WO2004074485A1 - Novel proteins and dnas encoding the same - Google Patents

Abstract

It is intended to analyze the base sequences of cDNA clones contained in a full-length cDNA library, analyze and identify the physiological activity of a protein encoded by a cDNA thus obtained which has a novel full-length sequence containing a splicing variant, and thus propose a method of using the protein and DNA encoding the same based on the physiological activity. Namely, the following proteins (a) or (b). (a) A protein having an amino acid sequence represented by any of SEQ ID NOS:13 to 24. (b) A protein having an amino acid sequence derived from an amino acid sequence represented by any of SEQ ID NOS:13 to 24 by deletion, substitution and/or addition of one to several amino acids and having a kinase activity.

Description

 Specification

 Novel proteins and DNA fields that encode them

 The present invention relates to a novel protein, a DNA encoding the protein, a full-length cDNA encoding the protein, a recombinant vector having the DNA, an oligonucleotide comprising a partial sequence of the DNA, The present invention relates to a transgenic cell into which NA has been introduced, an antibody that specifically binds to the protein, and the like. Background art

 At present, genomic sequences of various organisms are being elucidated and analyzed on a global level. The genome sequence of about a hundred prokaryotic microorganisms, lower eukaryotic budding yeast and nematodes, multicellular eukaryotes, have already been determined. A draft of the nucleotide sequence of the human genome, which is said to be 300 billion base pairs, was published in February 2001, but the complete sequence was deciphered and published in April 2003. The purpose of clarifying the genome sequence is to understand the complex life phenomena as a network of interactions and functions among all genes, between proteins, between cells, and even between individuals. Elucidating life phenomena from the genomic information of various species is not only important as a research topic in the academic field, but also how to develop the research results obtained therefrom into industrial applications. In that respect, its social significance is also great.

However, simply determining the genome sequence cannot clarify the functions of all genes. For example, in yeast, only about half of the about 6,000 genes estimated from the genome sequence could estimate its function. On the other hand, it is said that there are about 100,000 types of proteins in humans. Therefore, there is a strong demand for the establishment of a “high-throughput gene function analysis system” for quickly and efficiently elucidating the functions of a huge amount of new genes revealed from genome sequences. In eukaryotic genomic sequences, one gene is often divided into multiple exons by introns. Therefore, there are many problems in accurately predicting the structure of the encoded protein from the genome sequence information alone. On the other hand, in cDNA produced from mRNA from which introns have been removed, the amino acid sequence information of the protein is obtained as one continuous sequence information, so that the primary structure can be easily clarified. In human cDNA studies, more than 5 million Expressed Sequence Tag (EST) data have been published on public databases so far.

 Such information is used from various angles, such as elucidation of the human gene structure, prediction of the exon region in the genome sequence, and estimation of its expression profile. However, since most of these human EST information is concentrated near the 3 'end of cDNA, information on the mRNA, especially near the 5' end, is extremely insufficient. In addition, 40,000 cDNAs have been identified as a result of analyzes conducted at research institutions around the world (Helix Research Institute, Kazusa DNA Research Institute, The University of Tokyo Medical Research Institute, German Cancer Research Center, MGC Project, etc.) Thousands of them are considered to cover most of the 30,000 thousands of loci, but the percentage of cDNAs obtained as full-length clones is around 80%,と Considering that splicing variants are included, it is considered that there are many cDNAs that have not yet been obtained.

If the full-length cDNA can be obtained, the transcription start point of the mRNA on the genomic sequence can be estimated from the 5 'terminal sequence, and it is involved in the stability of mRNA contained in the sequence and the regulation of expression at the translation stage. Factor analysis is possible. Also, since the translation initiation codon atg is included on the 5 side, translation into protein can be performed in the correct frame. Therefore, by applying an appropriate gene expression system, it becomes possible to mass-produce the protein encoded by the cDNA or to express the protein and analyze its biological activity. Thus, analysis of full-length cDNA provides important information that complements genomic sequence analysis. In addition, the total length that can be expressed cDNA clones are of great importance in empirical analysis of the function of their genes and their application to industrial applications.

 On the other hand, even when mRNA is transcriptionally modified from the same gene, some exons in the gene sequence are inserted and deleted when splicing during the process of producing mature mRNA from the precursor RNA immediately after transcription. (Hereinafter, this may be referred to as “splicing variant mRNA”). In fact, a plurality of similar proteins (hereinafter sometimes referred to as “splicing variants”) produced by translating these mRNAs have been identified in vivo. Splicing variants are expressed in a tissue-specific, developmental-stage or disease-specific manner, and are thought to have different functions.

 For example, the JAK3 gene, which is a tyrosine kinase, has three types of splicing variants, S-type, B-type, and M-type.S-type is expressed in hematopoietic cells, whereas S-type is expressed in hematopoietic cells. The type is expressed on hematopoietic cells and epithelial cells. Antibodies co-precipitate S-type and M-type and express them in the same cell, allowing multiple splicing variants to work together, further increasing the complexity of intracellular cytokine signaling. (See, for example, Lai KS et al., J. Biol. Chem., 270: 25028-25036 (1995)).

 The mRNA or cDNA of such a splicing variant is also difficult to obtain from a conventional cDNA library or EST, and is a clone that is likely to be obtained from a full-length cDNA library including the transcription start site. (See, for example, WO 98Z2250 7 (SEQ ID NO. 1 and NO. 2)).

In particular, protein kinase is an enzyme that phosphorylates serine, threonine, or tyrosine residues of a protein as a substrate, and an extremely large number of families are known. In general, protein kinases are known to be involved in the control of various life phenomena by regulating intracellular signal transduction systems via protein phosphorylation. Many (for example, Hunter, T., Cell, 50: 823-829 (1987)). However, about 3 to 4% of human genes are said to be protein kinase genes, and it is estimated that about 1,000 different protein kinases exist in the human body, and there are still many protein kinase genes. Are left uncloaked. Therefore, it is significant to provide a full-length cDNA of a novel protein kinase including a splicing variant that has not progressed in humans. In addition, protein kinases can be expected to be useful as therapeutic target molecules and proteins themselves as pharmaceuticals. Therefore, it is of great significance to determine the full length of the cDNAs encoding these proteins. Disclosure of the invention

 The present invention analyzes the nucleotide sequence of a cDNA clone contained in a full-length cDNA library, and analyzes and identifies the physiological activity of a protein encoded by a cDNA having a novel full-length sequence including a splicing variant. An object of the present invention is to propose a protein based on the physiological activity and a method of using DNA encoding the protein.

 The present inventors have proposed the oligocap method (Maruyama, K., et al., Gene, 138: 171-174 (1994); Suzuki, Y. et al., Gene, 200: 149-156 (1997)). When a database containing the splicing variant obtained using the novel cDNA was searched in a database based on the homology of the nucleotide sequence of the cDNA clone, a sequence specific to a protein having kinase activity was found in the sequence. And identified that the protein encoded by these cDNAs was a protein kinase. The present invention has been accomplished based on these findings.

 That is, according to the present invention, the following inventions (1) to (15) are provided.

(1) The following protein of (a) or (b);

(a) a protein consisting of the amino acid sequence of any one of SEQ ID NOs: 13 to 24, (b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted, or added to the amino acid sequence of any one of SEQ ID NOs: 13 to 24, and which has kinase activity.

 (2) A DNA encoding the protein of (1).

 (3) A full-length cDNA encoding the protein of (1).

 (4) any one of the following DNAs (a), (b) or (c);

 (A) DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12,

 (b) coding for a protein having a kinase activity having a base sequence in which one or several bases are deleted, substituted and Z or added in the base sequence set forth in any one of SEQ ID NOs: 1 to 12; DNA,

 (c) a protein having a nucleotide sequence capable of hybridizing a DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12 or its complementary sequence under stringent conditions, and having a kinase activity DNA that encodes

 (5) A recombinant vector containing the DNA according to any one of (2) to (4).

(6) A transgenic cell into which the DNA according to any one of (2) to (4) or the recombinant vector according to (5) has been introduced, or an individual comprising the cell.

 (7) The protein according to (1), which is produced by the cell according to (6).

(8) A sense oligonucleotide having the same sequence as 5 to 100 consecutive nucleotides in the nucleotide sequence of DNA according to any one of (2) to (4), and an antisense having a sequence complementary to the sense oligonucleotide. An oligonucleotide selected from the group consisting of an oligonucleotide and an oligonucleotide derivative of the sense or antisense oligonucleotide.

 (9) An antibody or a partial fragment thereof that specifically binds to the protein of (1) or (7).

 (10) The antibody according to (9), wherein the antibody is a monoclonal antibody.

(11) The antibody according to (10), wherein the monoclonal antibody has an action of neutralizing the kinase activity of the protein according to (1) or (7). (12) A method for controlling the activity of a protein according to (1) or (7), comprising: Screening method.

 (13) Contacting a test substance with a cell that expresses the protein according to (1) or the gene-introduced cell according to (6), and detecting a change in the expression level of DNA introduced into the cell. A method for screening a substance that regulates the expression of DNA, characterized in that:

 (14) At least one or more amino acid sequence information selected from the amino acid sequence of the protein according to (1) and / or at least one selected from the nucleotide sequence of DNA according to any of (2) to (4) A computer-readable recording medium that stores one or more base sequence information.

 (15) A carrier to which the protein according to (1) and / or the DNA according to any of (2) to (4) are bound. BRIEF DESCRIPTION OF THE FIGURES

 FIG. 1 is a diagram comparing the structure of a protein having the amino acid sequence of SEQ ID NO: 15 with the structure of a known protein BC010640.

 FIG. 2 is a diagram comparing the exon structures obtained by mapping and analyzing the DNA having the nucleotide sequence of SEQ ID NO: 3 and the cDNA encoding the known protein BC 010640 to the human genomic sequence.

 FIG. 3 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 16 with the structure of the known protein AX405737.

 FIG. 4 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 4 and the cDNA encoding the known protein AX405573 to the human genome sequence and analyzing them.

FIG. 5 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 17 with the structure of the known protein AX262516. FIG. 6 is a diagram comparing the exon structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 5 and the cDNA encoding the known protein AX262516 to the human genome sequence and analyzing them.

 FIG. 7 is a diagram comparing the structure of a protein having the amino acid sequence of SEQ ID NO: 18 with the structures of known proteins AAV32449, AAW48841, and AAW48842.

 FIG. 8 is a diagram comparing the exon structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 6 and the cDNA encoding the known protein AAV32449 to human genomic sequences, respectively.

 FIG. 9 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 19 with the structure of the known protein cdk10.

 FIG. 10 is a diagram comparing exon structures obtained by mapping and analyzing the DNA having the nucleotide sequence of SEQ ID NO: 7 and the cDNA encoding the known protein cdk10 to the human genome sequence, respectively.

 FIG. 11 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 20 with the structure of the known protein AX327993.

 FIG. 12 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 8 and the cDNA encoding the known protein AX327993 to human genomic sequences, respectively.

 FIG. 13 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 21 with the structure of the known protein SGK040.

 FIG. 14 is a diagram comparing exon structures obtained by mapping a DNA having the nucleotide sequence of SEQ ID NO: 9 and a cDNA encoding the known protein SGK040 to a human genome sequence and analyzing them, respectively (a). In addition, a diagram comparing the structure of both proteins as seen from the exon structure is shown (b).

FIG. 15 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 22 with the structure of the known protein ACK1. FIG. 16 is a diagram comparing the etason structures obtained by mapping the DNA having the base sequence of SEQ ID NO: 10 and the cDNA encoding the known protein ACK1 to the human genome sequence and analyzing them.

 FIG. 17 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 23 with the structure of the known protein MAP KK4.

 FIG. 18 is a diagram comparing the exon structures analyzed by mapping the DNA encoding the nucleotide sequence of SEQ ID NO: 11 and the cDNA encoding the known protein MAPKK4 to the human genome sequence, respectively.

 FIG. 19 is a diagram comparing the structure of the protein having the amino acid sequence of SEQ ID NO: 24 with the structure of the known protein PKACa.

 FIG. 20 is a diagram comparing the exon structures obtained by mapping the DNA having the nucleotide sequence of SEQ ID NO: 12 and the cDNA encoding the known protein PKAC a to the human genome sequence and analyzing them.

 Figure 21 shows the standard polypeptides (Cdc2, Arg2-OH PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, The peak of Syntide2) is shown.

2 2, reference polypeptide as a substrate (C dc 2, Ar g 2- OH, PK A, PKC, DNA- PK :, PTK 1, PTK2 S MLCKS, C aMK II, Syntide2) in SEQ ID NO: 4 The figure shows the results obtained by adding and reacting a protein having an amino acid sequence and then measuring peaks on reversed-phase HPLC.

 Figure 23 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate The figure shows the results obtained by adding a protein having an amino acid sequence and causing a reaction to proceed, and then measuring peaks on reversed-phase HPLC.

Figure 24 shows the standard polypeptides as substrates (Cdc2, Arg2—OH, PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, The results obtained by adding a protein having the amino acid sequence of SEQ ID NO: 7 to Syntide 2) and reacting the resulting mixture, and measuring the peak on a reverse-phase HPLC.

 Figure 25 shows that the standard polypeptides (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as substrates are the amino acids of SEQ ID NO: 8. The figure shows the results of peaks measured on reversed-phase HPLC after a protein having a sequence was added and reacted.

Figure 26 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2 _N MLCKS, CaMKII, Syntide2) as a substrate has the amino acid of SEQ ID NO: 9. The figure shows the results of peaks measured on reversed-phase HP LC after a protein having a sequence was added and reacted.

 Figure 27 shows that the standard polypeptide (C dc2, Arg2—OH, PKA, PKC, DNA—PK1, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate has the amino acid of SEQ ID NO: 10. The figure shows the results of peaks measured on reversed-phase HP LC after a protein having a sequence was added and reacted.

 FIG. 28 shows that the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA_PK, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate has the amino acid sequence of SEQ ID NO: 11. The figure shows the results of peaks measured on reversed-phase HP LC after protein addition and reaction.

 Figure 29 shows the amino acid sequence of SEQ ID NO: 1 in the standard polypeptide (Cdc2, Arg2—OH, PKA, PKC, DNA—PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate. The figure shows the results of peaks measured on a reversed-phase HPLC after a protein having the above-mentioned property was added and reacted.

Figure 30 shows the amino acid sequence of SEQ ID NO: 2 in the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK :, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate. The figure shows the results of peaks measured on reversed-phase HPLC after a protein having the above was added and reacted. PT / JP2004 / 002133 Figure 31 shows c-testi siRNA with target gene 2053667 (testi 205366 7-964 alone, testi 2053667-1-190 alone, and testi 2053667-964 and test 1 20553667-1190 (Equivalent mixture) was introduced into HEK293 cells and HeLa cells, and the results of measuring the expression level of c-testi 2053667 gene in the cells are shown.

 Figure 32 shows that c-siRNA (testi 2053667-964 alone, a mixture of equal amounts of testi 2053667-964 and testi 2053667-1190) with testi 2053667 as the target gene was introduced into HEK293 cells and HeLa cells. 3 shows the results of quantifying the proliferation of the cells into which the cells were introduced, using the intracellular ATP content as an index.

 Fig. 33 shows that c-siRNA (testi 2053667-964 alone, a mixture of testi 2053667-964 and testi 2053667-1 190 in the same amount) with testi 2053667 as the target gene was introduced into HEK293 cells and HeLa cells. 5 shows the results of quantifying the cell death of the cells into which the siRNA was introduced, using the LDH activity released into the culture supernatant as an index. BEST MODE FOR CARRYING OUT THE INVENTION

 Hereinafter, the present invention will be described in more detail. However, these descriptions are merely examples (representative examples) of the embodiments of the present invention, and do not limit the scope of the present invention.

 (1) Acquisition of full-length cDNA and analysis of nucleotide sequence

The DNA of the present invention may be a protein comprising the amino acid sequence of any one of SEQ ID NOs: 13 to 24, or one or several amino acids in the amino acid sequence of any of SEQ ID NOs: 13 to 24 (here, The term "several" means, for example, 5 amino acids or less, preferably 3 amino acids or less, and more preferably 2 amino acids or less. Any substance may be used as long as it can encode a protein having kinase activity. Specifically, the It may be only the translation region encoding the amino acid sequence, or may include the full length of its cDNA.

 Specifically, examples of the DNA containing the full-length cDNA include a DNA having the nucleotide sequence of any one of SEQ ID NOS: 1 to 12, and the like. The translation regions include nucleotide numbers 39 to 2159 of SEQ ID NO: 1, nucleotide numbers 36 to 1454 of SEQ ID NO: 2, nucleotide numbers 401 to 1960 of SEQ ID NO: 3, nucleotide numbers 42 to 1733 of SEQ ID NO: 4, Nucleotide numbers 371 to 3874 of SEQ ID NO: 5, Nucleotide numbers 81 to 2720 of SEQ ID NO: 6, Nucleotide numbers 1744 to 2685 of SEQ ID NO: 7, Nucleotide numbers 254 to 2554 of SEQ ID NO: 8, Nucleotide numbers 32 to 3898 of SEQ ID NO: 9, Examples include those having the sequences represented by base numbers 146 to 3406 of SEQ ID NO: 10, base numbers 55 to 1287 of SEQ ID NO: 11, and base numbers 407 to 1690 of SEQ ID NO: 12. Furthermore, even if not the full length of the above-mentioned cDNA, those containing the above-mentioned translation region and a portion adjacent to the 3 ′ and Z or 5 ′ end thereof, which is the minimum necessary for the expression of the translation region, are also included in the DNA of the present invention. included.

 The DNA of the present invention may be obtained by any method as long as it can be obtained, and specifically, for example, can be obtained by the method described below. First, mRNA is prepared from human tissues or cultured cells by a method known per se and commonly used. Next, the oligo cap method

(Maruyama, K., et al., Gene, 138: 171-174 (1994)). Specifically, the cap is removed from the obtained mRNA with acid pyrophosphatase, and then the oligocap linker is ligated to the exposed 5'-terminal phosphate group using RNA ligase. Here, for the RNA molecule having no cap structure at the 5 'end, the phosphate group existing at the 5' end in advance is not removed from the 5 'cap so that the oligocap linker will not bind, 5. It is effective to remove using a phosphatase that has the activity to remove only the phosphate group at the end. Using this RNA molecule as type III, as a primer on the 3 side After reverse transcription is performed with reverse transcriptase using oligo dT primer, the RNA strand is degraded and removed.

 Furthermore, using the obtained single-stranded DNA as type III, the oligonucleotide having a partial sequence of the above oligocap linker as a primer 5, and a polymerase chain reaction using a specific primer (oligo dT primer, etc.) A full-length cDNA library can be prepared by performing PCR (PCR). Here, the 5 'primer and the 3 primer are not complementary to the full length of the synthetic oligonucleotide and the reverse transcription primer, and it is preferable to use a sequence shifted by 3 to 10 bases on the 3 side. The chain length of the primer is usually 15 to 100 nucleotides, preferably 15 to 30 nucleotides.If the length of the cDNA to be amplified is long, it is preferably 25 to 35 nucleotides. And Long and Accurate PCR (LA PCR: Takeshi Hayashi, Separate Volume on Experimental Medicine · The latest technology in PCR, Yodosha; Cheng, S., et al., Nature 369: 684-685 (1994)) Is preferred.

The cDNA thus obtained is inserted into an appropriate cloning vector and cloned. As the vector used here, a protein expression vector that can express the protein encoded by the cDNA by introducing the obtained cDNA clone into a cell is preferably used. Specifically, for example, when the host is a mammalian cell or the like, pME18SFL3 (Genbank AB O09864) is preferable, and when E. coli is used, pET3 and pETll (manufactured by Stratagene). ), PGEX (Amersham Pharmacia Biotech) and the like. In the case of yeast, pESP-I expression vector (Stratagene) and the like. In the case of insect cells, Bac PAK6 (Clontech) And the like are used. When the host is an animal cell, ZAP Express (manufactured by Stratagene), SVK3 (manufactured by Amersham Pharmacia Biotech) and the like can be mentioned. The nucleotide sequence of the thus obtained cDNA library is analyzed by a commonly used method known per se. The DNA of the present invention analyzes the nucleotide sequence at the 5, 5 or 3 ends of the obtained cDNA and converts it to NCBI (National Center for Biotechnology Information; http: // www. Ncbi. Nlm. Nih. Gov). BLAST (Basic local alignment search tool; Altschul, SF, et al., J. Mol. Biol.), Which is operated by Genbank, EMBL, DDB J, PDB, db EST etc. , 215, 403-410 (1990)), and when a sequence that completely matches the entire length is not found, it was decided to submit a new sequence for the following analysis.

 Examples of the DNA having such a full-length cDNA nucleotide sequence include those having the nucleotide sequence of SEQ ID NOS: 1 to 12. In addition, as the translation region, nucleotide numbers 39 to 2159 of SEQ ID NO: 1, nucleotide numbers 36 to 1454 of SEQ ID NO: 2, nucleotide numbers 401 to 1960 of SEQ ID NO: 3, nucleotide numbers 42 to 1733 of SEQ ID NO: 4, Nucleotide Nos. 371 to 3874 of SEQ ID No. 5, Nucleotide Nos. 81 to 2720 of SEQ ID No. 6, 1744 to 2685 of Nucleotide No. 7 To 3898, base numbers 146 to 3406 of SEQ ID NO: 10, base numbers 55 to 1287 of SEQ ID NO: 11, and base numbers 407 to 1690 of SEQ ID NO: 12. The novel nucleotide sequence obtained as the full-length cDNA obtained in this manner is used for homology search (homology search) using BLAST or HMMER (sequence analysis method using hidden Markov model; Eddy, SR, Bioinformatics 14: 755-763 (1998) HMM PF AM, one of the functions of))

search: ttp: // pf am. wustl. edu), etc., to estimate the function of the protein encoded by the nucleotide sequence.

In the homology search by BLAST, the function of the clone to be analyzed can be estimated from various annotation information accompanying the hit sequence whose homology is sufficiently significant as a result of the search. Here, a sufficiently significant hit sequence is T / JP2004 / 002133 Whether the identity between the catalytic domain portion of the registered sequence and the corresponding portion of the DNA of the present invention is 30% or more, e-value (query sequence as the expected value) present accidentally in the database showing the 1 ^0-4 or less.

 For example, if many of the top hit catalytic domain sequences have been confirmed to function as kinases, the clone to be analyzed that is similar in sequence to that will also have the same function, that is, kinase activity. The prediction holds.

 HMMP FAM is an analysis based on the method of identifying whether the amino acid sequence encoded by the nucleotide sequence to be analyzed has the characteristics of the amino acid sequence of an entry in a database that integrates protein profiles called P fam. . Profiles are extracted from a series of proteins with the same characteristics. Even if a function cannot be clearly identified by comparing the full length of one sequence to one sequence, if the characteristic region is present in the sequence, the function can be identified and predicted. . Thus, the cDNA activity of a cDNA which is predicted to have the kinase activity of the protein encoded thereby can be confirmed by a biochemical experiment described later.

 Specific examples of the clone determined to be novel as the full-length cDNA above include those having the nucleotide sequence shown in any one of SEQ ID NOS: 1 to 12. The amino acid sequences encoded by these nucleotide sequences include those shown in any of SEQ ID NOS: 13 to 24.

 The DNA of the present invention thus obtained, whose base sequence is determined, and whose function is estimated, is the base sequence described in any one of SEQ ID NOS: 1 to 12, or the base sequence shown above as its translation region. As well as one or more in these base sequences (the term "number" means, for example, 15 or less, preferably 9 or less, more preferably 6 or less) A DNA encoding a protein having a base sequence in which Z or an additional base or Z has been added and having a kinase activity, and a DNA which hybridizes with these under stringent conditions, and DNAs encoding proteins having activity are also included. these

As described above, the amino acid sequence of any of SEQ ID NOS: 13 to 24 is added to the DNA. The sequences include amino acid sequences in which one or several amino acid sequences have been deleted, substituted, and / or added, and include those encoding proteins having kinase activity.

 Here, the DNA that hybridizes under stringent conditions is: SEQ ID NO: 80% or more, preferably 90% or more, more preferably 95% or more by BLAST analysis with the base sequence described in! DNAs containing the nucleotide sequences having the above homology are listed. Hybridization under stringent conditions refers to a reaction in a normal hybridization buffer at a temperature of 40 to 70 ° C, preferably 60 to 65 ° C, and the like. Washing can be performed according to a method of washing in a washing solution having a salt concentration of 15 mM to 300 mM, preferably 15 mM to 60 mM.

 Further, the DNA of the present invention may be obtained by the above-described method or may be synthesized. The DNA base sequence can be easily replaced with a sales kit such as a site-directed mutagenesis kit (Takara Shuzo) or a quick change site-directed mutagenesis kit (Stratagene). it can.

 (2) The protein encoded by the novel cDNA

 The translation region of the protein encoded by the DNA of the present invention is, for example, the nucleotide sequence of the DNA which is converted into amino acids by three reading frames and the range encoding the longest polypeptide of the present invention is The amino acid sequence can be deduced as a protein translation region. Examples of such an amino acid sequence include those described in any of SEQ ID NOS: 13 to 24. Further, the protein of the present invention is not limited to the above amino acid sequence, but comprises an amino acid sequence in which one or several amino acids have been substituted, deleted, Z or added in the amino acid sequence. And those having kinase activity.

As a method for obtaining the protein of the present invention, the method of transcribing and translating the DNA of the present invention described in (1) by an appropriate method is preferably used. Specifically, it was inserted into an appropriate expression vector or an appropriate vector together with an appropriate promoter. It can be obtained by producing a recombinant vector, transforming a suitable host microorganism with this recombinant vector, or introducing it into a suitable cultured cell, expressing it, and purifying it.

 The protein of the present invention also includes a protein that is inserted into a vector or the like designed to fuse an appropriate tag to the N-terminus or C-terminus and has a tag added thereto. Specific examples of the tag include glutathione-1S-transferase, polyhistidine, F1ag, and the like.

 The protein produced by the transformant can be modified by incorporating an amino acid substituted / modified with a heavy atom or the like during protein synthesis. In addition, a protein can be converted into a modified protein by arbitrarily modifying the protein or partially removing the polypeptide by applying an appropriate protein modifying enzyme before or after purification. For example, N-terminal acetylation, terminal modification such as C-terminal amidation, glycosylation, lipid addition, acylation, methylation, sulfonation, carboxylation, hydroxylation, phosphorylation, ADP-ribosylation, etc. However, it is not necessarily limited to these. These modified proteins are also included in the scope of the present invention as long as they have the kinase activity described above.

 Further, the protein produced by the above transformant may be modified by arbitrarily modifying the protein before or after purification by the action of an appropriate protein modifying enzyme or by partially removing the polypeptide. It can be a protein. These modified proteins are also included in the scope of the present invention as long as they have the kinase activity described above.

When producing the protein of the present invention, the vector used for the production of the recombinant vector containing the DNA of the present invention is not particularly limited as long as the DNA is expressed in the transformant. Any of phage vectors. Of these, usually, a commercially available protein expression vector into which an expression control region DNA such as a promoter suitable for a host into which the DNA is introduced has already been inserted is used. As such a protein expression vector, specifically, for example, the host is Escherichia coli In the case of yeast, ET3, pETll (manufactured by Stratagene), GEX (manufactured by Amersham Pharmacia Biotech) and the like. In the case of yeast, pESP-I expression vector (manufactured by Stratagene) is used. In the case of insect cells, Bac PAK6 (Clontech) or the like is used. When the host is an animal cell, ZAP Express (Stratagene) and SVK3 (Amersham Pharmacia Biotech) can be mentioned. When the host is a mammalian cell, ρΜΕ18 SFL 3 (Ge nb nk AB 009864) and the like.

 When using a vector into which an expression control region has not been inserted, it is necessary to insert at least a promoter as the expression control region. Here, as the promoter, a promoter possessed by a host microorganism or a cultured cell can be used, but is not limited thereto.Specifically, for example, when the host is Escherichia coli, T3, T7, tac, 1ac promoter and the like can be used, and in the case of yeast, nmt1 promoter, Ga11 promoter and the like can be used. In the case of insect cells, a polyhedrin promoter or the like can be used. When the host is an animal cell, SV40 promoter, CMV promoter and the like are preferably used.

 When a host capable of functioning as a mammalian promoter is used, a promoter specific to the gene of the present invention can also be used. Insertion of the DNA of the present invention into these vectors may be performed by connecting the DNA or a DNA fragment containing the DNA to the amino acid sequence of the protein encoded by the gene DNA downstream of the open motor in the vector.

The recombinant vector thus prepared can be used to transform a host described below by a method known per se to prepare a DNA-introduced form. Examples of the method for introducing the vector into a host include a heat shock method (J. Mol. Biol., 53: 154 (1970)), a calcium phosphate method (Science, 221: 551 (1983)), DEAE Dextran method (Science, 215: 166 (1982)), in vitro packaging method (Pro atl. Acad. Sci. USA, 72: 581 (1975)), virus vector method

 (Cell, 37: 1053 (1984)) and the electric pulse method (Chu. Et al., Nuc. Acids Res., 15: 1331 (1987)).

 The host for producing the DNA-introduced host is not particularly limited as long as the DNA of the present invention is expressed in the body. For example, Escherichia coli, yeast, baculovirus

(Arthropod Polyhedrovirus) One insect cell or animal cell. Specifically, BL21 and XL-2B 1 ue (Stratagene) for E. coli, SP-Q01 (Stratagene) for yeast, and AcN PV (J. Biol. Chem., 263) for baculovirus. : 7406 (1988)) and its host Sf9 (ATC C CRL-17111; J. Biol. Chem., 263: 7406 (1988)). As animal cells, mouse fibroblast cell line C127 (ATCC CRL-1804; J. Viol., 26: 291 (1978)) and Chinese hamster ovary cell line CHO-K1 (ATC C CCL-61; Proc Natl. Acad. Sci. USA, 77: 4216 (1980)), etc., but preferably African green monkey kidney-derived cell line COS-7 (ATCC CRL 1651: American type culture) because of its expression level and simple screening. Collection follicle cells), human fetal kidney-derived cell line HEK293 (ATCC CRL 1573; hereinafter sometimes referred to as “HEK293 cells”) transformed with human adenovirus type 5, or cells derived from human cervical cancer. Strain HeLa (ATCC CCL-12; hereinafter sometimes referred to as "HeLa cell") is used.

In addition to the above-described expression method using a protein expression vector, a homologous recombination technique for directly inserting a DNA fragment of the present invention linked to a promoter directly into the chromosome of a host microorganism (Vertes, AA et al., Biosci. Biotec nol. Biochem., 57: 2036 (1993)), or transposon or inserted rooster (Vertes, AA et al., Molecular Microbiol., 11: 739 (1994)), etc. You can also. The culture obtained above is obtained by collecting cells or cells by a method such as centrifugation, suspending the cells or cells in a suitable buffer, and sonicating, lysozyme, and Z or freeze-thawing or other suitable method. After the disruption by a suitable method, a crude protein solution is obtained by centrifugation, filtration, or the like, and further purified by a combination of appropriate purification methods.

 Thus, the protein of the present invention is obtained. In addition to the above-described expression method using a protein expression recombinant vector, the DNA of the present invention obtained in (1) above may be used in a cell-free transcription / translation system (also referred to as a “cell-free protein synthesis system”). By inducing protein expression, the protein of the present invention can be obtained. The cell-free transcription / translation system used in the present invention is a system containing all elements necessary for transcription from DNA to mRNA and translation of mRNA to protein, and by adding DNA thereto, It refers to any system in which the protein encoded by the DNA is synthesized. Specific examples of the cell-free transcription / translation system include a transcription / translation system prepared on the basis of an extract from a eukaryotic cell, a bacterium, or a part thereof. Specific examples of the cell-free protein synthesis system include known ones such as Escherichia coli, plant seed embryos, and cell extracts such as egret reticulocytes. These can be used commercially, or a method known per se, specifically, an E. coli extract can be obtained from Pratt, JM, Transcription and Translation (Ed. By Hames, BD and Higgins, SJ), 179-209. , IRL Press, Oxford (1984). Examples of commercially available cell-free protein synthesis systems or cell extracts include those derived from Escherichia coli such as E. coli S30 extract system (manufactured by Promega) and RTS500 Rapid Translation System (manufactured by Roche). Those derived from Rabbit Reticulocyte Lysate System (Promega) and those derived from wheat germ include PR0TEI0S ™ (T0Y0B0).

Separation and purification of the protein of the present invention from the obtained transcription-translation product of the cell-free transcription / translation system can be performed by a method known per se and generally used. concrete 3 includes epitope peptides (for example, polyhistidine peptide, daltathione

A DNA region encoding S-transferase (GST), maltose binding protein, etc.) is introduced into the above-mentioned DNA to be transcribed and translated, expressed as described above, and subjected to affinity with a substance having affinity for the protein. It can be purified using two teas.

 The expression of the target protein is separated by SDS-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (manufactured by Sigma) or by using an antibody that specifically binds to the protein of the present invention described later. It can be confirmed by the detection method. It is generally known that the expressed protein is cleaved (processed) by a proteolytic enzyme present in the living body. The protein of the present invention is naturally included in the protein of the present invention as long as it has a kinase activity, even if it is a partial fragment of the cleaved amino acid sequence.

 (3) Confirmation of the activity of the protein of the present invention

 The protein of the present invention is produced as a recombinant protein as described in (2) above, and by analyzing this, it can be confirmed that it has the activity estimated in (1). . Furthermore, analysis can also be performed by combination with the antibodies and the like described in (4) below.

Whether the protein of the present invention has kinase activity can be confirmed by a conventional method known per se. As a specific example of the method, a substrate is brought into contact with the recombinant protein, and the amount of ATP and the amount of product consumed when the substrate is phosphorylated by the kinase activity of the recombinant protein are measured. The method and the like will be described below. As a reaction solution, the phosphorylation site of the substrate is serine Z-threonine. When measuring the activity of serine / threonine protein kinase, magnesium ion, for example, 5 to 10 OmM magnesium chloride or magnesium acetate, and Neutral to weakly basic buffer solution containing 1 to 10 OmM 2-mercaptoethanol or 1 to 10 mM dithiothreitol as a reagent, in the absence of phosphate ions, such as 5 OmM Tris monohydrochloride or HE PES Buffer (pH 7.0-8. When measuring the activity of tyrosine protein kinase where the phosphorylation site of the substrate is tyrosine, use tris-HCl containing manganese chloride, zinc chloride, NaVO ₃ , dithiothreitol or HEPES buffer ( pH 7.0-8.0) can be used.

 After adding ATP and a substrate suitable for each to this reaction solution, the purified protein of the present invention was added, and the mixture was reacted at room temperature to 37 ° C for about 24 hours, and then consumed by the kinase reaction of the protein. Measure the amount of ATP or the product of the kinase reaction performed by the protein. Here, when measuring the kinase activity of a protein that is expected to be a receptor kinase, it is preferable to express only the intracellular portion of the protein or the kinase activity center portion as a recombinant protein and use it in the above reaction. .

 Regarding the kinase reaction, in the case of a cyclic nucleotide-dependent protein kinase that is a serine / threonine protein kinase, it is necessary to add a cyclic nucleotide corresponding to each kinase to the reaction solution. For example, cyclic AMP (cAMP) is added for A-kinase and cyclic GMP (cGMP) is added for G-kinase, and histone is used as a substrate.

 In the case of phospholipid-dependent protein kinase, a phospholipid is added to the reaction solution. For example, in the case of C-kinase, phosphatidylserine is added and histone is used as a substrate. In the case of calcium-dependent protein kinase, calmodulin is added to the reaction solution, and myosin light chain is used as a substrate. This includes myosin light chain kinase and calmodulin kinase. In the case of tyrosine protein kinase, tubulin, histone, casein, myosin L chain, gastrin, angiotensin, tyrosine monoglutamic acid (1: 4) polymer, etc. are used as substrates.

In the measurement of kinase activity, the hydrolysis of ATP to ADP by the kinase occurs before the transfer of the phosphate group to the substrate. The kinase activity can be defined by measuring the amount of hydrolyzed ATP here. In this case, the substrate The amount of ATP in the reaction solution performed in the absence of the enzyme was measured, and the amount of ATP consumed was defined as the kinase activity (Whitehoouse, S., et al., J. Biol. Chem., 258: 3693-3701 (1983) ). When measuring the amount of ATP consumed by the kinase reaction, luciferin and luciferase are added to the above-mentioned kinase reaction solution, and after reacting for a certain period of time, the fluorescence intensity is measured at the fluorescence wavelength specific to the added luciferin, and the amount of fluorescence due to residual ATP is determined. The value obtained by subtracting the above fluorescence intensity from the total ATP fluorescence intensity present in the reaction solution measured in the absence of protein kinase and substrate is defined as the amount of ATP consumed by the kinase activity, and is defined as the kinase activity of the enzyme. .

When measuring the product of the kinase reaction, use [— ³² P] ATP that contains the radioactive isotope ³² P at the r-position of ATP as ATP to be added to the reaction solution. After the completion of the kinase reaction, the reaction solution is separated by SDS-polyacrylamide gel electrophoresis, and the gel after the electrophoresis is subjected to autoradiography using an X-ray film to detect the ³² P-incorporated protein band. To the reaction mixture, add 10% trichloroacetic acid or ethanol or acetone to a final concentration of 90% to precipitate the protein. Thereafter, the supernatant is removed by centrifugation or filtration with a filter, washed with the same solution several times, and dried, and ³² P transferred to the insoluble fraction due to phosphorylation of the substrate protein is measured with a liquid scintillation counter. As a method that does not use radioisotopes, the reaction solution after the completion of the kinase reaction can be separated by chromatography, and the activity can be measured by changing the elution position of the phosphorylated substrate and the amount of change It is. In this case, as the chromatography, ion exchange chromatography or reverse phase chromatography can be used. It is also possible to measure the activity by measuring the change in mass due to phosphorylation of the substrate with a mass spectrometer. In this case, the measurement accuracy is further increased by using the above-mentioned chromatography separation in combination.

Such a kinase activity analysis system can also be used to evaluate agonists and antagonists of the protein having the kinase activity of the present invention. The confirmation of the activity of the protein of the present invention is not limited to the method described above. (4) Functional analysis of the protein of the present invention

 The novel proteins, including those identified as splicing variants thus obtained, and having kinase activity,

Analysis of the function other than the kinase activity identified in (3) provides a new use of the protein. (Proteins for which functions other than the kinase activity are further analyzed are referred to as “proteins to be analyzed.” ”). In particular, since the protein of the present invention includes a splicing variant of a known protein, it is important to identify what functions this variant has with the known variant.

 Specific methods for analyzing functions include, for example, (1) a method for comparative analysis of the expression state at each tissue, disease, or developmental stage, and (ii) a method for analyzing interactions with other proteins and DNA. (Iii) a method of analyzing a phenotypic change by introducing the protein into an appropriate cell or individual, and (iv) a method of analyzing a phenotypic change by inhibiting the expression of the protein in an appropriate cell or individual. No.

 In the method (i), expression of the protein of the present invention can be analyzed at the mRNA or protein level. When the expression level is analyzed at the mRNA level, for example, the in situ hybridization method (¾ situ

Hybridization: Application to Developmental Biology & Medicine (Ed. by Harris, N. and Wilkinson, D.G.), Cambridge University Press (1990)), a hybridization method using a DNA chip, a quantitative PCR method, and the like are used. Here, when the protein to be analyzed is a splicing variant in which a known variant is present, a protein that is present only in the cDNA encoding the protein to be analyzed and does not hybridize to the cDNA encoding the known variant It is preferable to use a probe. In the case of the quantitative PCR method, the method is performed by selecting primers that can generate amplified fragments of different lengths between the target variant and the known variant.

(Wong, Y., Neuroscience Let., 320: 141-145 (2002)). Also, when analyzing at the protein level, the protein Tissue staining using an antibody that binds specifically. In this case, it is preferable to use an antibody that reacts only with the target protein and does not react with a known variant.

 In the method (ii), the function of the protein of the present invention can be analyzed by examining the presence or absence of interaction between the protein of the present invention and a known protein or DNA. As a method for analyzing the interaction, a conventional method known per se can be used. Specifically, for example, yeast two-hybrid method, fluorescence depolarization method, surface plasmon method, phage display method, liposomal The display method is an example. Also in this method, when the protein to be analyzed is a splicing variant in which a known variant is present, the known variant is similarly analyzed for interacting substances, and a substance that specifically interacts with the target protein is identified. It is preferable.

 In the method (iii), the cells into which the cDNA of the present invention is introduced are not particularly limited, but human cultured cells and the like are particularly preferably used. Methods for introducing DNA into cells include those described in (2) above. In addition, the phenotype of the transfected cells can be observed with a microscope, such as cell viability, cell growth rate, cell differentiation, neurite elongation, localization and migration of intracellular proteins, etc. And those that can be analyzed by biochemical experiments, such as changes in the expression of specific proteins in cells. For these phenotypes, in the case of a splicing variant in which a known variant exists, the known phenotype is also introduced into cells, and the phenotype associated with the variant to be analyzed is identified by comparative analysis. Can be. In addition, since it is known that the protein of the present invention has kinase activity, it is also preferable to analyze by paying attention to the phenotype and the like found in diseases associated with kinase.

The method (iv) can be efficiently performed by a method using an oligonucleotide described below or an RNA interference method. In this method, if the target protein to be analyzed is a splicing variant in which a known variant exists, the same applies to the known variant and other variants. 2004/002133 By performing analysis and comparative analysis, it is possible to identify the function specific to the target protein.

 (5) Preparation of oligonucleotides and functional analysis using the oligonucleotides Based on the nucleotide sequence information of DNA or fragments thereof obtained by the method described in (1) above, a nucleic acid synthesizer, etc. Oligonucleotides having a partial sequence of the DNA of the present invention, such as antisense oligonucleotides and sense oligonucleotides, can be prepared by a conventional method. Examples of the oligonucleotide include DNA having the same sequence as 5 to 100 consecutive nucleotides in the nucleotide sequence of DNA, or DNA having a sequence complementary to the DNA. Specific examples include a DNA having the same sequence as the consecutive 5 to 100 bases in the base sequence represented by any of SEQ ID NOS: 1 to 12, or a DNA having a sequence complementary to the DNA. Can be. Here, when the target protein is a splicing variant in which a known variant DNA is present, it is preferable to select a base sequence different from that of the known variant. When used as a sense primer and an antisense primer, the above-mentioned oligonucleotides whose melting temperature (Tm) and number of bases do not extremely change are preferred. The length of the sequence is generally 5 to 100 bases, preferably 10 to 60 bases, and more preferably 15 to 50 bases.

In addition, derivatives of these oligonucleotides can also be used as the oligonucleotide of the present invention. Examples of the oligonucleotide derivative include an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and a phosphodiester bond in an oligonucleotide in which an N 3, 1 P 5 ′ phosphoramidate bond is used. Oligonucleotide derivative in which ribose and phosphodiester bond in oligonucleotide are converted to peptide nucleic acid bond, Oligonucleotide in which peracyl in oligonucleotide is substituted by C-15 propynyl peracyl Derivatives, oligonucleotide derivatives in which peracyl in the oligonucleotide is substituted with C-15 thiazoleperacyl, Oligonucleotide derivatives in which cytosine in the oligonucleotide is substituted with C-5-propynylcytosine, oligonucleotide derivatives in which cytosine in the oligonucleotide is substituted with phenoxazine-modified cytosine, and ribose in the oligonucleotide are Oligonucleotide derivatives substituted with 2,1-O-propylribose, or oligonucleotide derivatives substituted with 2,1-methoxyethoxylipose in the oligonucleotide can be used.

 Moreover, the oligonucleotide of the present invention can be applied to the RNA interference method by preparing it as a double-stranded RNA. For the method for preparing double-stranded RNA and the RNA interference method, for example, the method described in Elbashir, S., et al., Nature, 411: 494-498 (2001) can be used. . The double-stranded RNAs need not all be RNAs. Specifically, as a part of which is a DNA, those described in WO 02/10374 can be used.

 The gene to be targeted in the RNA interference method (hereinafter sometimes referred to as “target gene”) may be any DNA as long as it is the DNA of the present invention. In addition, a gene predicted to be an ortholog of the gene DNA can also be a target gene. A double-stranded oligonucleotide consisting of RNA having a sequence substantially identical to at least a part of the base sequence of these DNAs (hereinafter, may be referred to as “double-stranded oligonucleotide”) However, a sequence substantially the same as a sequence of 15 bp or more, which may be any part of the base sequence of the target gene, is obtained. Here, “substantially the same” means having 80% or more homology with the sequence of the target gene.

Further, when the protein to be analyzed is an insertion type or substitution type variant as compared with a known protein, the double-stranded oligonucleotide sequence can be set at the insertion site where the insertion is present. If the protein to be analyzed is a deletion variant of a known protein, the sequence spanning the deletion should be By arranging the sequences, it is possible to select a sequence that is effective specifically for the protein. Furthermore, by selecting a nucleotide sequence specific to the DNA encoding the protein to be analyzed by comparison with the nucleotide sequence of the DNA encoding each of the protein to be analyzed and the known protein, Its expression can be inhibited.

 The nucleotide length may be any length from 15 bp to the entire length of the open reading frame (ORF) of the target gene, but a length of about 15 to 500 bp is preferably used. However, it is known that mammalian-derived cells have a signal transduction system that activates in response to a long double-stranded RNA of 30 bp or more. This is called an interferon reaction (Mareus, PI, et al., Interferon, 5: 115-180 (1983)), and when the double-stranded RNA enters the cell, P KR (dsR A-responsive protein) kinase: Bass, BL, Nature, 411: 428-429 (2001)), the initiation of translation of many genes is non-specifically inhibited, and at the same time, 2 '-5' oligoadenylate synthetase (Bass, BL, Nature, 411: 428-429 (2001)), which activates RNase L, causing nonspecific degradation of intracellular RNA. These non-specific reactions mask the specific response of the target gene. Therefore, when a mammal or a cell or a tissue derived from the animal is used as the transfectant, a double-stranded oligonucleotide of 15 to 30 bp, preferably 19 to 24 bp, more preferably 21 bp is used. But preferred. The double-stranded oligonucleotide does not need to be entirely double-stranded, and includes those whose 5 'or 3' ends are partially protruded, but those whose 3 'ends are protruded by 2 bases are preferably used. The double-stranded oligonucleotide refers to a double-stranded oligonucleotide having complementarity, but may be a self-annealed single-stranded oligonucleotide having self-complementarity. Single-stranded oligonucleotides having self-complementarity include, for example, those having inverted repeat sequences.

The method for preparing the double-stranded oligonucleotide is not particularly limited, but a known chemical synthesis method is preferably used. Chemical synthesis is complementary single-stranded Ligonucleotides can be separately synthesized and assembled into a double strand by associating them by an appropriate method. Examples of the method of association include a method in which the above oligonucleotides are mixed, heated to a temperature at which the double strand dissociates, and then gradually cooled. The associated double-stranded oligonucleotide is confirmed using an agarose gel or the like, and the remaining single-stranded oligonucleotide is removed by, for example, decomposing with a suitable enzyme. The transfectant into which the double-stranded oligonucleotide prepared in this manner is introduced may be any as long as the target gene can be transcribed into RNA or translated into protein in the cell. Good, but specific examples include those belonging to plants and animals. The plant can be a monocotyledonous, dicotyledonous or gymnosperm, and the animal can be a vertebrate or invertebrate. Examples of vertebrates include mammals, including fish, sea lions, goats, stags, sheep, hamsters, mice, rats, and humans, and invertebrates include nematodes, mosquitoes, Drosophila) and other insects. Preferably, the cells are vertebrate cells.

 The transfectant means a cell, tissue or individual. Here, the cells may be germline cells or somatic cells, and may be totipotent or pluripotent, divided or undivided, parenchymal or epithelial, immortalized or transformed, and the like. The cell may be a gamete or an embryo, in the case of an embryo, a single cell embryo or a constitutive cell, or a cell from a multicellular embryo, including fetal silk tissue. Furthermore, it may be an undifferentiated cell such as a stem cell, or a differentiated cell such as a cell of an organ or tissue including fetal tissue, or any other cell present in an organism. Differentiating cell types include fat cells, fibroblasts, muscle cells, cardiomyocytes, endothelial cells, nerve cells, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, Includes basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes and cells of the endocrine or exocrine glands.

As a method for introducing a double-stranded oligonucleotide into a recipient, when the recipient is a cell or tissue, calcium phosphate method, electoral poration method, lipofection method, virus infection, double-stranded polynucleotide. Immersion in a solution, Alternatively, a transformation method or the like is used. Examples of the method for introduction into an embryo include a microphone-injection, an elect-portation method, and a virus infection. When the recipient is a plant, a method of injecting or perfusing the plant into the body cavity or stromal cells, or spraying is used. In addition, in the case of an animal individual, it is introduced systemically by oral, topical, parenteral (including subcutaneous, intramuscular and intravenous administration), vaginal, rectal, nasal, ocular, intraperitoneal administration, etc. For example, a method such as electrophoresis or virus infection is used. For methods for oral introduction, the double-stranded oligonucleotide can be mixed directly with the food of the organism. Furthermore, when introduced into an individual, it can be administered, for example, by administration as an implanted long-term release preparation or by ingesting an introduced body into which a double-stranded oligonucleotide has been introduced.

 The amount of the double-stranded oligonucleotide to be introduced can be appropriately selected depending on the transductant and the target gene, but it is preferable to introduce an amount sufficient to introduce at least one copy per cell. Specifically, for example, when the transfectant is a cultured human cell and the double-stranded polynucleotide is introduced by the calcium phosphate method, 0.1 to 100 nM is preferable.

 By suppressing the expression of the DNA of the present invention in the transfected body by the RNA interference, the function of the protein encoded by the DNA of the present invention can be confirmed, or a new function can be analyzed.

 (6) an antibody that specifically binds to the protein of the present invention

As a method for preparing an antibody that specifically binds to the protein of the present invention, a commonly used known method can be used. The polypeptide used as an antigen also has a high antigenicity according to a known method and is used for epitope ( An appropriate sequence can be selected and used as the antigenic determinant. As a method for selecting an epitope, for example, commercially available software such as Epitope Adviser (manufactured by Fujitsu Kyushu System Engineering Co., Ltd.) can be used. In addition, when the target protein is a splicing variant in which a known variant exists, only the target protein reacts. However, by using an antibody that does not react with a known or other variant, a function specific to the target protein can be identified. As an epitope of such an antibody, for example, when there is an amino acid sequence in which the target protein is missing as compared with a known variant, an amino acid sequence before and after the deleted portion (junction portion) is preferable. When the target protein has an amino acid sequence to which a known variant is added with the N-terminal or C-terminal, it is preferable to use the added amino acid sequence as an epitope. As a method other than the above, an antibody that reacts only with the target protein can be obtained by removing an antibody that reacts with a known or other variant from the polyclonal antibody obtained with respect to the target protein. . As a method for removal, affinity chromatography in which a known or other variant is immobilized as a ligand, or immunoprecipitation using a known or other variant is used. As the polypeptide used as the antigen, a synthetic peptide synthesized according to a known method or the protein of the present invention itself can be used. A polypeptide serving as an antigen may be prepared in an appropriate solution or the like according to a known method and immunized to a mammal, for example, a heron, a mouse, a rat, or the like. In order to increase the immunity, it is preferable to use the antigen peptide as a conjugate with an appropriate carrier protein or to carry out immunization by adding an adjuvant or the like.

 The route of administration of the antigen upon immunization is not particularly limited, and any route such as subcutaneous, intraperitoneal, intravenous, or intramuscular route may be used. Specifically, for example, a method of inoculating a BALB / c mouse several times every several days to several weeks with an antigen polypeptide is used. The antigen intake is preferably about 0.3 to 0.5 mg / l when the antigen is a polypeptide, but is appropriately adjusted depending on the type of the polypeptide and the animal species to be immunized.

After immunization, test blood is collected as appropriate, and the increase in antibody titer is confirmed by methods such as the Octaloni method, enzyme-linked immunosorbent assay (hereinafter sometimes referred to as “ELISA”), and Western blotting. Blood from animals with sufficiently raised antibody titers. Do. A polyclonal antibody can be obtained by subjecting this to an appropriate treatment used for the preparation of the antibody. Specifically, for example, there is a method of obtaining a purified antibody obtained by purifying an antibody component from serum according to a known method. For purification of the antibody component, methods such as salting out, ion exchange chromatography, and affinity chromatography can be used.

 Monoclonal antibodies can also be prepared by using a hybridoma fused with spleen cells and myeloma cells of the animal according to a known method (Milstein, et al., Ature, 256: 495 (1975)). it can. A monoclonal antibody can be obtained, for example, by the following method.

 First, antibody-producing cells are obtained from an animal whose antibody titer has been raised by immunization with the above-mentioned antigen. The antibody-producing cells are plasma cells and lymphocytes which are precursor cells thereof, which may be obtained from any of individuals, but preferably obtained from spleen, lymph nodes, peripheral blood and the like. The myeloma to be fused with these cells is generally a cell line obtained from a mouse, for example, P3X63-Ag8.653 (ATCC: CR L-1580), P 3-NS 1/1 Ag 4.1 (RIKEN cell punk: RCB 009 5) and the like are preferably used. For cell fusion, antibody-producing cells and myeloma cells are mixed at an appropriate ratio, and mixed in an appropriate cell fusion medium, such as RPMI 1640, Iscove's modified Dulbecco's medium (IMDM), or Dulbecco's modified Eagle's medium (DMEM). % By dissolving polyethylene glycol (PEG). It can also be performed by the electrofusion method (Zi ermann, U. et al., Naturwissenschaften, 68: 577 (1981)).

High Priestess dormer is normal medium (HAT medium) in 5% C0 ₂ containing an appropriate amount of hypoxanthine 'aminopterin' thymidine (HAT) solution by utilizing the myeloma cell line is a 8-Azaguanin resistant strain used, It can be selected by culturing at 37 ° C for an appropriate time. This selection method can be appropriately selected and used depending on the myeloma cell line to be used. Antibodies produced by the selected hybridomas The antibody titer is analyzed by the method described above, the hybridoma producing an antibody with a high antibody titer is separated by a limiting dilution method or the like, and ammonium sulfate is obtained from a culture supernatant obtained by culturing the separated fused cells in an appropriate medium. A monoclonal antibody can be obtained by purification by an appropriate method such as fractionation and affinity chromatography. For purification, a commercially available monoclonal antibody purification kit can also be used. Furthermore, by growing the antibody-producing hybridoma obtained above in the abdominal cavity of an animal of the same strain as the immunized animal or a nude mouse, ascites containing a large amount of the monoclonal antibody of the present invention can be obtained. You can also.

 When a human-derived protein is obtained as the protein of the present invention, the polypeptide or a partial peptide thereof is used as an antigen, and Severe combined immune deficiency (a method adapted to SCID mice) transplanted with human peripheral blood lymphocytes. A humanized antibody can also be prepared by immunization in the same manner as described above and preparing a hybridoma of antibody-producing cells of the immunized animal and human myeloma cells.

(Mosier, DE, et al., Nature, 335: 256-259 (1988); Duchosal, MA, et al., Ature, 355: 258-262 (1992)).

 In addition, RNA is extracted from the obtained hybridoma producing the human antibody, the gene encoding the target human antibody is cloned, and this gene is inserted into an appropriate vector. By introducing the protein into a host and expressing it, a larger amount of a human antibody can be produced. Here, an antibody with low binding to an antigen can be obtained as an antibody with even higher binding by using an evolutionary engineering technique known per se. A partial fragment such as a transient antibody can be prepared by, for example, cleaving the Fab and Fc portions using papain or the like, and collecting the Fab portion using an affinity column or the like.

• The thus-obtained antibody that specifically binds to the protein of the present invention can also be used as a neutralizing antibody that specifically binds to the protein of the present invention and thereby inhibits the kinase activity or the like of the protein. There is no particular limitation on the method of selecting a substance that inhibits the activity of the protein. For example, the method selected in (2) above Methods include contacting or introducing an antibody into a DNA transfectant, and analyzing whether or not the function of the target protein in the transfectant is inhibited.

 Such a neutralizing antibody can be used alone when the clinical application is used, or can be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight. Such drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups for oral administration, or injections, infusions, ribosomes, Parenteral administration with suppositories and the like can be mentioned. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like.

 (7) Screening for a molecule that regulates the activity of the protein of the present invention. A substance that specifically binds to the protein of the present invention and that has an action of inhibiting, antagonizing, or enhancing the function (activity) of the protein of the present invention. By performing the screening, a function modulator of the protein of the present invention (hereinafter, this may be referred to as “modulator”) can be obtained.

 The screening method of the modulator may be any method as long as it can obtain a substance that specifically binds to the protein of the present invention and has an activity of inhibiting, antagonizing or enhancing the activity of the protein. Good. For example, first, the protein of the present invention is brought into contact with a substance to be subjected to screening (hereinafter, this may be referred to as “test substance”), and after selection using the binding property to the protein as an index, A method for selecting a test substance using the change in the activity of the protein of the present invention as an index can be used.

The test substance may be any substance as long as it can interact with the protein of the present invention and affect the activity of the protein. Examples thereof include peptides, proteins, non-peptidic compounds, low-molecular compounds, synthetic compounds, fermentation products, cell extracts, animal tissue extracts, and the like. These substances may be novel substances or known substances. Test object As a method for analyzing the interaction between the protein and the protein of the present invention, a conventional method known per se can be used. Specifically, for example, a yeast two-hybrid method, a fluorescence depolarization method, a surface plasmon method, Examples include the phage display method, the liposomal display method, and the competition analysis method with the antibody described in the above (6). By such a method, a substance found to bind to the protein of the present invention is then analyzed by analyzing how the activity of the protein of the present invention is affected in the presence of the substance. Whether it is used as a modulator or not is identified. Here, when the target protein is a splicing variant in which a known variant is present, the ability to analyze the effect of a substance that binds only to the target protein and does not bind to a known or other variant or a known substance is used. Similarly, it is possible to analyze the effect of the substance on the target protein by identifying whether or not it binds to the same or another variant, and analyzing the difference in the effect of the binding when binding. In addition, by examining the distribution of the substance in an individual, the effect on the target protein and known or other variants can be analyzed.

 As a specific analysis method, for example, when analyzing a substance that regulates kinase activity, a protein serving as a substrate is introduced into the DNA-introduced gene described in (2) in the same manner. The phosphorylation of the substrate protein in the presence / absence of the selected substance of this transductant is analyzed by a commonly used method known per se. Specifically, it can be performed using the method described in the above (3). If the phosphorylation of the substrate protein is increased as compared to the absence of the substance, the substance may function as a kinase activator and may be reduced or inhibited. Can be identified as having the potential to function as a kinase inhibitor.

Here, when using the DNA of the present invention or a recombinant protein used for screening a regulatory substance for the purpose of obtaining a pharmaceutically active ingredient, it is preferable to use human DNA or a protein. In addition, The leaked substance may be further selected as a drug candidate by screening in vivo. In addition, the evaluation of the function regulating substance of the protein of the present invention is not limited to the above-described method.

 The kinase activity of the protein of the present invention includes, for example, signaling functions on pathways related to cancer, signaling functions on pathways related to myocardial development, signaling on pathways controlling sperm motility. Functions, signaling on pathways that regulate germ cell differentiation, signaling on pathways that regulate cell differentiation, signaling on pathways that regulate sperm differentiation, pathways that regulate the onset of Alzheimer's disease Signal transduction function, Glycerol 3-phosphate generating function, Signal transduction function on pathways controlling brain cortex development, migration of nerve cells, etc., Function related to fatty acid sterol synthesis, Pathway related to cell death Signal transduction function, insulin signaling, immune and inflammatory disease Is a function, etc. related to the answer. Therefore, compounds that can be identified by this screening method include anticancer drugs, therapeutic agents for heart disease, therapeutic agents for infertility, regenerative tissue inducers, therapeutic agents for Alzheimer's disease, therapeutic agents for neurodegenerative diseases, therapeutic agents for diabetes, and therapeutics for immune and inflammatory diseases. It can be used as an agent.

 The DNA encoding the protein of the present invention may be a cDNA constructed from RNA derived from tissues or organs such as the adrenal gland, uterus, testis, and brain (whole brain, caudate nucleus, amygdala, thalamus, and cerebellum). Since the obtained protein of the present invention, which is cloned from the NA library, may have a specific function in the above-mentioned tissues or organs, the function-regulating substance of the protein of the present invention is It can be used as a therapeutic agent for diseases specific to the tissue or organ.

Such modulators can be used alone as the active ingredient when applied to clinical applications, but can also be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight. The drug can be administered in various forms, such as tablets, capsules, granules, powders, or syrups. Or parenteral administration by injection, infusion, ribosome, suppository and the like. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like.

 (8) Screening of the DNA expression regulator of the present invention

 Examples of the screening method include a method of analyzing the expression level of the protein of the present invention or the mRNA encoding the same in the presence of a test substance. Specifically, for example, cells expressing the protein of the present invention described in (2) are cultured in an appropriate medium containing a test substance, and the amount of the protein of the present invention expressed in the cells is determined by ELISA. Or by analyzing the amount of mRNA encoding the protein of the present invention in the cells by quantitative reverse transcription PCR, Northern blotting, or the like. .

 As the test substance, those described in (7) can be used. According to this analysis, if the amount of the protein or mRNA expressed in the cells cultured in the absence of the test substance increases as compared with the amount of the mRNA, the test substance of the present invention It may function as a DNA expression promoting substance, and when it decreases, it can be determined that this test substance can be used as a DNA expression inhibiting substance of the present invention. The above-mentioned active ingredient can be used alone for clinical application, but can also be used as a pharmaceutical composition by blending it with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight. In addition, powerful drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups, orally, injections, drops, Parenteral administration with ribosomes, suppositories and the like can be mentioned. The dose can be appropriately selected depending on the condition, age, weight, and the like.

 (9) The DNA-introduced animal of the present invention

The introduced DNA containing the DNA of the present invention described in the above (1) is constructed, introduced into a fertilized egg of a mammal other than a human, and transplanted into a female individual oviduct to generate it. Thus, a non-human mammal into which the DNA of the present invention has been introduced can be produced. More specifically, for example, a female individual is superovulated by hormone administration, then mated with a male, a fertilized egg is removed from the oviduct on the first day after mating, and DNA is introduced into the fertilized egg by microinjection. And so on. After culturing by an appropriate method, the surviving fertilized eggs are transplanted into the oviduct of a pseudopregnant female individual (foster parent) to give birth. Whether or not the desired DNA has been introduced into the neonate can be identified by performing Southern blot analysis on the DNA extracted from the cells of the individual. Non-human mammals include, for example, mice, rats, guinea pigs, hamsters, rabbits, goats, pigs, dogs, cats, and the like.

 The thus-obtained DNA-introduced animal of the present invention is used to breed this individual and subculture them in a normal breeding environment while confirming that the introduced DNA is stably maintained, thereby obtaining the offspring. Obtainable. It is also possible to obtain offspring by repeating in vitro fertilization and maintain the strain.

 The non-human mammal into which the DNA of the present invention has been introduced can be used as an analysis of the function of the DNA of the present invention in a living body, or as a screening system for a substance that regulates the function.

 (10) Other uses of the protein of the present invention and a DNA comprising the nucleotide sequence encoding the protein

The protein of the present invention can be used as a carrier on which it is bound. In addition, a nucleotide sequence encoding the protein of the present invention, for example, a DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12 and a partial fragment thereof can be used as a carrier obtained by binding them on a substrate. . Hereinafter, these may be referred to as “protein chips”, “DNA chips” or “DNA arrays” (DNA microarrays and DNA macroarrays). These protein chips or DNA chips or arrays may contain other proteins and DNAs in addition to the proteins and DNAs of the present invention. Here, when the target protein is a splicing variant in which a known variant exists, Although the amino acid sequence partial fragment specific to the target protein can be used for the step, the full length of the amino acid sequence fragment may be used because it may have a steric structure different from other variants. Further, it is preferable to select, from the DNA sequence encoding the target protein, a sequence that is different from other variant DNAs for the DNA array. In addition, a resin substrate such as a nylon film or a polypropylene film, a nitrocellulose film, a glass plate, a silicon plate, or the like is used as a substrate for binding proteins and DNA, but the detection of hybridization is non-RI. For example, when using a fluorescent substance or the like, a glass plate or a silicon plate containing no fluorescent substance is preferably used. The binding of the protein or DNA to the substrate can be easily carried out by a commonly used method known per se. These protein chips, DNA chips, or DNA arrays are also included in the scope of the present invention.

In addition, the amino acid sequence of the protein of the present invention and the nucleotide sequence of the DNA can also be used as sequence information. The base sequence of this DNA includes the base sequence of the corresponding RNA. That is, by storing the obtained amino acid sequence or base sequence in an appropriate recording medium in a predetermined format readable by a computer, a database of the amino acid sequence or base sequence can be constructed. This database may contain the nucleotide sequences of other types of proteins and the DNA that encodes them. Further, in the present invention, the database also means a computer system that writes the above-mentioned sequence on an appropriate recording medium and performs a search according to a predetermined program. Suitable recording media include, for example, magnetic media such as flexible disks, hard disks, and magnetic tapes; optical disks such as CD-ROM, MO, CD-R, CD-RW, DVD-R, and DVD-RAM; and semiconductors. Examples include a memory. Example Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited by these Examples. The results of the following experiments performed on each of the obtained cDNA clones are summarized in Example 7.

Example 1 Preparation of cDNA library by oligo cap method

Commercially available mRNA extracted from human tissues as total RNA (Clontech: adrenal gland (# 640 16-1), uterus (# 640 29-1), testis (# 640 27-1), cerebellum (# 6403 5-1) and whole brain (# 64020-1)), and extracted from human tissues as poly (A) + RNA 'Purified commercial mRNA (Clontech: Caudate) Poly (A) ⁺ RNA oligo d T from whole RNA to whole nucleus (# 6575-1), amygdala (# 6574-1), thalamus (# 65882-1) From the RNA mixed with poly (A) -RNA prepared by removing with cellulose, the cDNA library was obtained by the oligocap method (Maruyama, K., et al., Gene, 138: 171-174 (1994)). Each was produced.

 First, after treating the above RNA with BAP (Bacterial Alkaline Phosphatase) and TAP (Tobacco Acid Pyrophosphatase), oligocaplinker-1 (SEQ ID NO: 25) was ligated using RNA ligase. Using this RNA strand as type II, the first strand cDNA was synthesized by reverse transcription using oligo dT primer (SEQ ID NO: 26), and the RNA strand was degraded and removed (Suzuki et al., Protein Nucleic Acid Enzyme, 41: 603- 607 (1996); Suzuki, Y. et al., Gene, 200: 149-156.

(1997)). Next, double-stranded cDNA was amplified by PCR (polymerase chain reaction) using 5 PCR primers (SEQ ID NO: 27) and 3 'PCR primers (system' J number 28). The DNA strand was cut with SfiI. Next, the SfiI cleavage fragment obtained above was cloned into the DraIII site of pME18SFL3 (GenBank ABO09864), which is an expression vector, to prepare a cDNA library. . The pME18SFL3 vector used above contains the SRα promoter and SV40 sma11t intron upstream of the cloning site, and the SV40 poly (A) downstream. An attached signal sequence is inserted. The cloning site of pME18SFL3 is an asymmetric DraIII site, and a complementary SfiI site is added to the end of the cDNA fragment. Is unidirectionally inserted downstream of the SRa promoter. Therefore, in a clone containing full-length cDNA, the gene can be transiently expressed by directly introducing the obtained plasmid into COS cells. In other words, it is very easy to experimentally analyze proteins as gene products or their biological activities.

 In the plasmid DNA of the clone obtained from these, the nucleotide sequence of the 5 'end or the 3' end of the cDNA was converted to a DNA sequencing reagent (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine_Terminator Cycle).

Sequencing FS Ready Reaction Kit or BigDye Terminator Cycle

Using a Sequencing FS Ready Reaction Kit (manufactured by PE Biosystems), the sequencing reaction was performed according to the manual, and then the DNA base sequence was analyzed using a DNA sequencer (ABPRISM3700: manufactured by PE Biosystems). Example 2 Evaluation of full length of 5 'end of clone from cDNA library prepared by oligocap method

 The nucleotide sequence at the 5 'end of the human cDNA library prepared in Example 1 was compared with the sequence of the known human mRNA in the public database. If the 5 'end is longer than the known mRNA sequence, or if the 5' end is shorter but has a translation initiation codon, it is judged as "full length". Full length ".

Next, the clones were evaluated using EST iMate FL. EST iMate FL was used by Helix Research to select clones with a high probability of full-length cDNA by comparing them with the EST 5, 5 or 3 terminal sequences in public databases. This is a method developed by Nishikawa Ota et al. The sequence of the 5, 5 and 3 'ends of the cDNA clone analyzed in Example 1 was compared with the base sequence registered in the EST database, and the sequence of the obtained cDNA clone was found to be 5, 5 or 3, If ESTs extending to the side were present, the clone was determined to be "possibly not full length". Conveniently, the length is longer if the end of the EST sequence is 5 or shorter than the EST sequence in the public database, or if the difference is within 50 bases, and if the difference is shorter than 50 bases, the non-full length if the difference is shorter than 50 bases. It was. Example 3 Analysis of base sequence and amino acid sequence of cDNA clone

 All nucleotide sequences of the cDNA clones analyzed in Example 2 were homologous by BLAST (Basic local alignment search too 丄; Altschul, SF, et al., J. Mol. Biol., 215: 403-410 (1990)). Homology search, H MMER (Hidden Markov model sequence analysis method; Eddy, SR,

Bioinformatics, 14: 755-763 (1998)), a protein feature search using HMMP FAM (profile search: http: // pf am. Wustl. Edu), and each cDNA clone encodes The function of the protein was estimated. In addition, for clones that are presumed to be splicing variants in which known clones whose nucleotide sequences partially match completely exist, any exons that have been deleted if their genomic sequences can be analyzed have been spliced. Was analyzed.

 (1) c-a d r gl 200 1 5 54 (SEQ ID NOS: 1, 13)

c-adrgl 200 155 54 (hereinafter referred to as “the present DNA”, and the protein encoded by the DNA is referred to as “the present protein”), as shown in SEQ ID NO: 1, from 2168 bases. The open reading frame (including the stop codon) is composed of nucleotides 39 to 219. The amino acid sequence predicted from the open reading frame consists of 706 amino acid residues (SEQ ID NO: 13). When a homology search was performed for the amino acid sequence of SEQ ID NO: 13 using BLAST, the NRDB protein database (SWISS- (I) Database registration symbols AXO 40998 and the amino acid sequence described in WOO 0/65040 in PROT, PIR, TREMBL, GENPEPT, and PDB Was. As its contents, the amino acid sequence described in AX040998 and WO 00/65040 consists of 626 amino acids, and the amino acid number 17 to 616 in the amino acid sequence is the amino acid sequence described in SEQ ID NO: 13. with 32% degree of coincidence over 3 X 10- ⁸² and 655 amino acid residues (identity): value (expected value query sequence is present by chance in a database) - amino acid numbers 25 to 66 1 of SEQ, e It was recognized that. (Ii) Database registration gd-^-P 50528 and Serine / threonine-protein kinase plol (Fission yeast) were hits. As its contents, P50528 is composed of 683 amino acids, wherein amino acid numbers 47 to 674 in the amino acid sequence correspond to amino acid numbers 45 to 695 of the amino acid sequence described in SEQ ID NO: 13, and e-value: 6 X it has been found that with a 32% degree of coincidence over 10 ^_75 Chikaratsu 670 amino acid residues. (Iii) Database registration code, Q9R011, Cytokine-inducible

Serine / threonine-protein kinase (reproduced by foot force. Its content is that Q9R011 consists of 615 amino acids, and amino acid numbers 31 to 558 in the amino acid sequence are the same as those in SEQ ID NO: 13. and amino acid numbers 39-645 No. amino acid sequence, e- value:. 7 X 1 (Τ 71 Chikaratsu 6 13 to have an致度30% over amino acid residues was observed sequences from these results The protein consisting of the amino acid sequence shown in No. 13 was presumed to be a novel serine / threonine protein kinase.

(Genes Dev., 9: 1059-1073 (1995)), it is implicated in the formation of the septum in cells in the Gl and G2 phases, and the protein of (iii) is described in the literature (EMB0 J. , 18: 5528-5539 (1999)), respectively, have been shown to be involved in signal transmission that regulates synapse formation. Both indicate involvement in the cell cycle, and the latter may be involved in neuronal function. In addition, a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 13 using HMMPFAM. As a result, the amino acid sequence represented by amino acid numbers 39 to 297 of SEQ ID NO: 13 showed a sequence (Pfam amino acid sequence entered as pkinase). PROS I TE (Nucleic Acids Res., 30: 235-8 (2002)) is a database of amino acid patterns that classify the domain structure ゃ family according to the similarity of protein functions and search for functionally important sites. According to), amino acids 45-69 are the ATP region (ATP binding site), and amino acids 158-171 are the ST region (the site that phosphorylates the serine-threonine substrate). Yes, it possesses a functionally important site for serine threonine protein kinase, and is considered to have kinase activity. HMMPFAM search also found a sequence that shows the characteristics of the POLO box duplicated region in the amino acid sequence represented by amino acid numbers 511 to 585 (the amino acid sequence entered as POLO-box in P fam). POLO box is known to be a sub-gnorape of serine Z-threonine protein kinase involved in cell cycle, especially G2ZM phase transition and cytokinesis (cytokinesis). Further analysis by P SORT II (Trends Biochem. Sci., 24: 34-6 (1999)), a program for predicting the intracellular localization of the protein, revealed that the probability of the intracellular localization of this protein was The cytoplasm was 43.5%, the nucleus was 26.1%, the mitochondria was 17.4%, the vacuole was 4.3%, the plasma membrane was 4.3%, and the peroxisome was 4.3%. . Therefore, this protein was found to be most likely to be present in the cytoplasm.

On the other hand, in order to obtain genomic information, we attempted to map this DNA into the genome using sim 4 (Genome Res., 8: 967-74 (1998)), a software that maps human cDNA to human genomic sequences. It did not map to any of the chromosomes. This means that this DNA is not present in the draft sequence of the human genome and its presence cannot be predicted. However, we have repeatedly examined this DNA for the first time. Was successful. From the above, it was speculated that this protein is a novel serine / threonine protein kinase having functions related to cell cycle and nerve function. In addition, the present DNA was clawed from the adrenal gland, and it was speculated that the present protein may be related to the development, differentiation, function and disease specific to the tissue / cell.

 (2) c-t e s t i 2053667 (SEQ ID NOs: 2, 14)

c-testi 2053667 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) comprises 2135 bases, as shown in SEQ ID NO: 2, of which base number Nos. 36 to 1454 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 472 amino acid residues (SEQ ID NO: 14). A homology search was performed for the amino acid sequence of SEQ ID NO: 14 using BLAST. (I) Database registration symbols AYO 61 183, LD 14901 (fruit fly) were hits. AYO61183 is composed of 790 amino acids, and the amino acid numbers 325 to 788 in the amino acid sequence correspond to the amino acid numbers 7 to 468 of the amino acid sequence described in SEQ ID NO: 14; value: It was found to have 52% identity over 5X10 ¹³⁵ and 471 amino acid residues. (Ii) Database registration code P36102, PAB dependent poly (A) -specific ribonuclease subunit PAN3

(Yeast) was hit. As its contents, P36102 consists of 679 amino acids, wherein amino acid numbers 231 to 677 in the amino acid sequence are the amino acid numbers 6 to 464 of the amino acid sequence described in SEQ ID NO: 14, and e-value: It was found to have 26% identity over 1 X ^10-47 and 482 amino acid residues. (Iii) Database registration symbols AB 062450 and NEK 7 (Human) were hit. AB 062450 consists of 302 amino acids, and amino acid numbers 35 to 182 in the amino acid sequence correspond to the amino acids described in SEQ ID NO: 14. The amino acid sequence of amino acid No. 78 to 246 was confirmed to have an e-value of 4 × 10 ¹⁷ and a 24% identity over 173 amino acid residues. From these results, it was inferred that the protein consisting of the amino acid sequence shown in SEQ ID NO: 14 was a protein kinase. The protein of the above (ii) is considered to be involved in the function of shortening mRNA polyA in vivo from the literature information in the database (Mol. Cell. Biol., 16: 5744-5753 (1996)). Furthermore, the above-mentioned protein (iii) has been revealed to be involved in the regulation of mitosis, respectively, from literature information in the database (Genomics, 68: 187-196 (2000)). All show involvement in the cell cycle.

 In addition, a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 14 using HMMP FAM. As a result, the amino acid sequence represented by amino acid numbers 87 to 334 of SEQ ID NO: 14 showed a protein kinase domain characteristic (Pkinase Amino acid sequence that is entered as). Further analysis by P SORT II (Trends Biochem. Sci., 24: 34-6 (1999)), a program for predicting the intracellular localization of proteins, revealed that the probability of localization of this protein in cells was The cytoplasm was 43.5%, the nucleus 30.4%, the mitochondria 17.4%, the Golgi body 4.3%, and the endoplasmic reticulum 4.3%. Therefore, this protein was found to be most likely to be present in the cytoplasm. These results suggest that this protein is a novel serine / threonine protein kinase with functions related to the cell cycle.

In addition, in order to examine the expression organization of this D Ν B, a BLAST search was performed on dbEST (Nature Genetics, 4: 332-3 (1993)) using this DNA as a query, and e-value: 1 X 1 CT Extraction of the fibrous tissue containing the human ES し た hit in ⁵⁰ revealed normal 轧, immune system, intestine, cancerous uterus and testis. In addition, this DNA was cloned from a testis-derived cDNA library. This protein is used for functions and diseases unique to these tissues and cells, such as breast cancer, malignant lymphoma, leukemia, colon cancer, uterine cancer, testicular cancer, inflammatory diseases, immune system diseases, allergic diseases, infertility, etc. Relation Therefore, it is expected to be useful as a target for diagnostics and therapeutics for these diseases.

 (3) c-u t eru 2008019 (SEQ ID NOS: 3, 15)

 cu teru 200801 9 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) comprises 3165 bases as shown in SEQ ID NO: 3, of which base number 401 Numbers 1 to 1960 are open reading frames (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 519 amino acid residues (SEQ ID NO: 15). A homology search was performed for the amino acid sequence of SEQ ID NO: 15 using BLAST. In the NRDB protein database (SWISS—a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB) The cells were hit with a database registration code of BC010640, serine / threonine kinase 3te20, yeast homolog) (Human) e-value: 0.0, and 100% identity over 483 amino acid residues. BC010640 was composed of 491 amino acid residues. Amino acid numbers 9 to 491 in the amino acid sequence corresponded to amino acid numbers 37 to 519 in the amino acid sequence described in SEQ ID NO: 15. The difference between the two sequences is the N-terminal 36 residues of this protein and the N-terminal 8 residues of BC010640 (Fig. 1).

As shown in FIG. 1, a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 15 using HMMPFAM. As a result, a sequence (Pf Am amino acid sequence entered as pkinase). PRO SITE (Nucleic Acids Res., 30: 235-8. (2002)) A database of amino acid patterns in which domain structures are classified based on the similarity of protein functions and that can be searched for functionally important sites. According to), amino acids 61-85 of this protein kinase domain are the ATP region (ATP binding site). In order to compare the use of exon between the present DNA and BC010640 cDNA, the genome sequence was aligned using sim4 (Genome Res., 8: 967-74 (1998)) (FIG. 2). As a result, this DNA is mapped to 13 exons on human chromosome 8, and BC010640 shares its 4th to 13th exons, but has another 3rd and 3rd exons. It was found that the exon containing the translation initiation site differs between this DNA and BC010640, resulting in a difference in the terminal amino acid sequences of both proteins. This difference may lead to differences in enzyme activity, binding interaction with other proteins, and expression tissues. Based on the above, this protein is a splicing variant of BC010640, serine / threonine kinase 3 (Ste 20, yeast homolog) (Human).

 Analysis of the protein intracellular localization prediction program PS ORT II (Trends Biochem. Sci., 24: 34-6 (1999)) revealed that the localization probability of this protein in the cell was nucleus 69. It turned out to be 6%, cytoplasm 17.4% and peroxisome 13.0%. BC010640 is a member of the human Ste20-like kinase (MST), a homolog of the budding yeast Ste20, which is a substrate for caspase and increases susceptibility to apoptosis (J. Biol. Chem., 276: 19276-19285 (2001)). Based on the above, this protein is considered to be a Ste20-like serine-threonine protein kinase involved in apoptosis.

According to the Disease Browser (http://www.ensembl.org/Homo_sapiens/aiseaseview) in Ensemb 1 of the eukaryotic genome annotation information database, the location of the mapped DNA on chromosome 8 (Q 22.2), and q 22 -q 23 contain cohen's syndrome, and q 22.2 contains Talippel-Fail syndrome (with laryngeal malformation) causative loci. It was speculated that these genes may be the causative genes of these diseases and that the mutations of this DNA, including splicing variants, can be applied to diagnostics for these diseases. In order to examine the expression organization of this DNA, db EST (Nature Genetics, 4: 332-3 (1993)) performed B LA ST searched for, e - value: 1 where X 10- ⁵⁰ Dehi Tsu preparative human EST were extracted 5 more than a certain tissue, normal bone marrow, Kidney · prostate · placenta 'whole brain, cancerous uterus was obtained. In addition, this DNA was cloned from a library derived from a child. This protein is a function or disease specific to these tissues and cells, such as uterine cancer, prostate cancer, brain tumor, myeloma, leukemia, malignant lymphoma, and other neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease. Diseases, depression, central diseases such as schizophrenia, autoimmune diseases, inflammatory diseases, allergic diseases, glomerulonephritis, nephrotic syndrome, kidney diseases such as renal failure, bone marrow diseases such as Gaucher's disease, etc. It can be used as a target for diagnostics and therapeutics. ·

(4) c-b r c a n 2018 240 (SEQ ID NOs: 4, 16)

 cb rcan 2018240 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”), as shown in SEQ ID NO: 4, consisting of 2817 bases, of which base number 42 Numbers 1 to 733 are open reading frames (including a stop codon). Amino acid sequence predicted from open reading frame consists of 563 amino acid residues

(SEQ ID NO: 16). A homology search was performed for the amino acid sequence of SEQ ID NO: 16 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). Database registration symbol AX 405737

(unnamed 0RF) and the amino acid sequence described in WOO 2/22660 hit with an e-value of 0.0 and 95% identity over 514 amino acid residues. From the alignment of the BLAST search, this protein lacks the amino acid corresponding to amino acid Nos. 35 to 51 of AX405737 and 1 residue of No. 489, and amino acid No. 510 of AX405737. , 51 Nos. 5, 512, and 51 No substitution of Glycine Zalanine, Isoleucine / Lanine, Serine Zleucine, and Alanine Z glycine at amino acids (Figure 3). In addition, this DNA has the base number of AX405737 of 209 to 2

It lacks the 51 base at position 59 and the 3 bases at base numbers 1569 to 1571, and has inserted 34 bases at the position corresponding to base number 1634/1635 of AX405737. This insertion shifts the frame, resulting in a difference between the C-terminal 67 residues of this protein and the C-terminal 64 residues of AX405737. HMMPFAM was used to perform a protein feature search on the amino acid sequence of SEQ ID NO: 16, and the amino acid sequence represented by amino acids 132 to 379 showed a protein kinase domain characteristic sequence (Pfam!) As kiIIase. Amino acid sequence to be entered). In addition, a sequence showing the characteristics of the PX domain (an amino acid sequence entered as PX in Pfam) was found in the amino acid sequences shown in amino acid numbers 6 to 105 of SEQ ID NO: 16. The PX domain is a phosphoinositide binding domain and is known to be involved in intracellular signal transduction. Since this protein lacks a part of the PX domain compared to AX405737, it may have a different interaction from AX405737.

 Using the software sim4 (Genome Res., 8: 967-74 (1998)) that maps the cDNA sequence to the genomic sequence, the cDΝ sequence of the D D and AX405737 was mapped to the genomic sequence. However, this DNA was aligned to 18 exons, and AX405737 was aligned to 19 exons on the database registration code AC135507, clone RP11-1-80203 of human chromosome 3 (Fig. 4). . The exons corresponding to the 2nd to 16th exons of this DNA are also present in AX405405737, but this DNA lacks one exon between the 1st and 2nd exons. In addition, the 17th exon of this DNA is deleted in AX405737, but this region is composed of 34 bases, so the frame is shifted, and the C-terminal amino acid sequence of both is different.

 From the above, the present DNA of SEQ ID NO: 4 is AX405737 and WO02 / 226

No. 60 is a splicing variant of the nucleotide sequence described in It turned out that I was coding Ize. Both have different amino acid sequences at the N-terminal and C-terminal, and therefore may have different binding, interaction, and expression tissues with other proteins.

 Analysis by P SORT II (Trends Biochem. Sci., 24: 34-6 (1999)), a program for predicting the intracellular location of proteins, revealed that the probability of localization of this protein in cells was Nuclear 78.3%, cytoplasm 8.7%, mitochondria 8.7% .High probability of localization to the nucleus.This protein is used for cell growth and differentiation, cell cycle, regulation of transcription factors, etc. May be involved.

 The eukaryotic genome annotation information database in Ensemb1

According to the Disease Browser (http://www.ensembl.org/Homo_sapiens/diseaseview), p21-14 always contains the position (pl4.3) on chromosome 3 where this DNA was mapped. It is found that there is a locus that causes chromosomal recessive hearing loss, suggesting that this DNA may be the causative gene of these diseases, and that mutations of this DNA including splicing variants may be applied to diagnostics for these diseases Was done. To investigate the expression tissue of the DNA, db E ST this DNA as a query (Nature Genetics, 4: 332 - 3 (1993)) performed B LA ST searched for, e-value: ≤ 1 0 one ⁵ Extraction of 5 or more human ESTs hit in ° resulted in normal immune system, lymphatic system, skeletal muscle, brain, cancerous immune system, and testis. This DNA was cloned from a cDNA library derived from the caudate nucleus of the brain. This protein is used for functions and diseases unique to these tissues and cells, for example, cancer such as lymphoma, leukemia, brain tumor, testicular cancer, muscular dystrophy 'myopathy' tetany, skeletal muscle disease such as myasthenia gravis, immunity It can be speculated that it may be related to systemic diseases, infertility, autosomal recessive hearing loss, etc., and is expected to be useful as a target for diagnostics and therapeutics for these diseases.

 (5) c-b r a c e 3003920 (SEQ ID NOS: 5, 17)

cb race 3003920 (hereinafter, referred to as “present DNA” and a protein encoded by the DNA is referred to as “present protein”) is represented by SEQ ID NO: 5. As shown, it consists of 5342 bases, of which bases 371 to 3874 are the open reading frame (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 1167 amino acid residues (SEQ ID NO: 17). A homology search was performed for the amino acid sequence of SEQ ID NO: 17 using BLAST, and it was found in the NRDB protein database (a database of non-redundant amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). The amino acid sequence described in AX 26251 6 (unnamed 0RF) and WO 01/73050 has an e-value of 0.0, and 99% identity over 1160 amino acid residues. Hit in degrees. From this BLAST search alignment, this protein shows that amino acids corresponding to amino acid numbers 309, 456, and 557 of AX 262516 have substitutions for threonine Z isoleucine, threonine alanine, and lysine Z asparagine, respectively. It was found that the N-terminal 3 residues differ from the N-terminal 72 residues of AX262516, and the C-terminal 4 residues of this protein and the C-terminal 12 residues of AX262516 differ (Fig. 5). In addition, this DNA lacks the base corresponding to 148 bases of base numbers 386 to 533 of AX262516. A protein characteristic search by HMMP FAM was performed on the amino acid sequence of SEQ ID NO: 17, and the amino acid sequence represented by amino acid numbers 1-221 was found to be a sequence exhibiting the characteristics of a protein kinase domain. A database of amino acid patterns that classify domain structures and families according to the similarity of protein functions. PRO SITE ( According to Nucleic Acids Res., 30: 235-8 (2002)), of the protein kinase domain of AX262516, amino acids 27 to 51 were ATP regions (ATP binding sites). It corresponds to the 3 'hexon of AX 262516, and is deleted in this DNA. Using the software sim4 (Genome Res., 8: 967-74 (1998)) that maps a cDNA sequence to a genomic sequence, the c D Ν 本 sequence of this D Ν Α and AX 262516 was mapped to the genomic sequence. In both the present DNA and AX262516, 15 exons were aligned on human chromosome 15 (Fig. 6). This DNA lacks one exon part of AX 262516 between the third and fourth exons, and AX 262516 has no exon corresponding to the first exon of this DNA. In this DNA, the translation region starts near the end 3 of the third exon, but AX 26251 6 starts near the center of the third exon of this DNA, and the reading frame at the N-terminal of both is different . Since AX262516 has an insertion consisting of 148 bases not present in this DNA immediately after the third exon equivalent, a frame shift occurs, and the translation frames after the _fourth exon correspond to both. Also, AX2

625 One base (cytosine) inserted at the position (base No. 3855) of this DNA corresponding to base numbers 4006 and 4007 immediately upstream of the 1616 translation termination codon, resulting in frame shift. As a result, the C-terminal 4 amino acid residues of this protein are different from the C-terminal 12 amino acid residues of AX262516 protein. Although this insertion is not found in the genome sequence, both clones with this insertion and clones without this insertion are registered in the EST sequence, so this difference seems to be an individual difference. From the above, it is estimated that this protein is a variant of the amino acid sequence described in AX 262516 and WO 01/73050 and is a protein kinase or an endogenous inhibitor of protein kinase. Was done.

Analysis by P SORT II (Trends Biochem. Sci., 24: 34-6 (1999)), a program for predicting the intracellular location of proteins, revealed that the probability of localization of this protein in cells was Nucleus 91.3%, cytoplasm 4.3%, peroxisome 4.3%, localization probability of AX262516 in cells is 69.6% nucleus, 17.4% cytoplasm, cytoskeleton 4. 3%, mitochondria 4.3%, and peroxisome 4.3%. This protein has a higher distribution to the nucleus than AX 2625 16 Due to the increased probability, this protein is considered to be involved in cell proliferation and differentiation, cell cycle, regulation of transcription factor phosphorylation, etc. in the nucleus, but is predicted to have a function different from AX262516 Is done.

 In the Ensemb 1 annotation information database of eukaryotic genomes

According to the Disease Browser (http://www.ensembl.org/Homo_sapiens/diseaseview), the position on the chromosome 15 where the present DNA was mapped (q15.2) is included. It was found that there is a locus of amyotrophic lateral sclerosis (ALS 5) in 1, and a genetic locus of congenital erythroid dysplasia anemia in q15.1-q15.3. It was expected that mutations in this DNA, including splicing variants, could be applied to diagnostics for these diseases. To investigate the expression tissue of the DNA, db E ST this DNA as a query (Nature Genetics, 4: 332-3 ( 1993)) performed BLAST search ^{against, e - value: ≤ 10- 5} . Extraction of tissues with 5 or more human ESTs, which were obtained in Section 2, yielded normal immune / lymphoid tissues and cancerous lungs. This DNA was also cloned from the cerebellum. Therefore, this protein is a function or disease specific to these tissues or cells, for example, cancer such as lymphoma, leukemia, myeloma, lung cancer, brain tumor, spinal cerebellar degeneration, inflammatory disease, allergic disease, autoimmune disease, muscle atrophy It may be related to sex lateral sclerosis, congenital erythrocyte dysplasia anemia, etc., and is expected to be useful as a diagnostic or therapeutic target for these diseases.

 (6) c-b r a c e 3038687 (SEQ ID NOs: 6, 18)

 cb race 3038687 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”), as shown in SEQ ID NO: 6, consisting of 4938 bases, of which base number 81 Open reading frame (including the stop codon) from position number 2720 to 879 amino acid residues

It is presumed to encode the protein of (SEQ ID NO: 18). A homology search was performed on the amino acid sequence of SEQ ID NO: 18 using BLAST. Human receptor tyrosine kinase LMRlJi described as QID NO. 11 was hit. Human LMRlJi is a receptor tyrosine protein kinase consisting of 1383 amino acid, the amino acid number 10 to 905 in the amino acid sequence thereof is the amino acid number 1 to 860 of the amino acid sequence described in SEQ ID NO: 18, e-value: 0 was found to have 94% identity over 897 amino acid residues.

The gene for human LMR 1-h (GENE SEQ database nucleotide sequence registration code AA V32449) described as SEQ ID NO. 2 in WO 98Z22507 consists of 5267 bases and is open reading at base numbers 515 to 4138 The frame may encode a protein of 1207 amino acids (LMR1-h). However, the amino acid sequence described in the publication (GENESEQ database amino acid sequence registration code AAW48842) discloses a protein consisting of 1383 amino acids by virtually synthesizing a protein sequence linked to the rat upstream sequence 176 amino acid. (This is called LMR 1— r + h) (Figure 7). This is based on a comparison of the human and rat sequences, presuming that the human sequence has not reached the N-terminus, and a full-length human LMR protein has not yet been reported. On the other hand, the rat LMR1-r gene (AAV32448) described as S EQ ID NO. 1 in WO 98/22507 consists of 2572 bases and takes the largest open reading frame, base numbers 13 to 2571. There is no stop codon, and the number of amino acid residues in this part is 853. However, the publication describes a protein (LMR11r) consisting of 848 amino acids derived from base numbers 13 to 2556 of this base sequence (AAW48841). Rat LMR 1-r (AA W48841) has a short C-terminus, indicating an incomplete length due to an unknown stop codon. As described above, human LMR1-h has an incomplete N-terminus, and rat LMR1-r has an incomplete C-terminus. It's just The amino acid sequence of SEQ ID NO: 18 differs from the amino acid sequence of LMR1-r + h in the following points.

 (a) This protein lacks the N-terminal 9 amino acids of LMR1-r + h, but the sequence difference in this region is considered to reflect the species difference between human and rat. From the genomic mapping described below, the sequence near the translation initiation site of the cDNA corresponds to the human genome sequence.

 (b) There is a deletion of 36 amino acids corresponding to amino acids 477 to 512 of ^ [11 r + h between amino acids 467 and 468 of this protein. This is the result of intra-exon splicing.

 (c) The sequence of amino acid No. 861 or later (amino acid No. 906 or later of LMR1—r + h) of this protein is different.

LMR1 is a membrane receptor tyrosine kinase with little extracellular domain. Analysis of this protein with the transmembrane domain prediction software TMp red (Biol. Chem. Hoppe-Seyler, 374: 166 (1993)) reveals that the transmembrane domain consisting of LAVVAVS FSG LFAV I VLMLA CL at amino acids 32 to 53 It was hit. In addition, when the HMMP F AM search, to amino acid number 12 No. 5-395 of the protein e- value: protein kinase domain was hit by 3. 3 X 10- ^47. Since this protein and LMR1-h have a difference on the C-terminal side from the intracellular protein kinase domain, this protein may be involved in signal transduction different from LMR1-h.

When the position of this DNA sequence on the genome is searched using the NRNEE nucleotide sequence database (a non-overlapping nucleotide sequence database excluding ESTs created from EMB L GenBank and DDB J), it is derived from human chromosome 17 Mapped to RPCI-13 Human Female BAC (database registration code AC 1 299 9). Therefore, on the sequence of AC1299919, which is the genome sequence, the DNA encoding this DNA and the DNA encoding LMR1-h (WO 98/98) were obtained using sim4 (Genome Res. 8: 967-74 (1998)). No. 22507) (Fig. 8). As a result, this DNA Consisting of 16 exons, LMR 1-h had a long exon, including exons 11, 12, and 13 of this DNA. In other words, this DNA has a deletion of 108 bases and 36 amino acids by splicing between bases 11 and 12 (base No. 1481Z1482) and a splice of 263 bases between bases 12 and 13 (base No. 1481Z1482). 2660 2661) causes a deletion of 88 amino acids and a frame shift, and ends the translation by adding 19 amino acids at the 13th exon (base Nos. 266 1-3344) after splicing. On the other hand, LMR1-h continues translation and produces a long C-terminal protein. In addition, since the 5th end of LMR 1-h is 100 bases shorter than this DNA, it does not have the ATG translation initiation codon of this DNA, and if LMR 1-h predicts the open reading frame itself, The translation will start at 5 exons (Figure 8). From the above, human LMR1-h is an incomplete N-terminal clone, but this protein is considered to be a variant and full-length.

Searching for db EST (Nature Genetics, 4: 332-3 (1993)) using the 11th, 12th, and 13th exons, which are features of this DNA, as a probe, AL 120847 from adult melanoma was found. A hit was found at nucleotide numbers 1084-1482 (corresponding to the tenth, eleventh, and twelfth exons) of the present DNA sequence. In addition, the hypothalamus-derived ABI 600711 hit number 1130 to 1805 (corresponding to the 10th, 11th and 12th exons) of this DNA. This indicates that molecules splicing out between exons 1.1 and 12 are present in melanoma and hypothalamus. According to WO 98/22507, the expression of LMR1 is restricted to nerve cells. This DNA is a full-length LMR1 isolated from a cerebellar cDNA library and having a different sequence in its intracellular domain. From this fact, this protein is used for cancers such as brain tumors, neuroblastomas and melanomas, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, spinocerebellar degeneration, central diseases such as depression, anxiety, and schizophrenia. It may be involved in endocrine diseases such as diabetes, inflammation, etc., and can be used as targets for diagnostics and therapeutics for these diseases. (7) c ~ brace 3050764 (SEQ ID NOs: 7, 19)

cb race 3050764 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3346 bases as shown in SEQ ID NO: 7, of which base number 1744 The open reading frame (including the stop codon) is from No. 2685 to No. 2685. The amino acid sequence predicted from the open reading frame consists of 313 amino acid residues (SEQ ID NO: 19). A homology search was performed for the amino acid sequence of SEQ ID NO: 19 using BLAST. Cell division kinaselO / PISSLRE (cdk 10, Human) registered under database registration code Q15131, with a S e-value: 5 X 10 ¹⁷⁹ with a 99% match over 306 amino acids

(Figure 9). The cdk10 protein is a cyclin dependent kinase consisting of 360 amino acid residues and having a protein kinase domain at amino acids 39-323. At amino acids 80 to 86 there is a PIS SLR E sequence to which a growth inhibitory factor binds. Since amino acid sequence numbers 55 to 360 of cdk10 correspond to amino acid numbers 8 to 313 of this protein, this protein was considered to be a variant that differs from cdk10 at the N-terminus.

 An HMMPF AM search was performed on the amino acid sequence of SEQ ID NO: 19, and a protein kinase domain was found at amino acids 8 to 276. It is shorter on the N-terminal side than the protein kinase domain of cdk10 (amino acids 39-323).

Since the genomic sequence encoding cdk 10 is known (AJ010341), the CDS portion and the present DNA were sim4 (Genome Res., 8: 967-74) on the human chromosome 16-derived sequence AC103888. (1998)) and examined the differences in exons (Fig. 10). As a result, this DNA consists of 12 exons, and the CDS of cdk 10 shares its 2nd to 12th exons, with a distinction between the 1st and 2nd exons. Had two exons (1 'and 1', exon). The translation start of this DNA is in the first exon, and cdk 10 starts translation from the first exon. The difference between the N-terminal amino acid sequences of the two proteins is due to the difference in the ethasons that encode them. This DNA is a splicing variant of cdk10. This protein and cdk10 may differ in substrate specificity and activity due to differences in the N-terminal part of the protein kinase domain.

 It has been reported that the cdk10 protein is involved in the progression of the cell cycle from G2 to M, and that overexpression suppresses growth (Cancer Res., 55: 3992-3995 (1995)). Although its protein is expressed ubiquitously in adult fibroblasts, it is expected to be a tumor suppressor because it is particularly high in cells that have undergone terminal differentiation, but no mutation has been observed in breast cancer ( Genomics, 56: 90-97 (1999)), but details of its function are unknown. However, this protein has an N-terminal sequence (derived from the first exon) that is different from cdk10, and may be under different expression control. Therefore, this protein has an important role in cell proliferation, differentiation, carcinogenesis, and tumor suppressor function. It can be used as a target for diagnostics and therapeutics for involvement, immuno-inflammation, and neurodegenerative diseases.

 (8) c-b r amy 3018357 (SEQ ID NOs: 8, 20)

c-bra my 3018357 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3576 bases as shown in SEQ ID NO: 8, of which base number Nos. 254 to 2554 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 766 amino acid residues (SEQ ID NO: 20). A homology search was performed for the amino acid sequence of SEQ ID NO: 20 using BLAST. In the NRDB protein database (SWISS—a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB) AX 327993 and the unnamed 0RF listed as SEQ ID NO. 2 in WO 01Z81588 with an e-value of 0 and a 94% agreement over 660 amino acids It was hit. This sequence consists of 674 amino acids, and the amino acid numbers 31 to 646 corresponded to the amino acid numbers 77 to 692 of the present protein. This protein appeared to be a variant that differs from AX327993 in the N- and C-termini (Fig. 11). When the amino acid sequence of SEQ ID NO: 20 was searched by HMMPF AM, a protein kinase domain was detected at amino acid numbers 77 to 316, and the amino acid sequence was searched by PROS ITE (Nucleic Acids Res., 30: 235-8 (2002)). Sequences unique to serine / threonine protein kinases were found at Nos. 183-196. On the other hand, when the protein kinase domain was searched for ΑΧ327993 by HMMPF AM, it was predicted that the protein was present at amino acids 19 to 270. In other words, the protein kinase domain covers different regions of the N-terminal sequences of both, and it is presumed that the substrate specificity and the activity are different.

 According to the above NRDB search, Serine / threonine protein kinase 29 (human; listed as registration code Q 8 I WQ 3 also hits higher with 93% identity over e-value: 0 and 749 amino acids. This sequence is composed of 736 amino acids, whose amino acid numbers 3 to 736 correspond to the amino acid numbers 34 to 766 of this protein. It seems that the C-terminal variant is different.

When this DNA is searched against the NRNEE nucleotide sequence database (a non-overlapping nucleotide sequence database excluding ESTs created from EMBL, GenBank, and Oppo DDBJ), human No. 11 registered in AC 116022 The clone CTD-2583 L21 derived from the chromosomal genome sequence was hit. Then, using sim4 (Genome Res., 8: 967-74 (1998)) on chromosome 11, this DNA was aligned with AX327993, which is the blast upper hit, to compare the exon structures (FIG. 12). Although this DNA consisted of 21 exons, AX327993 (a) shares the 2nd to 20th exons of this DNA, and (b) another 1st, 1st exon on the 5 'side of the 1st exon of this DNA Mochi (c) Exon 18 and 19 of this DNA (D) lack a region corresponding to the 21st exon of the present DNA.

 The ORF derived from this DNA is present in the 1st to 20th exons, and the ORF of AX327993 is present in the 1st, 2nd to 18th and 18th exons. In other words, the difference in N-terminus is due to the initiation of translation from a different exon, and the difference in C-terminus is that this DNA skips the 18th and 18th exons and continues translation downstream from the 19th exon. In 327993, the translation ends at the 18th ェ xon. From the above, it was found that this DNA and AX327993 are splicing variants from the same gene.

 AX327993 is composed of 2219 bases, and their base numbers are 141 to 1992, 2084 to 2219, and 99% and 100%, which correspond to the 480 to 2331 and 2328 to 2463 of the present DNA, respectively.

 According to the above NRNEE search, the registration number A X 7 66346 (DNA described as SEQ ID NO. 42 in Patent WOO 2Z18557) is higher than AX 327993. AX 766 346 consists of 2647 bases, whose base numbers 77 to 1975 and 1975 to 2647 correspond to 100% and 99% of 480 to 2378 and 2800 to 3470 of the present DNA, respectively. According to the above NRNEE search, the registration number AX661191 (DNA described as SEQU ID NO.1 in Patent WO 02/059287) is higher than AX327993. AX661191 is composed of 2007 bases, and base numbers 89 to 1987 correspond 100% to 480 to 2378.

 Therefore, it is expected that the present DNA and AX 766346 or AX 661 191 also have a splicing variant relationship from the same gene.

This DNA was isolated from tonsils of the brain, but a homology search was performed on human dbEST (Nature Genetics, 4: 332-3 (1993)) to examine its expression distribution. 10 ^1M 1 clone a ratio of 3 clones and derived from fetal brain from the eye to the following I did it. Based on the above, this DNA and this protein function in the development and differentiation of the brain, diagnostic and therapeutic drugs for anxiety, depression, schizophrenia, neurodegenerative diseases, cancer, inflammation, diabetes, and ophthalmology. (Glaucoma, cataract, retinopathy, etc.) can be used as a diagnostic or therapeutic target.

 (9) c-b r awh 3022866 (SEQ ID NOS: 9, 21)

cb r awh 3022866 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) consists of 4547 bases as shown in SEQ ID NO: 9; Nos. 3898 to 3898 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 1288 amino acid residues (SEQ ID NO: 21). A homology search was performed on the amino acid sequence of SEQ ID NO: 21 using BLAST. Sequence database) In the Chuo patent database GENESEQ (amino acid sequence), a human protein kinase (SGK040, 909 amino acids) described as SEQ ID NO. 54 in WO 0138503 e-value: 0, Hits were 88% consistent over 945 amino acids. Comparing the amino acid sequence of SEQ ID NO: 21 with the amino acid sequence of SGK040, the amino acid numbers 310 to 407, 408 to 521, 571 to 683, and 684 of the present protein: Amino acids 20 to 117, 130 to 243, 244 to 356, and 401 to 909, respectively (Fig. 13). In other words, this protein lacks (a) 12 amino acids corresponding to amino acids 118-129 of SGK040, and (b) inserts 49 amino acids between amino acids 243 and 244 of SGK040. (C) 44 amino acids of amino acids 357 to 400 of SGK040 are deleted, (d) amino acid sequence at the N-terminus is different from 309 amino acids, and (e) at the C-terminus, this protein has 96 amino acids. Long amino acids. As a result of HMMP FAM search of the amino acid sequence of SEQ ID NO: 21, a protein kinase domain was predicted at amino acids 684-926, and an ATP binding region was predicted at amino acids 684-705. SGK040 has a 44 amino acid insertion immediately upstream of the protein kinase domain. This indicates that this protein may differ from SGK040 in substrate specificity or activity. In addition, amino acids 360 to 389 of this protein have a leucine zipper structure in which leucine is repeated every 7 amino acids, and there is a possibility that protein interaction or this protein may form a dimer.

 In order to elucidate the exon structure of both DNAs, mapping was performed with sim4 (Genome Res., 8: 967-74 (1998)) (Fig. 14). As a result, it was found that base numbers 16 to 4547 of this DNA were aligned on human chromosome 12 and consisted of 23 etasons. On the other hand, SGK040 had base numbers 52 to 2730 aligned and consisted of 18 exons. SGK040 has (a) another 7th and 8th exon between the 7th and 8th exons of the present DNA, (b) deletion of 10th exon of the present DNA, and (c) 12th and 7th exons of the present DNA. It has another 12 'exon between 13 exons. (D) Following the 22nd exon of this DNA, a stop codon TAA appears on the genome and the translation region ends. On the other hand, in this DNA, translation ends at 23rd exon. (E) Although the positions of the 5, sequences of both cannot be determined in this genomic sequence, there is no common sequence between base numbers 1 to 951 of the present DNA and base numbers 1 to 58 of SGK040, so that both Presumed to be from another ethason.

 The difference in protein structure from this genome structure is as follows.

(a) This DNA has a deletion of 12 amino acids by skipping the 7 '

(b) insertion of 49 amino acids by having the 10th exon, (c) deletion of 44 amino acids by skipping the 12th exon, and (d) C-terminal by having the 23rd exon. It has a 96 amino acid long sequence. (E) The N-terminal amino acid sequence differs due to having different 5 'exons. From the above, it was found that the present DNA and SGKO40 are splicing variants from the same gene.

 Although this DNA is derived from the brain, BLAST searches for dbEST (Nature Genetics, 4: 332-3 (1993)) show hit clones throughout the immune system, skin, kidney, brain, adrenal gland, and other areas. According to the prediction of intracellular localization by P SORT II (Trends Biochem. Sci., 24: 34-6 (1999)), this protein has five nuclear localization signal candidate sequences, and RCC (regulator of chromosome condensation signature) Since I GTGGGH ILLL is found at amino acids 1225-1235, this protein is present in the nucleus and is expected to be involved in chromosome aggregation. Therefore, diagnosis and treatment of diseases related to cell division, such as cancer, and use as target of diagnostics and therapeutics for immunoinflammation (eg, autoimmune diseases, nephritis, etc.), hypertension, neurodegenerative diseases, etc., based on the tissue information of the expression Conceivable.

 (10) c-b r awh 3043827 (SEQ ID NOS: 10, 22)

cb r awh 3043827 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) consists of 4222 bases, as shown in SEQ ID NO: 10, of which base number 146 Numbers 3406 are open reading frames (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 1086 amino acid residues (SEQ ID NO: 22). A homology search was performed for the amino acid sequence of SEQ ID NO: 22 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWISS-PROTs PIR, TREMBL, GENPEPT, and PDB). Homo sapiens activated p21cdc42Hs kinase (ACK1) of 1036 amino acids registered in the database registration code L1378 was hit with e-value: 0 and 953 concordance over 1053 amino acids. In this protein, (a) amino acid numbers 64 to 577 correspond to amino acid numbers 1 to 513 of ACK1, and (b) amino acid numbers 578 to 592 It has the insertion and insertion of 55 amino-amino acids, and ((cc)) amino-amino acid number 559933 ~~ 11004422 is the amino-amino acid number of AACCKK 11 551144 ~~ 996622 And ((dd)) aaminominonic acid number no. 11004422ZZ110044 having no deletion of 3300 aaminominonic acid between number 33, ((ee )) The number of aminoaminoic acid number 11004433 ~~ 11008866 is identical to the number of aminoaminoic acid number 999933 ~~ 11003366 of AACCKK11 ((Fig. 1155)). .

In other words, ((aa)) the terminal end of the NN is longer than that of AACCKK11, and the terminal end of the NN is 6633 aminamino acid acid, and ((bb)) the amino acid number of AACCKK11. Between the numbers 551133 and 551144, the insertion and insertion of 1155 amymininoic acid ((this amino acid number 557788 to 559922 of this protein protein)), ((Cc)) Aminoamino acid number no. 110044 Between No. 22 and No. 11004433 no deletion of 3300 aminamino acid acid ((AACC amino acid number no. 996633 of KK11 ~~

 In order to clarify the splicing variant from the nucleotide sequence, the position of the present DNA and the cDNA encoding ACK1 (L13738) on the genome was identified as sim4 (Genome Res., 8: 967-74 (1998) )) (Fig. 16). As a result, base numbers 311 to 4222 of the present DNA were aligned on the genomic sequence AC 1 12775 derived from human chromosome 3, and this region was defined by 14 ethasons.

 (a) This DNA has a 15 amino acid insertion by having the first exon not present in ACK1.

 (b) ACK 1 has another insertion of the first 2 'ethathon between twelfth and thirteenth exons of the present DNA. This is a 30 amino acid deletion for this protein.

(c) In both cases, the use status of exon encoding the sequence corresponding to the N-terminus is unknown because the 5 'end is not aligned with the genome, but the nucleotide numbers 1 to 3 of this DNA and the nucleotide numbers 1 to 3 of ACK1 are unknown. Since there is no common part in No. 596, it is considered that both are specified in different exons. The open reading frame of this DNA starts from an unaligned upstream exon and is 63 amino acids longer at the N-terminus than ACK1. In addition, mapping of the ACK1 cDNA (L13738) revealed that the 12th exon had one amino acid deletion due to a three base deletion, and two nearby positions. 4002133 Although there are amino acid substitutions and deletions of one amino acid due to deletion of a total of three bases, this DNA had a sequence reflecting the genome (FIG. 16).

ACK1 contains the tyrosine protein kinase domain, SH3 domain, and cdc42Hs binding domain ^ clathrin binding domain from the N-terminus. - How, Rooster G歹¹ J numbers 22 result of amino acid sequence was searched hMMP F AM of the protein kinase domain is amino acid number 180 to 450 No., 45 No. 4 to 509 SH3 domain amino acid number, also paper information (Nature, 363: 364-367 (1993)), the cdc42Hs binding region was found at amino acids 509-552, and the clathrin binding region was found at amino acids 639-723.

ACK1 is an activated p21cdc42Hs kinase that phosphorylates the activated small G protein and inhibits its conversion to the inactivated form, keeping the G protein in the activated form. In the Rho family of low molecular weight G proteins (GTP binding protein p2l), RACI, Rho, Cdc42Hs are known. These molecules have an active form (GTP-bound type) and an inactive form (GDP-bound type). GEF (guanine nucleotide exchange factor) is involved in the conversion of force to active form. ACK1 is a tyrosine kinase that binds to activated Cdc42Hs and inhibits its GTPase activity, and is involved in cytoskeleton, cell differentiation, cell proliferation and the like. Further, ACK1 will accumulate the Db 1 phosphorylates active small G protein is a GEF (cdc 42H _S) induces Akuchin fibers cytoskeletal. ACK1 is known to have a short C-terminal variant, ACK2.

 It has been reported that phosphoric acid is phosphorylated by epidermal growth factor and bradykinin, and regulates cytoskeletal formation in response to extracellular signals.

Furthermore, it has been reported that ACK 1 also binds to clathrin and fc) exerts it on receptor mediated endocytosis by clathrin-coated vehicles. Clathrin is an organelle-backed protein called coated vehicle or coated pit in which receptors form clusters. Involved in Itsis. Endocytosis of receptors into cells is known for many receptors that also function as HIV receptors, including chemokine receptors, adrenergic receptors, insulin receptors, and LDL receptors. Incorporation of the ligand-bound receptor regulates extracellular signaling or recycles the receptor. This protein has a 15 amino acid insertion between the cdc42 binding region and clathrin binding region, and its binding and interaction with cdc42 and clathrin may be different from ACK1. Based on the above, this protein can be used to diagnose cancer, arteriosclerosis, diabetes, HIV, inflammation, diseases related to receptor uptake, diseases related to neurotransmission disorders, dementia such as Alzheimer's disease, hypertension, glaucoma, etc. Drugs · They can be used as targets for therapeutic drugs.

 (1 1) c-b r t a 2034874 (SEQ ID NOS: 11, 23)

c—brtha 2034874 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) is composed of 3857 bases as shown in SEQ ID NO: 11; Nos. 55 to 1287 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 410 amino acid residues (SEQ ID NO: 23). A homology search was performed using the BLAST for the amino acid sequence of SEQ ID NO: 23. Dual specincity mitogen-activated protein kinase kinase 4, MAP kinase kinase 4 (MAP KK 4), JNK activating kinase 1, c-Jun N-terminal kinase kinase 1 ( J NKK) and SAPK / ERK kinase 1 (SEK1)) hit 97% of e-value: 0 and 410 amino acids with 97% agreement. MAP KK4 is 399 amino acids in length. This protein is a variant with an insertion of 11 amino acids between amino acids 39 and 40 of MAP KK4 (amino acids 40-50 of this protein) (Fig. 17). HMMP FAM search of the amino acid sequence of SEQ ID NO: 23 reveals a protein kinase domain at amino acid number 113 to 378, and amino acid number 236 to ST region (characteristic sequence of serine / threonine protein kinase) at No. 249 ATP region (ATP binding site of protein kinase) was detected at amino acids 119-143.

 The nucleotide sequence was compared to determine whether the insertion of 11-amino acid in this protein was due to splicing (Fig. 18). When this DNA and L36870cDNA encoding MAPKK4 were mapped to the genome using sim4 (Genome Res., 8: 967-74 (1998)), this DNA was found to be on human chromosome 17 Although it has 12 exons, ΜAΡΚΚ4 lacks its second exon (base Nos. 170-203 of this DNA, corresponding to 11 amino acids). This indicates that the present DNA has 11 amino acids that are not present in MAP KK4 by adding an exon. The nucleotide sequence of cDNA (including EST) having homology with this specific etason portion was searched, but was not found. This suggests that this exon is a rare molecule, and that this DNA is a novel molecule.

MAPKK4 is a dual specificity protein kinase belonging to serine / threonine protein kinase. In response to external signals such as growth factors or stress, MAPK: Serine Z threonine of K4 is phosphorylated and activated by MAP3K / MEKK, and J NK1 (MAPK 8), J NK2 corresponding to MAPK (MAPK 9),]] ^ 3 is activated in the same way as 1) 38 (MAPK 14). Furthermore, transcription factors downstream thereof are activated, and genes involved in apoptosis are expressed. Analysis of MAPKK4 knockout mice has been shown to be involved in T cell differentiation, survival signals and liver organogenesis. MAPKK 4 is highly expressed in skeletal muscle, but is also found in other tissues. MAP KK4 also phosphorylates JNK3, which associates with and binds to β-arrestin2, a protein involved in receptor internalization (related to GPCR desensitization). 133 This results in crosstalk between GPCR signaling and the MAPK signaling cascade. This protein is used for apoptosis against immune, liver, brain and other stress, cell proliferation, cancer, abnormal signal transduction by GPCR, elongation of nerve cells, dementia, liver regeneration, diabetes, blood pressure regulation, amyotrophic lateral sclerosis Or, it is presumed to be involved in self-immune diseases, immuno-inflammatory diseases such as allergies, etc., and it can be used as a diagnostic or therapeutic drug target for these diseases.

 (1 2) c-t e st i 405 2 1 9 7 (SEQ ID NOS: 12, 24)

 c-test 1 40 5 2 1 9 7 (hereinafter referred to as “the present DNA”, and the protein encoded by the DNA is referred to as “the present protein”), as shown in SEQ ID NO: 12 It consists of 05 bases, of which base numbers 407 to 1690 are the open reading frame (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 427 amino acid residues (SEQ ID NO: 24). A homology search was performed for this protein using BLAST, and the database was registered in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMB L, GENPEPT, and PDB). C Human cAMP-dependent protein kinase catalytic subunit type alpha (P KACa) registered with the symbol XO 77767 hit with a 99% agreement over e-value: 0 and 336 amino acids. This sequence consists of 351 amino acids and its amino acid number 16-351 corresponds to amino acid numbers 92-427 of this protein, so this protein is considered to be an N-terminal variant of PKACα. (Fig. 19). In addition, amino acid number 309 arginine (AGG) of PKAC o; is 385 glycine (GGG) in this protein.

As a result of searching the amino acid sequence of SEQ ID NO: 24 by HMMP FAM, a protein kinase domain was found at amino acid numbers 120 to 374. This region is common with PKA Ca. _S i _m 4 for comparing the Ekuson usage c DNA of W present DNA and PKAC α (Genome Res, 8: . 967-74 (1998)) was Araimento into the genome using (2 0) . As a result, the present DNA consisted of 10 exons on human chromosome 19, and PKACα shared its 2nd to 10th ethadons, but another 1st exon. Both differ in the first exon containing the translation initiation site, resulting in a difference in the 配 列 -terminal amino acid sequences of both proteins. This protein is a splicing variant of PKACα.

 Α Α is a serine Z-threonine pruiten kinase consisting of two regulatory subunits (R) and two catalytic subunits (C) .The tetramer (R 2 C 2) exists in the cytoplasm as an inactive form, but Gs-coupled. Upon receipt of a signal from the receptor, adenylyl cyclase is activated and cAMP is generated from ATP, which binds to the PKA Regulatory subunit (R) to release the catalytic subunit (C) and activates it. The C amino acids involved in the interaction of R and C are lysine 190, arginine 195, tributofan 197, and lysine 214 in the protein kinase domain (PRS2 domain). . R is a protein that stays in the cytoplasm and anchors C to the cytoplasm. When C moves away from R, it interacts with PKI (protein kinase inhibitor) through another region (PRS1 domain; arginine at position 134, glutamic acid at position 204, and tyrosine at position 236) to enter the cytoplasm. Anchored. For the R subunit, the RI type (RIa, RIβ) involved in cell proliferation and the RII type (RIIα, RII) involved in differentiation are known, and for the C subunit, C and Cβ are known. Literature sources report that C α translocation to the nucleus when inhibition of C anchored in the cytoplasm by R by antisense oligonucleotides of RI α.

(Oncogene, 20: 8019-24 (2001)). When TC6 insulin-stimulated cells were stimulated with glucose or GLP-1 (glucagon-like polypeptide-1), Co; translocated to the nucleus, C / 3 translocated to the cell membrane and nucleus, and was localized in the cell. It has been reported that it does not change (Biochem. J., 368: 397-404 (2002)). In this way, PKA The subcellular localization or activity of the active subunit, the catalytic subunit, is regulated by various molecules.

 Substrates for PKA include Glycogen phosphorylase kinase (GPK) and cAMP responisible element binding protein (CREB). Glycogen is hydrolyzed by Glycogen phosphorylase, which is activated by phosphorylation by PKA, and glycogen degradation proceeds. In addition, CREB binds two molecules to the cAMP responsible element, phosphorylates serine No. 133 by proteinase such as PKA, and activates genes such as somatostatin and SF-I (steroid genie factor-1). . According to the analysis of PKA catalytic subunit a knockout mice, neonates are mostly lethal, but those that survive are severely inhibited from growing due to decreased expression of IGF-1 in the liver and urinary proteins derived from the kidney. However, it was found that sperm could not be matured in os.

 In this protein, amino acid numbers 1 to 91 are a novel sequence. It may have a function different from that of the original PKA catalytic subunit α by a protein that specifically binds to this region or by subjecting it to specific expression regulation. In addition, this DNA was isolated from testis, and it was estimated from experiments on knockout mice of PKA catalytic subunit that this protein is involved in sperm maturation, regulation of liver and kidney protein expression, regulation of glycogen synthesis, and IGF Use as a target for diagnosis and treatment of cancers such as liver cancer, kidney cancer, testicular cancer, hepatitis, cirrhosis, nephritis, diabetes, inflammatory diseases, infertility, diseases related to GPCR signaling, etc. Can be considered. Example 4 Measurement of kinase activity

 (1) Preparation of protein

For the cDNA clone presumed to have kinase activity in Example 3, the protein that it encodes was synthesized using a cell-free protein synthesis system, and it was determined whether the protein had kinase activity. Was analyzed by the following biochemical experiments. The open reading frame (ORF) fragment of the cDNA clone presumed to have kinase activity in Example 3 was used as a primer on the 5 side and the following primers specific to each clone. Obtained by PCR using primers.

5, Side primer

 (a) c-adr 1 2 0 0 1 5 5 4: ATGGAGGACAGGAAGGAGC (SEQ ID NO: 29)

(b) c-te st i i 0 2 5 3 6 6 7: ATGGTGTTTCCAAACTATCATATTTATCCTC (SEQ ID NO: 30)

 (C) c-b r c a n 2 0 1 8 2 4 0: ATGGCCTTCATGGAGAAGCC (SEQ ID NO: 3

1)

 (d) c-b r a c e 3 0 3 8 6 8 7: ATGTCGTCGTCCTTCTTCAAC (SEQ ID NO: 3

2)

 (e) c-b r a c e 3 0 5 0 7 6 4: ATGGAGCCCATGTATCAAGATCG (SEQ ID NO: 3

3)

 (f) c-b r amy 3 0 1 8 3 5 7: ATGAGCCCTGAGGGCC (SEQ ID NO: 34)

(g) c-one b r a h 3 0 2 2 8 6 6: ATGAGCAGCAATGATATTCAGTACC (SEQ ID NO:

35)

 (h) c-b r a w h 3 0 4 3 8 2 7: ATGCTCGAGGCCCGG (SEQ ID NO: 36)

(i) c brtha2 0 3 4 8 7 4: ATGGCGGCTCCGAGC (SEQ ID NO: 37)

(j) c-te s t i 4 0 5 2 1 9 7: ATGTTCACCTTGGGATACCATGG (SEQ ID NO: 3

8)

 3 'common primer

 GGCCCTTATGGCCGGAGAAAGGCGGACAGGTAT (SEQ ID NO: 39)

This is used to cleave the translation control region containing the SP6 promoter, glutathione, S-transferase gene, PreScission Protease (Amersham Pharmacia Biotech), cleavage site, DNA closing site (Sma.I, Sf_iI) It was inserted into the clonindustite of a vector (pEU-SS4) having a poly (A) signal sequence.

 Using the plasmid DNA prepared as described above as type III, transcription was performed using SP6 RNA polymerase (manufactured by Promega), and the resulting RNA was extracted with phenolic clonal honolem, precipitated with ethanol and precipitated with Nick Column (Amersham Pharmacia Biotech).

 The method of cell-free protein synthesis using a wheat germ extract by a dialysis method followed the method described previously (Endo, Y. et al., J. Biotech., 25: 221-230 (1992)). The reaction solution contains 24% of the wheat germ extract by volume, and has the following composition according to the method of Erickson et al. 2 OmM HEPE S-KOH, pH 7.6, 8 OmM potassium acetate, 1.6 mM magnesium acetate, 0.4 mM spermidine, 2 mM dithiothreitol, 20 kinds of L-amino acids (0.24 mM each), 1.2 mM ATP, 0.26 mM GTP, 16 mM creatine phosphate, 0.4 mg Zm, 1 creatine kinase, 1,000 units / ml ribonuc 丄 ease inhibitor (RN asin ™), and the above-mentioned mRNA (1 mg Zm (1 reaction volume). The above reaction solution was placed in a floater riser (Spectra / Float-A-Lyzer (Biotech RC), molecular weight cut off: 10 kDa, volume: 1 ml), and the dialysis solution was 40 times as large as the reaction solution. (3 OmM HEPE S_KOH, pH 7.6, 10 OmM potassium acetate, 2.7 mM magnesium acetate, 0.4 mM spermidine, 2.5 mM dithiothreitol, 20 kinds of L-amino acids (0.3 mM each), 1. The reaction was performed in a dialysis system against 2 mM ATP, 0.25 mM GTP, and 16 mM creatine phosphate at 26 ° C for 48 hours.

After the reaction was completed, the dialysate was centrifuged at 16,000 rpm for 5 minutes, and the supernatant was separated. This supernatant is diluted 5-fold with 50 mM Tris-HCl buffer (pH 8.5) containing 15 OmM sodium chloride and 1 OmM dithiothreitol, and Darfin, an affinity resin equilibrated with the same buffer, is used. Add at room temperature to the affinity ram filled with Tathione Sepharose 4B (Amersham Biosciences) at room temperature. Parkin was adsorbed. Here, for the column, half the amount of the obtained centrifugal supernatant was used as the affinity resin.

 After washing the column with 10 times the volume of the affinity resin used in the above buffer, the column was washed with 2 units of sZ1 concentration of PreScission protease (manufactured by Amersham Biosciences) in the same buffer. An equal volume of the double-diluted solution was added to the affinity resin, and a cleavage reaction was performed at 4 ° C. for 40 hours. Then, the target protein was eluted with the buffer solution.

 (2) Measurement of kinase activity using A A Τ consumption of target protein as an index

 The target protein isolated in (1) above was quantified using serum albumin as a standard. 0.1 g of the target protein was diluted with 0.1 mM SrngZm 1 ゥ serum albumin and 8 mM magnesium chloride in 5 OmM Tris.HCl buffer (pH 7.4) to a final concentration of 1 to 1 OmM. After adding threitol, 1] ^ After incubation at room temperature for 24 hours, luciferase / luciferin kit

After adding 100 μl (manufactured by Wako Pure Chemical Industries, Ltd.) and reacting at room temperature for 24 hours, the fluorescence intensity at 560 ηm was measured. Using the reaction system to which the target protein was not added as a control, the fluorescence intensity at 560 nm was measured in the same manner. The difference between the value of this control and the value of the system to which the target protein was added is defined as the amount of ATP consumed by the target protein, and the amount of ATP (mo1) consumed per 1 mo1 of the target protein in 24 hours is the kinase of the target protein. Activity (Table 1). In addition, as a negative control, B430206E18 (SEQ ID NO: 57, Nature, 420: 563-573 (2002)), which is a mouse full-length cDNA encoding the serine protease in the system of (1) above, was used as a negative control. ) 0.1 µg of isolated protein was used. Those that did not perform the experiment are denoted as rrt. table 1

(3) Kinase activity measurement using phosphorylation of polypeptide by target protein

 The target protein isolated in (1) above was quantified using serum albumin as a standard. 0.1 Zg of target protein is converted to a standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK, PTK1, PTK2) as a substrate: Promega, MLCKS, Ca MK II: Sigma, Syntide2: BACHEM

With _{FEINCHEMIKALIEN AG) 0. 2 μ §,} 0. 2mg / m 1 © shea serum albumin,. 1 to 1 Omm dithiothreitol I torr, 5 Om M Tris' HCl buffer containing 8 mM magnesium chloride (pH 7. 4) Incubate with 1 μΜ ATP at room temperature for 2 hours. After completion of the reaction, the reaction solution was added to a Bakerbond C18 (0.46 x 25 cm) column equilibrated with 0.1% trifluoroacetic acid containing 20% acetonitrile, and 0.1% trifluoroacetic acid was added. In the presence of 20-80. The peptides were separated at a flow rate of 1 m 1 / min by a linear concentration gradient of / ₀ acetonitrile over 60 min. Peptide elution was measured by absorbance at 215 nm. As a control, the reaction solution without addition of the target protein was similarly separated, and the absorbance at 215 ηπι was measured (FIG. 21). Here, by adding the target protein, Polypeptides in which a decrease in peak and a change in elution position are detected can be determined to be substrates for kinase activity of the target protein. As a negative control, 0.1 l ^ g of a protein synthesized and isolated from B430206E18, a mouse full-length cDNA encoding serine protease, was used in the same manner as in (2) above. . Table 1 shows the results. In Table 1, polypeptides whose elution positions fluctuated (substrates with shifted peaks) are indicated, and those for which no experiment was performed are indicated as nt. Example 5 Expression analysis in human cell lines and tissues using quantitative PCR

 Encoding the human protein of the present invention! To examine the changes in tissue expression of nRNA (ca drgl 200155 4 and c-testi 2053667) in human cell lines and normal humans and diseased patients, a conventional method (Higuchi R, et al. al., Biotechnology, 11: 1026-30 (1993)), expression analysis using quantitative PCR was performed.

 (1) Cell cDNA

 Human cervical cancer cell line HeLa (ATCC CCL-2), human fetal kidney cell line HEK293 (ATCC CRL 1573), neuroblastoma cell line SH-S Y5 Y (ATCC CRL-2266), promyelocytic leukemia-derived cell line HL 60 (ATCC CCL-240), liver cancer-derived cell line Hep G 2 (ATCC HB-8065), astrocytoma-derived cell line KI NGS-1

(J CRB I FO50435), neuroblastoma-derived cell line S S—N—SH (ATC CΗΤΒ—11), spleen cancer-derived cell line PANC—1 (ATCC CRL—14 69), colorectal adenocarcinoma-derived cell Total RNA was extracted from strain SW620 (ATCC CCL-227), breast cancer-derived cell line BT-474 (ATCC HT B-20) and metastatic ovarian adenocarcinoma-derived cell line AsPC_l (ATCC CRL-1682). Type II cDNA was synthesized using random primers. The following cDNAs derived from human tissues were purchased from Clontech (normal breast, breast cancer, normal colon, colon cancer, normal kidney, kidney cancer, normal liver, lung cancer, normal rectum, rectum cancer, normal small intestine, small intestine cancer, normal Stomach, gastric cancer and placenta). The following human tissue-derived cDNA was purchased from Biochain (fetal brain, normal brain, normal frontal lobe, Alzheimer's disease frontal lobe, normal hippocampus, Alzheimer's disease hippocampus, normal thalamus, normal kidney, lupus disease kidney, normal liver, cirrhosis liver , Normal spleen, normal skeletal muscle, normal fat, normal spleen, heart and leukocytes).

 (2) Quantification by PCR method

 The quantification of mRNA encoding the human protein of the invention (c-adrg 1 2001 554 and c-te st i 2053667) was determined by ABI PRISM7000

Using Sequence Detection System (manufactured by Applied Biosystems, Inc.), use the above cDNA as the type II in the reaction solution, qPCR Mastermix Plus (EUR0GENTEC, RT-QP2X-03-075 +), 300 nM 5, side primer, 300 The procedure was performed using nM3, side primer 1, and 100 nM double-labeled probe (FAM-TAMRA) according to the instrument manual.

 The synthetic DNA sequence of the primer and probe used for quantitative PCR is shown below.

(a) c-a d r g l 2001 554

 5 'side primer: GGTGACTCGCACAGCGMCT (SEQ ID NO: 40)

 3 'primer: CGGMATTGGTGCGGAAGTAC (SEQ ID NO: 41)

 Double labeled probe: AACATCGGCATCCTGTTCMCGAC (SEQ ID NO: 42)

 (b) c- t e s t i 2053667

 5 'primer: GACCMMCAGGATGCGMGTG (SEQ ID NO: 43)

 3. Side primer: GGCACACCAGCATCTAGCTTGT (SEQ ID NO: 44)

 Double-labeled probe: TGCTCCCTGGATTGACCTCAGTC (SEQ ID NO: 45)

 (c) GAPDH

 5, side primer: ACACCCACTCCTCCACCTTTGA (SEQ ID NO: 46)

3, primer: CCTGTTGCTGTAGCCA TTCG (SEQ ID NO: 47) Double-labeled probe: TTGCCCTCMCGACCACTTTGTC GC (SEQ ID NO: 48) The quantification results were corrected using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Torii, column number 56) as an internal standard. That is, the expression level of the target gene in each tissue was divided by the expression level of GAPDH and multiplied by a constant (1 × 10 ⁵ ). Table 2 shows the results of expression analysis in human cell lines, and Table 3 shows tissue expression analysis in normal humans and diseased patients. Table 2

Table 3

As is evident from Tables 2 and 3, the mRNA level of ca drgl 2001554 is very low overall, but it is a gastrointestinal tissue such as gastric cancer, normal small intestine, normal rectum, and colon cancer. , And weak expression was observed in the neuroblastoma-derived cell line SH-SY5Y and the like.

The mRNA of c-testi 2053667 is expressed in all cells and tissues as far as it is examined. High expression was also observed in the cell line SW 620 derived from cervix and colorectal adenocarcinoma, the cell line derived from metastatic knee adenocarcinoma As PC-1 and the cell line derived from neuroblastoma SH-SY5Y. From these results, the above cDNA and the protein encoded by the cDNA can be applied to the treatment and diagnosis of cancer, immunity, inflammatory diseases, neurodegenerative diseases, respiratory diseases, diabetes and the like. In addition, the protein encoded by the cDNA may be involved in the above-mentioned diseases involving tissues with high mRNA expression levels. Example 6 Inhibition of Expression by Introducing s ί RNA into Cells and Effects on Cell Death and Cell Proliferation

 (1) Preparation of siRNA

 After introducing siRNA designed to target c-testi 2053667 into HEK293 cells and HeLa cells, and confirming the effect of introducing the siRNA into c-testi 205 3667 mRNA, the proliferation of HEK293 cells and HeLa cells And the effect of inducing cell death were examined. In addition, those designed corresponding to the sequence of lucif erase ¾f 云 (P. pyralis luc gene: SEQ ID NO: 55) of the negative control siRNA (Photinus pyralis) were used. The synthesis was outsourced to Proligo or Qiagen.

 The sequences shown in SEQ ID NO: 49 and SEQ ID NO: 51 correspond to the target gene c-testi 2053667 (translation region is 1419 base pairs in full length from base number 36 in SEQ ID NO: 2), counted from the translation start site of the sense strand 966 to 966. These correspond to bases 986 and 1192-1212, respectively. The sequences shown in SEQ ID NO: 50 and SEQ ID NO: 52 correspond to the bases at positions 984 to 964 and 1210 to 1190 of the antisense strand, respectively, counted from the translation initiation site of c-testi 2053667. The sequences shown in SEQ ID NO: 53 and SEQ ID NO: 54 correspond to the P. pyralis luc gene (the translation region is 1653 base pairs in full length from nucleotide number 1 to 1653 of SEQ ID NO: 55) counted from the translation initiation site of the sense strand. The 58th to 58th bases correspond to the 56th to 36th bases of the antisense strand, respectively.

The method for preparing the double-stranded siRNA used to inhibit the expression of the c-testi 2053667 gene is described below. SEQ ID NO: 49 sense strand and SEQ ID NO: 50 antisense By associating with the sense strand, siRNA of testi 205366 7-964 was prepared. Similarly, by associating the sense strand of SEQ ID NO: 51 with the antisense strand of SEQ ID NO: 52, the siRNA of c-testi 20 53 66 7-190 can be obtained by combining the siRNA of SEQ ID NO: 53 A negative control siRNA was prepared by associating the sense strand with the antisense strand of SEQ ID NO: 54. For the production of siRNA, for the contract of Proligo, sense single-stranded RNA and antisense single-stranded RNA were each received as a single item, and they met themselves. For Qiagen, the company commissioned a meeting. When his meeting, a mixture of the sense strand RNA and antisense strand _{RNA 10 β Μ Tris-HCl (} pH7.5), was heated 2 min at 20 μΜ NaCl reaction liquid at 9 0 ° C, further gradually After lowering the temperature to 37 ° C, the mixture was incubated at 37 ° C for 1 hour, and then left to reach room temperature. The formation of double-stranded RNA by association of the sense strand and the antisense strand was detected by 2% agarose gel electrophoresis in a TBE buffer.

 The sequence of the double-stranded si RNA used is described below.

 (a) t e s t i 2 0 5 3 6 6 7— 9 64 s i RNA

 Sense strand; CAGGAUGCGAAGUGUMAUGA (SEQ ID NO: 49)

 Antisense strand; AUUUACACUUCGCAUCCUGUU (SEQ ID NO: 50)

 (b) t e s t i 2 0 5 3 6 6 7—1 190 s i RNA

 Sense strand; CUCUUUAGGGAUCAUCUUUUU (SEQ ID NO: 51)

 Antisense strand; MAGAUGAUCCCUAAAGAGUU (SEQ ID NO: 52)

 (c) Negative control siRNA

 Sense strand; CAUUCUAUCCGCUGGMGAUG (SEQ ID NO: 53)

 Antisense strand; UCUUCCAGCGGAUAGAAUGGC (SEQ ID NO: 54)

 (2) Introduction of siRNA into cultured cells

HEK293 cells and HeLa cells were used as the culture cells, and Dulbecco's modified Eagle's medium (manufactured by Sigma) supplemented with non-deprived 10% fetal bovine serum (manufactured by JRH) was used. 3 7 ° C, 5% C0 2 and cultured in the presence. HEK293 cells were seeded at a density of 1.4 × 10 ⁵ cells / ml on a 24-well plate (collagen type 1 coated, Iwaki Glass Co., Ltd.) at a volume of 1 ml per 1 μl, and after 1 day GeneSilencer siRNA Transfection Reagent (Gene Therapy Systems) was used to introduce a total of 50 nM of each siRNA. The concentration of siRNA was expressed as a molar concentration in the presence of 1 ml of medium per 1 μl, considering the state of double-stranded RNA as one molecule. HeLa cells are seeded at a density of 0.7 × 10 ⁵ cells / ml on a 24-well plate (24-well plate (manufactured by Greiner)) at a volume of lml / well, and siRNA is introduced in the same manner as for HEK293 cells. did.

 (3) Measurement of gene expression level in cultured cells

 The cells prepared in Example (2) above were

The DNA was recovered by solubilization using a Solution (manufactured by Applied Biosystems), and total RNA was extracted and purified using a nucleic acid extractor ABI PRISM 6100 Nucleic Acid PrepStation (manufactured by Applied Biosystems). Further

ReverseTranscriptaseXL (AMV) for RT-PCR, Ribonuclease inhibitor Random Primer, ²⁵ mM MgCl ₂ solution, lOxPCR Buffer (TaKaRa), dNTP

Reverse transcription reaction was performed using Mixture (lOmM) (manufactured by T0Y0B0) to obtain a cDNA preparation. Using the cDNA sample obtained in this way as type II, a quantitative PCR device ABI PRISM 7000

(Applied Biosystems) was used to quantify the target gene mRA. The quantification method followed the method described in Example 5 (2).

Expression of the c-testi 2053667 gene in HEK293 and HeLa cells was inhibited by either testi 2053667-964 or testi 2053667-1190 siRNA, or by a mixture of these siRNAs (Fig. 31). All values are relative to the expression level of the c-testi 2053667 gene (normalized by GAPDH amount), with the value of the cell group not transfected with siRNA (non-transfected group) as 100%. expressed. In addition, these data show the average value of the 3 ゥ -well experiment, and the vertical line in the figure shows the standard deviation. In HEK293 cells, c— testi 2 In the group to which siRNA for 053667 was added at 50 nM, testi 20 53667-964 alone, testi 2053667-1190 alone, and 74%, 51%, and 85%, respectively, of a mixture of equal amounts of the two types were used. Inhibition of 1 esti 2053667 gene expression was observed. In HeLa cells, 91%, 80%, and 90% inhibition of c-testi 2053667 gene expression was observed for test # 2053667-964 alone, testi 2053667_1 190 alone, and a mixture of these two equal amounts, respectively. In the group into which the negative control siRNA was introduced, no inhibition of c-testi 2053667 gene expression was observed.

 (4) Effect on proliferation of HEK293 cells and HeLa cells

Medium used after adding Dulbecco 's modified Eagle's medium non慟化(manufactured by J RH Co.) with 10% fetal calf serum (Sigma), they were cultured in C0 ₂ the presence 37 ° C, 5%.

HEK293 cells ^{0. IX 10 5, 0. 15 10} 5 or 0. 2 X 10 ⁵ cells Zml density in 96-well plates (collagen type 1 coated already, manufactured by Iwaki Glass Co., Ltd.) in. To 1 Ueru per 0. 25 m l One day later, a total of 50 nM siRNA was introduced using GeneSilencer siRNA Transfection Reagent (Gene Therapy Systems). As the siRNA, a negative control siRNA alone, testi 2053667-964 alone, and an equal mixture of testi 2053667-964 and testi 2053667-1190 were used, respectively. For HeLa cells the 0. 1 X 10 ^5, were plated at 0.15 10 ⁵ or 0. 2 X 10 ⁵ cellsZml density in 96-well plates (Greiner Co.) in 1 Ueru per 0 · 25m l, HEK293 cells The siRNA was introduced in the same manner as described above.

Quantification of cell proliferation was performed by measuring ATP (adenosin triphosphate) derived from living cells using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) 4 days after introduction of the siRNA. It is known that the intracellular ATP content is proportional to the number of living cells. FIG. 32 shows the results when the cell seeding density was 0.2 × 10 ⁵ cells / ml. Similar results were obtained with other cell seeding densities. The values are shown as the ATP concentration when ATP derived from living cells in each cell eluted in a 100 ^ 1 liquid medium. In addition, these show the average value of the 8 ゥ -well experiment, and the vertical line in the figure shows the standard deviation. In the group to which 50 nM of the negative control siRNA was introduced, the ATP content was reduced by 36 and 34% in HEK293 cells and HeLa cells, respectively, compared to the non-introduced group without transfusion treatment. This is presumed to be the effect on cell proliferation resulting from treatment. Testi 20536 67-964 alone, a cell group transfected with 50 nM of an equal mixture of testi 2053667-964 and testi 20536 67-1190 showed similar ATP content to the group transfected with 50 nM negative control siRNA. Was. c- The introduction of siRNA against testi 2053667 into HEK293 cells or HeLa cells did not suppress cell growth despite the decrease in c-testi 2053667 gene expression. It was suggested that they did not play an important role in the proliferation of HEK293 cells and HeLa cells.

 (5) Effects on cell death of HEK293 cells and HeLa cells

 The effect on cell death of HEK293 cells and HeLa cells was examined using siRNA (single or mixture) whose c_testi 2053667 expression-suppressing effect was confirmed by (3) above.

HEK293 cells are seeded at a density of 1.2 × 10 ⁵ cellsZml on a 96-well plate (one coated with collagen type, manufactured by Iwaki Glass Co., Ltd.) at a rate of 250 cells per 1 μl. Was introduced. Confluency at the time of introduction was around 50-60%. The same siRNA as that used in the cell proliferation evaluation system was used. HeLa cells were applied to a 96-well plate (Greiner) at a density of 0.5 x 10 ⁵ cells / ml in 1 ゥ el. PT / JP2004 / 002133 was seeded at 0.25 ml, and siRNA was introduced in the same manner as in HEK293 cells. The confluency at the time of introduction was around 60-70%.

 Cell death is quantified by measuring the LDH (lactate dehydrogenase) activity released into the culture supernatant from dead cells using the CytoTox96 Non-Radioactive Cytotoxicity Assay (Promega) three days after introduction of the siRNA. went. The total LDH activity is a measured value of the LDH activity in a sample obtained by freeze-thawing the cells in the untreated group set for each experiment and completely disrupting the cells. As a standard for measurement, the LDH Positive Control contained in the above product was diluted with PBS containing 1% bovine albumin (Sigma) or a serum-containing medium used for cell culture.

 The results of the cell death evaluation are shown in FIG. The results are measured 3 days after siRNA introduction. The values indicate the results obtained by converting the LDH activity released from dead cells in each well to the average of all LDH activities as 100%. In addition, these are the average values of the experiment of 8 mm, and the vertical line in the figure indicates the standard deviation. In each of the siRNA-transferred groups, only 7% and less than 14% of the maximum value of LDH activity in HEK293 cells and HeLa cells were shown, respectively. Therefore, induction of cell death of HEK293 cells and HeLa cells was not observed by the introduction of siRNA into c-t e sti 2053667. The introduction of siRNA against c-testi 2053667 into HEK29 cells 3 or HeLa cells did not induce cell death despite the decrease in c_testi 2053667 gene expression. It was suggested that they did not play an important role in the survival of cells and HeLa cells. Example 7 Comprehensive analysis of proteins encoded by each full-length cDNA

 (1) c-a d r g l 2001554 (SEQ ID NOS: 1, 13)

ca drgl 2001554 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) is represented by SEQ ID NO: 1. As shown, it consists of 2168 bases, of which the base number from 39 to 2159 is an open reading frame (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 706 amino acid residues (SEQ ID NO: 13). A homology search was performed for the amino acid sequence of SEQ ID NO: 13 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). (I) The amino acid sequences described in the database registration symbols AXO 40998 and WO 00/65040 were hits. As its contents, the amino acid sequences described in AX040998 and WO 00Z65040 consist of 626 amino acids, and the amino acid numbers 17 to 616 in the amino acid sequence are the amino acid sequences described in SEQ ID NO: 13. and amino acid number 25-661 incense sequence, e- value (Us expected value sequence is present by chance in a database) to have 32% of the degree of coincidence over 3 X 10- ⁸² and 655 amino acid residues (identity) Was observed. The (ii) database registration § himself ^{"^ J 3 50528, Serine /} threonine- protein kinase plol (Fission yeastj had been hit. As its contents, P 50528 consists of 683 amino acids, amino acid number of the amino acid sequence of 47 No. ～674 is, the amino acid number 45-695 No. § amino acid sequence of Ki载in SEQ ID NO: 13, e - value: 6 10- 75 force, one can 670 having a 32% degree of coincidence over amino acid residues (Iii) Database registration code, Q9R011, Cytokine-inducible

Serine / threonine—protein kinase, rat strength As an inner valley, Q9R011 is composed of 615 amino acids, and amino acid numbers 31 to 558 in the amino acid sequence correspond to amino acid numbers 39 to 645 of the amino acid sequence described in SEQ ID NO: 13; - value: over 7 X 10- ⁷¹ and 61 3 amino acid residues have a 30% one致度was observed. From these results, it was inferred that the protein having the amino acid sequence shown in SEQ ID NO: 13 was a novel serine-threonine protein kinase. The protein of (ii) above is obtained from literature information in the database. (Genes Dev., 9: 1059-1073 (1995)) suggests that it is involved in the formation of septum in cells in Gl and G2 phases. , 18: 5528-5539 (1999)), respectively, revealed that they are involved in signal transmission that regulates synapse formation. Both indicate involvement in the cell cycle, and the latter may be involved in neuronal function.

 In addition, a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 13 using HMMPFAM. As a result, the amino acid sequence represented by amino acid numbers 39 to 297 of SEQ ID NO: 13 showed a sequence (Pfam amino acid sequence entered as pkinase). In the search by HMMP FAM, a sequence showing the characteristics of the POLO box duplicated region (amino acid sequence entered as POLO-box in Pfam) was also found in the amino acid sequences shown in amino acid numbers 511 to 585. POLO box is known to be a subgroup of serine Z-threonine protein kinases involved in the cell cycle, particularly the G2ZM phase transition and cytokinesis (cytokinesis). Using this protein expressed and prepared in the cell-free protein synthesis system described in Example 4 (1), the kinase activity was measured using the ATP consuming activity as an index in the system of Example 4 (2). i tZd ay. Next, Example 4

When the kinase activity was evaluated using the phosphorylation using peptide as an index in the system of (3), no peak shift in HPLC due to transphosphorylation was observed for the peptide substrate as far as it was examined. This suggests that this protein is a novel kinase targeting a special substrate (Fig. 29).

 From the expression analysis of the present DNA in Example 5 (2), the expression level of the mRNA of the present DNA is very low overall, but the digestive system tissues such as stomach cancer, normal small intestine, normal rectum, and colon cancer and lung, kidney, And weak expression was observed in neuroblastoma-derived cell line SH-SY5Y.

From the above, it was speculated that this protein is a novel serine Z-threonine protein kinase having functions related to cell cycle and nerve function. This protein The digestive system · Respiratory system · Cancer of the nervous system, cell proliferation · Atherosclerosis as a disease caused by abnormal cell differentiation or cell cycle · Diabetic retinopathy · Endometriosis · Glomerulonephritis · Heart Hypertrophy · Mental illness such as brain dysplasia, depression, schizophrenia, Parkinson's disease * Neurodegenerative disease such as Alzheimer's disease, immunity such as asthma · Gastrointestinal disease such as Crohn's disease May be involved.

 (2) c-t e s t i 2053667 (SEQ ID NOs: 2, 14)

c-testi 2053667 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 2135 bases as shown in SEQ ID NO: 2, of which base number 36 Numbers 1 to 1454 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 472 amino acid residues (SEQ ID NO: 14). A homology search was performed for the amino acid sequence of SEQ ID NO: 14 using BLAST. (I) Database registration symbols AY 0 61 183, LD 14901 (fruit fly) were hits. AY061183 consists of 790 amino acids, and amino acid numbers 325 to 788 in the amino acid sequence correspond to amino acid numbers 7 to 468 in the amino acid sequence described in SEQ ID NO: 14, and e-value. : to have 52% of the degree of coincidence over 5 X 10- ¹³⁵ and 471 amino acid residues was observed. (Ii) Database registration code P36102, PAB-dependent poly (A) -specific ribonuclease subunit PAN3

. (Yeast) was hit. As its contents, P36102 consists of 679 amino acids, wherein amino acid numbers 231 to 677 in the amino acid sequence are the amino acid numbers 6 to 464 of the amino acid sequence described in SEQ ID NO: 14, and e-value: 1 It was found to have 26% identity over X 10 ^-47 and 482 amino acid residues. (Iii) Database registration symbols AB 062450 and NEK 7 (Human) were hit. AB 062450 consists of 302 amino acids. The amino acid numbers 35 to 182 in the amino acid sequence of the amino acid sequence are the amino acid numbers 78 to 246 of the amino acid sequence described in SEQ ID NO: 14, and the e-value is 4 X 1 O " ⁷ and 173 amino acid residues. From these results, it was inferred that the protein consisting of the amino acid sequence shown in SEQ ID NO: 14 was a protein kinase. From the literature information in the database (Mol. Cell. Biol., 16: 5744-5753 (1996)), it is implicated in the function of shortening mRNA polyA in vivo. Literature information in the database (Genomics, 68: 187-196 (2000)) has revealed that they are involved in the regulation of mitosis, and deviations indicate their involvement in the cell cycle.

 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consumption activity (24 units / day) was observed by the method described in Example 4 (2). 4 In (3), no peak shift of HP LC was observed due to the transphosphorylation using a peptide as a substrate (Figure 30), suggesting that this protein is a novel kinase targeting a special substrate. Was.

 According to the expression analysis of the present DNA in Example 5 (2), it was expressed in all cells and tissues as far as it was examined, and tissues involved in immunity and inflammation such as leukocyte, spleen, and promyelocytic leukemia-derived cell line HL60 And high expression in cells, as well as in the cell line SWW620, a cell line derived from the colon and colorectal adenocarcinoma, the cell line A s PC-1, a cell line derived from the metastatic knee adenocarcinoma, and the SH-SY5Y cell line derived from the neuroblastoma. it was high.

 From the results of the RNAi experiments on the present DNA in Example 6, the cell death and cell proliferation of HEK293 cells (cell line derived from human fetal kidney) and HeLa cells (cell line derived from human cervical cancer) under normal culture conditions It has been found that it does not affect cell death, but it may also affect cell death and cell growth in hypoxic and hypotrophic conditions. It may also affect cell cycle, cell death and cell proliferation in other cancer cells.

From the above, it was speculated that this protein is a novel serine Z-sleonine protein kinase having functions related to the cell cycle and the like. This protein is DiseasesGastrointestinal cancer Various types of cancers such as neuroblastoma, cell proliferationArteriosclerosis as a disease caused by abnormal cell differentiation or cell cyclePeripheral diabetic retinopathyEndometriotic hyperplasiaGlomerulonephritis Hypertrophy, brain dysplasia, depression, mental disorders such as schizophrenia, Parkinson's disease Neurodegenerative diseases such as Alzheimer's disease, immunity such as asthma, inflammatory diseases, digestive system diseases such as Crohn's disease there is a possibility.

 (3) c -u t e r u 200801 9 (SEQ ID NOS: 3, 15)

 cuter 200801 9 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) comprises 3165 bases as shown in SEQ ID NO: 3, of which base number 401 Numbers 1 to 1960 are open reading frames (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 519 amino acid residues (SEQ ID NO: 15). A homology search was performed on the amino acid sequence of SEQ ID NO: 15 using BLAST, and the results were found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). The database entry code BC010640, serine / threonine kinase 3, Ste20, yeast homolog) (Human power e-value: 0.0) and a 100% match over 483 amino acid residues. BC010640 was composed of 491 amino acid residues, and amino acid numbers 9 to 491 in the amino acid sequence corresponded to amino acid numbers 37 to 519 in the amino acid sequence described in SEQ ID NO: 15. The differences in the sequence are the N-terminal 36 residues of this protein and the N-terminal 8 residues of BC010640 (Fig. 1) .This difference causes differences in enzyme activity, binding / interaction with other proteins, and expression tissues. I think it could bring That the. Above, the protein B C010640, serine / threonine kinase 3 (S t e 20, yeast homolog) Ru splicing variant der of (Human).

BC010640 is a member of the human Ste20-like kinase (MST), a homolog of the budding yeast Ste20, which is a caspase substrate. It is known to increase the sensitivity of potosis (J. Biol. Chem., 276: 19276-19285 (2001)). From the above, this protein is considered to be a Ste 20-like serine Z threonine protein kinase involved in apoptosis.

 In order to examine the expression organization of this DNA, this DNA was used as a query and dbEST

A BLAST search was performed on (Nature Genetics, 4: 332-3 (1993)), and the e-value: 1 X 1 (it was found that there were 5 or more human ES ヒ ッ ト hits at ⁵ °). In addition, normal bone marrow, kidney, prostate, placenta, whole brain, and cancerous uterus were obtained, and this DNA was cloned from a uterus-derived library. Functions and diseases such as childhood cancer · prostate cancer · brain tumor · myeloma · leukemia · cancer such as malignant lymphoma, Alzheimer's disease · Parkinson's disease · neurodegenerative diseases such as Huntington's chorea, depression · central illness such as schizophrenia, Autoimmune diseases, inflammatory diseases, allergic diseases, glomerulonephritis, nephrotic syndrome, kidney diseases such as renal failure, bone marrow diseases such as Gaucher disease, etc. La That.

 (4) c-b r c a n 2018 240 (SEQ ID NOs: 4, 16)

 cb rcan 2018240 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”), as shown in SEQ ID NO: 4, consisting of 2817 bases, of which base number 42 From 1 to 733 are open reading frames (including the stop codon). Amino acid sequence predicted from open reading frame consists of 563 amino acid residues

(SEQ ID NO: 16). A homology search was performed for the amino acid sequence of SEQ ID NO: 16 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). Database registration symbol AX 405737

(unnamed 0RF) and the amino acid sequence described in WOO 2/22660 hit with an e-value of 0.0 and 95% identity over 514 amino acid residues. From the alignment of BLAST search, this protein is AX4057 Amino acid corresponding to 17 amino acid residues 35 to 51 and 1 residue of 489 is deleted, and amino acid numbers 510, 511, 512, 513 of AX405737 are deleted. It was found that glycine Z-alanine, isoleucine Z-alanine, serine Z-leucine, and alanine Z-glycine were substituted for the amino acids corresponding to (Fig. 3). In addition, this DNA lacks the bases corresponding to bases 209 to 259 of AX405737 and three bases of bases 1569-1571, and is located at the position corresponding to bases 1634/1635 of AX405737. 34 bases have been inserted. This insertion shifts the frame, resulting in a difference between the C-terminal 67 residues of this protein and the C-terminal 64 residues of AX405737. When the function of the present protein expressed in the cell-free protein synthesis system described in Example 4 (1) was evaluated, the ATP consumption activity of the present protein (73 unit Xday) was determined by the method described in Example 4 (2). Was detected. Furthermore, as described in Example 4 (3), the results of the analysis of the transphosphorylation activity using a synthetic peptide as a substrate by reverse-phase HPLC were performed.

(Figure 22. The arrow indicates the changed elution position.) The phosphorylation activity of Syntide2 was confirmed, and it was clarified that this protein was a kinase.

 To examine the expression tissue of this DNA, use this DNA as a query.

(Nature Genetics, 4: 332-3 ( 1993)) performs a BLAST search against, e- value: 10- ⁵ ° where the person EST which was hit was extracted five or more a thread且織in, normal immune System · lymphatic system · skeletal muscle · brain, cancerous immune system · testes were obtained. This DNA was also cloned from a cDNA library derived from the caudate nucleus of the brain. This protein is a unique function or disease of these tissues or cells, for example, lymphoma It can be speculated that it may be related to diseases, infertility, autosomal recessive hearing loss, etc., and is expected to be useful as a target for diagnostics and therapeutics for these diseases.

(5) c-brace 3003920 (SEQ ID NOS: 5, 17) cb race 3003920 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 5342 bases, as shown in SEQ ID NO: 5, among which base number 371 To 3874 are open reading frames (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 1167 amino acid residues (SEQ ID NO: 17). A homology search was performed for the amino acid sequence of SEQ ID NO: 17 using BLAST. The database in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB) The amino acid sequence described in the registration symbol AX 26251 6 (unnamed 0RF) and WO 01/73050 has an e-value of 0.0, and 99% identity over 1160 amino acid residues. It was hit. From this BLAST search alignment, this protein shows that amino acids corresponding to amino acids 309, 456, and 557 of AX262516 have substitutions for threonine noisoleucine, threonine Zalanine, and lysine asparagine, respectively. It was found that the N-terminal 3 residues of the protein were different from the N-terminal 72 residues of AX262516, and the C-terminal 4 residues of this protein were different from the C-terminal 12 residues of AX262516 (Fig. 5). In addition, this DNA lacks the base corresponding to 148 bases of base numbers 386 to 533 of AX262516. When a protein characteristic search was performed on the amino acid sequence of SEQ ID NO: 17 by HMMP FAM, the amino acid sequence represented by amino acid Nos. 1 to 212 showed a sequence exhibiting the characteristics of the protein kinase domain (Pfam; as pkinase Entrant amino acid sequence). PRO SITE (Nucleic Acids Res., 30: 235-8 (2002)), which is a database of amino acid patterns that classify domain structures and families according to the similarity of protein functions. According to), in the protein kinase domain of AX262516, amino acids 27 to 51 were ATP regions (ATP binding sites). This The region of 2004/002133 corresponds to the third exon of AX262516 and is deleted in this DNA.

From the above, this protein is a variant of the amino acid sequence described in AX 262516 and WO 01/73050, and is estimated to be a protein kinase or an endogenous inhibitor of protein kinase. Was done. In order to examine the expression organization of this DNA, a BLAST search was performed for db EST (Nature Genetics, 4: 332-3 (1993)) using this DNA as a query, and hit with e-value: ≤ 1 CT ⁵ ° Extraction of tissues with five or more human ESTs resulted in normal immune system, lymphoid tissue, and cancerous lung. This DNA was cloned from the cerebellum.

 Therefore, this protein is used for functions and diseases unique to these tissues and cells, such as lymphoma, leukemia, myeloma, lung cancer, brain tumors, spinal cerebellar degeneration, inflammatory diseases, allergic diseases, autoimmune diseases, It is possible to speculate that it may be involved in amyotrophic lateral sclerosis, congenital erythroid dysplasia anemia, etc., and is expected to be useful as a diagnostic or therapeutic target for these diseases.

 (6) c -b r a c e 3038687 (SEQ ID NOs: 6, 18)

 cb race 3038687 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”), as shown in SEQ ID NO: 6, consisting of 4938 bases, of which base number 81 The open reading frame (including the stop codon) from position to position 2720 is 879 amino acid residues

Presumed to encode the protein of (SEQ ID NO: 18). A homology search was performed on the amino acid sequence of SEQ ID NO: 18 using BLAST, and as a result of the patent database GENES EQ (amino acid sequence), as WO 98/22507, SE QID NO. Human receptor tyrosine kinase LMR1-h on Bii was hit. Human LMRl_h is a receptor tyrosine protein kinase consisting of 1383 amino acid, and the amino acid numbers 10 to 905 in the amino acid sequence thereof are the amino acid numbers 1 to 860 of the amino acid sequence described in SEQ ID NO: 18, e-value: 0 was found to have 94% identity over 897 amino acid residues.

LMR1 is a membrane receptor tyrosine kinase with little extracellular domain. Analysis of this protein with the transmembrane domain prediction software TMp red (Biol. Chem. Hoppe-Seyler, 374: 166 (1993)) shows that the transmembrane domain consists of LAVVAVS FSG LF AV I VLMLA CL at amino acids 32 to 53. Hit. In addition, when the HMMPFAM search, to amino acid number 12 No. 5-395 of the protein e- value: protein kinase domain was hit by 3. 3 X 10- ^47. Since this protein and LMR1-h differ at the C-terminal side from the intracellular protein kinase domain, this protein may be involved in signal transduction different from LMR1_h.

 Human LMR l__h is an incomplete N-terminal clone, but this protein is considered to be a variant and full-length.

 When this protein was expressed using the wheat germ cell-free protein synthesis system of Example 4 (1), ATP consuming activity was observed by Example 4 (2) (> 100 units / day). In Example 4 (3), no peak shift of HP LC due to transphosphorylation using a synthetic peptide as a substrate was observed (Fig. 23). Therefore, this protein is a protein kinase targeting a special substrate. The possibility was suggested.

 According to WO 98/22507, the expression of LMR1 is restricted to nerve cells. This DNA is a full-length LMR1 isolated from a cerebellar cDNA library and having a different sequence in the cell 內 domain.

Based on the above, this protein is used in brain tumors, neuroblastoma, melanoma and other cancers, Alhaima's disease, Parkinson's disease, neurodegenerative diseases such as spinocerebellar degeneration, depression, anxiety, and schizophrenia. It may be involved in endocrine diseases such as diabetes, inflammation, etc., and may be used as targets for diagnostics and therapeutics for these diseases. (7) cb race 3050764 (SEQ ID NOs: 7, 19)

cb race 3050764 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3346 bases as shown in SEQ ID NO: 7, of which base number 1744 The open reading frame (including the stop codon) is from No. 2685 to No. 2685. The amino acid sequence predicted from the open reading frame consists of 313 amino acid residues (SEQ ID NO: 19). A homology search was performed for the amino acid sequence of SEQ ID NO: 19 using BLAST, and the results were obtained from the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). Cell division kinaselO / PISSLRE (cdk 10, Human) registered with database registration number Q 15131 hits with 99% concordance over 306 amino acids with e-value: 5 X 10 ¹⁷⁹

(Figure 9). The cdk10 protein is a cyclin dependent kinase consisting of 360 amino acid residues and having a protein kinase domain at amino acids 39-323. At amino acids 80 to 86 there is a PISSLE sequence to which a growth inhibitory factor binds. Since the amino acid sequence numbers 55 to 360 of cdk10 correspond to the amino acid numbers 8 to 313 of the present protein, this protein was considered to be a variant having a different N-terminal from cdk10.

 When an HMMP FAM search was performed on the amino acid sequence of SEQ ID NO: 19, a protein kinase domain was found at amino acids 8 to 276. It is shorter on the N-terminal side than the protein kinase domain of cdk10 (amino acids 39-323). This protein and cdk10 may differ in substrate specificity and activity due to differences in the N-terminal of the protein kinase domain.

It has been reported that the cdk10 protein is involved in the progression of the cell cycle from G2 to M, and that overexpression suppresses growth (Cancer Res., 55: 3992-3995 (1995)). Although its protein is ubiquitously expressed in adult tissues, it is expected to be a tumor suppressor because it is particularly high in terminally differentiated cells. However, no mutation was found in breast cancer (Genomics, 56: 90-97 (1999)), and the details of its function are unknown.

 When this protein was expressed in the wheat germ cell-free protein synthesis system of Example 4 (1), it was confirmed that it had ATP consuming activity by the method of Example 4 (2) (39 units / day). According to the method of (3), peak shift of HP LC due to transphosphorylation was recognized using syntide2 as a substrate (FIG. 24), indicating that the present protein is a kinase.

 This protein has a different N-terminal sequence from cdk10, and may be under different expression control.Involvement in cell proliferation, differentiation, carcinogenesis, tumor suppressor function, immunity, inflammation, diagnosis of neurodegenerative diseases, etc. It can be used as a target for drugs and therapeutics.

 (8) c-b r amy 3018357 (SEQ ID NOs: 8, 20)

cb r amy 3018357 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3576 bases as shown in SEQ ID NO: 8, of which base number 254 Numbers 2554 are open reading frames (including the stop codon). The amino acid sequence predicted from the open reading frame consists of 766 amino acid residues (SEQ ID NO: 20). A homology search was performed for the amino acid sequence of SEQ ID NO: 20 using BLAST, and it was found in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB). The unnamed ORF described as SEQU ID NO. 2 in AX 327993 and WO 01Z81 588 was hit with an e-value of 0 and a 94% identity over 660 amino acids. This sequence consisted of 674 amino acids, whose amino acid numbers 31 to 646 corresponded to amino acid numbers 77 to 692 of the present protein. This protein appeared to be a variant that differs from AX327993 in the N- and C-termini (Fig. 11). When the amino acid sequence of SEQ ID NO: 20 was searched by HMMPF AM, a protein kinase domain was detected at amino acid numbers 77 to 316, and the amino acid sequence was searched by PROS ITE (Nucleic Acids Res., 30: 235-8 (2002)). Nos. 183 to 196 found a sequence specific to serine / threonine protein kinase. On the other hand, when the protein kinase domain was searched for 799327993 by HMMPFAM, it was predicted that 存在 327993 was present at amino acids 19 to 270. In other words, the protein kinase domain covers different regions of the N-terminal sequences of both, and it is presumed that the substrate specificity and the activity are different.

 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consuming activity (69 units / day) was observed by the method described in Example 4 (2). According to the method described in (3), peak shift due to phosphate group transfer was observed using syntide2 as a substrate (FIG. 25), indicating that the present protein is a kinase.

This DNA was isolated from brain tonsils, and a homology search was performed on human db EST (Nature Genetics, 4: 332-3 (1993)) to examine its expression distribution. value: ^{≤10—1Q ()} hit 3 clones from the eye and 1 clone from the fetal brain.

 Based on the above, this DNA and this protein are functions in the development and differentiation of the brain, anxiety disorders, depression, schizophrenia, neurodegenerative diseases, cancer, inflammation, diabetes and other diagnostic and therapeutic agents, or ophthalmology (glaucoma). Cataracts, retinopathy, etc.) as targets for diagnostics and therapeutics.

 (9) c-b r awh 3022866 (SEQ ID NOS: 9, 21)

cb r awh 3022866 (hereinafter, referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) consists of 4547 bases as shown in SEQ ID NO: 9; Nos. 3898 to 3898 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 1288 amino acid residues. (SEQ ID NO: 21). When the amino acid sequence of SEQ ID NO: 21 Homology searches were performed using BLAST, NRDB protein database in the human sequence _{(SWI S S-PROT s PIR} , TREMBL, GENPEPT, non-redundant amino acid sequence created from PDB In the Chuopo patent database GENESEQ (amino acid sequence), a human protein kinase (SGK040, 909 amino acids) described as S EQ ID NO. 54 in WO 01Z38503 is e-value: 0, Hits were 88% consistent over 945 amino acids.

 Detailed examination revealed that the present DNA and SGK040 are splicing variants from the same gene. In addition, SGK040 was found to have a 44 amino acid insertion adjacent to and upstream of the protein kinase domain. This suggests that this protein may differ from SGK040 in substrate specificity or activity.

 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consumption activity (217 unit / άay) was observed in Example 4 (2). According to 3), a peak shift in HPLC by phosphoryl transfer using syntide2 as a substrate was confirmed (Fig. 26), confirming that it is a kinase. This DNA is derived from the brain, but db EST (Nature Genetics, 4) : 332-3

 (1993)), BLAST searches against the immune system, skin, kidney, brain, adrenal gland, and other hit clones were found throughout. In addition, this protein is present in the nucleus and is expected to be involved in the aggregation of chromosomes.

 From the above, it is considered that the present DNA and the present protein can be used as targets for diagnostics and therapeutics for cancer, immune inflammation (eg, autoimmune diseases, nephritis, etc.), hypertension, and neurodegenerative diseases.

(10) cb r awh 3043827 (SEQ ID NOS: 10, 22) c-bra wh 3043827 (hereinafter, referred to as “the present DNA” and the protein encoded by the DNA is referred to as “the present protein”), as shown in SEQ ID NO: 10, consisting of 4222 bases, Nos. 146 to 3406 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 1086 amino acid residues (SEQ ID NO: 22). A homology search using BLAST was performed on the amino acid sequence of SEQ ID NO: 22, which was found in the NRDB protein database (SWISS—a database of non-overlapping amino acid sequences created from PROT, PIR, TREMBL, GENPEPT, and PDB). Homo sapiens activated p21cdc42Hs kinase (ACK 1) of 1036 amino acids registered in the database registration code L13738 was hit with 95% identity over e-value: 0 and 1053 amino acids. This protein is a protein with 15 amino acids between the cdc42 binding region and clathrin binding region. Its binding and interaction with cdc42 and clathrin may be different from ACK1.

 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), no ATP consuming activity was observed in Example 4 (2). It was suggested that sufficient activation of this protein requires modifications such as phosphoric acid or protease cleavage, or that it is a protein kinase targeting a special substrate. Based on the above, this protein is a diagnostic agent for cancer, arteriosclerosis, diabetes, HIV, inflammation, diseases related to receptor uptake, diseases related to neurotransmission disorders, dementia such as Alzheimer's disease, hypertension, glaucoma, etc. It can be used as a target for therapeutic drugs.

 (1 1) c-b r t h a 20348 74 (SEQ ID NOS: 11, 23)

c-brtha 2034874 (hereinafter referred to as “present DNA” and the protein encoded by the DNA is referred to as “present protein”) consists of 3857 bases, as shown in SEQ ID NO: 11, of which base number Nos. 55 to 1287 are open reading frames (including a stop codon). Open 04002133 The amino acid sequence predicted from the coding frame consists of 410 amino acid residues (SEQ ID NO: 23). A homology search was performed for the amino acid sequence of SEQ ID NO: 23 using BLAST. , Database registration code: Registered in P45985, Dual specificity mitogen—activated protein kinase kinase 4, MAP kinase kinase 4 (MAP KK 4), JK activating kinase 1, c-Jun N-terminal kinase kinase 1 (JNKK ), SAPK / ERK kinase 1 (SEK 1)) hit 97% of e-value: 0, 410 amino acids. MA P KK 4 has a total length of 399 amino acids. This protein is a variant that has an insertion of 11 amino acids between amino acids 39 and 40 of MAP KK4 (amino acids 40-50 of this protein) (Figure 17).

 When this protein was expressed in the cell-free protein synthesis system of Example 4 (1), ATP consuming activity (33 units / day) was detected by the method of Example 4 (2). As a result, a peak shift in HPLC due to transphosphorylation using syntide2 as a substrate was observed (FIG. 28), indicating that this protein has kinase activity.

 This protein is used for apoptosis against immune, liver, brain and other stress, cell proliferation, cancer, abnormal signal transduction by GPCR, elongation of nerve cells, dementia, liver regeneration, diabetes, blood pressure regulation, amyotrophic lateral sclerosis In addition, it is presumed to be involved in autoimmune diseases, immune inflammatory diseases such as allergic diseases, etc., and it can be used as a target for diagnostics and therapeutics for these diseases.

 (12) c-te s t i 4052197 (SEQ ID NOS: 12, 24)

c-testi 4052197 (hereinafter referred to as “present DNA”, and the protein encoded by the DNA is referred to as “present protein”) comprises 3105 bases as shown in SEQ ID NO: 12, of which base number 407 Numbers 1690 to 1690 are open reading frames (including stop codons). open The amino acid sequence predicted from the reading frame consists of 427 amino acid residues (SEQ ID NO: 24). A homology search was performed on this protein using BLAST, and the database registration symbol in the NRDB protein database (a database of non-overlapping amino acid sequences created from SWI SS—PROT, PIR, TREMBL, GENPEPT, and PDB) was obtained. O Human cAMP-dependent protein kinase catalytic subunit type alpha (P KACa) registered in XO7767 hit with 99% identity over 0 and 336 amino acids. This sequence is composed of 351 amino acids, and amino acid numbers 16 to 351 correspond to amino acid numbers 92 to 427 of this protein, indicating that this protein is an N-terminal variant of PKACa (Fig. 19). .

 When this protein was expressed by the cell-free protein synthesis system of Example 4 (1), no ATP consuming activity was observed in Example 4 (2). It is thought that the function of this protein requires stimulation such as phosphorylation or activation such as protease cleavage.

 This protein has a novel sequence at amino acids 1 to 91. It may have a function different from that of the original PKA catalytic subunit α by a protein that specifically binds to this region or by subjecting it to specific expression regulation. Although this DNII was isolated from the testis, experiments on PKA catalytic subunit chick knockout mice suggest that this protein is involved in sperm maturation, regulation of liver, and kidney protein expression.

 Based on the above, this protein is targeted for diagnosis and treatment of cancers such as liver cancer, kidney cancer, testis cancer, hepatitis, cirrhosis, nephritis, diabetes, immunity, inflammatory diseases, infertility, and diseases related to GPCR signaling. It can be used as Industrial potential

Since the protein of the present invention and the DNA encoding the same have kinase activity and the like, the activity is regulated by using the protein or the DNA encoding the protein. It is useful for the development of a medicament that can screen for a substance that can act on diseases associated with the protein.

 This application is based on a Japanese patent application filed on Feb. 24, 2003 (Japanese Patent Application No. 2003-46666), the contents of which are incorporated herein by reference. The contents of the documents cited in the present specification are also incorporated herein by reference.

Claims

The scope of the claims

1. The following protein (a) or (b):

 (a) a protein consisting of the amino acid sequence of any one of SEQ ID NOs: 13 to 24,

(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence of any of SEQ ID NOs: 13 to 24, and which has a kinase activity;

 2. A DNA encoding the protein of claim 1.

 3. A full-length cDNA encoding the protein of claim 1.

 4. DNA of either (a) or (b) below;

 (A) DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12,

 (b) Encoding a protein having a kinase activity having a base sequence in which one or several bases are deleted, substituted and / or added in the base sequence set forth in any one of SEQ ID NOS: 1 to 12 DNA,

 (c) a protein having a nucleotide sequence capable of hybridizing a DNA having the nucleotide sequence of any one of SEQ ID NOs: 1 to 12 or a sequence complementary thereto under stringent conditions, and encoding a protein having kinase activity DNA.

 5 · A recombinant vector containing the DNA according to any one of claims 2 to 4 or any of the preceding claims.

 6. A transgenic cell into which the DNA according to any one of claims 2 to 4 or the recombinant vector according to claim 5 has been introduced, or an individual comprising the cell.

 7. The protein of claim 1, produced by the cell of claim 6,

8-A sense oligonucleotide having the same sequence as 5 to 100 consecutive nucleotides in the nucleotide sequence of DNA according to any one of claims 2 to 4, and an antisense having a sequence complementary to the sense oligonucleotide. An oligonucleotide selected from the group consisting of a sense oligonucleotide and an oligonucleotide derivative of the sense or antisense oligonucleotide.

9. An antibody or a partial fragment thereof that specifically binds to the protein of claim 1 or Ί.

 10. The antibody according to claim 9, wherein the antibody is a monoclonal antibody.

 11. The antibody according to claim 10, wherein the monoclonal antibody has an action of neutralizing the kinase activity of the protein according to claim 1 or 7.

 12. The method according to claim 1, wherein the test substance is brought into contact with the protein according to claim 1 or 7, and a change in the activity of the protein caused by the test substance is measured. Screen Jung method.

 13. Contacting a test substance with a cell that expresses the protein according to claim 1 or the gene-transfected cell according to claim 6, and detecting a change in the expression level of DNA introduced into the cell. A method for screening for a substance that regulates expression of DNA, characterized in that:

 14. At least one or more amino acid sequence information selected from the amino acid sequence of the protein according to claim 1, and at least one selected from Z or the base sequence of the DNA according to any one of claims 24 to 24. A computer-readable recording medium that stores one or more base sequence information.

 15. A carrier to which the protein according to claim 1 and Z or the DNA according to any one of claims 2 to 4 are bound.