JP2005245274A - Cell proliferation promoter - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a protein based on a bioactivity, obtained by analyzing base sequences of cDNA clones contained in a full-length cDNA library, and specifying the bioactivity of the protein encoded by the full-length cDNA estimated that the cDNA encodes a protein kinase; and to provide a method for utilizing the DNA encoding the protein. <P>SOLUTION: The cell proliferation promoter contains one protein of the following (a) to (c): (a) a protein having a specific amino acid sequence; (b) a protein obtained by deleting, substituting and/or adding one or several amino acids from, with and/or to the specific amino acid sequence, and having kinase activities and/or cell proliferation activities; and (c) a protein comprising a partial amino acid sequence of the specific amino acid sequence, and having the kinase activities and/or the cell proliferation activities. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a cell growth promoter containing a protein having kinase activity and / or cell growth activity, a cell growth inhibitor containing a substance that inhibits the activity of the protein, and a substance that regulates gene expression of the protein The present invention relates to a cell growth promoter or a cell growth inhibitor containing a protein, a cell growth inhibitor containing an oligonucleotide targeting the protein gene, a cell growth inhibitor containing an antibody that specifically binds to the protein, and the like. Furthermore, the present invention relates to a method for screening a substance that regulates the cell proliferation activity of the protein, a method for screening a substance that regulates the expression of DNA encoding the protein, and a method for promoting or inhibiting cell proliferation.

  A protein kinase is an enzyme that phosphorylates serine, threonine, or tyrosine residues of a substrate protein, and many families are known. In addition, protein kinases are generally known to be involved in the control of various life phenomena as well as apoptosis and cell proliferation / differentiation by regulating intracellular signal transduction systems through protein phosphorylation. Elucidation of the relationship is underway (for example, see Non-Patent Document 1).

  Cells respond to various external stimuli such as growth factors, cytokines, or physicochemical stress, and exhibit adaptive responses such as proliferation, differentiation, and apoptosis. One of the major systems that accurately convey extracellular stimuli to the nucleus is the mitogen-activated protein kinase (MAPK) pathway, which controls gene expression from yeast to mammals. Mediates various signals that regulate cell proliferation and differentiation and stress-induced responses in a range of organisms (see, eg, Non-Patent Document 2).

  MAPK was found in cultured mammalian cells as a serine / threonine kinase that is commonly activated by various growth factors such as epidermal growth factor and platelet-derived growth factor and proliferation stimuli such as insulin. MAPK is activated by phosphorylation of threonine / tyrosine residues in its activation loop by MAPK kinase (MAPKK), which is a serine / threonine / tyrosine kinase. MAPKK is also activated by the serine / threonine residues in its activation loop being phosphorylated by MAPKK kinase (MAPKKKK). Thus, the MAPK pathway is constituted by a cascade of three types of kinases, MAPKKKK-MAPKK-MAPK, and activated MAPK phosphorylates and activates transcription factors among other substrates. Signals from outside the cell are transmitted through a series of phosphorylation cascades: tyrosine kinase receptor → adaptor molecule → GTP / GDP exchange factor → low molecular weight G protein (Ras) → MAPKKKK (Raf1) → MAPKK → MAPK → transcription factor. It is transmitted from the cell membrane to the nucleus while being amplified.

  The MAPK cascade includes a classic MAPK cascade and a stress-responsive protein kinase (SAPK) cascade. The cascades of mammalian ERK (extracellular signal-regulated kinase) 1 and ERK2, which are classical MAPKs, are initiated by Ras stimulated by growth factors and involve Raf, MEK and ERK (see, for example, Non-Patent Document 2). reference). As a result of signaling through the classical MAPK cascade, cell proliferation and differentiation are controlled. On the other hand, the SAPK cascade is conserved across species, and is a mechanism common to all eukaryotic cells from budding yeast, fission yeast, Drosophila and nematodes to humans. As SAPK, JNK (c-Jun N-terminal kinase) and p38 are known in mammals, Hog1 in a cascade that responds to high osmotic pressure in budding yeast, and Fus3 and Kss1 in a cascade that responds to mating pheromones in fission yeast. While ERK is activated by growth stimulation, both JNK and p38 are activated by various physicochemical stresses such as radiation, ultraviolet rays, anticancer agents, hyperosmotic pressure, heat shock, peroxide, endotoxin, and serum removal. It is also activated by inflammatory cytokines such as TNF (tumor necrosis factor) -1 and IL (interleukin) -1. The results of signal transduction by the SAPK cascade are diverse, and physiological and cytochemical reactions such as stress adaptation, apoptosis, cell carcinogenesis, cell proliferation, cell differentiation, cell cycle, immune response are controlled. Therefore, it has been found that abnormalities of these reactions involving kinases cause many biological dysfunctions. In particular, abnormalities in cell proliferation, cell differentiation or cell cycle are the direct causes of cancer development. In addition to cancer, diseases caused by cell proliferation, cell differentiation or cell cycle abnormality include arteriosclerosis, diabetic Retinopathy, endometrial hyperplasia, glomerulonephritis, cardiac hypertrophy, etc. (wherein the control of three reactions of cell proliferation, cell differentiation and cell cycle are closely related, Refers to cell growth promotion, cell differentiation inhibition and cell cycle initiation / enhancement as “cell proliferation promotion”, and cell growth inhibition, cell differentiation promotion and cell cycle arrest / delay as “cell growth inhibition”. "Proliferation promotion" and "cell growth inhibition" are collectively referred to as "cell growth regulation"). Therefore, the cell growth promoter or cell growth inhibitor of the present invention capable of regulating cell proliferation, cell differentiation or cell cycle is used for the treatment of diseases caused by these cell proliferation, cell differentiation or cell cycle abnormalities and / or Or it can be used as a preventive agent.

  The human genome, which is said to have 3 billion base pairs, was published in February 2001 as a draft of its base sequence. In April 2003, the complete sequence was decoded and published. The purpose of elucidating the genome sequence is to understand the complex life phenomenon as a network of interactions and functions of all genes or between genes, proteins, cells and even individuals. Elucidating biological phenomena from genome information of various species is not only important as a research subject in the academic field, but also how to develop the research results obtained there for industrial application In that sense, its social significance is also great.

  In eukaryotic genome sequences, a single gene is often divided into multiple exons by introns. Therefore, there are many problems in accurately predicting the structure of the protein encoded there from only the genomic sequence information. On the other hand, in cDNA prepared from mRNA from which introns have been removed, information on the amino acid sequence of the protein can be obtained as a single piece of continuous sequence information, so that the primary structure can be easily clarified. In human cDNA research, more than 5 million EST (Expressed Sequence Tags) data have been published in public databases.

  Such information is utilized from various angles such as elucidation of human gene structure, prediction of exon region in genome sequence, and estimation of its expression profile. However, since most of these human EST information is concentrated in the vicinity of the 3 ′ end of cDNA, the information in the vicinity of the 5 ′ end of mRNA is extremely deficient. On the other hand, even when a protein encoded by the same genome is transcribed, an isomer (hereinafter referred to as “splicing”) in which a part of the exon in the genome is inserted and deleted when it is transcribed. Sometimes called "variant mRNA"). In fact, a plurality of types of similar proteins (hereinafter sometimes referred to as “splicing variants”) produced by translating these mRNAs have been confirmed in vivo. Splicing variants are expressed in a tissue-specific, developmental stage-specific or disease-specific manner and are considered to have different functions.

  In addition, more than 40,000 cDNAs have been revealed as a result of analysis conducted at research institutions around the world (Helix Laboratories, Kazusa DNA Laboratories, Institute of Medical Science, University of Tokyo, German Cancer Research Center, MGC Project, etc.) It seems that it covers the majority of gene loci, which are said to be several thousand in number, but the percentage of cDNA obtained as a full-length clone is about 80%, duplication and splicing Considering that the variants are included, it is considered that there are many cDNAs that have not yet been obtained.

As described above, protein kinases are enzymes that phosphorylate serine, threonine, or tyrosine residues of a substrate protein, and there are a great many families. In addition, protein kinases are generally associated with the control of various life phenomena as well as cell proliferation, cell differentiation, or cell cycle by regulating intracellular signal transduction systems through protein phosphorylation. I also mentioned earlier that clarification is in progress. About 3-4% of human genes are said to be protein kinase genes, and it is estimated that there are hundreds of different protein kinases in the human body, but many protein kinase genes have not been cloned yet. Even if it is cloned or cloned, its function (kinase activity and functions other than kinase activity) is only estimated in silico. The protein encoded by the gene is actually obtained to measure its activity, In experimental methods such as using animals to confirm the function of the gene, it is left unconfirmed or unclear. For example, in a cascade involving JNK and p38, which has accumulated results suggesting that apoptosis is induced, in mice deficient in the JNK gene, apoptosis of forebrain neurons is promoted, resulting in embryonic lethality, It suggests that cascades involving JNK and p38 function as survival signals in some situations, such as T cells lacking MKK4, a protein kinase that activates JNK, are more susceptible to apoptosis against Fas and CD3 stimulation. The opposite result has been reported (for example, see Non-Patent Document 3). Therefore, it is highly significant to analyze and clarify the function of protein kinases including variants, and the relationship between kinase activity and functions other than kinases, particularly the relationship between cell proliferation, cell differentiation or cell cycle, using experimental methods. In addition, protein kinases that have been clearly associated with cell proliferation, cell differentiation, or cell cycle are used as target molecules for the treatment of diseases caused by cell proliferation, cell differentiation, or cell cycle abnormalities, and proteins themselves Can be expected to be useful. Therefore, it is important to analyze the functions of protein kinase encoded by full-length cDNA in relation to cell proliferation, cell differentiation or cell cycle and to develop new cell growth promoters or inhibitors using these proteins. it makes sense.
Hunter, T., Cell, 50: 823-829 (1987) Lewis, TS et al., Adv. Cancer Res., 74: 49-139 (1998) Nishida, H. et al., Nature, 385: 350-353 (1997)

  The present invention analyzes a nucleotide sequence of a cDNA clone contained in a full-length cDNA library, and newly identifies a protein encoded by a cDNA having kinase activity and / or cell proliferation activity by an experimental method, It is an object of the present invention to propose a method for using a protein based on the activity and a DNA encoding the protein.

  The present inventors have used an oligo-capping method (Maruyama, K., et al., Gene, 138: 171-174 (1994); Suzuki, Y. et al., Gene, 200: 149-156 (1997)). The full-length cDNA obtained by using the cDNA was searched based on the homology of the base sequence of the cDNA clone, and a full-length cDNA presumed to encode a protein kinase was selected. Among the cDNAs presumed to encode these protein kinases, it was clarified that the protein obtained by expressing FCBBF2003102 (SEQ ID NOs: 1 and 7; GenBank registration symbol AK122988) has kinase activity, and further the expression of FCBBF2003102. It was revealed for the first time that the protein encoded by FCBBF2003102 has a cell proliferation activity, by analyzing the phenotypic change of cells that inhibited the phenotype. In addition, it is a variant including a splicing variant of FCBBF2003102 and is a protein kinase GenBank registration code AX452865 (SEQ ID NOs: 2 and 8; nageneseq registration code AAL44017, aageneseq registration code AAO15419, SEQ ID NO. 3 of WO02 / 42438) No. 5), GenBank registration symbol AX504237 (SEQ ID NOS: 3 and 9; nageneseq registration symbol AAD38847, aageneseq registration symbol AAE24133, SEQ ID NO.4 and NO.26 of WO02 / 33099), GenBank registration symbol AX534347 (sequence number) 4 and 10; nagenesseq registration symbol ABV73287, aageneseq registration Symbol ABB82471, SEQ ID NO.1 and NO.2 of WO02 / 70678, GenBank registration symbol AX056382 (SEQ ID NOS: 5 and 11; nageneseq registration symbol AAF44647, aagenesseq registration symbol AAB65621, SEQ ID NO. Of WO00 / 73469) 26 and No. 147) and GenBank accession number AB051552 (SEQ ID NOs: 6 and 12) have also been demonstrated for the first time, and the present invention has been accomplished based on these findings. Table 1 summarizes the relationship between names used in the present invention, such as registered symbols in various databases, documents described, and names given in documents.

That is, according to the present invention, the following inventions 1 to 14 are provided.
1. A cell growth promoting agent comprising any of the following proteins (a) to (c):
(A) a protein comprising the amino acid sequence of any one of SEQ ID NOs: 7 to 12,
(B) It consists of an amino acid sequence in which one or several amino acids are deleted, substituted and / or added in the amino acid sequence described in any of SEQ ID NOs: 7 to 12, and has kinase activity and / or cell proliferation activity protein,
(C) A protein consisting of a partial amino acid sequence in the amino acid sequence of any one of SEQ ID NOs: 7 to 12 and having kinase activity and / or cell proliferation activity.
2. A cell growth inhibitor comprising a substance that inhibits the activity of the protein according to item 1.
3. A cell growth promoter or cell growth inhibitor comprising a substance that regulates expression of the gene of the protein according to item 1.
4). A sense oligonucleotide having the same sequence as 5 to 100 consecutive bases in any one of the following base sequences (a) to (c), an antisense oligonucleotide having a sequence complementary to the sense oligonucleotide, and the sense Alternatively, a cell containing an oligonucleotide selected from the group consisting of an oligonucleotide derivative of an antisense oligonucleotide, a double-stranded oligonucleotide comprising the sense oligonucleotide or antisense oligonucleotide, and an oligonucleotide derivative of the double-stranded oligonucleotide Growth inhibitor;
(A) the base sequence according to any one of SEQ ID NOs: 1 to 6,
(B) In the base sequence described in any one of SEQ ID NOs: 1 to 6, the base sequence has one or several bases deleted, substituted and / or added, and has kinase activity and / or cell proliferation activity A base sequence of DNA encoding a protein having
(C) has a base sequence capable of hybridizing under stringent conditions with a DNA having the base sequence described in any of SEQ ID NOs: 1 to 6 or a complementary sequence thereof, and has kinase activity and / or cell proliferation A base sequence of DNA encoding a protein having activity.
5. The cell growth inhibitor according to item 4, wherein the double-stranded oligonucleotide is selected from the group consisting of the following (a) to (c):
(A) a double-stranded oligonucleotide consisting of an oligonucleotide having the base sequences set forth in SEQ ID NOs: 25 and 26,
(B) a double-stranded oligonucleotide consisting of an oligonucleotide having the base sequences set forth in SEQ ID NOs: 27 and 28,
(C) A double-stranded oligonucleotide consisting of an oligonucleotide having the nucleotide sequence set forth in SEQ ID NOs: 29 and 30.
6). A cell growth inhibitor comprising an antibody or a partial fragment thereof that specifically binds to the protein according to item 1.
7). A substance for regulating cell proliferation activity of the protein, comprising contacting the protein according to item 1 with a test substance, and measuring a change in kinase activity and / or cell proliferation activity of the protein by the test substance. Screening method.
8). A kit for screening a substance that regulates cell proliferation activity of the protein, comprising the protein according to item 1.
9. Contacting a test substance with a cell that expresses the protein according to item 1 or a gene-transfected cell into which a recombinant vector containing a DNA encoding the protein has been introduced, and detecting a change in the expression level of the DNA in the cell A screening method for a substance that regulates the expression of DNA.
10. It contains at least one selected from the group consisting of DNA encoding the protein according to item 1, cells expressing the protein, a recombinant vector containing the DNA, or a gene-transferred cell into which the recombinant vector has been introduced. A kit for screening for a substance that regulates expression of the DNA.
11. A method for promoting cell proliferation using the protein according to item 1.
12 A method for promoting cell growth using a recombinant vector comprising DNA encoding the protein according to item 1.
13. 6. A method for inhibiting cell proliferation using the oligonucleotide according to item 4 or 5.
14 7. A method for inhibiting cell growth using the antibody or partial fragment thereof according to item 6 above.

  Since the protein used in the present invention has cell proliferation activity in addition to kinase activity, a cell proliferation promoter using the protein can be provided. In addition, a substance that regulates cell proliferation activity can be screened using the protein or the DNA encoding the protein, and development of a drug that can act on a disease associated with the protein, such as a cell proliferation promoter or cell proliferation It is useful for the development of inhibitors and the like.

The present invention provides a cell growth promoter containing a protein consisting of the amino acid sequence set forth in any of SEQ ID NOs: 7-12. Hereinafter, the present invention will be described in more detail, but these descriptions are examples (representative examples) of the embodiments of the present invention and do not limit the scope of the present invention.
(1) Acquisition of full-length cDNA and analysis of base sequence The DNA used in the present invention is a protein consisting of the amino acid sequence described in SEQ ID NOs: 7-12, or 1 or a number in the amino acid sequence described in SEQ ID NOs: 7-12 (Here, several means, for example, 5 or less, preferably 3 or less, more preferably 2 or less) consisting of an amino acid sequence including substitution, deletion and / or addition of amino acid residues. And any protein that can encode a protein having kinase activity and / or cell proliferation activity. Specifically, it may be only the translation region encoding the amino acid sequence (hereinafter sometimes referred to as “open reading frame” or “ORF”), or may include the full length of the cDNA.

  Specifically, examples of the DNA containing the full length of cDNA include DNA consisting of the base sequences described in SEQ ID NOs: 1-6. The translation region includes nucleotide numbers 27 to 1757 of SEQ ID NO: 1 (including a stop codon), nucleotide numbers 113 to 2566 of SEQ ID NO: 2 (including a stop codon), and nucleotide numbers of 1 to 2508 of SEQ ID NO: 3 (including a stop codon). Including a stop codon), base numbers 1-2505 of SEQ ID NO: 4 (not including a stop codon), base numbers 1-2061 of SEQ ID NO: 5 (including a stop codon), base numbers 2-1828 of SEQ ID NO: 6 (stop) Having a sequence shown in (including codons). Furthermore, the DNA used in the present invention includes not only the full length of the cDNA described above, but also those containing the translation region and the 3 ′ and / or 5 ′ end adjacent to the translation region at least necessary. included.

  The DNA used in the present invention may be obtained by any method as long as it can be obtained. Specifically, for example, it can be obtained by the method described below. First, mRNA is prepared from human tissue or cultured cells by a commonly used method known per se. Next, cDNA is obtained by the oligo cap method (Maruyama, K. et al., Gene, 138, 171-174 (1994)) using this mRNA as a template. Specifically, the 5 ′ cap is removed from the obtained mRNA with acid pyrophosphatase, and then the exposed 5 ′ terminal phosphate group is used as a target and an oligo cap linker is ligated using RNA ligase. Here, for RNA molecules that do not have a cap structure at the 5 ′ end, in order to prevent the oligo cap linker from binding, the 5 ′ cap is not removed, but the 5 ′ cap is removed in advance. It is effective to remove the phosphoric acid group using phosphatase having an activity of removing only the phosphate group. Using this RNA molecule as a template, reverse transcription is performed by reverse transcriptase using an oligo dT primer as a 3'-side primer, and then the RNA strand is decomposed and removed.

  Furthermore, using the obtained single-stranded DNA as a template, the oligonucleotide having the partial sequence of the oligocap linker is a 5 ′ primer, and a primer specific to the 3 ′ end (such as an oligo dT primer) is used for a polymerase chain reaction ( PCR) can be used to prepare a full-length cDNA library. The primer chain length is usually 15 to 100 bases, preferably 15 to 30 bases. However, when the length of the cDNA to be amplified is long, the length is preferably 25 to 35 bases. and Accurate PCR (LA PCR: Kenji Hayashi, Experimental Medicine separate volume, latest technology of PCR, Yodosha; Cheng, S. et al., Nature 369: 684-685 (1994)) is preferably used.

  The cDNA thus obtained is cloned by inserting it into an appropriate cloning vector. As the vector used here, a protein expression vector which can introduce the obtained cDNA clone into a cell and express the protein encoded by the cDNA is preferably used. Specifically, for example, when the host is a mammalian cell or the like, pME18SFL3 (Genbank AB009864) or the like is preferable. In the case of Escherichia coli, pET3, pET11 (manufactured by Stratagene), pGEX (manufactured by Amersham Pharmacia Biotech) or the like In the case of yeast, pESP-I expression vector (Stratagene) is used, and in the case of insect cells, BacPAK6 (Clontech) is used. When the host is an animal cell, examples include ZAP Express (Stratagene), pSVK3 (Amersham Pharmacia Biotech), and the like.

  The cDNA library thus obtained is subjected to base sequence analysis by a commonly used method known per se. The DNA used in the present invention is analyzed for the nucleotide sequence of the 5 ′ end or 3 ′ end of the obtained cDNA, and this is analyzed by NCBI (National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov). /) Genbank, EMBL, DDBJ, PDB, EST and other databases such as BLAST (Basic local alignment search tool; Altschul, SF, et al., J. Mol. Biol., 215, 403-410 (1990) ) Was used, and when a completely identical sequence was not found for the entire length, it was decided to be subjected to the following analysis as new.

  Examples of the DNA having such a full-length cDNA base sequence include those having the base sequences described in SEQ ID NOs: 1 to 6. The translation region includes nucleotide numbers 27 to 1757 of SEQ ID NO: 1 (including a stop codon), nucleotide numbers 113 to 2566 of SEQ ID NO: 2 (including a stop codon), and nucleotide numbers of 1 to 2508 of SEQ ID NO: 3 (including a stop codon). Including a stop codon), base numbers 1-2505 of SEQ ID NO: 4 (not including a stop codon), base numbers 1-2061 of SEQ ID NO: 5 (including a stop codon), base numbers 12-1828 of SEQ ID NO: 6 (stop) Having a sequence shown in (including codons).

  A novel nucleotide sequence as a full length of the cDNA thus obtained is obtained by using BLAST homology search (homology search) and HMMER (sequence analysis method using hidden Markov model; Eddy, SR, Bioinformatics 14, 755-763 (1998). The function of the protein encoded by the base sequence can be estimated by performing a protein feature search (profile search: http://pfam.wustl.edu) or the like using HMMPFAM, which is one of the functional groups of ()).

In the homology search by BLAST, the function of the clone to be analyzed can be estimated from various annotation information attached to hit sequences with sufficiently significant homology obtained as a result of the search. Here, a sufficiently significant hit sequence means that the identity between the catalytic domain portion of the registered sequence and the corresponding portion of the DNA used in the present invention is 30% or more, or an e-value of 10 ^{− 4} or less are shown.

For example, if many of the top hit catalytic domain sequences have been confirmed to function as kinases, the analyzed clones that are similar in sequence will also have the same function, ie, kinase activity. Prediction is valid.
HMMPFAM is an analysis based on a method for determining whether the amino acid sequence encoded by the base sequence to be analyzed has the characteristics of the amino acid sequence of an entry in a database in which protein profiles called Pfam are accumulated. Profiles are extracted from a series of proteins having the same characteristics, and even if the function cannot be clarified by comparison over the entire length of one sequence to one sequence, if the characteristic region is present in the sequence, this can be found and the function can be predicted. As described above, the cDNA predicted to have the kinase activity of the protein encoded by the protein can be confirmed by the biochemical experiment described below.

Specific examples of clones that are novel as full-length cDNAs described above include those having the base sequences shown in SEQ ID NOs: 1 to 6. Moreover, the amino acid sequences encoded by these base sequences include those shown in SEQ ID NOs: 7-12.
The DNA used in the present invention thus obtained, whose base sequence is determined, whose function is estimated, and whose function is confirmed as will be described later, is the base sequence described in SEQ ID NOs: 1 to 6, or its translation region. In addition to those having the base sequences shown above, in these base sequences, one or several (herein, several means, for example, 15 or less, preferably 9 or less, more preferably 6 or less) And a DNA encoding a protein having a nucleotide sequence deleted, substituted and / or added and having kinase activity and / or cell proliferation activity. As described above, these DNAs consist of amino acid sequences in which one or several amino acid sequences are deleted, substituted and / or added in the amino acid sequences of the proteins shown in SEQ ID NOs: 7 to 12, and kinase activity and / or Those encoding proteins with cell proliferating activity are included.

  Furthermore, the DNA used in the present invention may be obtained by the above method or may be synthesized. The substitution of the DNA base sequence can be easily performed with a commercially available kit such as a site-directed mutagenesis kit (Takara Bio) or a quick change site-directed mutagenesis kit (Stratagene).

(2) Protein encoded by the cDNA used in the present invention The translation region of the protein encoded by the DNA used in the present invention, for example, converts the base sequence of the DNA into an amino acid by three kinds of reading frames, The amino acid sequence can be deduced from the region encoding the longest polypeptide as the translation region of the DNA used in the present invention. Examples of such amino acid sequences include those described in SEQ ID NOs: 7 to 12. The protein used in the present invention is not limited to the above amino acid sequence, and is composed of an amino acid sequence in which one or several amino acids are substituted, deleted, and / or added in the amino acid sequence, and is a kinase. Those having activity and / or cell proliferation activity are also included.

  As a method for obtaining the protein used in the present invention, a method for transcription / translation of the DNA used in the present invention described in (1) by an appropriate method is preferably used. Specifically, an appropriate expression vector or a recombinant vector inserted into an appropriate vector with an appropriate promoter is prepared, and an appropriate host microorganism is transformed with this recombinant vector or introduced into an appropriate cultured cell. And can be obtained by purifying it.

Proteins used in the present invention also include proteins that are inserted into a vector or the like designed so that an appropriate tag is fused to the N-terminus or C-terminus thereof and added with a tag. Specific examples of the tag include glutathione-S-transferase, polyhistidine, and Flag.
The protein produced by the transformant can be modified by incorporating amino acids substituted or modified with heavy atoms during protein synthesis. In addition, the protein can be made into a modified protein by applying an appropriate protein-modifying enzyme before or after purification, by arbitrarily modifying the protein, or by partially removing the polypeptide. For example, terminal modification such as N-terminal acetylation, C-terminal amidation, glycosylation, lipid addition, acylation, methylation, sulfonation, carboxylation, hydroxylation, phosphorylation, ADP-ribosylation, etc. It is not necessarily limited to these. These modified proteins are also included in the scope of the protein used in the present invention as long as they have the above kinase activity and / or cell proliferation activity.

  In addition, the protein produced by the transformant may be modified as desired by applying an appropriate protein-modifying enzyme before or after purification, or by partially removing the polypeptide. Can do. These modified proteins are also included in the scope of the protein used in the present invention as long as they have the above kinase activity and / or cell proliferation activity.

  When the protein used in the present invention is produced, the vector used for the production of the recombinant vector containing the DNA used in the present invention is not particularly limited as long as the DNA is expressed in the transformant. Either a plasmid vector or a phage vector may be used. Of these, usually a commercially available protein expression vector into which an expression control region DNA such as a promoter suitable for a host into which the DNA is introduced has already been inserted is used. Specific examples of such a protein expression vector include pET3, pET11 (manufactured by Stratagene), pGEX (manufactured by Amersham Pharmacia Biotech) when the host is Escherichia coli, and pESP when yeast is used. -I expression vector (manufactured by Stratagene) and the like, and in the case of insect cells, BacPAK6 (manufactured by Clontech) etc. are used. When the host is an animal cell, ZAP Express (Stratagene) or pSVK3 (Amersham Pharmacia Biotech) can be used. When the host is a mammalian cell, pME18SFL3 (Genbank AB009864) is preferred.

  When using a vector into which an expression control region is not inserted, it is necessary to insert at least a promoter as an expression control region. Here, the promoter possessed by the host microorganism or the cultured cell can be used as the promoter, but is not limited to this. Specifically, for example, when the host is Escherichia coli, T3, T7, tac, lac A promoter or the like can be used, and in the case of yeast, nmt1 promoter, Gal1 promoter and the like can be used. In the case of insect cells, a polyhedrin promoter or the like can be used. When the host is an animal cell, SV40 promoter, CMV promoter, etc. are preferably used.

  When a host capable of functioning from a mammal-derived promoter is used, a promoter specific to the gene used in the present invention can also be used. The DNA used in the present invention may be inserted into these vectors by linking the DNA or a DNA fragment containing the DNA with the amino acid sequence of the protein encoded by the gene DNA downstream of the promoter in the vector.

  The recombinant vector thus prepared can be transformed into a host to be described later by a method known per se to prepare a DNA transductant. Specific examples of methods for introducing the vector into the host include the heat shock method (J. Mol. Biol., 53, 154, (1970)), the calcium phosphate method (Science, 221, 551 (1983)), DEAE. Dextran method (Science, 215, 166, (1982)), in vitro packaging method (Proc. Natl. Acad. Sci. USA, 72, 581, (1975)), viral vector method (Cell, 37, 1053, (1984) )), And electric pulse method (Chu. Et al., Nuc. Acids Res., 15, 1331 (1987)).

  The host for preparing the DNA transductant is not particularly limited as long as the DNA used in the present invention is expressed in the body. For example, Escherichia coli, yeast, baculovirus (arthropod polyhedrosis virus) -insect cells Or animal cells. Specifically, BL21, XL-2Blue (manufactured by Stratagene) etc. are used for Escherichia coli, SP-Q01 (manufactured by Stratagene), etc. for yeast, and AcNPV (J. Biol. Chem., 263, 7406, ( 1988)) and its host, Sf9 (ATCC CRL-1711; J. Biol. Chem., 263, 7406, (1988)). Examples of animal cells include mouse fibroblast cell line C127 (ATCC CRL-1804; J. Viol., 26, 291, (1978)) and Chinese hamster ovary cell line CHO-K1 (ATCC CCL-61; Proc. Natl. Acad. Sci. USA, 77, 4216, (1980)), etc., preferably from an African green monkey kidney-derived cell line COS-7 (ATCC CRL 1651: American type culture collection storage cell), Human embryonic kidney-derived cell line HEK293 (ATCC CRL 1573; hereinafter sometimes referred to as “HEK293 cells”) transformed with human adenovirus type 5 or human cervical cancer-derived cell line HeLa (ATCC CCL-2; Hereinafter, it may be referred to as “HeLa cell”).

  In addition to the expression method using a protein expression vector as described above, a homologous recombination technique (AA Vertes et al.) In which a DNA fragment used in the present invention linked to a promoter is directly inserted into the chromosome of a host microorganism. , Biosci. Biotechnol. Biochem., 57, 2036, (1993)), or transposon and insertion sequences (AA Vertes et al., Molecular Microbiol., 11, 739, (1994)), etc. The body can also be made.

The culture obtained above is obtained by collecting cells or cells by a method such as centrifugation, suspending the cells or cells in an appropriate buffer, and using a suitable known per se method such as ultrasound, lysozyme, and / or freeze-thawing. After disruption by the method, a crude protein purification solution can be obtained by centrifugation, filtration or the like, and further purified by combining appropriate purification methods.
Thus, the protein used in the present invention is obtained. In addition to the expression method using the protein expression recombinant vector described above, the DNA used in the present invention obtained in (1) above is subjected to a cell-free transcription / translation system to induce protein expression and used in the present invention. Protein can be obtained. The cell-free transcription / translation system used in the present invention is a system including all elements necessary for transcription from DNA to mRNA and translation from mRNA to protein, and the DNA is encoded by adding DNA thereto. It refers to any system in which the protein being synthesized is synthesized. Specific examples of the cell-free transcription / translation system include transcription / translation systems prepared on the basis of extracts from eukaryotic cells and bacterial cells, or a part thereof. Specific examples of the cell-free protein synthesis system include known cell extracts such as Escherichia coli, plant seed germs, and rabbit reticulocytes. These may be commercially available, and methods known per se, specifically, Escherichia coli extracts may be obtained from Pratt, JM et al., Transcription and Tranlation, Hames, 179-209, BD & Higgins, SJ, eds. ), IRL Press, Oxford (1984). Examples of commercially available cell-free protein synthesis systems or cell extracts include E. coli S30 extract system (Promega), RTS 500 Rapid Tranlation System (Roche), etc. Examples derived from erythrocytes include Rabbit Reticulocyte Lysate System (Promega), and those derived from wheat germ include PROTEIOS ^™ (TOYOBO).

  Separation and purification of the protein used in the present invention from the transcription-translation product of the obtained cell-free transcription / translation system can be performed by a commonly used method known per se. Specifically, a DNA region encoding an epitope peptide (eg, polyhistidine peptide, glutathione-S-transferase (GST), maltose binding protein, etc.) is introduced into the DNA to be transcribed and translated as described above. It can be expressed and purified using affinity with a substance having affinity for the protein.

  The target protein is expressed by SDS-polyacrylamide gel electrophoresis or the like and stained with Coomassie Brilliant Blue (manufactured by Sigma), or an antibody that specifically binds to the protein used in the present invention described later It can be confirmed by a method of detecting by the above. In general, it is known that the expressed protein is cleaved (processing) by a proteolytic enzyme present in the living body. The protein used in the present invention is, of course, a partial fragment of the cleaved amino acid sequence as long as it has kinase activity and / or cell proliferation activity, and is included in the protein used in the present invention.

(3) Confirmation of the activity of the protein used in the present invention The protein used in the present invention was prepared as a recombinant protein as described in (2) above, and was estimated in (1) by analyzing it. It can be confirmed that it has activity. Furthermore, it can also analyze by the combination with the antibody etc. as described in the following (4).

For the protein used in the present invention to have kinase activity, a conventional method known per se can be used. Specific examples of methods include a method of measuring the amount of ATP consumed and the amount of product consumed when a substrate is brought into contact with the recombinant protein and phosphorylated by the kinase activity of the recombinant protein. explain.
As a reaction solution, when measuring the activity of Ser / Thr protein kinase whose substrate phosphorylation site is serine / threonine, magnesium ion, for example, 5 to 100 mM magnesium chloride or magnesium acetate, and 1 to 1 as a reducing agent are used. Neutral to weakly basic buffer containing 100 mM 2-mercaptoethanol or 1-10 mM dithiothreitol, for example, 50 mM Tris-HCl or HEPES buffer (pH 7.0-8. 0), and when measuring the activity of Tyr protein kinase whose substrate phosphorylation site is tyrosine, tris-hydrochloric acid containing manganese chloride, zinc chloride, NaVO ₃ , dithiothreitol or HEPES buffer (pH 7). 0.0 to 8.0) can be used.

After adding ATP and a substrate suitable for each to this reaction solution, the purified protein used in the present invention is added, and after reacting at room temperature to 37 ° C. for about 24 hours, ATP consumed by the kinase reaction possessed by the protein The amount or product of the kinase reaction performed by the protein is measured.
Here, when the kinase activity of a protein that is expected to be a receptor kinase is measured, it is preferable that only the intracellular portion of the protein or the kinase active center portion is expressed as a recombinant protein and used in the above reaction.

Regarding the kinase reaction, in the case of a cyclic nucleotide-dependent protein kinase which is a Ser / Thr protein kinase, it is necessary to add a cyclic nucleotide corresponding to each kinase to the reaction solution. For example, cyclic AMP (cAMP) is added in the case of A-kinase, cyclic GMP (cGMP) is added in the case of G-kinase, and histone is used as a substrate.
In the case of phospholipid-dependent protein kinase, phospholipid is added to the reaction solution. For example, in the case of C-kinase, phosphatidylserine is added and histone is used as a substrate. In the case of calcium-dependent protein kinase, calmodulin is added to the reaction solution, and myosin light chain is used as a substrate. Here, myosin light chain kinase and calmodulin kinase are included. In the case of tyrosine-specific protein kinase, tubulin, histone, casein, myosin light chain, gastrin, angiotensin, tyrosine-glutamic acid (1: 4) polymer, etc. are used as substrates.

In the kinase activity measurement, hydrolysis of ATP to ADP occurs by the kinase prior to transfer of the phosphate group to the substrate. Here, the kinase activity can be defined by measuring the amount of ATP hydrolyzed. In this case, the amount of ATP in the reaction solution performed in the absence of the substrate is measured, and the amount of ATP consumed is defined as the kinase activity.
When measuring the amount of ATP consumed by the kinase reaction, luciferin and luciferase are added to the kinase reaction solution, and after reaction for a certain period of time, the fluorescence intensity is measured at the fluorescence wavelength peculiar to the added luciferin to obtain the fluorescence amount by the remaining ATP. The value obtained by subtracting the fluorescence intensity from the total ATP fluorescence intensity present in the reaction solution, measured in the absence of protein kinase and substrate, is defined as the amount of ATP consumed by the kinase activity, and the enzyme kinase activity.

When measuring the product of the kinase reaction, [γ- ³² P] ATP containing ³² P, which is a radioisotope, at the γ position of ATP is used as ATP added to the reaction solution. After completion of the kinase reaction, the reaction solution is separated by SDS-polyacrylamide gel electrophoresis, and the gel after electrophoresis is subjected to autoradiography using an X-ray film to detect a protein band incorporating ³² P. Further, 10% trichloroacetic acid or ethanol or acetone is added to the reaction solution so that the final concentration becomes 90% to precipitate the protein. Thereafter, the supernatant is removed by centrifugation or filter filtration, further washed several times with the same solution, dried, and ³² P transferred to the insolubilized fraction due to phosphorylation of the substrate protein is measured with a liquid scintillation counter. As a method that does not use a radioisotope, the reaction solution after completion of the kinase reaction can be separated by chromatography, and the activity can be measured by changing the elution position and the amount of change of the phosphorylated substrate. In this case, ion exchange chromatography or reverse phase chromatography can be used as the chromatography. It is also possible to measure activity by measuring a mass change due to phosphorylation of a substrate with a mass spectrometer. In this case, the measurement accuracy is further increased by using in combination with the aforementioned chromatographic separation.

  Such a kinase activity analysis system can also be used to evaluate agonists and antagonists of proteins having kinase activity used in the present invention. The confirmation of the activity of the protein used in the present invention is not limited to the method described above.

(4) Functional analysis of protein used in the present invention The protein used in the present invention which is encoded by the full-length cDNA thus obtained and has kinase activity is the kinase identified in (3) above. Analyzing functions other than activity, that is, cell proliferation activity, provides a novel usage method (a protein to be further analyzed for functions other than kinase activity is hereinafter referred to as “protein to be analyzed”). is there). In particular, since the protein used in the present invention includes a known protein variant, it is important to identify how this variant functions differently from the known variant.

  Specific functional analysis methods include, for example, (i) a method for comparative analysis of expression states at each tissue, disease, or developmental stage, (ii) a method for analyzing interactions with other proteins and DNA, ( iii) A method for introducing into an appropriate cell or individual and analyzing the phenotype change, and (iv) a method for analyzing the phenotype change by inhibiting the expression of the protein in an appropriate cell or individual.

In the method (i), the expression of the protein used in the present invention can be analyzed at the mRNA level or the protein level. If you want to analyze the expression level at the mRNA level, for example, in situ hybridization method (In situ hybridization:.. Application to Developmental Biology & Medicine, Ed by Harris, N. and Wilkinson, DG), Cambridge University Press (1990) ), A hybridization method using a DNA chip, a quantitative PCR method and the like are used. Here, when a known variant exists in the protein to be analyzed, it is preferable to use a probe that is present only in the cDNA encoding the protein to be analyzed and does not hybridize with the cDNA encoding the known variant. In the case of the quantitative PCR method, a method (Wong, YW, Neuroscience Lett., 320, 141-145 (2002)), etc., is performed by selecting primers capable of producing amplified fragments having different lengths between the target variant and the known variant. Can be mentioned. In the case of analysis at the protein level, a tissue staining method using an antibody that specifically binds to the protein used in the present invention described later can be used. In this case, it is preferable to use an antibody that reacts only with the target protein and does not react with a known variant.

  As a method for analyzing the interaction of (ii), a conventional method known per se can be used. Specifically, for example, a yeast two-hybrid method, a fluorescence depolarization method, a surface plasmon method, a phage display method, Examples include the ribosomal display method. Also in this method, when a known variant exists in the protein to be analyzed, it is preferable to analyze a substance that interacts with the known variant in the same manner and identify a substance that interacts specifically with the target protein.

  In the method (iii), the cells into which the cDNA used in the present invention is introduced are not particularly limited, but human cultured cells and the like are particularly preferably used. Examples of the method for introducing DNA into cells include those described in (2) above. In addition, the phenotype of the introduced cell can be observed with a microscope, such as cell viability, cell growth rate, cell differentiation, neurite elongation when cells are nerve cells, and localization and migration of intracellular proteins. And those that can be analyzed by biochemical experiments such as changes in expression of specific proteins in cells. When these known phenotypes are present, known phenotypes can be introduced into cells in the same manner, and phenotypes related to the analysis target variants can be identified by comparative analysis. Moreover, since it is known that the protein used in the present invention has a kinase activity, it is also preferable to analyze by paying attention to a phenotype or the like found in a disease associated with a kinase.

  The method (iv) can be efficiently performed by a method using an oligonucleotide described later or an RNA interference method. Also in this method, when a known variant exists in the target protein to be analyzed, the same analysis is performed for the known variant and other variants, and the function specific to the target protein is identified by comparative analysis. be able to.

  Thus, the protein used in the present invention whose function has been analyzed has cell proliferation activity in addition to kinase activity, and therefore can be used as a cell proliferation promoter. The protein used in the present invention has been cloned from a cDNA library constructed from brain tissue (for example, fetal brain, normal brain, etc.), and the obtained protein used in the present invention is the tissue or organ described above. Therefore, it can be used as a therapeutic agent for diseases peculiar to the tissues and organs. Such a protein can be used alone for the clinical application, but can also be used as a pharmaceutical composition by blending with a pharmaceutically acceptable carrier. The ratio of the active ingredient to the carrier at this time can vary between 1 and 90% by weight. In addition, such drugs can be administered in various forms, such as tablets, capsules, granules, powders, syrups or the like, or injections, drops, liposomes, Parenteral administration with a suppository or the like can be mentioned. Further, the dose can be appropriately selected depending on symptoms, age, body weight and the like.

(5) Preparation of oligonucleotide A part of the DNA used in the present invention by a conventional method using a DNA synthesizer or the like using the DNA used in the present invention or a fragment thereof obtained by the method described in (1) above. Oligonucleotides such as antisense oligonucleotides and sense oligonucleotides having the following sequence can be prepared.

  Examples of the oligonucleotide include DNA having the same sequence as 5 to 100 consecutive bases in the base sequence of the DNA or DNA having a sequence complementary to the DNA. Specific examples include DNA having the same sequence as 5 to 100 consecutive bases in the base sequences represented by SEQ ID NOs: 1 to 6 or DNA having a sequence complementary to the DNA. Here, when a known variant DNA exists in the target protein, it is preferable to select a base sequence of a portion different from the known variant. When used as a sense primer and an antisense primer, the above oligonucleotides in which the melting temperature (Tm) and the number of bases of both do not change extremely are preferable. The length of the sequence is generally 5 to 100 bases, preferably 10 to 60 bases, and more preferably 15 to 50 bases.

  In addition, derivatives of these oligonucleotides can also be used as oligonucleotides used in the present invention. The oligonucleotide derivative includes an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and an oligonucleotide in which a phosphodiester bond in an oligonucleotide is converted to an N3′-P5 ′ phosphoramidate bond. Nucleotide derivatives, oligonucleotide derivatives in which ribose and phosphodiester bonds in oligonucleotides are converted to peptide nucleic acid bonds, oligonucleotide derivatives in which uracil in oligonucleotides is substituted with C-5 propynyl uracil, uracil in oligonucleotides Oligonucleotide derivative substituted with C-5 thiazole uracil, oligonucleotide derivative substituted with C-5 propynylcytosine in cytosine in oligonucleotide, in oligonucleotide Oligonucleotide derivatives in which cytosine is substituted with phenoxazine-modified cytosine, oligonucleotide derivatives in which ribose in the oligonucleotide is substituted with 2′-O-propylribose, or ribose in the oligonucleotide is 2 ′ Examples thereof include oligonucleotide derivatives substituted with -methoxyethoxy ribose.

  In addition, the oligonucleotide used in the present invention can be applied to the RNA interference method (RNAi method) by preparing it as a double-stranded RNA (dsRNA). Among these, those having a short chain length, particularly those having about 21 bases, are sometimes referred to as “siRNA” (small interfering RNAs). For example, the method described in Elbashir, S., et al., Nature, 411, 494-498 (2001) can be used for the method for producing double-stranded RNA and the RNA interference method. The double-stranded RNAs need not all be RNA. Specifically, those described in WO 02/10374 can be used as a part of which is DNA.

  The target gene in this RNA interference method (hereinafter sometimes referred to as “target gene”) may be any DNA as long as it is DNA used in the present invention. In addition, a gene predicted to be an ortholog of the gene DNA can also be used as a target gene. A double-stranded oligonucleotide composed of RNA having a sequence substantially the same as at least a part of the base sequence of these DNAs (hereinafter sometimes referred to as “double-stranded oligonucleotide”) refers to a target gene Among these nucleotide sequences, the nucleotide sequence is substantially the same as a sequence of 15 bp or more which may be any part. Here, “substantially identical” means having a homology of 80% or more with the sequence of the target gene.

  Further, when the protein to be analyzed is an insertion type or substitution type variant as compared with a known protein, the double-stranded oligonucleotide sequence can be set at the insertion or substitution site. In addition, when the protein to be analyzed is a deletion variant of a known protein, it is possible to select a sequence that is specifically effective for the protein by setting the sequence across the deletion to a double-stranded oligonucleotide sequence. it can. Furthermore, by comparing the base sequence of the DNA encoding each of the protein to be analyzed and the known protein, by selecting a base sequence specific to the DNA encoding the protein to be analyzed, Expression can be inhibited.

  The nucleotide chain length may be any length from 15 bp to the entire length of the open reading frame (ORF) of the target gene, but preferably about 15 to 500 bp. However, in cells derived from mammals, the existence of a signal transduction system that is activated in response to a long double-stranded RNA of 30 bp or more is known. This is called an interferon reaction (Mareus, PI, et al., Interferon, 5, 115-180 (1983)), and when the double-stranded RNA enters the cell, PKR (dsRNA-responses) protein kinase: Bass, B.L., Nature, 411, 428-429 (2001)), the initiation of translation of many genes is non-specifically inhibited, and at the same time, 2'-5'-oligoadenylate synthetase (Bass , B.L., Nature, 411, 428-429 (2001)), activation of RNaseL occurs, and nonspecific degradation of intracellular RNA is induced. These non-specific reactions mask the specific reaction of the target gene. Therefore, when using a mammal or a cell or tissue derived from the animal as a recipient, it is preferable to use a double-stranded oligonucleotide of 15 to 30 bp, preferably 19 to 24 bp, more preferably 21 bp. The double-stranded oligonucleotide does not need to be double-stranded as a whole, and includes those in which the 5 ′ or 3 ′ end partially protrudes, but it is preferable to use the one in which the 3 ′ end protrudes 2 bases. The double-stranded oligonucleotide means a double-stranded oligonucleotide having complementarity, but may be a self-annealed single-stranded oligonucleotide having self-complementarity. Examples of the single-stranded oligonucleotide having self-complementarity include those having an inverted repeat sequence.

  Although there is no restriction | limiting in particular as a preparation method of a double stranded oligonucleotide, It is preferable to use the chemical synthesis method known per se. In chemical synthesis, single-stranded oligonucleotides having complementarity can be synthesized separately and associated with each other by an appropriate method to be double-stranded. Examples of the association method include a method in which the oligonucleotides are mixed, heated to a temperature at which the double strands dissociate, and then gradually cooled. The associated double-stranded oligonucleotide is confirmed using an agarose gel or the like, and the remaining single-stranded oligonucleotide is removed by decomposing it with an appropriate enzyme.

  The recipient to which the double-stranded oligonucleotide thus prepared is introduced may be any one as long as the target gene can be transcribed into RNA or translated into protein in the cell. Specific examples include those belonging to plants and animals. The plant may be monocotyledonous, dicotyledonous or gymnosperm, and the animal may be a vertebrate or invertebrate. Examples of vertebrates include mammals including fish, cattle, goats, pigs, sheep, hamsters, mice, rats, and humans, and invertebrates include nematodes, Drosophila, and others Of insects. Preferably, the cell is a vertebrate cell.

  An introducer means a cell, tissue or individual. Here, the cells may be germline or somatic, totipotent or multipotent, divided or undivided, parenchyma or epithelium, immortalized or transformed, and the like. The cell may be a gamete or embryo, and in the case of an embryo, it is a single-cell embryo or constitutive cell, or a cell from a multi-cell embryo and includes fetal tissue. Furthermore, it may be an undifferentiated cell such as a stem cell, or a differentiated cell such as from a cell of an organ or tissue including fetal tissue, or any other cell present in an organism. Differentiated cell types include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelial cells, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, Basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes and cells of endocrine or exocrine glands are included. In the analysis of functions related to cell growth, any cell can be used as long as it can be grown in a medium. However, human-derived cells are preferable, specifically HEK293 cells, HeLa cells, nerves. Examples include blastoma-derived cell line SK-N-SH, promyelocytic leukemia-derived cell line HL60, and the like.

  As a method for introducing a double-stranded oligonucleotide into a recipient, when the recipient is a cell or tissue, a calcium phosphate method, an electroporation method, a lipofection method, a virus infection, a double-stranded oligonucleotide solution Soaking or transformation method is used. Examples of the method for introduction into the embryo include microinjection, electroporation, and virus infection. When the recipient is a plant, a method by injection or perfusion into the body cavity or stromal cells of the plant or spraying is used. In the case of an animal individual, it is introduced systemically by oral, topical, parenteral (including subcutaneous, intramuscular and intravenous administration), vaginal, rectal, nasal, ophthalmic, intraperitoneal administration, etc. The method, electroporation method, virus infection or the like is used. For methods for oral introduction, double-stranded oligonucleotides can be mixed directly with the food of the organism. Furthermore, when introduced into an individual, it can be administered, for example, as an implanted long-term release preparation or by ingesting an introduced body into which a double-stranded oligonucleotide has been introduced.

The amount of the double-stranded oligonucleotide to be introduced can be appropriately selected depending on the introduced body and the target gene, but it is preferable to introduce an amount sufficient to introduce at least one copy per cell. Specifically, for example, when the introducer is a human cultured cell and a double-stranded oligonucleotide is introduced by the calcium phosphate method, 0.1 to 1000 nM is preferable.
By suppressing the expression of the gene used in the present invention in the introduced body by RNA interference, the function of the protein encoded by the gene used in the present invention can be confirmed, or a new function can be analyzed.

  When the oligonucleotide used in the present invention is applied clinically, for example, it can be applied to gene therapy. Since the protein used in the present invention has kinase activity and / or cell proliferation activity, for example, cancer is considered to be suitable as a target disease for gene therapy. When the oligonucleotide is used for gene therapy, for example, an ex vivo method or an in vivo method using a viral vector such as a retroviral vector, an adenoviral vector, or an adeno-associated viral vector, or a non-viral vector such as a liposome. It may be administered to a patient by such as, and can be used as a cell growth inhibitor.

(6) Antibody that specifically binds to the protein used in the present invention As a method for preparing an antibody that specifically binds to the protein used in the present invention, a commonly used known method can be used, which is used as an antigen. As for the polypeptide to be obtained, a sequence having high antigenicity and suitable as an epitope (antigenic determinant) can be selected and used according to a known method. As an epitope selection method, for example, commercially available software such as Epitope Advisor (manufactured by Fujitsu Kyushu System Engineering Co., Ltd.) can be used. In addition, when a known variant exists in the target protein, a function specific to the target protein is identified by using an antibody that reacts only with the target protein and does not react with a known or other variant. can do. As an epitope of such an antibody, for example, when there is an amino acid sequence in which the target protein is deleted compared to a known variant, an amino acid sequence (junction part) before and after the deleted part is preferable. In addition, when the target protein has an amino acid sequence to which a known variant N-terminal or C-terminal is added, it is also preferable to use the added amino acid sequence as an epitope. As a method other than the above, an antibody that reacts only with the target protein can be obtained by removing an antibody that reacts with a known or other variant from the polyclonal antibody obtained against the target protein. As a method for removal, affinity chromatography in which a known or other variant is immobilized as a ligand, or an immunoprecipitation method using a known or other variant is used.

  The polypeptide used as the antigen may be a synthetic peptide synthesized according to a known method, or the protein itself used in the present invention. Polypeptides that serve as antigens can be prepared in an appropriate solution according to known methods and immunized to mammals such as rabbits, mice, rats, etc. In order to perform stable immunization or increase antibody titers It is preferable to immunize by using an antigen peptide as a conjugate with an appropriate carrier protein or adding an adjuvant or the like.

  There are no particular limitations on the route of administration of the antigen during immunization, and any route such as subcutaneous, intraperitoneal, intravenous, or intramuscular may be used. Specifically, for example, a method of inoculating BALB / c mice several times every several days to several weeks is used. The antigen intake is preferably about 0.3 to 0.5 mg / dose when the antigen is a polypeptide, but is appropriately adjusted depending on the type of polypeptide and the animal species to be immunized.

  After immunization, blood is collected on a trial basis as appropriate, and an increase in antibody titer is confirmed by a method such as octaloney method, solid phase enzyme immunoassay (hereinafter sometimes referred to as “ELISA method”) or Western blotting. Blood is collected from an animal with a sufficiently increased antibody titer. A polyclonal antibody can be obtained by performing an appropriate treatment used for preparing the antibody. Specific examples include a method of obtaining a purified antibody obtained by purifying antibody components from serum according to a known method. For purification of antibody components, methods such as salting out, ion exchange chromatography, affinity chromatography and the like can be used.

A monoclonal antibody can also be prepared by using a hybridoma fused with spleen cells and myeloma cells of the animal according to a known method (Milstein, et al., Nature, 256, 495 (1975)). . A monoclonal antibody can be obtained, for example, by the following method.
First, antibody-producing cells are obtained from an animal having an increased antibody titer by immunization with the antigen described above. Antibody-producing cells are plasma cells and lymphocytes that are precursor cells thereof, and these may be obtained from any individual, but are preferably obtained from spleen, lymph nodes, peripheral blood, and the like. The myeloma to be fused with these cells is generally a cell line obtained from a mouse, for example, an 8-azaguanine resistant mouse (BALB / c-derived etc.) myeloma cell line P3X63-Ag8.653 (ATCC: CRL). -1580), P3-NS1 / 1Ag4.1 (RIKEN Cell Bank: RCB0095) and the like are preferably used. For cell fusion, antibody-producing cells and myeloma cells are mixed at an appropriate ratio, and 50% polyethylene is added to an appropriate cell fusion medium such as RPMI 1640, Iskov modified Dulbecco medium (IMDM), Dulbecco modified Eagle medium (DMEM), or the like. It can be performed by using a solution in which glycol (PEG) is dissolved. It can also be carried out by electrofusion (U. Zimmermann. Et al., Naturewissenschafften, 68, 577 (1981)).

The hybridoma is 5% CO _{2 in} a normal medium (HAT medium) containing an appropriate amount of hypoxanthine / aminopterin / thymidine (HAT) solution using the fact that the myeloma cell line used is an 8-azaguanine resistant strain. It can be selected by culturing at an appropriate time at ° C. This selection method can be appropriately selected depending on the myeloma cell line used. The antibody titer of the antibody produced by the selected hybridoma is analyzed by the method described above, the hybridoma producing the antibody having a high antibody titer is separated by a limiting dilution method, etc., and the isolated fused cells are cultured in an appropriate medium. A monoclonal antibody can be obtained by purifying the resulting culture supernatant by an appropriate method such as ammonium sulfate fractionation or affinity chromatography. For purification, a commercially available monoclonal antibody purification kit can also be used. Furthermore, ascites containing a large amount of the monoclonal antibody used in the present invention can be obtained by growing the antibody-producing hybridoma obtained above in the abdominal cavity of an animal of the same strain as the immunized animal or a nude mouse. it can.

  In addition, when a protein derived from human is obtained as a protein used in the present invention, the above-mentioned polypeptide or a partial peptide thereof is used as an antigen to a Combined Immunity Definition (SCID) mouse transplanted with human peripheral blood lymphocytes. Human-type antibodies can also be prepared by immunizing in the same manner as described above and preparing hybridomas of antibody-producing cells of the immunized animal and human myeloma cells (Mosier, DE, et al. Nature, 335, 256-259 (1988); Duchosal, MA, et al., Nature, 355, 258-262 (1992)).

  In addition, RNA is extracted from the obtained hybridoma producing the human antibody, the gene encoding the desired human antibody is cloned, this gene is inserted into an appropriate vector, and this is introduced into an appropriate host. By expressing it, it is possible to produce a human antibody in a larger amount. Here, an antibody having a low binding property to an antigen can also be obtained as an antibody having a higher binding property by using a known evolutionary engineering technique. A partial fragment such as a transient antibody can be prepared by cleaving the Fab portion and the Fc portion using, for example, papain, and collecting the Fab portion using an affinity column or the like.

  The antibody specifically binding to the protein used in the present invention thus obtained is neutralized by specifically binding to the protein used in the present invention to inhibit the kinase activity and / or cell proliferation activity of the protein. It can also be used as an antibody. There are no particular restrictions on the method for selecting the protein that inhibits the activity of the protein. For example, the antibody is brought into contact with or introduced into the DNA introduced product prepared in (2) above, and the function of the target protein in the introduced product is inhibited. And a method of analyzing whether or not.

  Such a neutralizing antibody can be used alone in the clinical application, but can also be used as a pharmaceutical composition by blending with a pharmaceutically acceptable carrier. The ratio of the active ingredient to the carrier at this time can vary between 1 and 90% by weight. In addition, such drugs can be administered in various forms, such as tablets, capsules, granules, powders, syrups or the like, or injections, drops, liposomes, Parenteral administration with a suppository or the like can be mentioned. Further, the dose can be appropriately selected depending on symptoms, age, body weight and the like.

(7) Screening of a molecule that regulates the activity of a protein used in the present invention and a screening kit Specifically binding to the protein used in the present invention and inhibiting the function (activity) of the protein used in the present invention, By screening a substance having an antagonistic or potentiating action, a protein function-regulating substance used in the present invention (hereinafter sometimes referred to as “regulating substance”) can be obtained.

  Any method may be used for this modulator screening method as long as it is capable of obtaining a substance that specifically binds to the protein used in the present invention and has an action of inhibiting, antagonizing or enhancing the activity of the protein. Good. For example, firstly, the protein used in the present invention is contacted with a substance to be screened (hereinafter sometimes referred to as “test substance”), and the binding with the protein is selected as an index. A method of selecting a test substance using the change in activity of the protein used in the invention as an index can be used.

  The test substance may be any substance that can interact with the protein used in the present invention and affect the activity of the protein. Specifically, for example, , Peptides, proteins, non-peptidic compounds, low molecular compounds, synthetic compounds, fermentation products, cell extracts, animal tissue extracts and the like. These substances may be novel substances or known substances. As a method for analyzing the interaction between the test substance and the protein used in the present invention, a conventional method known per se can be used. Specifically, for example, yeast two-hybrid method, fluorescence depolarization method, surface Examples thereof include a plasmon method, a phage display method, a ribosomal display method, and a competitive analysis method with the antibody described in (6) above. By such a method, a substance that has been found to have an activity that binds to the protein used in the present invention is then analyzed how the activity of the protein used in the present invention is affected in the presence of the substance. By doing so, it is identified whether it is used as a regulator. Here, when a known variant exists in the target protein, the effect is analyzed on a substance that binds only to the target protein and does not bind to the known or other variants, or a known or other variant. Similarly, in the case of binding, the effect of the substance on the target protein can be analyzed by analyzing whether or not the binding is performed and analyzing the difference in the influence of the binding. Further, by examining the distribution of the substance in an individual, the influence on the target protein and known or other variants can be analyzed.

  As a specific analysis method, for example, when analyzing a substance that regulates kinase activity, a protein serving as a substrate is also introduced into the DNA transductant described in (2) by the same method. The phosphorylation of the protein serving as a substrate in the presence / absence of the substance selected for this transductant is analyzed by a commonly used method known per se. Specifically, it can be performed using the method described in (3) above. If the phosphorylation of the protein as a substrate is increased compared to that in the absence of the substance, the substance may function as a kinase active substance, and if it is reduced or inhibited, the substance Can be identified as potentially acting as kinase inhibitors. When analyzing a substance that regulates cell proliferation activity, cells into which the DNA described in (2) has been introduced, specifically, HeLa cells, HEK293 cells, SK-N-SH cells, HL60 cells, various normal types. Cells and the like are cultured in the presence / absence of a selected substance, and analyzed by a commonly used method known per se, such as measurement of the number of viable cells or quantification of intracellular ATP content correlated with the number of viable cells. When cell growth is promoted compared to that in the absence of the substance, the substance may function as a cell growth promoter, and when suppressed or inhibited, the substance It can be identified that it may function as an inhibitor. In addition, for screening for a substance that regulates the activity of the protein used in the present invention, for example, either kinase activity or cell proliferation activity may be used as an indicator, or these two indicators may be combined.

  Here, in the case of using the DNA used in the present invention or recombinant protein used for screening a regulatory substance for the purpose of obtaining a pharmaceutically active ingredient, it is preferable to use human DNA or protein. Furthermore, the substance screened by the above method may be further selected as a pharmaceutical candidate by in vivo screening. The evaluation of the protein function regulator used in the present invention is not limited to the method described above.

  Examples of the kinase activity of the protein used in the present invention include a signal transduction function on a pathway associated with cancer, a signal transduction function on a pathway associated with myocardial development, and a signal transduction on a pathway that controls sperm motility. Functions, signaling functions on pathways that control germ cell differentiation, signaling functions on pathways that control cell differentiation, signaling functions on pathways that control sperm differentiation, signals on pathways that control the onset of Alzheimer's disease Signaling function on pathways that control transmission function, function to generate glycerol triphosphate, development of brain cortex, migration of nerve cells, etc., function related to fatty acid and sterol synthesis, signal transmission function on pathways related to cell death Insulin signaling and the like. Therefore, modulators that can be identified by this screening method are anticancer agents, heart disease treatment agents, fertility treatment agents, regenerative tissue inducers, Alzheimer's disease treatment agents, neurodegenerative disease treatment agents, diabetes treatment agents, immune / inflammatory disease treatment agents. Can be used. In addition, since the protein used in the present invention has cell proliferation activity in addition to kinase activity, the regulatory substance that can be identified by a screening method using the protein or a gene encoding the protein is a cell growth promoter or cell It can be used as a growth inhibitor.

  Furthermore, the protein used in the present invention has been cloned from a cDNA library constructed from brain tissue (for example, fetal brain, normal brain, etc.), etc., and may have a unique function in the above tissues and organs. Therefore, a modulator that can be identified by a screening method using the protein or a gene encoding the protein can be used as a therapeutic agent for diseases peculiar to the tissue and organ.

In the clinical application, the above-mentioned active ingredient can be used alone for clinical application, but it can also be used as a pharmaceutical composition by blending with a pharmaceutically acceptable carrier. The ratio of the active ingredient to the carrier at this time can vary between 1 and 90% by weight. In addition, such drugs can be administered in various forms, such as tablets, capsules, granules, powders, syrups or the like, or injections, drops, liposomes, Parenteral administration with a suppository or the like can be mentioned. Further, the dose can be appropriately selected depending on symptoms, age, body weight and the like.
In addition, such a regulatory substance screening kit may be any one containing the protein or the like used in the present invention.

(8) Screening of DNA expression regulator used in the present invention and screening kit As a screening method, the expression level of the protein used in the present invention or the mRNA encoding it in the presence of the test substance is analyzed. And the like. Specifically, for example, the protein used in the present invention expressed in the cells obtained by culturing cells expressing the protein used in the present invention described in (2) in an appropriate medium containing a test substance. The amount is analyzed by a conventional method such as ELISA, or the amount of mRNA encoding the protein used in the present invention in the cells is analyzed by a quantitative reverse transcription PCR method, a Northern blot method or the like. be able to.

  As the test substance, those described in (7) can be used. If this analysis shows that the amount of protein or mRNA expressed in the cells cultured in the absence of the test substance is increased compared to the amount of the test substance, the test substance can express the DNA used in the present invention. If the substance is likely to function as an accelerating substance and decreases, it can be determined that this test substance can be used as an expression inhibitor of DNA used in the present invention.

Such an expression regulating substance can be used alone in the clinical application, but can also be used as a pharmaceutical composition by blending with a pharmaceutically acceptable carrier. The ratio of the active ingredient to the carrier at this time can vary between 1 and 90% by weight. In addition, such drugs can be administered in various forms, such as tablets, capsules, granules, powders, syrups or the like, or injections, drops, liposomes, Parenteral administration with a suppository or the like can be mentioned. Further, the dose can be appropriately selected depending on symptoms, age, body weight and the like.
Such a kit for screening an expression regulator may be any one containing the DNA used in the present invention, a recombinant vector containing the DNA, or a gene-transferred cell into which the recombinant vector has been introduced.

(9) DNA-transfected animal used in the present invention An introduced DNA containing the DNA used in the present invention described in (1) above is constructed and introduced into a fertilized egg of a mammal other than a human, and this is introduced into a female A non-human mammal introduced with the DNA used in the present invention can be produced by transplanting it into an individual oviduct. More specifically, for example, a female individual is over-ovulated by hormone administration, then mated with a male, a fertilized egg is extracted from the oviduct on the first day after mating, and the introduced DNA is microinjected into the fertilized egg, etc. It introduces by the method of. Then, after culturing by an appropriate method, surviving fertilized eggs are transplanted into the oviduct of a female individual (temporary parent) that has been pseudo-pregnant to give birth. Whether or not the target DNA has been introduced into the newborn can be identified by performing Southern blot analysis of DNA extracted from the cells of the individual. Examples of mammals other than humans include mice, rats, guinea pigs, hamsters, rabbits, goats, pigs, dogs, cats and the like.

The thus-introduced DNA-transfected animal used in the present invention is bred by breeding in an ordinary breeding environment while crossing this individual and confirming that the introduced DNA is stably retained. You can get offspring. Moreover, the offspring can be obtained by repeating in vitro fertilization and a line can be maintained.
The non-human mammal into which the DNA used in the present invention has been introduced can be used as an analysis of the function of the DNA used in the present invention in vivo, or as a screening system for substances that regulate it.

(10) Other uses of the protein used in the present invention and DNA containing the base sequence encoding the protein The protein used in the present invention can be used as a carrier bound on a substrate. Moreover, the base sequence encoding the protein used in the present invention, for example, the DNA having the base sequence set forth in SEQ ID NOs: 1 to 6 and partial fragments thereof can be used as a carrier on which they are bound on a substrate. Hereinafter, these may be referred to as “protein chip”, “DNA chip” or “DNA array” (DNA microarray and DNA macroarray). These protein chips, or DNA chips or arrays may contain other proteins and DNAs in addition to the proteins and DNAs used in the present invention. Here, when a known variant exists in the target protein, an amino acid sequence partial fragment specific to the target protein can be used for the protein chip, but it may have a three-dimensional structure different from other variants. Therefore, the full length can also be used. For the DNA array, it is preferable to select a sequence different from other variant DNAs among the DNA sequences encoding the target protein.

  In addition, as a substrate for binding proteins and DNA, a resin substrate such as a nylon membrane or a polypropylene membrane, a nitrocellulose membrane, a glass plate, a silicon plate, or the like is used. When performing using a substance etc., the glass plate, silicon plate, etc. which do not contain a fluorescent substance are used suitably. The protein or DNA can be easily bound to the substrate by a commonly used method known per se. These protein chips, DNA chips, or DNA arrays are also included in the scope of the substrate used in the present invention.

  Moreover, the amino acid sequence of the protein used in the present invention and the base sequence of DNA can also be used as sequence information. The base sequence of this DNA includes the base sequence of the corresponding RNA. That is, an amino acid sequence or base sequence database can be constructed by storing the obtained amino acid sequence or base sequence in an appropriate recording medium in a predetermined format readable by a computer. This database may include base sequences of other types of proteins and DNAs encoding the same. In the present invention, the database also means a computer system in which the above array is written on an appropriate recording medium and a search is performed according to a predetermined program. Examples of suitable recording media include magnetic media such as flexible disks, hard disks, and magnetic tapes, optical disks such as CD-ROM, MO, CD-R, CD-RW, DVD-R, and DVD-RAM, and semiconductor memory. Etc.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated in detail, the scope of the present invention is not limited by these Examples.

Preparation of cDNA Library by Oligocap Method From human fetal brain (Brain, Fetal) tissue, mRNA was prepared by the method described in the literature (J. Sambrook, et al., Molecular Cloning Second Edition, Cold Spring Harbor Laboratory Press (1989)). Extracted. Furthermore, poly (A) + RNA was purified using oligo dT cellulose.

A cDNA library was prepared from the poly (A) + RNA obtained above by the oligo cap method (Maruyama, K., et al., Gene, 138, 171-174 (1994)).
First, the RNA was treated with BAP (Bacterial Alkaline Phosphatase) and TAP (Tobacco Acid Pyrophosphatase), and then an oligocap linker (SEQ ID NO: 13) was ligated using RNA ligase. First strand cDNA was synthesized by reverse transcription reaction using oligo dT primer (SEQ ID NO: 14) using this RNA strand as a template, and then RNA strand was decomposed and removed (Suzuki et al., Protein Nucleic Acid Enzyme, 41, 603-607 ( 1996); Suzuki, Y. et al., Gene, 200, 149-156 (1997)). Next, double-stranded cDNA was amplified by PCR (polymerase chain reaction) using the 5 ′ PCR primer (SEQ ID NO: 15) and the 3 ′ PCR primer (SEQ ID NO: 16), and the amplified DNA strand was cleaved with SfiI. .

Subsequently, the Sfi I digested fragment obtained above was cloned into the Dra III site of pME18SFL3 (GenBank AB009864), which is an expression vector, to prepare a cDNA library. In the pME18SFL3 vector used above, the SRα promoter and the SV40 small t intron are incorporated upstream of the cloning site, and the SV40 poly A addition signal sequence is inserted downstream thereof. The cloning site of pME18SFL3 is an asymmetric Dra III site, and a complementary Sfi I site is added to the end of the cDNA fragment, so that the cloned cDNA fragment is located downstream of the SRα promoter. Inserted in direction. Therefore, in a clone containing a full-length cDNA, it is possible to express a gene transiently by directly introducing the obtained plasmid into a COS cell. That is, it can be analyzed very easily as a protein that is a gene product or as an experimental analysis of their biological activity.

  For the plasmid DNA of the clones obtained from these, the nucleotide sequence at the 5 ′ end or 3 ′ end of the cDNA was converted to a DNA sequencing reagent (Dye Terminator Cycle Ready Cycle Reactor Cycle Sequencing Cycle Sequencing Cycle Sequencing Cycle Sequencing Cycle Sequencing Cycle Sequencing Cycle Sequencing Using a FS Ready Reaction Kit (manufactured by PE Biosystems), the DNA base sequence was analyzed with a DNA sequencer (ABI PRISM 3700: manufactured by PE Biosystems) after sequencing reaction according to the manual.

Evaluation of full length of 5 ′ end of clone from cDNA library prepared by oligocap method The base sequence of 5 ′ end of human cDNA library prepared in Example 1 is the same as that of human known mRNA in public database. For all clones that match the 5 ′ end sequence compared to the sequence, the 5 ′ end extends longer than the known mRNA sequence in the public database, or the 5 ′ end is short but has a translation initiation codon Was judged as “full length”, and the case where the translation initiation codon was not included was judged as “non-full length”.

  Next, clones were evaluated using ESTiMateFL. ESTiMateFL is a method developed by Nishikawa and Ota et al. Of Helix Laboratories in order to select clones with high possibility of full-length cDNA by comparing with EST 5 'and 3' end sequences in public databases. is there. The 5 ′ end or 3 ′ end sequence of the cDNA clone analyzed in Example 1 is compared with the base sequence registered in the EST database, and extends to the 5 ′ side or 3 ′ side of the obtained cDNA clone sequence. When the EST was present, it was judged that the clone was “possibly not full length”. When the 5 'end is extended from the EST sequence in the public database, or even if the 5' end is short, the difference is within 50 bases for the sake of convenience, and when it is shorter than that, the non-full length is assumed. .

Analysis of base sequence and amino acid sequence of cDNA clone The entire base sequence of the cDNA clone analyzed in Example 2 was analyzed using BLAST (Basic local alignment search tool; Altschul, SF, et al., J. Mol. Biol., 215, 403-410 (1990)) and HMMER (sequence analysis method using hidden Markov model; Eddy, SR, Bioinformatics 14, 755-763 (1998)). Protein feature search (profile search: http://pfam.ustl.edu) using one HMMPFAM to estimate the function of the protein encoded by each cDNA clone It was. In addition, with regard to a clone presumed to be a splicing variant in which there is a known clone in which a part of the base sequence is completely identical, any exon deleted and spliced if the genome sequence can be analyzed It was analyzed.

Sequence analysis of cDNA clone FCBBF2003102 (SEQ ID NOs: 1 and 7) FCBBF2003102, which is a cDNA clone presumed to have kinase activity in Example 3 (hereinafter referred to as “the present DNA”, and a protein encoded by the DNA (Referred to as “the present protein”) consists of 2157 bases as shown in SEQ ID NO: 1, of which base numbers 27 to 1757 are open reading frames (including a stop codon). The amino acid sequence predicted from the open reading frame consists of 576 amino acid residues (SEQ ID NO: 7).

A homology search for the amino acid sequence shown in SEQ ID NO: 7 using BLAST (Basic local alignment search tool; Altschul, SF, et al., J. Mol. Biol., 215, 403-410 (1990)) (1) The registered symbol AAO15419 (SEQ ID NO: 8; Novel human kinase protein 2, GenBank registered symbol AX425865) in the amino acid sequence database (ageneseq) of the patent sequence database (GeneSeq) was hit. As its contents, AAO15419 is composed of 817 amino acids, and amino acid numbers 242 to 817 in the amino acid sequence are amino acid numbers 1 to 576 of the amino acid sequence described in SEQ ID NO: 7, e-value: 0.0, and 576 amino acids. Over 99%. (2) The registered symbol AAE24133 (SEQ ID NO: 9; Human kinase (PKIN) -4 protein, GenBank registered symbol AX504237) in the amino acid sequence database (aageneseq) of the patent sequence database (GeneSeq) was hit. As its contents, AAE24133 is composed of 835 amino acids, and amino acid numbers 260 to 835 in the amino acid sequence are amino acid numbers 1 to 576 of the amino acid sequence described in SEQ ID NO: 7, e-value: 0.0, and 576 amino acids. The degree of coincidence was 100%. (3) The registered symbol ABB82471 (SEQ ID NO: 10; Human serine / threonine protein kinase, GenBank registered symbol AX5343476) in the amino acid sequence database (aageneseq) of the patent sequence database (GeneSeq) was hit. As its contents, ABB82471 consists of 835 amino acids, and amino acid numbers 260 to 835 in the amino acid sequence are amino acid numbers 1 to 576 of the amino acid sequence described in SEQ ID NO: 7, e-value: 0.0, and 576 amino acids. The degree of coincidence was 100%. (4) The registered symbol AAB65621 (SEQ ID NO: 11; Novel protein kinase protein, GenBank registered symbol AX056382) in the amino acid sequence database (aageneseq) of the patent sequence database (GeneSeq) was hit. As its contents, AAB65621 consists of 686 amino acids, and amino acid numbers 313 to 686 in the amino acid sequence are amino acid numbers 204 to 576 of the amino acid sequence described in SEQ ID NO: 7, e-value: 0.0, and 374 amino acids. The degree of agreement was 98%. (5) Registration symbol AB051552 (SEQ ID NO: 12; KIAA1765, GenBank registration symbol AB051552) in the TREMBL database was hit. As its contents, AB051552 consists of 608 amino acids, and amino acid numbers 33 to 608 in the amino acid sequence are amino acid numbers 1 to 576 of the amino acid sequence described in SEQ ID NO: 7, e-value: 0.0, and 576. There was 100% agreement across amino acids. (6) The registered code ABB82472 (Human doublecortin-like and cam kinase-like 1) in the amino acid sequence database (aageneseq) of the patent sequence database (GeneSeq) was hit. As its contents, ABB82472 is composed of 740 amino acids, amino acid numbers 382 to 674 in the amino acid sequence are amino acid numbers 276 to 569 of the amino acid sequence described in SEQ ID NO: 7, e-value: 1 × 10 ⁻⁸⁷ , and There was a 52% agreement over 294 amino acids.

  Next, a protein feature search by HMMPFAM (profile search: http://pfam.wustl.edu) was performed on the amino acid sequence shown in SEQ ID NO: 7. As a result, the characteristics of the protein kinase catalytic domain were found at amino acid numbers 284 to 541. The sequence shown (amino acid sequence entered as pkinase in Pfam) was hit. AAO15419 (SEQ ID NO: 8; GenBank accession code AX425865), AAE24133 (SEQ ID NO: 9; GenBank accession code AX504237), ABB82471 (SEQ ID NO: 10; GenBank accession code AX5343476), AAB65621 (SEQ ID NO: 11; A protein feature search by HMMPFAM was also performed on the amino acid sequences indicated by GenBank registration code AX056382) and GenBank registration code AB051552 (SEQ ID NO: 12). As a result, a sequence indicating the characteristic of the catalytic domain of the same protein kinase (Pkinase was entered as Pkinase). Amino acid sequence) was hit. Furthermore, for AAO15419, AAE24133, ABB82471, and AAB65621, a sequence showing the Doublecortin consensus domain (amino acid sequence entered as DCX in Pfam) was hit, but the amino acid sequence shown in SEQ ID NO: 7 and the amino acid sequence of AB051552 were hit. There wasn't.

  The base sequences corresponding to AAO15419, AAE24133, ABB82471 and AAB65621 are registered symbols AAL44017 (SEQ ID NO: 2; Novel human kinase protein coding sequence 2) and AAD38847 (sequence) in the base sequence database (nageneseq) of the patent sequence database (GeneSeq). No. 3; Human kinase (PKIN) -4), ABV73287 (SEQ ID NO: 4; Human serine / threonine protein kinase coding sequence) and AAF44647 (SEQ ID NO: 5; Novel protein kinase cDNA), AAL44017, AAD38847, ABV73287 and The open reading frame was investigated from the base sequence indicated by AAF44647, and the amino acid sequences thereof were AAO15419, AAE24133, ABB82471, and AAB65621, respectively. It was confirmed by match (Table 1). The GenBank registration symbol AB051552 was assigned the same registration symbol AB051552 in both the amino acid sequence database TREMBL database and the base sequence database EMBL.

  In order to elucidate the exon structure of this DNA, using software sim4 (Genome Res. 8, 967-974 (1998)) that maps the cDNA base sequence to the genomic base sequence, the cDNA shown in SEQ ID NO: 1, AAL44017 ( SEQ ID NO: 2; GenBank registry symbol AX425865), AAD38847 (SEQ ID NO: 3; GenBank registry symbol AX504237), ABV73287 (SEQ ID NO: 4; GenBank registry symbol AX5343476), AAF44647 (SEQ ID NO: 5; GenBank registry symbol AX056382) and AB05552 As a result of mapping the 6 base sequences of 6) onto the genome base sequence, the genome base sequence of the region of chromosome 3p22.3 is 4, 5, 5, 5, 4, 4 respectively. Mapping as an exon It was. The four exons of the cDNA shown in SEQ ID NO: 1 correspond to the second to fifth exons of AAL44017, AAD38847, and ABV73287, respectively, and the cDNA shown in SEQ ID NO: 1 is the first of the cDNAs of AAL44017, AAD38847, and ABV73287. It turns out that there is no exon corresponding to the exon. The four exons of the cDNA shown in SEQ ID NO: 1 correspond to the four exons of AB051552, and the difference in the base sequence is that AB051552 is 71 bases longer on the 5 ′ end side of the first exon, and 3 ′ of the fourth exon. The terminal side was 2506 bases long. In AAF44647, the exons on the 5 'end could not be mapped on the genome, but the four exons that could be mapped corresponded to the four exons of the cDNA shown in SEQ ID NO: 1, but one of the cDNAs shown in SEQ ID NO: 1 Compared to the exon of the eye, the exon of AAF44647 was shorter on the 5 ′ end side. Also, compared to the first exon of AAL44017, the first exon of AAD38847 and ABV73287 were mapped to different sites on the genome. From this, it was found that AAL44017, AAD38847 and ABV73287 are in a splice variant relationship with each other.

  Based on the above, this DNA is represented by GenBank accession symbols AX425865 (SEQ ID NO: 2), AX504237 (SEQ ID NO: 3), AX534347 (SEQ ID NO: 4) and AX056382 (SEQ ID NO: 5), which are cDNAs of doublekintin-like protein kinase genes. It turns out to be a variant. The expression level of this DNA and the expression levels of AX452865, AX504237, AX53434736, and AX056382 may differ depending on the tissue, the stage of development / differentiation, and the disease.

  It was speculated that this protein has a protein kinase domain but does not have a Doublecortin domain, and thus functions differently from the proteins encoded by AX425865, AX504237, AX53434736, and AX056382. The Doublecortin domain is known to be involved in association with microtubules (Hum Mol Genet. Sep; 8 (9): 1599-610. (1999)). From this, this protein may have a function different from the protein encoded by, for example, AX425865, AX504237, AX53434736, and AX056382 in association with microtubules.

  Protein kinases regulate pathway signaling related to cell proliferation and cancer, pathway signaling related to myocardial development, signaling pathways that control sperm motility, and control germ cell differentiation Signal transduction function on pathway, signal transduction function on pathway controlling cell differentiation, function to generate glycerol triphosphate, brain cortex development, signal transduction function on pathway controlling migration of nerve cells, fatty acid and sterol It is known to be involved in functions related to synthesis, and this protein kinase is a cancer, immune / inflammatory disease, heart disease, infertility, morphogenesis abnormality, neurological disease, cardiovascular disease, bone system Suggested to be involved in various diseases such as diseases, endocrine diseases, stress diseases, viral diseases It was.

  This DNA has been cloned from a cDNA library derived from fetal brain. In addition, as described above, human doublecortin-like and cam kinase-like 1 that has been found to be homologous to this DNA is known to exhibit brain-specific expression (Genomics. Feb 15; 56 (1): 121-6 (1999)). From the above, this DNA may also be expressed in the brain. In addition, human doublecortin-like and cam kinase-like 1 is involved in the development and differentiation of the central nervous system, and is known to be a related gene of spondylosis linked to the X chromosome and subcortical ectopic gray matter. (Genomics. Feb 15; 56 (1): 121-6 (1999)). This protein is also related to the proliferation and migration of nervous system cells and the development and differentiation of the central nervous system. May be involved in neurological diseases such as Alzheimer's disease, depression, and schizophrenia.

Measurement of kinase activity (1) Preparation of protein For FCBBF2003102 which is a cDNA clone presumed to have kinase activity in Example 3 and Example 4, a protein encoded by this was synthesized using a cell-free protein synthesis system, Whether the protein has kinase activity was analyzed by the following biochemical experiment.

The open reading frame (ORF) fragment of FCBBF2003102 was obtained by PCR using the following primers specific for each clone as 5′-side primers and the following common primers as 3′-side primers.
5 'primer
TGAGGCACCAGGGGAA (SEQ ID NO: 17)
3 'primer
GGCCCTTATGGCCGGAGAAAGGCGGACAGGTAT (SEQ ID NO: 18)
A translation control region containing SP6 promoter-glutathione-S-transferase gene-PreScission Protease (manufactured by Amersham Pharmacia Biotech) cleavage site-DNA cloning site ( Sma I, Sfi I) -vector having poly A signal sequence (pEU) -Inserted into the cloning site of SS4).

Using the plasmid DNA prepared above as a template, transcription was carried out using SP6 RNA Polymerase (Promega), and the resulting RNA was extracted with phenol / chloroform and precipitated with ethanol, followed by Nick Column (Amersham Pharmacia Biotech). Purified by
The method of cell-free protein synthesis using the wheat germ extract by dialysis was the same as that of a previous report (Endo, Y. et al., (1992) J. Biotech., 25, 221-230). The reaction solution contains 24% of wheat germ extract, and has the following composition according to the method of Erickson et al. 20 mM HEPES-KOH, pH 7.6, 80 mM potassium acetate, 1.6 mM magnesium acetate, 0.4 mM spermidine, 2 mM dithiothreitol, 20 L-amino acids (each 0.24 mM), 1.2 mM ATP, 0.26 mM GTP, 16 The above-mentioned mRNA (1 mg / ml reaction volume) was added to mM creatine phosphate, 0.4 mg / ml creatine kinase, 1000 units / ml ribonuclease inhibitor (RNasin ^™ ).

  Place the above reaction solution in a floater riser (Spectra / Float-A-Lyzer (Biotech RC), molecular weight cut-off: 10 kDa, volume: 1 ml) and 40 times the volume of the dialysis solution (30 mM HEPES- KOH, pH 7.6, 100 mM potassium acetate, 2.7 mM magnesium acetate, 0.4 mM spermidine, 2.5 mM dithiothreitol, 20 L-amino acids (0.3 mM each), 1.2 mM ATP, 0.25 mM GTP, 16 mM creatine phosphate The reaction was carried out at 26 ° C. for 48 hours.

  After completion of the reaction, the dialyzed solution was centrifuged at 16,000 rpm for 5 minutes, and the supernatant was separated. This supernatant was diluted 5-fold with 50 mM Tris / HCl buffer (pH 8.5) containing 150 mM sodium chloride and 10 mM dithiothreitol, and glutathione sepharose 4B (Amersham Bio), an affinity resin equilibrated with the same buffer. The product was added to an affinity column packed with Science) at room temperature to adsorb the target protein. Here, 1/2 column of affinity resin of the obtained centrifugal supernatant was used for the column.

  Further, after washing the column with 10 times the same volume of the affinity resin used above, a 25-fold dilution of 2 units / μl concentration of PreScience protease (Amersham Biosciences) in the same buffer was used. After adding an equal volume to the resin and performing a cleavage reaction at 4 ° C. for 40 hours, the target protein was eluted with the buffer solution.

(2) Measurement of kinase activity using ATP consumption of target protein as index The target protein isolated in (1) above was quantified using bovine serum albumin as a standard. Dithiothreitol was added to 0.1 μg of the target protein in a final concentration of 1 to 10 mM in 50 mM Tris / HCl buffer (pH 7.4) containing 0.2 mg / ml bovine serum albumin and 8 mM magnesium chloride. After incubating with 1 μM ATP for 24 hours at room temperature, 100 μl of luciferase luciferin kit (manufactured by Wako Pure Chemical Industries, Ltd.) was added and reacted at room temperature for 24 hours, and then the fluorescence intensity at 560 nm was measured. Fluorescence intensity at 560 nm was measured in the same manner using the reaction system to which the target protein was not added as a control. The difference between the value of this control and the value of the system to which the target protein was added was defined as the amount of ATP consumed by the target protein, and the amount of ATP (mol) consumed per mol of the target protein for 24 hours was identified as the kinase activity of the target protein.

(3) Measurement of kinase activity by using phosphorylation of polypeptide by target protein as an index The target protein isolated in the above (1) was quantified using bovine serum albumin as a standard. 0.1 μg of the target protein as a standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK, PTK1, PTK2: Promega, MLCKS, CaMKII: Sigma, Syntide 2: BACHEM FEINCHEMIKAALIEN AG) 0 0.2 μg / ml bovine serum albumin, 1 to 10 mM dithiothreitol, 50 mM Tris / HCl buffer (pH 7.4) containing 8 mM magnesium chloride, and 1 μM ATP were incubated at room temperature for 2 hours. After completion of the reaction, the reaction solution was added to a Bakerbond C18 (manufactured by JT Baker: 0.46 × 25 cm) column equilibrated with 0.1% trifluoroacetic acid containing 20% acetonitrile, and 0.1% Peptides were separated at a flow rate of 1 ml / min with a 60-minute linear gradient of 20-80% acetonitrile in the presence of trifluoroacetic acid. Peptide elution was measured by absorbance at 215 nm. As a control, the reaction solution to which the target protein was not added was also separated in the same manner and the absorbance at 215 nm was measured (FIG. 1). Here, it is possible to determine that a polypeptide in which a decrease in peak and a change in elution position are detected by adding a target protein serves as a substrate for the kinase activity of the target protein.

(4) Measurement result The kinase activity of the protein as an index measured by the ATP consumption activity was measured by the above system (2) to be 98.9, and the reactivity to the peptide substrate was examined (above (3) ), Reacted with two types of calmodulin kinase II substrate peptide (CaMKII) and Syntide2 (the reaction to Syntide2 was somewhat strong), and peak shifts due to transfer of phosphate groups were observed using these as substrates (FIG. 2). It was confirmed to have kinase activity. As a negative control, 0.1 μg of protein synthesized and isolated from B430206E18 (SEQ ID NO: 36, Nature, 420: 563-573 (2002)), which is a mouse full-length cDNA encoding serine protease in the system of (1) above. However, no ATP consuming activity was observed in the measurement of the system (2), and no peak shift of the substrate due to transfer of the phosphate group was observed in the measurement of (3).

Analysis of expression in human cell lines and tissues using quantitative PCR method To examine changes in tissue expression in human cell lines and normal humans and disease patients of mRNA (FCBBF2003102) encoding human protein used in the present invention. According to a conventional method (Higuchi R, et al., Biotechnology, 11: 1026-30 (1993)), expression analysis was performed using a quantitative PCR method.
(1) cDNA synthesis and acquisition Human-derived cervical cancer-derived cell line HeLa (ATCC CCL-2), human fetal kidney-derived cell line HEK293 (ATCC CRL 1573), neuroblastoma-derived cell line SH- SY5Y (ATCC CRL-2266), promyelocytic leukemia-derived cell line HL60 (ATCC CCL-240), liver cancer-derived cell line HepG2 (ATCC HB-8065), astrocytoma-derived cell line KINGS-1 (JCRB IFO50435) , Neuroblastoma cell line SK-N-SH (ATCC HTB-11), pancreatic cancer cell line PANC-1 (ATCC CRL-1469), colorectal adenocarcinoma cell line SW620 (ATCC CCL-227), breast cancer Cell line BT-474 (ATCC HTB-20) and metastatic pancreatic adenocarcinoma Total RNA was extracted from 胞株 AsPC-1 (ATCC CRL-1682), was synthesized template cDNA using random primers.

  The following human tissue-derived cDNAs were purchased from Clontech (normal breast, breast cancer, normal colon, colon cancer, normal kidney, kidney cancer, normal liver, lung cancer, normal rectum, rectal cancer, normal small intestine, small intestine cancer, normal stomach, Gastric cancer, and placenta). The following human tissue-derived cDNAs were purchased from Biochain (fetal brain, normal brain, normal frontal lobe, Alzheimer's disease frontal lobe, normal hippocampus, Alzheimer's disease hippocampus, normal thalamus, normal kidney, lupus disease kidney, normal liver, cirrhosis liver, Normal pancreas, normal skeletal muscle, normal fat, normal spleen, heart, and white blood cells).

(2) Quantification by PCR method Quantification of mRNA encoding the human protein used in the present invention (FCBBF2003102) was performed using ABI PRISM7000 Sequence Detection System (manufactured by Applied Biosystems), and the above cDNA was used as a template for the reaction solution. And qPCR Mastermix Plus (EUROGENTEC RT-QP2X-03-075 +), 300 nM 5′-side primer, 300 nM 3′-side primer, and 100 nM double-labeled probe, and carried out according to the instrument manual.
The synthetic DNA sequences of primers and probes used for quantitative PCR are shown below.
(A) 5 'primer for quantification of FCBBF2003102; CTATGCGATGAAGATCATTGACAAG (SEQ ID NO: 19)
3 ′ primer; CGTACTCCAGGATCAGGTAGATTTC (SEQ ID NO: 20)
Double labeled probe; TCACCCCAACATCGTGAAATTGCATG (SEQ ID NO: 21)
(B) 5 'side (forward) primer for quantification of human GAPDH; ACACCCACTCCTCCACCTTTGA (SEQ ID NO: 22)
3 ′ side (reverse) primer; CCTGTTGCTGTAGCCAAATTCG (SEQ ID NO: 23)
Double labeled (TaqMan) probe; TTGCCCTCAACGACCACTTTGTCAAGC (SEQ ID NO: 24)
The quantitative results were corrected using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal standard. That is, the expression level of the target gene in each tissue was divided by the expression level of GAPDH and displayed by multiplying by a constant (1 × 10 ⁵ ). Table 2 shows the expression analysis results of FCBBF2003102 in human cell lines, and Table 3 shows the results of tissue expression analysis of FCBBF2003102 in normal humans and disease patients.

  As is clear from Table 2, mRNA of FCBBF2003102 was highly expressed in promyelocytic leukemia-derived cell line HL60, colorectal adenocarcinoma-derived cell line SW620, neuroblastoma-derived cell line SH-SY5Y, and the like. As is apparent from Table 3, mRNA of FCBBF2003102 is generally expressed in low amounts, but in addition to placenta, normal and cancer gastrointestinal tissues such as stomach, small intestine and rectum, nervous system tissues such as brain and fetal brain, spleen・ Expression was observed in tissues related to immunity and inflammation such as leukocytes.

From the above results, the cDNA and the protein encoded by the cDNA are
It is expressed in the brain, gastrointestinal tract, and immune-related tissues, and is central to brain cancer, neuroblastoma, gastric cancer, small intestine cancer, large intestine cancer, leukemia and other cancers, immune / inflammatory diseases, schizophrenia, and depression It can be applied to the treatment and diagnosis of neurological diseases, Alzheimer's disease and Parkinson's disease, digestive system diseases, Crohn's disease, etc. In addition, the protein encoded by the cDNA may be involved in diseases related to tissues with a high mRNA expression level as described above.

Functional analysis by RNA interference method using siRNA designed with FCBBF2003102 as a target gene (1) Preparation of siRNA siRNA designed with FCBBF2003102 as a target gene was introduced into HEK293 cells, and this siRNA introduction was responsible for the expression and expression of FCBBF2003102. The effect on the proliferation of HEK293 cells was investigated. The negative control siRNA used was designed corresponding to the sequence of the luciferase gene (P. pyralis luc gene: SEQ ID NO: 34) of firefly (Photinus pyralis).

  21 base RNA used for preparation of siRNA used for the present Example is shown by sequence number 25-30. The sequences represented by SEQ ID NOs: 25, 27 and 29 correspond to the sense strand of siRNA, and the sequences represented by SEQ ID NOs: 26, 28 and 30 correspond to the respective antisense strands. These RNAs were outsourced to Proligo (formerly Genset) through Hitachi Instrument Service Co., Ltd. The sequences shown in SEQ ID NO: 25 and SEQ ID NO: 27 are the sequences shown in the 1296th to 1316th and 1337th to 1357th bases of the sense strand, counted from the translation start site (base number 27 of SEQ ID NO: 1) of FCBBF2003102, which is the target gene. (That is, the sequences represented by base numbers 1322 to 1342 and base numbers 1363 to 1383 of SEQ ID NO: 1), respectively. The sequences shown in SEQ ID NO: 26 and SEQ ID NO: 28 are the sequences shown in the 1314 to 1294th and 1355 to 1335th bases of the antisense strand from the translation start site of FCBBF2003102 (that is, the base numbers 1320 to 1340 of SEQ ID NO: 1). And a sequence complementary to the sequence represented by base numbers 1361 to 1381). The sequences shown in SEQ ID NO: 29 and SEQ ID NO: 30 are the 20th to 40th bases of the sense strand and 38 to 38 of the antisense strand counted from the translation start site (base number 1 of SEQ ID NO: 34) of the P. pyralis luc gene. It corresponds to the sequence shown in the 18th base (namely, the sequence shown in base numbers 20 to 40 of SEQ ID NO: 34 and the complementary sequence of the sequence shown in base numbers 18 to 38) (FIG. 5).

A method for producing a double-stranded siRNA used to inhibit the expression of the FCBBF2003102 gene is shown below. The siB of FCBBF20030102-1294 was prepared by associating the sense strand of SEQ ID NO: 25 with the antisense strand of SEQ ID NO: 26. Similarly, by associating the sense strand of SEQ ID NO: 27 with the antisense strand of SEQ ID NO: 28, the siRNA of FCBBF20031023-1335 is associated with the sense strand of SEQ ID NO: 29 and the antisense strand of SEQ ID NO: 30. Negative control siRNA was prepared. The meeting was requested from the above-mentioned synthesis consignment company, or each of the sense single-stranded RNA and the antisense single-stranded RNA was received as a single product, and the meeting was held. In the latter case, the mixture of the sense strand RNA and the antisense strand RNA was heated at 90 ° C. for 2 minutes in a 10 μM Tris-HCl (pH 7.5), 20 μM NaCl reaction solution, and further gradually cooled to 37 ° C. The incubation was performed at 37 ° C. for 1 hour, and then allowed to stand until room temperature. As a result, the sense strand and the antisense strand associate to form a double-stranded RNA. The formation of double-stranded RNA was assayed by 2% agarose gel electrophoresis in TBE buffer. Almost all single-stranded RNA was associated with double-stranded RNA under the above conditions.
The sequence of the double-stranded siRNA used is described below.
(A) siRNA of FCBBF20030102-1294
Sense strand; GCAUGUGGUGAGACCUAUAUU (SEQ ID NO: 25)
Antisense strand; UAUAGGUCUCACCACAUGCUU (SEQ ID NO: 26)
(B) siRNA of FCBBF20031023-1335
Sense strand; CUUACGUAGCUCCCGAAAUUC (SEQ ID NO: 27)
Antisense strand; AUUUCGGGAGCUACGUAAGUU (SEQ ID NO: 28)
(C) Negative control siRNA
Sense strand; UAAAGAAAGGCCCGGCGCCAU (SEQ ID NO: 29)
Antisense strand; GGCGCCGGGCCUUUCUUUAUG (SEQ ID NO: 30)

(2) Introduction of siRNA into cultured cells HEK293 cells (human embryonic kidney cells transformed with human adenovirus type 5, Dainippon Pharmaceutical) are used as cultured cells, and the culture medium is Dulbecco's modified Eagle's medium (manufactured by Sigma). Non-hatched 10% fetal bovine serum (manufactured by JRH) and antibiotics containing penicillin 100 units / ml and streptomycin 100 μg / ml (manufactured by Invitrogen) were used and cultured in the presence of 37 ° C. and 5% CO ₂ .

These HEK293 cells were seeded at a density of 0.9 × 10 ⁵ cells / ml in a 24-well plate (collagen type 1 coated, manufactured by Iwaki Glass Co., Ltd.) in an amount of 1 ml per well, and one day later, GeneSilencer siRNA Transfection Reagent ( A total of 50 nM of each siRNA was introduced using Gene Therapy Systems. The siRNA concentration was expressed as a molar concentration in a state where 1 ml of medium was finally present per well, assuming that the state of double-stranded RNA was one molecule.

(3) Measurement of gene expression level in cultured cells The cells prepared in Example 7 (2) above were collected by solubilization using Lysis Solution (Applied Biosystems) 48 hours after siRNA introduction, Total RNA was extracted and purified using a nucleic acid extraction apparatus ABI PRISM 6100 Nucleic Acid PrepStation (Applied Biosystems). Furthermore, reverse transcription reaction was performed using ReverseTranscriptaseXL (AMV) for RT-PCR, Ribonuclease inhibitor, Random Primer, 25 mM MgCl ₂ solution, 10xPCR Buffer (above TaKaRa), dNTP Mixture (10 mM) (TOYOBO), and cDNA. A sample was obtained. Using the thus obtained cDNA preparation as a template, the target gene mRNA was quantified using a quantitative PCR apparatus ABI PRISM 7000 (Applied Biosystems). The quantitative method used TaqMan chemistry of Applied Biosystems. The sequences of the forward primer, reverse primer and TaqMan probe (FAM-TAMRA double label) used in this method are shown in SEQ ID NOs: 22-24 and 31-33. The sequences shown in SEQ ID NOs: 31, 32, and 33 indicate a forward primer, a reverse primer, and a TaqMan probe for quantification of FCBBF2003102, respectively. Further, the sequences shown in SEQ ID NOs: 22, 23, and 24 represent a forward primer, a reverse primer, and a TaqMan probe for quantification of human GAPDH (glyceraldehyde-3-phosphate dehydrogenase, SEQ ID NO: 35), respectively. The synthesis of these forward primer, reverse primer and TaqMan probe was outsourced to Applied Biosystems Japan. QPCR Master Mix Plus (Nippon Gene) was used as a reagent for quantification. The expression level of FCBBF2003102 mRNA was determined by standardizing the quantitative value of FCBBF2003102 with the quantitative value of GAPDH.

  Expression of the FCBBF2003102 gene in HEK293 cells was inhibited by both of the two types of siRNA (FIG. 3). All values are relative representations of the expression level of FCBBF2003102 gene (standardized by the amount of GAPDH) as a value of 100% of the cell group not subjected to siRNA transfection operation (non-introduced group). Moreover, these have shown the average value of experiment of 6 wells, and the vertical line in a figure shows a standard deviation. In the group to which 50 nM of siRNA against FCBBF2003102 was added, 94% and 84% of inhibition of FCBBF2003102 gene expression was observed for FCBBF20030102-1294 and FCBBF20031023-1335, respectively, compared to the non-introduced group in which no siRNA was introduced. In the group into which negative control siRNA was introduced, expression inhibition of FCBBF2003102 gene was not observed.

The primer and probe sequences used for quantification of FCBBF2003102 are described below.
Forward primer; ACGTAGCTCCCGAAATTCTTTCT (SEQ ID NO: 31)
Reverse primer; CTGATGAGCTGTGTAGCGCTTT (SEQ ID NO: 32)
TaqMan probe; TCCTCTATATCCTGCTGTGTGGCTTTCCC (SEQ ID NO: 33)

(4) Effect on proliferation of HEK293 cells The medium is Dulbecco's modified Eagle's medium (Sigma), non-hatched 10% fetal bovine serum (JRH) and antibiotics penicillin 100 units / ml, streptomycin 100 μg / ml (Invitrogen) ) Was added and cultured at 37 ° C. in the presence of 5% CO ₂ .
HEK293 cells were seeded at a density of 0.1 or 0.15 × 10 ⁵ cells / ml in a 96-well plate (collagen type 1 coated, manufactured by Iwaki Glass Co., Ltd.) at 0.25 ml per well, and one day later GeneSilencer siRNA A total of 50 nM siRNA was introduced using Transfection Reagent (manufactured by Gene Therapy Systems). As siRNA, negative control siRNA and FCBBF2003102-1294 are used, and the dosage of FCBBF2003102-1294 is 0.5, 12.5, 25, 50 nM.

Quantification of cell proliferation was performed by measuring ATP (adenosine triphosphate) derived from living cells using CellTiter-Glo Luminescent Cell Vialbility Assay (Promega) 3 or 4 days after siRNA introduction. It is known that the intracellular ATP content is proportional to the number of living cells.
HEK293 cell proliferation was inhibited by FCBBF2003102-1294 (FIG. 4). The value is shown as the ATP concentration when ATP derived from living cells in each well is eluted in 100 μl of liquid medium. Moreover, these have shown the average value of experiment of 8 wells, and the vertical line in a figure shows a standard deviation. In the group introduced with negative control siRNA 50 nM, a 27% decrease in ATP content was observed compared to the non-transfected group not treated with transfection, which is presumed to be an effect on cell proliferation derived from the transfection treatment. The In the cell group into which FCBBF2003102-1294 50 nM was introduced, the ATP content was reduced by 60% compared to the group into which 50 nM negative control siRNA was introduced. Since the expression of FCBBF2003102 gene was reduced by introducing siRNA for FCBBF2003102 into HEK293 cells and cell growth was suppressed, FCBBF2003102 has cell proliferation activity and plays an important role in the proliferation of HEK293 cells. It has been suggested.

  The sequences shown in SEQ ID NO: 25 and SEQ ID NO: 27 are variants including the splicing variant of FCBBF2003102 and are estimated to be protein kinases. The sense strand counted from the translation start site (base number 113 of SEQ ID NO: 2) of AX425865 In addition, the translation start site of AX504237 (the base of SEQ ID NO: 3) is shown in the sequence shown in the bases from 2019 to 2039 and 2060 to 2080 (that is, the sequences shown in base numbers 2131 to 2151 and 2172 to 2192 of SEQ ID NO: 2). The sequence shown in the 2076 to 2096 and 2117 to 2137th bases of the sense strand counted from (No. 1) (that is, the sequence shown in the base numbers 2076 to 2096 and 2117 to 2137 of SEQ ID NO: 3), and AX53473 Sequence shown in the 2076 to 2096 and 2117 to 2137th bases of the sense strand counted from the translation start site (base number 1 of SEQ ID NO: 4) (ie, base numbers 2076 to 2096 and base numbers 2117 to 2137 of SEQ ID NO: 4) Respectively). Further, the sequences shown in the 1107th to 1127th and 1148th to 1168th bases of the sense strand counted from the first base (base number 1 of SEQ ID NO: 5) of the full-length sequence of AX056382 (that is, base numbers 1107 to 1127 of SEQ ID NO: 5) And the sequence shown in base numbers 1148 to 1168) and the bases 1393 to 1413 and 1434 to 1454 in the sense strand counted from the first base of the full-length sequence of AB051552 (base number 1 of SEQ ID NO: 6). It corresponds to the sequence (that is, the sequence represented by base numbers 1393 to 1413 and base numbers 1434 to 1454 of SEQ ID NO: 6).

  Furthermore, the sequences shown in SEQ ID NO: 26 and SEQ ID NO: 28 are the sequences shown in the 2037 to 2017 and 2078 to 2058 bases of the antisense strand counted from the translation start site of AX425865 (that is, the base numbers 2129 to 2 of SEQ ID NO: 2). 2149 and a sequence complementary to the sequence shown in nucleotide numbers 2170 to 2190), and the sequences shown in the 2094 to 2074 and 2135 to 2115th bases of the antisense strand from the translation start site of AX504237 (ie Sequence complementary to the sequences shown in base numbers 2074 to 2094 and base numbers 2115 to 2135), and sequences shown in the 2094th to 2074th and 2135th to 2115th bases of the antisense strand counted from the translation start site of AX534347 (ie, the sequence) number Respectively corresponding to a complementary sequence) of the nucleotide numbers 2074-2094 and nucleotide numbers 2115-2135 sequence shown in. Further, the sequences shown in the 1125th to 1105th and 1166th to 1146th bases of the antisense strand counted from the first base of the full-length sequence of AX056382 (ie, shown in base numbers 1105 to 1125 and base numbers 1146 to 1166 of SEQ ID NO: 5) Sequence shown in the 1411 to 1391 and 1452 to 1432 bases of the antisense strand from the first base of the full-length sequence of AB051552 (ie, base numbers 1391 to 1411 and bases of SEQ ID NO: 6) Corresponding to the sequences shown in the numbers 1432 to 1452) (FIG. 5).

  Therefore, AX452865, AX504237, AX534347, AX056382 and AB051552 are also variants including the splicing variant of FCBBF2003102, which are presumed to be protein kinases, and have an important role in the growth of HEK293 cells as well as FCBBF2003102. It was suggested that

FIG. 1 shows the standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK, PTK1, PTK2, MLCKS, CaMKII, Syntide2) and BSA peaks as measured on reverse phase HPLC. FIG. 2 shows the reaction by adding a protein having the amino acid sequence of SEQ ID NO: 1 to a standard polypeptide (Cdc2, Arg2-OH, PKA, PKC, DNA-PK, PTK1, PTK2, MLCKS, CaMKII, Syntide2) as a substrate. The result of having measured the peak on reverse phase HPLC is shown. FIG. 3 shows the results of measuring the expression level of FCBBF2003102 gene in HEK293 cells after siRNA (FCBBF20030102-1294, FCBBF20031023-1335) targeting FCBBF2003102 was introduced into HEK293 cells. FIG. 4 shows the results of measuring the proliferation of HEK cells into which siRNA was introduced 4 days after introduction, using the intracellular ATP content as an index, after introducing siRNA (FCBBF20030102-1294) with FCBBF2003102 as a target gene into HEK293 cells. FIG. 5 is a diagram showing the positional relationship between FCBBF2003102 and variants including its splicing variants (AX452865, AX504237, AX534347, AX056382 and AB051552) and siRNA (FCBBF20033102-1294) targeting FCBBF2003102. * Indicates the position of the stop codon.

Claims (14)

A cell growth promoting agent comprising any of the following proteins (a) to (c):
(A) a protein comprising the amino acid sequence of any one of SEQ ID NOs: 7 to 12,
(B) It consists of an amino acid sequence in which one or several amino acids are deleted, substituted and / or added in the amino acid sequence described in any of SEQ ID NOs: 7 to 12, and has kinase activity and / or cell proliferation activity protein,
(C) A protein consisting of a partial amino acid sequence in the amino acid sequence of any one of SEQ ID NOs: 7 to 12 and having kinase activity and / or cell proliferation activity. A cell growth inhibitor comprising a substance that inhibits the activity of the protein according to claim 1. A cell growth promoter or cell growth inhibitor comprising a substance that regulates the expression of the gene of the protein according to claim 1. A sense oligonucleotide having the same sequence as 5 to 100 consecutive bases in any one of the following base sequences (a) to (c), an antisense oligonucleotide having a sequence complementary to the sense oligonucleotide, and the sense Alternatively, a cell containing an oligonucleotide selected from the group consisting of an oligonucleotide derivative of an antisense oligonucleotide, a double-stranded oligonucleotide comprising the sense oligonucleotide or antisense oligonucleotide, and an oligonucleotide derivative of the double-stranded oligonucleotide Growth inhibitor;
(A) the base sequence according to any one of SEQ ID NOs: 1 to 6,
(B) In the base sequence described in any one of SEQ ID NOs: 1 to 6, the base sequence has one or several bases deleted, substituted and / or added, and has kinase activity and / or cell proliferation activity A base sequence of DNA encoding a protein having
(C) has a base sequence capable of hybridizing under stringent conditions with a DNA having the base sequence described in any of SEQ ID NOs: 1 to 6 or a complementary sequence thereof, and has kinase activity and / or cell proliferation A base sequence of DNA encoding a protein having activity. The cell growth inhibitor according to claim 4, wherein the double-stranded oligonucleotide is selected from the group consisting of the following (a) to (c);
(A) a double-stranded oligonucleotide consisting of an oligonucleotide having the base sequences set forth in SEQ ID NOs: 25 and 26,
(B) a double-stranded oligonucleotide consisting of an oligonucleotide having the base sequences set forth in SEQ ID NOs: 27 and 28,
(C) A double-stranded oligonucleotide consisting of an oligonucleotide having the nucleotide sequence set forth in SEQ ID NOs: 29 and 30. A cell growth inhibitor containing an antibody or a partial fragment thereof that specifically binds to the protein of claim 1. The protein of claim 1 is brought into contact with a test substance, and the change of the kinase activity and / or cell proliferation activity of the protein by the test substance is measured, and the cell growth activity of the protein is regulated Substance screening method. A kit for screening a substance that regulates cell proliferation activity of the protein, comprising the protein according to claim 1. A test substance is brought into contact with a cell into which a protein expressing the protein according to claim 1 or a gene-transfected cell into which a recombinant vector containing a DNA encoding the protein is introduced, and a change in the expression level of the DNA in the cell is detected. A screening method for an expression regulator of the DNA. A DNA encoding the protein according to claim 1, a cell expressing the protein, a recombinant vector containing the DNA, or at least one selected from the group consisting of a gene-transferred cell into which the recombinant vector has been introduced. A kit for screening a substance that regulates the expression of the DNA. A method for promoting cell proliferation using the protein according to claim 1. A method for promoting cell growth using a recombinant vector comprising DNA encoding the protein of claim 1. A method for inhibiting cell growth using the oligonucleotide according to claim 4 or 5. A method for inhibiting cell proliferation using the antibody or partial fragment thereof according to claim 6.

Images