris-HCl ( pH7.5), was heated 2 min at 20 ⁇ NaCl reaction liquid at 9 0 ° C, further gradually After lowering the temperature to 37 ° C, the mixture was incubated at 37 ° C for 1 hour, and then left to reach room temperature. The formation of double-stranded RNA by association of the sense strand and the antisense strand was detected by 2% agarose gel electrophoresis in a TBE buffer.
  • HEK293 cells and HeLa cells were used as the culture cells, and Dulbecco's modified Eagle's medium (manufactured by Sigma) supplemented with non-deprived 10% fetal bovine serum (manufactured by JRH) was used. 3 7 ° C, 5% C0 2 and cultured in the presence.
  • HEK293 cells were seeded at a density of 1.4 ⁇ 10 5 cells / ml on a 24-well plate (collagen type 1 coated, Iwaki Glass Co., Ltd.) at a volume of 1 ml per 1 ⁇ l, and after 1 day GeneSilencer siRNA Transfection Reagent (Gene Therapy Systems) was used to introduce a total of 50 nM of each siRNA.
  • the concentration of siRNA was expressed as a molar concentration in the presence of 1 ml of medium per 1 ⁇ l, considering the state of double-stranded RNA as one molecule.
  • HeLa cells are seeded at a density of 0.7 ⁇ 10 5 cells / ml on a 24-well plate (24-well plate (manufactured by Greiner)) at a volume of lml / well, and siRNA is introduced in the same manner as for HEK293 cells. did.
  • the DNA was recovered by solubilization using a Solution (manufactured by Applied Biosystems), and total RNA was extracted and purified using a nucleic acid extractor ABI PRISM 6100 Nucleic Acid PrepStation (manufactured by Applied Biosystems). Further
  • ReverseTranscriptaseXL (AMV) for RT-PCR, Ribonuclease inhibitor Random Primer, 25 mM MgCl 2 solution, lOxPCR Buffer (TaKaRa), dNTP
  • Reverse transcription reaction was performed using Mixture (lOmM) (manufactured by T0Y0B0) to obtain a cDNA preparation.
  • a quantitative PCR device ABI PRISM 7000
  • c-testi 2053667 gene in HEK293 and HeLa cells was inhibited by either testi 2053667-964 or testi 2053667-1190 siRNA, or by a mixture of these siRNAs (Fig. 31). All values are relative to the expression level of the c-testi 2053667 gene (normalized by GAPDH amount), with the value of the cell group not transfected with siRNA (non-transfected group) as 100%. expressed. In addition, these data show the average value of the 3 ⁇ -well experiment, and the vertical line in the figure shows the standard deviation.
  • c— testi 2 In the group to which siRNA for 053667 was added at 50 nM, testi 20 53667-964 alone, testi 2053667-1190 alone, and 74%, 51%, and 85%, respectively, of a mixture of equal amounts of the two types were used. Inhibition of 1 esti 2053667 gene expression was observed. In HeLa cells, 91%, 80%, and 90% inhibition of c-testi 2053667 gene expression was observed for test # 2053667-964 alone, testi 2053667_1 190 alone, and a mixture of these two equal amounts, respectively. In the group into which the negative control siRNA was introduced, no inhibition of c-testi 2053667 gene expression was observed.
  • HEK293 cells 0. IX 10 5, 0. 15 10 5 or 0. 2 X 10 5 cells Zml density in 96-well plates (collagen type 1 coated already, manufactured by Iwaki Glass Co., Ltd.) in. To 1 Ueru per 0. 25 m l One day later, a total of 50 nM siRNA was introduced using GeneSilencer siRNA Transfection Reagent (Gene Therapy Systems). As the siRNA, a negative control siRNA alone, testi 2053667-964 alone, and an equal mixture of testi 2053667-964 and testi 2053667-1190 were used, respectively. For HeLa cells the 0. 1 X 10 5, were plated at 0.15 10 5 or 0. 2 X 10 5 cellsZml density in 96-well plates (Greiner Co.) in 1 Ueru per 0 ⁇ 25m l, HEK293 cells The siRNA was introduced in the same manner as described above.
  • FIG. 32 shows the results when the cell seeding density was 0.2 ⁇ 10 5 cells / ml. Similar results were obtained with other cell seeding densities. The values are shown as the ATP concentration when ATP derived from living cells in each cell eluted in a 100 ⁇ 1 liquid medium. In addition, these show the average value of the 8 ⁇ -well experiment, and the vertical line in the figure shows the standard deviation.
  • HEK293 cells are seeded at a density of 1.2 ⁇ 10 5 cellsZml on a 96-well plate (one coated with collagen type, manufactured by Iwaki Glass Co., Ltd.) at a rate of 250 cells per 1 ⁇ l. Was introduced. Confluency at the time of introduction was around 50-60%. The same siRNA as that used in the cell proliferation evaluation system was used. HeLa cells were applied to a 96-well plate (Greiner) at a density of 0.5 x 10 5 cells / ml in 1 ⁇ el. PT / JP2004 / 002133 was seeded at 0.25 ml, and siRNA was introduced in the same manner as in HEK293 cells. The confluency at the time of introduction was around 60-70%.
  • LDH lactate dehydrogenase
  • the total LDH activity is a measured value of the LDH activity in a sample obtained by freeze-thawing the cells in the untreated group set for each experiment and completely disrupting the cells.
  • the LDH Positive Control contained in the above product was diluted with PBS containing 1% bovine albumin (Sigma) or a serum-containing medium used for cell culture.
  • the results of the cell death evaluation are shown in FIG.
  • the results are measured 3 days after siRNA introduction.
  • the values indicate the results obtained by converting the LDH activity released from dead cells in each well to the average of all LDH activities as 100%. In addition, these are the average values of the experiment of 8 mm, and the vertical line in the figure indicates the standard deviation.
  • the siRNA-transferred groups only 7% and less than 14% of the maximum value of LDH activity in HEK293 cells and HeLa cells were shown, respectively. Therefore, induction of cell death of HEK293 cells and HeLa cells was not observed by the introduction of siRNA into c-t e sti 2053667.
  • present DNA and the protein encoded by the DNA is referred to as “present protein”
  • SEQ ID NO: 1 is represented by SEQ ID NO: 1. As shown, it consists of 2168 bases, of which the base number from 39 to 2159 is an open reading frame (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 706 amino acid residues (SEQ ID NO: 13).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 13 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB).
  • amino acid sequences described in the database registration symbols AXO 40998 and WO 00/65040 were hits.
  • the amino acid sequences described in AX040998 and WO 00Z65040 consist of 626 amino acids, and the amino acid numbers 17 to 616 in the amino acid sequence are the amino acid sequences described in SEQ ID NO: 13. and amino acid number 25-661 incense sequence, e- value (Us expected value sequence is present by chance in a database) to have 32% of the degree of coincidence over 3 X 10- 82 and 655 amino acid residues (identity) Was observed.
  • Q9R011 is composed of 615 amino acids, and amino acid numbers 31 to 558 in the amino acid sequence correspond to amino acid numbers 39 to 645 of the amino acid sequence described in SEQ ID NO: 13; - value: over 7 X 10- 71 and 61 3 amino acid residues have a 30% one ⁇ was observed. From these results, it was inferred that the protein having the amino acid sequence shown in SEQ ID NO: 13 was a novel serine-threonine protein kinase.
  • the protein of (ii) above is obtained from literature information in the database.
  • Example 4 Using this protein expressed and prepared in the cell-free protein synthesis system described in Example 4 (1), the kinase activity was measured using the ATP consuming activity as an index in the system of Example 4 (2). i tZd ay. Next, Example 4
  • Example 5 From the expression analysis of the present DNA in Example 5 (2), the expression level of the mRNA of the present DNA is very low overall, but the digestive system tissues such as stomach cancer, normal small intestine, normal rectum, and colon cancer and lung, kidney, And weak expression was observed in neuroblastoma-derived cell line SH-SY5Y.
  • this protein is a novel serine Z-threonine protein kinase having functions related to cell cycle and nerve function.
  • This protein The digestive system ⁇ Respiratory system ⁇ Cancer of the nervous system, cell proliferation ⁇ Atherosclerosis as a disease caused by abnormal cell differentiation or cell cycle ⁇ Diabetic retinopathy ⁇ Endometriosis ⁇ Glomerulonephritis ⁇ Heart Hypertrophy ⁇ Mental illness such as brain dysplasia, depression, schizophrenia, Parkinson's disease * Neurodegenerative disease such as Alzheimer's disease, immunity such as asthma ⁇ Gastrointestinal disease such as Crohn's disease May be involved.
  • c-testi 2053667 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 2135 bases as shown in SEQ ID NO: 2, of which base number 36 Numbers 1 to 1454 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 472 amino acid residues (SEQ ID NO: 14).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 14 using BLAST.
  • AY061183 consists of 790 amino acids, and amino acid numbers 325 to 788 in the amino acid sequence correspond to amino acid numbers 7 to 468 in the amino acid sequence described in SEQ ID NO: 14, and e-value. : to have 52% of the degree of coincidence over 5 X 10- 135 and 471 amino acid residues was observed.
  • Example 5 (2) According to the expression analysis of the present DNA in Example 5 (2), it was expressed in all cells and tissues as far as it was examined, and tissues involved in immunity and inflammation such as leukocyte, spleen, and promyelocytic leukemia-derived cell line HL60 And high expression in cells, as well as in the cell line SWW620, a cell line derived from the colon and colorectal adenocarcinoma, the cell line A s PC-1, a cell line derived from the metastatic knee adenocarcinoma, and the SH-SY5Y cell line derived from the neuroblastoma. it was high.
  • HEK293 cells cell line derived from human fetal kidney
  • HeLa cells cell line derived from human cervical cancer
  • this protein is a novel serine Z-sleonine protein kinase having functions related to the cell cycle and the like.
  • This protein is DiseasesGastrointestinal cancer
  • Various types of cancers such as neuroblastoma, cell proliferationArteriosclerosis as a disease caused by abnormal cell differentiation or cell cyclePeripheral diabetic retinopathyEndometriotic hyperplasiaGlomerulonephritis Hypertrophy, brain dysplasia, depression, mental disorders such as schizophrenia, Parkinson's disease Neurodegenerative diseases such as Alzheimer's disease, immunity such as asthma, inflammatory diseases, digestive system diseases such as Crohn's disease there is a possibility.
  • present DNA and the protein encoded by the DNA is referred to as “present protein”
  • present protein comprises 3165 bases as shown in SEQ ID NO: 3, of which base number 401 Numbers 1 to 1960 are open reading frames (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 519 amino acid residues (SEQ ID NO: 15).
  • a homology search was performed on the amino acid sequence of SEQ ID NO: 15 using BLAST, and the results were found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB).
  • BC010640 serine / threonine kinase 3, Ste20, yeast homolog
  • BC010640 was composed of 491 amino acid residues, and amino acid numbers 9 to 491 in the amino acid sequence corresponded to amino acid numbers 37 to 519 in the amino acid sequence described in SEQ ID NO: 15.
  • the differences in the sequence are the N-terminal 36 residues of this protein and the N-terminal 8 residues of BC010640 (Fig. 1) . This difference causes differences in enzyme activity, binding / interaction with other proteins, and expression tissues. I think it could bring That the.
  • the protein B C010640, serine / threonine kinase 3 (S t e 20, yeast homolog) Ru splicing variant der of (Human).
  • BC010640 is a member of the human Ste20-like kinase (MST), a homolog of the budding yeast Ste20, which is a caspase substrate. It is known to increase the sensitivity of potosis (J. Biol. Chem., 276: 19276-19285 (2001)). From the above, this protein is considered to be a Ste 20-like serine Z threonine protein kinase involved in apoptosis.
  • MST human Ste20-like kinase
  • a homolog of the budding yeast Ste20 which is a caspase substrate. It is known to increase the sensitivity of potosis (J. Biol. Chem., 276: 19276-19285 (2001)). From the above, this protein is considered to be a Ste 20-like serine Z threonine protein kinase involved in apoptosis.
  • this DNA was used as a query and dbEST
  • Functions and diseases such as childhood cancer ⁇ prostate cancer ⁇ brain tumor ⁇ myeloma ⁇ leukemia ⁇ cancer such as malignant lymphoma, Alzheimer's disease ⁇ Parkinson's disease ⁇ neurodegenerative diseases such as Huntington's chorea, depression ⁇ central illness such as schizophrenia, Autoimmune diseases, inflammatory diseases, allergic diseases, glomerulonephritis, nephrotic syndrome, kidney diseases such as renal failure, bone marrow diseases such as Gaucher disease, etc. La That.
  • present DNA the protein encoded by the DNA is referred to as “present protein”
  • SEQ ID NO: 4 the protein encoded by the DNA is referred to as “present protein”
  • SEQ ID NO: 4 consisting of 2817 bases, of which base number 42 From 1 to 733 are open reading frames (including the stop codon).
  • Amino acid sequence predicted from open reading frame consists of 563 amino acid residues
  • SEQ ID NO: 16 A homology search was performed for the amino acid sequence of SEQ ID NO: 16 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). Database registration symbol AX 405737
  • this protein is AX4057 Amino acid corresponding to 17 amino acid residues 35 to 51 and 1 residue of 489 is deleted, and amino acid numbers 510, 511, 512, 513 of AX405737 are deleted. It was found that glycine Z-alanine, isoleucine Z-alanine, serine Z-leucine, and alanine Z-glycine were substituted for the amino acids corresponding to (Fig. 3).
  • this DNA lacks the bases corresponding to bases 209 to 259 of AX405737 and three bases of bases 1569-1571, and is located at the position corresponding to bases 1634/1635 of AX405737. 34 bases have been inserted. This insertion shifts the frame, resulting in a difference between the C-terminal 67 residues of this protein and the C-terminal 64 residues of AX405737.
  • c-brace 3003920 (SEQ ID NOS: 5, 17) cb race 3003920 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 5342 bases, as shown in SEQ ID NO: 5, among which base number 371 To 3874 are open reading frames (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 1167 amino acid residues (SEQ ID NO: 17).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 17 using BLAST.
  • the database in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB)
  • the amino acid sequence described in the registration symbol AX 26251 6 (unnamed 0RF) and WO 01/73050 has an e-value of 0.0, and 99% identity over 1160 amino acid residues. It was hit. From this BLAST search alignment, this protein shows that amino acids corresponding to amino acids 309, 456, and 557 of AX262516 have substitutions for threonine noisoleucine, threonine Zalanine, and lysine asparagine, respectively.
  • PRO SITE Nucleic Acids Res., 30: 235-8 (2002)
  • PRO SITE Nucleic Acids Res., 30: 235-8 (2002)
  • amino acids 27 to 51 were ATP regions (ATP binding sites).
  • This The region of 2004/002133 corresponds to the third exon of AX262516 and is deleted in this DNA.
  • this protein is a variant of the amino acid sequence described in AX 262516 and WO 01/73050, and is estimated to be a protein kinase or an endogenous inhibitor of protein kinase.
  • a BLAST search was performed for db EST (Nature Genetics, 4: 332-3 (1993)) using this DNA as a query, and hit with e-value: ⁇ 1 CT 5 ° Extraction of tissues with five or more human ESTs resulted in normal immune system, lymphoid tissue, and cancerous lung. This DNA was cloned from the cerebellum.
  • this protein is used for functions and diseases unique to these tissues and cells, such as lymphoma, leukemia, myeloma, lung cancer, brain tumors, spinal cerebellar degeneration, inflammatory diseases, allergic diseases, autoimmune diseases, It is possible to speculate that it may be involved in amyotrophic lateral sclerosis, congenital erythroid dysplasia anemia, etc., and is expected to be useful as a diagnostic or therapeutic target for these diseases.
  • present DNA cb race 3038687
  • present protein protein encoded by the DNA
  • LMR1 is a membrane receptor tyrosine kinase with little extracellular domain. Analysis of this protein with the transmembrane domain prediction software TMp red (Biol. Chem. Hoppe-Seyler, 374: 166 (1993)) shows that the transmembrane domain consists of LAVVAVS FSG LF AV I VLMLA CL at amino acids 32 to 53. Hit. In addition, when the HMMPFAM search, to amino acid number 12 No. 5-395 of the protein e- value: protein kinase domain was hit by 3. 3 X 10- 47. Since this protein and LMR1-h differ at the C-terminal side from the intracellular protein kinase domain, this protein may be involved in signal transduction different from LMR1_h.
  • Human LMR l__h is an incomplete N-terminal clone, but this protein is considered to be a variant and full-length.
  • Example 4 (1) When this protein was expressed using the wheat germ cell-free protein synthesis system of Example 4 (1), ATP consuming activity was observed by Example 4 (2) (> 100 units / day). In Example 4 (3), no peak shift of HP LC due to transphosphorylation using a synthetic peptide as a substrate was observed (Fig. 23). Therefore, this protein is a protein kinase targeting a special substrate. The possibility was suggested.
  • LMR1 the expression of LMR1 is restricted to nerve cells.
  • This DNA is a full-length LMR1 isolated from a cerebellar cDNA library and having a different sequence in the cell ⁇ domain.
  • this protein is used in brain tumors, neuroblastoma, melanoma and other cancers, Alhaima's disease, Parkinson's disease, neurodegenerative diseases such as spinocerebellar degeneration, depression, anxiety, and schizophrenia. It may be involved in endocrine diseases such as diabetes, inflammation, etc., and may be used as targets for diagnostics and therapeutics for these diseases. (7) cb race 3050764 (SEQ ID NOs: 7, 19)
  • cb race 3050764 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3346 bases as shown in SEQ ID NO: 7, of which base number 1744
  • the open reading frame (including the stop codon) is from No. 2685 to No. 2685.
  • the amino acid sequence predicted from the open reading frame consists of 313 amino acid residues (SEQ ID NO: 19).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 19 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB).
  • Cell division kinaselO / PISSLRE (cdk 10, Human) registered with database registration number Q 15131 hits with 99% concordance over 306 amino acids with e-value: 5 X 10 179
  • the cdk10 protein is a cyclin dependent kinase consisting of 360 amino acid residues and having a protein kinase domain at amino acids 39-323. At amino acids 80 to 86 there is a PISSLE sequence to which a growth inhibitory factor binds. Since the amino acid sequence numbers 55 to 360 of cdk10 correspond to the amino acid numbers 8 to 313 of the present protein, this protein was considered to be a variant having a different N-terminal from cdk10.
  • a protein kinase domain was found at amino acids 8 to 276. It is shorter on the N-terminal side than the protein kinase domain of cdk10 (amino acids 39-323). This protein and cdk10 may differ in substrate specificity and activity due to differences in the N-terminal of the protein kinase domain.
  • cdk10 protein is involved in the progression of the cell cycle from G2 to M, and that overexpression suppresses growth (Cancer Res., 55: 3992-3995 (1995)). Although its protein is ubiquitously expressed in adult tissues, it is expected to be a tumor suppressor because it is particularly high in terminally differentiated cells. However, no mutation was found in breast cancer (Genomics, 56: 90-97 (1999)), and the details of its function are unknown.
  • Example 4 (1) When this protein was expressed in the wheat germ cell-free protein synthesis system of Example 4 (1), it was confirmed that it had ATP consuming activity by the method of Example 4 (2) (39 units / day). According to the method of (3), peak shift of HP LC due to transphosphorylation was recognized using syntide2 as a substrate (FIG. 24), indicating that the present protein is a kinase.
  • This protein has a different N-terminal sequence from cdk10, and may be under different expression control.Involvement in cell proliferation, differentiation, carcinogenesis, tumor suppressor function, immunity, inflammation, diagnosis of neurodegenerative diseases, etc. It can be used as a target for drugs and therapeutics.
  • present DNA comprises 3576 bases as shown in SEQ ID NO: 8, of which base number 254 Numbers 2554 are open reading frames (including the stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 766 amino acid residues (SEQ ID NO: 20).
  • a homology search was performed for the amino acid sequence of SEQ ID NO: 20 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB).
  • 183 to 196 found a sequence specific to serine / threonine protein kinase.
  • the protein kinase domain was searched for 799327993 by HMMPFAM, it was predicted that ⁇ 327993 was present at amino acids 19 to 270.
  • the protein kinase domain covers different regions of the N-terminal sequences of both, and it is presumed that the substrate specificity and the activity are different.
  • Example 4 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consuming activity (69 units / day) was observed by the method described in Example 4 (2). According to the method described in (3), peak shift due to phosphate group transfer was observed using syntide2 as a substrate (FIG. 25), indicating that the present protein is a kinase.
  • this DNA and this protein are functions in the development and differentiation of the brain, anxiety disorders, depression, schizophrenia, neurodegenerative diseases, cancer, inflammation, diabetes and other diagnostic and therapeutic agents, or ophthalmology (glaucoma). Cataracts, retinopathy, etc.) as targets for diagnostics and therapeutics.
  • present DNA cb r awh 3022866
  • present protein consists of 4547 bases as shown in SEQ ID NO: 9; Nos. 3898 to 3898 are open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 1288 amino acid residues. (SEQ ID NO: 21).
  • Example 4 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consumption activity (217 unit / ⁇ ay) was observed in Example 4 (2). According to 3), a peak shift in HPLC by phosphoryl transfer using syntide2 as a substrate was confirmed (Fig. 26), confirming that it is a kinase.
  • This DNA is derived from the brain, but db EST (Nature Genetics, 4) : 332-3
  • BLAST searches against the immune system, skin, kidney, brain, adrenal gland, and other hit clones were found throughout.
  • this protein is present in the nucleus and is expected to be involved in the aggregation of chromosomes.
  • the present DNA and the present protein can be used as targets for diagnostics and therapeutics for cancer, immune inflammation (eg, autoimmune diseases, nephritis, etc.), hypertension, and neurodegenerative diseases.
  • a homology search using BLAST was performed on the amino acid sequence of SEQ ID NO: 22, which was found in the NRDB protein database (SWISS—a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB).
  • SWISS a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB.
  • This protein is a protein with 15 amino acids between the cdc42 binding region and clathrin binding region. Its binding and interaction with cdc42 and clathrin may be different from ACK1.
  • this protein When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), no ATP consuming activity was observed in Example 4 (2). It was suggested that sufficient activation of this protein requires modifications such as phosphoric acid or protease cleavage, or that it is a protein kinase targeting a special substrate. Based on the above, this protein is a diagnostic agent for cancer, arteriosclerosis, diabetes, HIV, inflammation, diseases related to receptor uptake, diseases related to neurotransmission disorders, dementia such as Alzheimer's disease, hypertension, glaucoma, etc. It can be used as a target for therapeutic drugs.
  • c-brtha 2034874 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) consists of 3857 bases, as shown in SEQ ID NO: 11, of which base number Nos. 55 to 1287 are open reading frames (including a stop codon). Open 04002133
  • the amino acid sequence predicted from the coding frame consists of 410 amino acid residues (SEQ ID NO: 23). A homology search was performed for the amino acid sequence of SEQ ID NO: 23 using BLAST.
  • MA P KK 4 has a total length of 399 amino acids. This protein is a variant that has an insertion of 11 amino acids between amino acids 39 and 40 of MAP KK4 (amino acids 40-50 of this protein) ( Figure 17).
  • Example 4 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consuming activity (33 units / day) was detected by the method of Example 4 (2). As a result, a peak shift in HPLC due to transphosphorylation using syntide2 as a substrate was observed (FIG. 28), indicating that this protein has kinase activity.
  • This protein is used for apoptosis against immune, liver, brain and other stress, cell proliferation, cancer, abnormal signal transduction by GPCR, elongation of nerve cells, dementia, liver regeneration, diabetes, blood pressure regulation, amyotrophic lateral sclerosis
  • GPCR GPCR-specific kinase
  • elongation of nerve cells dementia, liver regeneration, diabetes, blood pressure regulation, amyotrophic lateral sclerosis
  • immune inflammatory diseases such as allergic diseases, etc.
  • it can be used as a target for diagnostics and therapeutics for these diseases.
  • c-testi 4052197 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3105 bases as shown in SEQ ID NO: 12, of which base number 407 Numbers 1690 to 1690 are open reading frames (including stop codons). open The amino acid sequence predicted from the reading frame consists of 427 amino acid residues (SEQ ID NO: 24). A homology search was performed on this protein using BLAST, and the database registration symbol in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB) was obtained.
  • Example 4 When this protein was expressed by the cell-free protein synthesis system of Example 4 (1), no ATP consuming activity was observed in Example 4 (2). It is thought that the function of this protein requires stimulation such as phosphorylation or activation such as protease cleavage.
  • This protein has a novel sequence at amino acids 1 to 91. It may have a function different from that of the original PKA catalytic subunit ⁇ by a protein that specifically binds to this region or by subjecting it to specific expression regulation. Although this DNII was isolated from the testis, experiments on PKA catalytic subunit chick knockout mice suggest that this protein is involved in sperm maturation, regulation of liver, and kidney protein expression.
  • this protein is targeted for diagnosis and treatment of cancers such as liver cancer, kidney cancer, testis cancer, hepatitis, cirrhosis, nephritis, diabetes, immunity, inflammatory diseases, infertility, and diseases related to GPCR signaling. It can be used as Industrial potential
  • the protein of the present invention and the DNA encoding the same have kinase activity and the like, the activity is regulated by using the protein or the DNA encoding the protein. It is useful for the development of a medicament that can screen for a substance that can act on diseases associated with the protein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Information Retrieval, Db Structures And Fs Structures Therefor (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention se rapporte à l'analyse des séquences de bases de clones d'ADNc contenues dans une banque d'ADNc complet, et à l'analyse et à l'identification de l'activité physiologique de la protéine codée par l'ADNc résultant, lequel comprend une nouvelle séquence complète qui contient un variant d'épissage, de manière à proposer une méthode d'utilisation de la protéine et de l'ADN codant pour cette dernière, en accord avec son activité physiologique. L'invention concerne plus particulièrement les protéines (a) ou (b) suivantes : (a) une protéine comprenant une séquence d'acides aminés représentée par une séquence quelconque des SEQ ID NO :13 à 24, et (b) une protéine comprenant une séquence d'acides aminés dérivée d'une séquence d'acides aminés représentée par une séquence quelconque des SEQ ID NO : 13 à 14, par délétion, substitution et/ou addition d'un ou de plusieurs acides aminés, et présentant une activité kinase.
PCT/JP2004/002133 2003-02-24 2004-02-24 Nouvelles proteines et adn codant pour ces proteines WO2004074485A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2003-046606 2003-02-24
JP2003046606A JP2006174701A (ja) 2003-02-24 2003-02-24 新規タンパク質およびそれをコードするｄｎａ

Publications (1)

Publication Number Publication Date
WO2004074485A1 true WO2004074485A1 (fr) 2004-09-02

Family

ID=32905588

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/002133 WO2004074485A1 (fr) 2003-02-24 2004-02-24 Nouvelles proteines et adn codant pour ces proteines

Country Status (2)

Country Link
JP (1) JP2006174701A (fr)
WO (1) WO2004074485A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008066498A1 (fr) * 2006-12-01 2008-06-05 Agency For Science, Technology And Research Protéine kinases liées au cancer
WO2008122789A3 (fr) * 2007-04-05 2008-12-04 Medical Res Council Procédés
US8206942B2 (en) 2007-04-05 2012-06-26 Medical Research Council Methods of identifying LRRK2 inhibitors

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999017794A1 (fr) * 1997-10-03 1999-04-15 Smithkline Beecham Corporation UDP-N-ACETYLMURAMOYL-L-AIANINE:D-GLUTAMATE LIGASE (murD) DE STAPHYLOCOCCUS AUREUS
WO2000065040A2 (fr) * 1999-04-22 2000-11-02 Pioneer Hi-Bred International, Inc. Genes du cycle cellulaire et procedes d'utilisation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999017794A1 (fr) * 1997-10-03 1999-04-15 Smithkline Beecham Corporation UDP-N-ACETYLMURAMOYL-L-AIANINE:D-GLUTAMATE LIGASE (murD) DE STAPHYLOCOCCUS AUREUS
WO2000065040A2 (fr) * 1999-04-22 2000-11-02 Pioneer Hi-Bred International, Inc. Genes du cycle cellulaire et procedes d'utilisation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LI B. ET AL: "Prk, A cytokine-inducible human protein serine/threonine kinase whose expression appears to be down-regulated in lung carcinomas", J. BIOL. CHEM., vol. 271, no. 32, 1996, pages 19402 - 19408, XP002979795 *
MAMMALIAN GENE COLLECTION (MGC) PROGRAM TEAM: "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences", PNAS USA, vol. 99, no. 26, 24 December 2002 (2002-12-24), pages 16899 - 16903, XP002964739 *
UEYAMA T. ET AL: "cDNA cloning of an alternative splicing variant of protein kinase C delta (PKC deltaIII), a new truncated form of PKCdelta, in rats", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 269, 2000, pages 557 - 563, XP002979796 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008066498A1 (fr) * 2006-12-01 2008-06-05 Agency For Science, Technology And Research Protéine kinases liées au cancer
WO2008122789A3 (fr) * 2007-04-05 2008-12-04 Medical Res Council Procédés
US7947468B2 (en) 2007-04-05 2011-05-24 Medical Research Council Methods
US8206942B2 (en) 2007-04-05 2012-06-26 Medical Research Council Methods of identifying LRRK2 inhibitors

Also Published As

Publication number Publication date
JP2006174701A (ja) 2006-07-06

Similar Documents

Publication Publication Date Title
CA2665489C (fr) Compositions associees a prrg4 et procedes d'utilisation de celles-ci dans des procedes de diagnostic de tumeur
WO2004009622A2 (fr) Complexes de proteiniques de reseaux cellulaires fondant le developpement du cancer et d'autres maladies
US20030215803A1 (en) Human genes and gene expression products isolated from human prostate
US20020098511A1 (en) Protein-protein interactions
WO2004074485A1 (fr) Nouvelles proteines et adn codant pour ces proteines
Simmons et al. Identification of NOM1, a nucleolar, eIF4A binding protein encoded within the chromosome 7q36 breakpoint region targeted in cases of pediatric acute myeloid leukemia
JP2005245274A (ja) 細胞増殖促進剤
WO2004099408A1 (fr) Nouvelle proteine et adn la codant
US20020164647A1 (en) Protein-protein interactions
JPWO2004024913A1 (ja) 新規タンパク質及びそれをコードするｄｎａ
US20020098514A1 (en) Protein-protein interactions
WO2004031242A2 (fr) Complexes proteiques impliques dans des maladies neurologiques
WO2003084992A1 (fr) Nouvelles proteines et adn les codant
JP2004229639A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229643A (ja) 新規タンパク質及びそれをコードするｄｎａ
WO2007128553A9 (fr) Mig12
JP2004041180A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004357702A (ja) 新規蛋白質およびそれをコードするｄｎａ
Bera et al. Identification of novel cancer target antigens utilizing EST and genome sequence databases
JP2004229640A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229649A (ja) 新規タンパク質及びそれをコードするｄｎａ
WO2003089466A1 (fr) Nouvelles proteines et adn codant de celles-ci
WO2003091435A1 (fr) Nouvelles proteines et differents adn les codant
WO2003091428A1 (fr) Nouvelles proteines et adn codant ces proteines
JP2005021093A (ja) 新規タンパク質およびそれをコードするｄｎａ

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP