WO2003091428A1 - Nouvelles proteines et adn codant ces proteines - Google Patents

Nouvelles proteines et adn codant ces proteines Download PDF

Info

Publication number
WO2003091428A1
WO2003091428A1 PCT/JP2003/005175 JP0305175W WO03091428A1 WO 2003091428 A1 WO2003091428 A1 WO 2003091428A1 JP 0305175 W JP0305175 W JP 0305175W WO 03091428 A1 WO03091428 A1 WO 03091428A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
dna
seq
amino acid
sequence
Prior art date
Application number
PCT/JP2003/005175
Other languages
English (en)
Japanese (ja)
Inventor
Yoshihide Hayashizaki
Mamoru Kamiya
Hideo Kubodera
Original Assignee
Riken
K. K. Dnaform
Mitsubishi Chemical Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Riken, K. K. Dnaform, Mitsubishi Chemical Corporation filed Critical Riken
Priority to AU2003235100A priority Critical patent/AU2003235100A1/en
Publication of WO2003091428A1 publication Critical patent/WO2003091428A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to a novel protein, a DNA encoding the protein, a full-length cDNA encoding the protein, a recombinant vector having the DNA, an oligonucleotide comprising a partial sequence of the DNA, and introducing the DNA.
  • the present invention relates to a transfected cell obtained, and an antibody specifically binding to the protein. Background art
  • cDNA and its nucleotide sequence analysis are indispensable for analyzing the physiological activity of a protein expressed in a living body and developing a method for utilizing the protein based on the activity.
  • creating a library that catalogs full-length cDNAs for all transgene species is one of the important issues of the human genome project.
  • the cataloged library means that there is no duplication in the cDNAs contained in the library, and is a library containing one type of each C.DNA.
  • the full-length cDNA cloning method is described in JP-A-9-248187 and JP-A-10-127291.
  • a tag molecule is bound to a diol structure present at the 5 ′ cap site of mRNA, the mRNA bound to the tag molecule is converted into a rust type, and RNA-DNA is subjected to reverse transcription using oligo dT as a primer.
  • a method comprising preparing a complex, and separating a complex having a DNA corresponding to the full length of the mRNA using the function of the tag molecule.
  • the full-length cDNA library produced by such a technique does not include all the elements that are different evenly as individual elements of the library. Some clones only exist. Since clones that exist only in such a trace amount are likely to be novel, a subtraction method for enriching such clones--a normalization method has also been developed.
  • nucleotide sequence of each clone of the cataloged full-length cDNA library thus obtained can be identified by a known method, and the nucleotide sequence can be identified. The biological activity remains unknown. Disclosure of the invention
  • the present invention analyzes the nucleotide sequence of a cDNA clone contained in a cataloged full-length cDNA library, and among those having a novel sequence, identifies the physiological activity of the protein encoded by the nucleotide sequence.
  • the purpose of the present invention is to propose a method of using a protein based on activity and a DNA encoding the protein.
  • the present inventors analyzed the nucleotide sequence of the cDNA clone in the mouse full-length cDNA library and searched a database based on the homology of the sequence, and found that the sequence has phosphatase activity. A sequence specific to the protein was found, and the protein encoded by these cDNAs was identified as a protein having phosphatase activity. In addition, (i) the expression level of these cDNAs in each tissue is analyzed, (ii) the protein encoded by the cDNA is expressed and its activity is confirmed, and (iii) the expressed protein is compared with other proteins. Were analyzed, and the functions of the protein encoded by the cDNA were comprehensively analyzed by combining the analysis results of (i) to (iii). Furthermore, human orthologs corresponding to these mouse full-length cDNAs were found from human genome sequences and analyzed. The present invention It was achieved based on knowledge.
  • DNA encoding a protein having a base sequence in which one or several bases are deleted, substituted and / or added, and having phosphatase activity.
  • An activity modulator of the protein according to (1) or (7) which comprises bringing the protein of (1) or (7) into contact with a test substance and measuring a change in the activity of the protein due to the test substance. Screening method.
  • a gene expression-regulating substance for the DNA wherein the gene-transfected cell according to (6) is brought into contact with a test substance, and a change in the expression level of the DNA introduced into the cell is detected. Screening method.
  • Computer-readable recording medium that stores at least one or more base sequence information.
  • Figure 1 shows the results of SDS-polyacrylamide gel electrophoresis analysis of various purified phosphatase purified products synthesized by the wheat embryo cell-free translation system.
  • 1 indicates dnaform31429
  • 2 indicates dnaform60475
  • 3 indicates dnaform48918,
  • 4 indicates dnaform45743
  • 5 indicates dnaform65509
  • 6 indicates dnaform28618, 7 indicates dnaform52812
  • E indicates an eluted fraction (soluble)
  • B indicates a bead fraction (insoluble).
  • the molecular weight marker is “Daiichi Kagaku -J ⁇ III was used.
  • the DNA of the present invention may be a protein or an amino acid sequence comprising the amino acid sequence of SEQ ID NOS: 8 to 14, 25, or 26, or one or several amino acids (the number mentioned here is not particularly limited, For example, 20 or less, preferably 15 or less, more preferably 10 or less, and even more preferably 5 or less) amino acid residue including substitution, deletion, insertion, addition, or inversion. Any material can be used as long as it can encode a protein having phosphatase activity. Specifically, it may be only the translation region encoding the amino acid sequence, or it may include the full length of its cDNA.
  • examples of the DNA containing the full-length cDNA include a DNA having the nucleotide sequence of SEQ ID NOS: 1 to 7, 23, or 24.
  • the translated regions include nucleotide numbers 296 to 1414 of SEQ ID NO: 1, nucleotide numbers 243 to 2105 of SEQ ID NO: 2, nucleotide numbers 85 to 1570 of SEQ ID NO: 3, and nucleotide number 155 of SEQ ID NO: 4.
  • base Nos. 98 to 745 of SEQ ID No. 5 base Nos. 46 to 1053 of SEQ ID No. 6, bases 77 to 1855 of SEQ ID No. 7, base Nos. 1 to 1959 of SEQ ID No. 23, SEQ ID No.
  • the DNA of the present invention includes not only the full length of the above-mentioned cDNA but also a region adjacent to the above-mentioned translation region and the 3 ′ and / or 5 ′ end thereof and containing a minimum necessary part for the expression of the translation region. included.
  • the DNA of the present invention may be obtained by any method as long as it can be obtained, but specifically, it can be obtained, for example, by the method described below.
  • mRNA is prepared from a suitable animal, preferably a mammalian tissue or the like, by a method known per se and generally used.
  • the cDNA thus obtained is inserted into an appropriate cloning vector for cloning.
  • the vector used here has a recombinase recognition sequence at both ends of the cloning site, which enables uniform cloning of DNAs of various chain lengths, and a linear sequence inserted into the host by a method other than infection.
  • Vector JP-A-11-9273
  • the cDNA library obtained in this manner does not mean that all clones are uniformly present (hereinafter, this may be referred to as “cataloged”), but is not included in this library. It is highly probable that a clone that exists only in a trace amount is new. Therefore, a subtraction method and a normalization method (JP-A-2000-325080; Carninci, P. et al., Genomics, 37, 327-336 (1996)) for enriching such clones should be used. Is preferred.
  • the nucleotide sequence of the cataloged cDNA library is analyzed by a commonly used method known per se.
  • the DNA of the present invention is obtained by converting the base sequence obtained for the sequence based on the terminal 100 bases into a database such as NCB I GenBank, EMBL, DDBJ or the like.
  • Examples of such a DNA having the base sequence of the full-length cDNA include those having the base sequence of SEQ ID NOS: 1 to 7, 23 or 24.
  • nucleotide numbers 296 to 1414 of SEQ ID NO: 1 nucleotide numbers 243 to 2105 of SEQ ID NO: 2, nucleotide numbers 85 to: 1570 of SEQ ID NO: 3, nucleotide numbers 155 to 3472 of SEQ ID NO: 4, Nucleotide numbers 98 to 745 of SEQ ID NO: 5, Nucleotide numbers 46 to 1053 of SEQ ID NO: 6, Nucleotide numbers 77 to 1855 of SEQ ID NO: 7, Nucleotide numbers 1 to 1959 of SEQ ID NO: 23, Nucleotide number 1 of SEQ ID NO: 24 No. 3699 to No. 3699.
  • BLAST Basic local alignment search tool
  • HMMP FAM sequence analysis method using hidden Markov model
  • a sufficiently significant hit sequence means that the degree of coincidence between the catalytic domain portion of the registered amino acid sequence and the corresponding portion of the amino acid sequence encoded by the DNA of the present invention is e ⁇ V a 1 ue. — Show 4 or less, or 30% or more.
  • the sequence to be analyzed has the characteristics of the sequence of the entry in the database that integrates the protein profile of P fam.
  • An analysis is performed according to a method of determining whether or not there is an error.
  • Profiles are extracted from a series of proteins with the same characteristics, and even if a function cannot be clarified by comparing one-to-one sequences over the entire length, if the characteristic region exists in the sequence, it can be identified and its function can be predicted.
  • a specific example of the protein function prediction performed by force is described below.
  • Kamimi protein phosphatase 2 and homolog 1 (Schizosaccharorayces pombe) proteins are considered to be involved in the heat shock reaction based on literature information in the database (Mol. Cell. Biol. 14: 3742-3751 (1994)).
  • the phosphatase 2C homolog 1 (YEAST) protein has been shown to be involved in the effects of temperature on growth and reproduction from the literature information in the database (Mol. Cell. Biol. 14: 3634-3645 (1994)). I have.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 1 is a phosphatase having a function related to the heat shock reaction.
  • the JigciProtein phosphatase 2C homolog 2 (icnizosaccharomyces pombe) protein is known to be involved in the osmotic pressure stability of cells based on the literature information in the database (EMB0 14: 492-502 (1995)). 2C homolog 1
  • Protein phosphatase 2C (Arabidopsis thaliana) protein is described in the literature (Mol.Cell. Biol. 17: 5485-5498 (1997)), each of which has been clarified to be involved in cell cycle regulation.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 2 is a phosphatase having a function of regulating the cell cycle.
  • the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 3 was found to have 33% homology over 301 amino acid residues with Protein ybfQ (Bacillus subtilis) in e-value: 2 X 1 CT by BLAST search. and also, the protein TC0916 (Chlamydia muridarum), e- value: at 5 X 10- 37, 35% homology over 296 amino acid residues, further, protein SP0095 and (Arabidopsis thaliana), e- va 1 ue:. in 5 X 10- 4, it has a 31% homology over 121 amino acid residues it is presumed protein comprising the amino acid sequence shown in SEQ ID NO: 10 these results are phosphatases.
  • amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 3 When a protein feature search is performed using PFAM, a sequence that exhibits phosphatase characteristics (a sequence that is entered as Rhodanese in P fam) is found.
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 4 was found by BLAST search to have 18% homology with Dentin sialophosphoprotein precursor over 828 amino acid residues at e-value: 8 ⁇ 10 " 11. , a Dual specificity protein phosphatase 4, e- value : at 8 X 10- 11, 145 amino acid residues 32% homology 3 ⁇ 4 ⁇ over further 46 kDa FK506 - binding nuclear protein and, e- va 1 ue: 3 X in 10_ 7, has a 22% homology over 236 amino acid residues. It is presumed protein consisting amino acid sequence shown in SEQ ID NO: 1 1 these results are phosphatases.
  • Kamimemi Dentin sialophosphoprotein precursor protein / protein poverty is related to dentin generation from literature information (Nat. Genet. 27: 201-204 (2001)) in the data.
  • the specificity protein phosphatase 4 protein has been shown to be involved in the regulation of mitotic signal transmission according to literature information in the 7-base (J. Biol. Chem. 270: 14587-14596 (1995)).
  • the 46 kDa FK506-binding nuclear protein protein is available from the literature information in the database (J. Biol. Chem.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 4 is a phosphatase having a function related to the transmission of ferns.
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 5 was obtained by BLAST search to find Dual speciricity protein phosphatase 13 and e-value: o XIO - In ", 51% homology over 175 amino acid residues, also with Protein-tyrosine phosphatase vhp- 1, e_v a 1 ue: with 2 X 10- 5, 28% of the homologous over 150 amino acid residues Furthermore, it has 34% homology over 141 amino acid residues at e-va 1 ue: 0.034 with Voltage-dependent P / Q-type calcium channel alpha-1A subunit. Thus, it is presumed that the protein consisting of the amino acid sequence shown in SEQ ID NO: 12 is a phosphatase.
  • Dual specificity protein phosphatase 13 protein based on the literature information in the 7-base (Biochem. J. 344: 819-825 (1999)), has been shown to be involved in the regulation of mitosis.
  • Voltage-dependent P / Q-type calcium channel alpha-lA subunit protein can be found in the database (J. Neurosci.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 5 is a phosphatase having a function related to calcium ion uptake.
  • Amino acid sequences which nucleotide sequence is encoded according to SEQ ID NO: 6 and more B LAST search, and Myotubularin, e-va 1 ue: with 2 X 10- 16, 39% homologous ⁇ raw over 136 Amino acid residue and also, a 105.4 kDa protein T24A11, e-value : at 2 X 1 0 one 9, a 38% homology over 90 amino acid residues, further comprising Collagen alpha 2 (1) chain precursor , e-value : 1.7, with 40% homology over 80 amino acid residues. From these results, it is presumed that the protein consisting of the amino acid sequence shown in SEQ ID NO: 13 is a phosphatase.
  • the Myotubularin protein is involved in signal transduction from literature information in the database (Hum. Mol. Genet. 7: 1703-1712 (1998)). (Curr. Biol. 13 (6) 504-509 (2003)), the protein is phosphoinositide phosphatase, phosphatidylinositol 3-phosphate (PtdIns3P) phosphatase. It has been clarified that abnormalities of this gene are related to myopathy-de-europathy.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 6 is a phosphatase having a function related to the transfer of sidanal, or phosphoinositide phosphatase, phosphatin / reinositol monophosphate 3-phosphatidylinositol It is presumed that it is 3-phosphate (PtdIns3P) phosphatase, and that abnormalities of this gene are related to myopathy and neuropathy.
  • PtdIns3P 3-phosphate
  • Kamimeki protein tyrosine phosphatase, non-receptor type 13 protein poor is considered to be involved in the induction of apoptosis by Fas antigen based on literature information in the database (Biochemistry 39: 2572-2580 (2000)).
  • the Ezrin protein may be involved in the binding of the skeletal structure to the plasma membrane from literature information (Arch. Biochera. Biophys. 330: 229-237 (1996)) in the database, and the Radixin protein may be involved in the database. From the literature information (Biochim. Biophys. Acta 1216: 479-482 (1993)), it has been clarified that they are involved in the binding of actin to the plasma membrane.
  • the protein encoded by the nucleotide sequence shown in SEQ ID NO: 7 is a phosphatase having a function related to apoptosis induction.
  • the DNA of the present invention may be obtained in a state where a base sequence is deleted or inserted in the translated sequence.
  • the base of the DNA is obtained.
  • a deletion or insertion in the sequence is estimated, a full-length cDNA having no base deletion or insertion using a method commonly used by those skilled in the art such as library screening or PCR closing. Can be obtained.
  • the full-length cDNA thus obtained is used to express the protein of the present invention, which can be used for functional analysis.
  • the DNA of the present invention which is obtained by force, whose nucleotide sequence is determined, and whose function is estimated, is shown above as the nucleotide sequence of SEQ ID NOS: 1 to 7, 23 or 24, or its translated region. Not only those having a base sequence, but also one or several (the number is not particularly limited, for example, 60 or less, preferably 30 or less, more preferably 20 Or less, more preferably 10 or less, particularly preferably 5 or less.)
  • DNAs are composed of amino acid sequences in which one or several amino acid sequences have been deleted, substituted and / or added in the amino acid sequence of the protein described in SEQ ID NOs: 8 to 14, 25 or 26. And those encoding proteins having phosphatase activity.
  • DNA that hybridizes under stringent conditions refers to the nucleotide sequence shown in SEQ ID NOS: 1 to 7, 23 or 24 or its complementary sequence in a BLAST analysis of 80% or more, preferably 90% or more, and more preferably 90% or more.
  • DNA including a nucleotide sequence having a homology of 95% or more can be mentioned.
  • Hybridization under stringent conditions means that the reaction is carried out in a normal hybridization buffer at a temperature of 40 to 70 ° (preferably 60 to 65 ° C, etc., Washing method in a washing solution of 5 mM to 30 OmM, preferably 15 mM to 60 mM etc. Can be performed according to
  • the DNA of the present invention may be obtained by the above-described method or may be synthesized.
  • the DNA base sequence can be easily replaced with a commercially available kit such as a site-directed mutagenesis kit (Takara Shuzo) or a quick change site directed mutagenesis kit (Stratagene). it can.
  • the nucleotide sequences of SEQ ID NOs: 1 to 7 are derived from mouse.
  • a human cDNA library was prepared according to the above-described method for preparing a cDNA library, and the sequence was determined for the library.
  • DNA encoding a human homolog protein of the protein encoded by the nucleotide sequence of SEQ ID Nos. 1 to 7 was obtained.
  • DNAs that hybridize under stringent conditions to the DNAs of SEQ ID NOs: 1 to 7 of the present invention include DNAs encoding such human homologs.
  • the human homolog of the present invention includes, for example, a human ortholog protein (SEQ ID NO: 25 or 26) encoded by the nucleotide sequence of SEQ ID NO: 23 or 24.
  • methods for predicting a base sequence encoding a homolog protein of a target protein using informatics include, for example, (i) using a base sequence of a target cDNA as a query, A homology search using BLAST etc. against cDNA databases (including cDNA databases predicted by informatics), and (ii) querying the base sequence of the target cDNA
  • a homology search is performed using an EST database such as humans by using BLAST or the like, and the sequence of the hit EST is linked to the base sequence of the target cDNA, and the method is further described in (iii.
  • Salt of desired cDNA Using the base sequence as a query, a homology search is performed using a BLAST or the like on a genomic database such as human to identify the position on the genome where the cDNA gene of interest exists, enscan (http: ⁇ genes.
  • a human homologous protein corresponding to the protein encoded by the nucleotide sequence of SEQ ID NOS: 1 to 7 is coded from the above human cDNA library. You can also obtain cDNA.
  • a specific acquisition method for example, using the primers having a nucleotide sequence complementary to the nucleotide sequence at the 5 'end and 3' end of the predicted human homolog DNA, And a method in which a part of the predicted human homolog DNA sequence is used as a probe to perform hybridization on one of the above human cDNA libraries.
  • a similar gene having a nucleotide sequence having the highest homologous nucleotide sequence to the nucleotide sequence of the target gene is referred to as a “homolog”, and the above-mentioned method also aims to obtain a human homolog. It is important to confirm not only that the nucleotide sequences are similar, but also that the gene obtained as a homolog is a family member of the target gene. Genes acquired as “homologs” between two species of organisms are likely to be “orthologs”, which are the same genes evolved from a common ancestral gene, and also arise from duplication from a common ancestral gene It may be a different gene, a “paralog”.
  • human-derived DNA obtained as a homolog above In order to understand that the protein has the same function as the protein of the present invention, and to estimate and verify the function of the protein encoded by the DNA derived from the human as the function of the protein of the present invention in mice, It is preferable to confirm that the homolog is an ortholog of a closely related species of the mouse gene of the present invention.
  • the following method is used as a method for confirming the ortholog.
  • (2) homology is analyzed for the nucleotide sequence of the obtained human homolog DNA and the corresponding nucleotide sequence of the cDNA of the present invention.
  • homology search was performed on the mouse nucleotide sequence contained in the international nucleotide sequence database such as DDB J, EMBL, GenBank, etc. Confirm that the degree of matching between the cDNA and the base sequence of the query is higher than the degree of matching between the base sequence obtained from the database and the base sequence of the query.
  • the homology analysis described in (1) and (2) above may be performed by comparing amino acid sequences, or by drawing a molecular evolutionary phylogenetic tree. In addition, it is preferable that the homology analysis described in (1) and (2) above be analyzed as the degree of coincidence over the entire length of the query.
  • the function of the protein encoded by the nucleotide sequence can be estimated and determined. Can be confirmed ⁇
  • the base sequence of the DNA is converted into amino acids by three types of reading frames, and the range in which the longest polypeptide is encoded is defined by the present invention.
  • its amino acid sequence can be deduced as a translation region. Examples of such an amino acid sequence include those described in SEQ ID NOs: 8 to 14, 25 or 26.
  • the protein of the present invention is not limited to the above amino acid sequence, but comprises an amino acid sequence in which one or several amino acids have been substituted, deleted and / or added in the amino acid sequence; and Those having phosphatase activity are also included.
  • the method of transcription and translation of the DNA of the present invention described in (1) by an appropriate method is preferably used.
  • a recombinant vector inserted with a suitable promoter into a suitable expression vector or a suitable vector is prepared, and a suitable host microorganism is transformed with the recombinant vector, or a suitable culture is performed. It can be expressed by introducing it into cells, and can be obtained by purifying it.
  • the protein thus obtained when the protein thus obtained is obtained in a free form, it can be converted to a salt by a known method or a method analogous thereto, and conversely, when the protein is obtained in a salt form, the free form or another salt Can be converted to Such salts of the protein of the present invention are also included in the protein of the present invention.
  • the protein produced by the above transformant may be modified before or after purification with an appropriate protein modifying enzyme to optionally modify the protein or partially remove the polypeptide to modify the protein. Quality.
  • modified proteins are also included in the scope of the present invention as long as they have the phosphatase activity described above.
  • a vector used for producing a recombinant vector containing the DNA of the present invention is one that expresses the DNA in a transformant.
  • a plasmid vector or a phage vector There is no particular limitation as long as it is a plasmid vector or a phage vector.
  • a commercially available protein expression vector into which an expression control region DNA such as a promoter suitable for a host into which the DNA is introduced has already been inserted is used.
  • Specific examples of such a protein expression vector include, when the host is Escherichia coli, pET3, pETll (manufactured by Stratagene) GEX (manufactured by Amersham Armacia Biotech), and yeast.
  • p ESP-I expression vector manufactured by Stratagene
  • Bac PAK6 manufactured by Clontech
  • examples include ZAP Express (manufactured by Stratagene), p SV K3 (manufactured by Amersham Pharmacia Biotech) and the like.
  • the promoter used herein may be a promoter contained in a host microorganism or a cultured cell, but is not limited thereto.
  • the host is Escherichia coli, T3, T7, tac , 1 ac promoter and the like.
  • the nmt1 promoter, Ga11 promoter and the like can be used.
  • the host is an animal cell, SV40 promoter, CMV promoter and the like are preferably used.
  • a promoter specific to the gene of the present invention can also be used. Insertion of the DNA of the present invention into these vectors may be performed by linking the DNA or a DNA fragment containing the DNA to the amino acid sequence of the protein encoded by the gene DNA downstream of the open motor in the vector.
  • the recombinant vector thus prepared can be transformed into a host described below by a method known per se to prepare a DNA-introduced body.
  • Examples of the method of introducing the vector into a host include a heat shock method (J. Mol. Biol., 53, 154, (1970)), a calcium phosphate method (Science, 221,551, (1983)), DEAE Dext Run method (Science, 215, 166, (1982)), in vitro packaging method (Proc. Natl. Acad. Sci. USA, 72, 581, (1975)), virus vector method (Cell, 37, 1053, ( 1984)), and the electric pulse method (Chu. Et al., Nuc. Acids Res., 15, 1331 (1987)).
  • the host for preparing the DNA transfectant is not particularly limited as long as the DNA of the present invention is expressed in the body.
  • the host include Escherichia coli, yeast, baculovirus (arthropod polyhedrovirus), insect cells, Alternatively, animal cells and the like can be mentioned.
  • BL21 and XL-2B1ue manufactured by Stratagene
  • SP-Q01 manufactured by Stratagene
  • AcNPV AcNPV for baculovirus.
  • a homologous recombination technique for directly inserting a promoter-ligated DNA fragment of the present invention into the chromosome of a host microorganism (AA Vertes et al., Biosci. Biotechnol . Biochera., 57, 2036,
  • a transposon or an inserted sequence (AA Vertes et al., Molecular Microbiol., 11, 739, (1994)) can be used to prepare a DNA transductant.
  • the resulting culture is harvested by centrifugation or the like to collect cells or cells, suspended in an appropriate buffer, and then subjected to an appropriate method known per se such as ultrasonication, lysozyme, and / or freeze-thawing. After the disruption, a crude protein solution is obtained by centrifugation, filtration, or the like, and further purified by a combination of appropriate purification methods. Thus, the protein of the present invention is obtained.
  • protein expression is induced by subjecting the DNA of the present invention obtained in (1) above to a cell-free transcription / translation system. You can get protein.
  • the cell-free transcription / translation system used in the present invention includes:
  • Specific examples of the cell-free transcription / translation system include a transcription / translation system prepared based on an eukaryotic cell, a bacterial cell, or an extract from a part thereof, and a particularly preferred example is Egret A transcription / translation system prepared based on an extract from reticulocytes, wheat germ, or E. coli (E. coli S30 extract) may be mentioned.
  • Separation and purification of the protein of the present invention from the obtained transcription-translation product of the cell-free transcription / translation system can be carried out by a commonly used method known per se. Specifically, for example, a DNA region encoding an epitope peptide, a polyhistidine peptide, daltathione-1S-transferase (GST), a maltose binding protein, or the like is introduced into the DNA to be transcribed and translated as described above. It can be expressed and purified using the affinity of the protein with a substance having affinity.
  • GST daltathione-1S-transferase
  • the expression of the target protein is separated by SDS-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (manufactured by Sigma), or an antibody that specifically binds to the protein of the present invention described below. Can be confirmed by the detection method. It is generally known that the expressed protein is cleaved (processed) by a proteolytic enzyme present in the living body.
  • the protein of the present invention is naturally included in the protein of the present invention as long as it has a phosphatase activity, even if it is a partial fragment of the cleaved amino acid sequence. By analyzing the interaction between the protein thus obtained and other proteins and DNA, it is possible to know the multifunctionality in vivo.
  • a conventional method known per se can be used. Specifically, for example, a yeast two-hybrid method, a fluorescence depolarization method, a surface plasmon method, a phage display method, A marspray method and the like can be mentioned.
  • an antisense having a partial sequence of the DNA of the present invention an oligonucleotide, a sense ⁇ Oligonucleotides such as oligonucleotides can be prepared.
  • the oligonucleotide examples include a DNA having the same sequence as the consecutive 5 to 100 bases in the nucleotide sequence of the DNA or a DNA having a sequence complementary to the DNA.
  • the above oligonucleotides in which the melting temperature (Tm) and the number of bases of both do not extremely change are preferable.
  • the length of the sequence is generally from 5 to 100 bases, preferably from 10 to 60 bases, and more preferably from 15 to 50 bases.
  • oligonucleotide derivatives of these oligonucleotides can also be used as the oligonucleotide of the present invention.
  • the oligonucleotide derivative include an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and a phosphodiester bond in an oligonucleotide that is converted to an N3, -P5 'phosphoramidate bond.
  • RNA interference method can be applied to the RNA interference method by preparing it as a double-stranded RA.
  • Methods for preparing double-stranded RA and RNA interference are described in, for example, (Elbashir, S., et al., Nature, 411, 494- 498 (2001)).
  • the double-stranded RNA does not need to be all RNA.
  • the DNA described in WO02Z10374 can be used as a part of the DNA.
  • the target gene may be any target DNA as long as it is the DNA of the present invention.
  • a double-stranded polynucleotide consisting of RNA having a sequence substantially identical to at least a part of the base sequence of these DNAs (hereinafter sometimes referred to as “double-stranded polynucleotide”) is a target gene. It is composed of a sequence substantially identical to a sequence of 15 bp or more, which may be any portion of the base sequence.
  • substantially the same means that it has 80% or more homology with the sequence of the target gene.
  • the nucleotide length may be any length from 15 bp to the full length of the open reading frame (0RF) of the target gene, but a length of about 15 to 50 Obp is preferably used.
  • mammalian-derived cells have a signal transduction system that activates in response to long double-stranded RNA of 3 Obp or more.
  • a double-stranded polynucleotide of 15 to 30 bp, preferably 19 to 24 bp, most preferably 2 lbp It is preferable to use.
  • the double-stranded polynucleotide does not need to be entirely double-stranded, and may include 5, 3, or 3, partially protruding ends. preferable.
  • the double-stranded polynucleotide means a double-stranded polynucleotide having complementarity, but may be a self-annealed single-stranded polynucleotide having self-complementarity.
  • Examples of the single-stranded polynucleotide having self-complementarity include those having an inverted repeat sequence.
  • the method for preparing the double-stranded polynucleotide is not particularly limited, but it is preferable to use a chemical synthesis method known per se.
  • chemical synthesis a single-stranded polynucleotide having complementarity can be separately synthesized, and can be converted into a double-stranded strand by associating them by an appropriate method.
  • Examples of the method of association include a method in which the above polynucleotides are mixed, heated to a temperature at which the double strand dissociates, and then gradually cooled.
  • the associated double-stranded polynucleotide is confirmed using an agarose gel or the like, and the remaining single-stranded polynucleotide is removed by, for example, decomposing with a suitable enzyme.
  • the transfectant into which the double-stranded polynucleotide prepared in this way is introduced may be any as long as the target gene can be transcribed into RNA or translated into protein in the cell.
  • Specific examples include those belonging to plant, animal, protozoan, viral, bacterial, or fungal species.
  • the plant may be a monocotyledonous, dicotyledonous or gymnosperm, and the animal may be a vertebrate or invertebrate.
  • Preferred microorganisms are those used in agriculture or by industry and are pathogenic to plants or animals. Fungi include organisms in both mold and yeast forms.
  • vertebrates examples include fish, sea lions, goats, Includes mammals, including pigs, sheep, hamsters, mice, rats and humans; invertebrates include nematodes and other reptiles, Drosophi la and other insects Is included.
  • the cells are vertebrate cells.
  • the transductant means a cell, tissue, or individual.
  • the cell may be from a germ line or somatic, totipotent or pluripotent, divided or undivided, parenchymal or epithelial, immortalized or transformed, and the like.
  • the cells may be gametes or embryos, in the case of embryos, single cell embryos or constitutive cells, or cells from multicellular embryos, including fetal tissue. Further, they may be undifferentiated cells, such as stem cells, or differentiated cells, such as from cells of an organ or tissue, including fetal tissue, or any other cells present in an organism.
  • Differentiating cell types include lunar fat cells, fibroblasts, muscle cells, cardiomyocytes, endothelial cells, neurons, glial, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, and eosinophils Includes spheres, basophils, mast cells, leukocytes, granulocytes, keratinocytes, osteoblasts, osteoclasts, liver cells and cells of the endocrine or exocrine glands.
  • Methods for introducing a double-stranded polynucleotide into a recipient include, when the recipient is a cell or a tissue, a calcium phosphate method, an electroporation method, a lipofection method, a viral infection, or a double-stranded polynucleotide. Immersion in a polynucleotide solution or a transformation method is used. Examples of a method for introducing the gene into an embryo include microinjection, electoral poration, and viral infection. When the recipient is a plant, a method of injecting or perfusing the plant into the body cavity or stromal cells, or spraying is used.
  • the double-stranded polynucleotide can be mixed directly with the food of the organism.
  • it can also be administered, for example, by administration as a long-term release preparation containing a carrier, or by ingesting an introduced body into which a double-stranded polynucleotide has been introduced.
  • the amount of the double-stranded polynucleotide to be introduced can be appropriately selected depending on the introduced substance and the target gene, but it is preferable to introduce an amount sufficient to introduce at least one copy per cell. Specifically, for example, when the transfectant is a cultured human cell and the double-stranded polynucleotide is introduced by the calcium phosphate method, 0.1 to: L0OnM is preferred.
  • the function of the protein encoded by the gene of the present invention can be confirmed, or a new function can be analyzed.
  • an antibody that specifically binds to the protein of the present invention As a method for preparing an antibody that specifically binds to the protein of the present invention, a commonly used known method can be used.
  • the polypeptide used as an antigen also has high antigenicity according to a known method, and can be used for epitope ( An appropriate sequence can be selected and used as the antigenic determinant.
  • An appropriate sequence can be selected and used as the antigenic determinant.
  • commercially available software such as Epitope Adviser (manufactured by Fujitsu Kyushu System Engineering Co., Ltd.) can be used.
  • polypeptide used as the above antigen a synthetic peptide synthesized according to a known method or the protein itself of the present invention can be used.
  • a polypeptide serving as an antigen may be prepared in an appropriate solution or the like according to a known method and immunized to a mammal, for example, a heron, a mouse, a rat, or the like.
  • an antigen peptide in a conjugate with a suitable carrier protein or to add an adjuvant or the like to perform immunization.
  • the route of administration of the antigen upon immunization is not particularly limited, and any route such as subcutaneous, intraperitoneal, intravenous, or intramuscular route may be used. Specifically, for example, a method of inoculating BALB mice several times every several days to several weeks with an antigen polypeptide is used.
  • the antigen intake is preferably about 0.3 to 0.5 mg times when the antigen is a polypeptide, but depending on the type of the polypeptide and the animal species to be immunized. It is adjusted appropriately.
  • test blood is collected as appropriate, and an increase in antibody titer is confirmed by enzyme-linked immunosorbent assay (hereinafter sometimes referred to as “ELISA”) or Western blotting.
  • ELISA enzyme-linked immunosorbent assay
  • Blood is collected from animals with elevated antibody titers.
  • a polyclonal antibody can be obtained by subjecting this to an appropriate treatment used for antibody preparation. Specifically, for example, a method of obtaining a purified antibody obtained by purifying an antibody component from serum according to a known method, and the like can be mentioned.
  • the antibody component can be purified by a method such as iontophoresis, ion exchange chromatography, affinity chromatography, and the like.
  • a monoclonal antibody can be produced by using a hybridoma fused with spleen cells and myeloma cells of the animal according to a known method (Milstein, et al., Nature, 256, 495 (1975)). it can.
  • a monoclonal antibody can be obtained, for example, by the following method.
  • antibody-producing cells are obtained from an animal whose antibody titer has been raised by immunization with the above-mentioned antigen.
  • the antibody-producing cells are plasma cells and lymphocytes which are precursor cells thereof, which may be obtained from any of the individuals, but is preferably obtained from spleen, lymph nodes, peripheral blood and the like.
  • the myeloma to be fused with these cells is generally a cell line obtained from a mouse, for example, an 8-azaguanine-resistant mouse (such as BALB / c-derived) myeloma cell line, P3X63-Ag8.65 (ATCC: CRL-1580), P3-NSl / lAg4.1 (RIKEN cell bank: RCB0095) and the like are preferably used.
  • an appropriate cell fusion medium such as RPMI1640, Iskov's modified Dulbecco's medium (IMDM), or Dulbecco's modified Eagle's medium is used.
  • DMEM polyethylene glycol
  • PEG polyethylene glycol
  • High Priestess dormer is myeloma cell line 8 Azaguanin resistance by utilizing the fact that a strain suitable amount of hypoxanthine 'aminopterin' thymidine (HAT) solution in including normal medium (HAT medium) 5% C0 2 using Select by culturing at 37 ° C for an appropriate time can do.
  • HAT hypoxanthine 'aminopterin' thymidine
  • HAT medium normal medium
  • Select by culturing at 37 ° C for an appropriate time can do.
  • This selection method can be appropriately selected and used depending on the myeloma cell line to be used.
  • the antibody titer of the antibody produced by the selected hybridoma is analyzed by the above-described method, the hybridoma producing the antibody with a high antibody titer is separated by limiting dilution, etc., and the separated fused cells are cultured in an appropriate medium.
  • the monoclonal antibody can be obtained by purifying the culture supernatant obtained by culturing by an appropriate method such as ammonium sulfate fractionation and affinity chromatography. For purification, a commercially available monoclonal antibody purification kit can also be used. Furthermore, ascites containing a large amount of the monoclonal antibody of the present invention can be obtained by growing the antibody-producing hybridoma obtained above in an animal of the same strain as the immunized animal or in the abdominal cavity of a nude mouse or the like. it can.
  • human peripheral blood lymphocytes are transplanted using the polypeptide or a partial peptide thereof as an antigen to obtain a Severe combined immune deficiency (SCID) mouse.
  • SCID Severe combined immune deficiency
  • a human antibody can also be prepared by immunizing the animal with the above method and
  • RNA is extracted from the obtained hybridoma producing the human antibody, the gene encoding the desired human antibody is cloned, this gene is inserted into an appropriate vector, and this is inserted into an appropriate host.
  • a human antibody can be produced in a larger amount by introducing the gene into the gene and expressing it.
  • an antibody having a low binding property to the antigen can be obtained as an antibody having a higher binding property by using an evolutionary engineering technique known per se.
  • a partial fragment such as a monovalent antibody can be prepared by, for example, cleaving the Fab portion and the Fc portion using papain or the like, and recovering the Fab portion using an affinity column or the like.
  • the thus-obtained antibody that specifically binds to the protein of the present invention binds to the phosphatase contained in the protein of the present invention by specifically binding to the protein of the present invention. It can also be used as a neutralizing antibody that inhibits the activity.
  • a neutralizing antibody that inhibits the activity There is no particular limitation on the method of selecting a substance that inhibits the activity of the protein, but, for example, whether the function of the target protein in the transfectant is inhibited by contacting the antibody with the DNA transfectant prepared in (2) above And a method of analyzing the above.
  • Such a neutralizing antibody can be used alone for the clinical application, but can also be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • Such drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups for oral administration, or injections, drops, ribosomes, Parenteral administration with suppositories and the like can be mentioned. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like.
  • the protein of the present invention is prepared as a recombinant protein as described in (2) above, and by analyzing this, it can be confirmed that it has the activity estimated in (1). Furthermore, analysis can also be performed by combination with the antibody or the like prepared as described in (4) above.
  • the protein of the present invention has phosphatase activity can be confirmed, for example, by bringing an appropriate phosphorylated protein into contact with the recombinant protein and measuring orthophosphate released from the phosphorylated protein by dephosphorylation. Can be done. Specific methods include, for example, the methods described below.
  • phosphoric acid H1 histone is used as a base, 0.2 M sodium chloride is added instead of magnesium acetate.
  • a synthetic phosphopeptide containing the phosphorylation site, phosphorylated serine, threonine, tyrosine and analogs thereof, or phosphatidylinositol can also be used.
  • the phosphatase activity of phosphotyrosine phosphatase 1B can be measured by the following method using a phosphorylated peptide or a phosphorylated compound as a substrate.
  • a protein synthesized from a cDNA in which the PTP 1 B sequence and the glutathione S-transferase sequence were linked via a Pre S cission protease cleavage sequence in a cell-free protein translation system using wheat germ extract was obtained at 15 OmM. Dilute 5 fold with 5 OmM Tris' hydrochloric acid buffer (pH 8.5) containing sodium chloride and 1 mM dithiothreitol, equilibrate with the same buffer, and use glutathione sepharose in 1/2 volume of the protein synthesis reaction solution. B (manufactured by Amersham Pharmacia Biotech) Add to the affinity column at room temperature and adsorb.
  • a 25-fold diluted solution of PreScission protease at 2 units sZ / L in the same buffer is used as the affinity resin.
  • elute PTP 1B with the above buffer solution is quantified using serum albumin as a standard. 200 nM of isolated PTP 1B was placed in 0.1 M acetate buffer (pH 5.5) containing 1 mM EDTA and 150 mM sodium chloride, and added with 600; / 600 paranitrophenyl phosphate as a substrate. After performing the reaction for 15 minutes, the activity can be measured by measuring the absorbance at 405 nm.
  • the activity can be measured using the ultraviolet absorption of the dephosphorylated peptide as an index.
  • the activity can be measured in the same manner using a tyrosine phosphatase assay kit (promega).
  • a phosphorylated peptide substrate amino acid sequence: END (pY) I NASL or DADE (p Y) LI PQQG, where p Y is phosphorylated tyrosine
  • PTP 1B 6 OmM acetate buffer (pH 5.
  • the novel proteins including those identified as splicing variants and having the phosphatase activity should be analyzed for functions other than the phosphatase activity confirmed above. Provides a new use thereof (the protein whose function other than the phosphatase activity is to be further analyzed may be hereinafter referred to as “protein to be analyzed”).
  • protein to be analyzed the protein whose function other than the phosphatase activity is to be further analyzed.
  • the proteins of the present invention include splicing variants of known proteins, it is important to identify how these variants have different functions from known variants.
  • the method for analyzing the function of the protein of the present invention includes, for example, (i) a method for comparatively analyzing the expression state of each tissue, disease, or developmental stage, and (ii) a method for analyzing other proteins.
  • a method for analyzing the interaction with protein or DNA (iii) a method for analyzing the phenotypic change by introduction into an appropriate cell or individual, and (iv) an expression of the protein in an appropriate cell or individual.
  • a method of analyzing a change in phenotype by inhibiting phenotype is analyzed.
  • the expression of the protein of the present invention can be analyzed at the mRNA level or the protein level.
  • the expression level is analyzed at the mRNA level, for example, in situ hybridization (Application to Developmental Biology & Medicine., Ed. by Harris, N. and Wilkinson, DG, Cambridge University Press (1990)), a hybridization method using a DNA chip, a quantitative PCR method, and the like.
  • a tissue staining method using an antibody that specifically binds to the protein of the present invention an ELISA method, a Western blot method, and the like described later are mentioned.
  • the protein to be analyzed is a splicing variant in which a known variant is present
  • the quantitative PCR method a method of selecting primers that can generate amplified fragments of different lengths between the target variant and the known variant
  • the function of the protein of the present invention can be analyzed by examining the presence or absence of interaction between the protein of the present invention and a known protein.
  • a force S that can use a conventional method known per se, specifically, for example, yeast two-hybrid method, fluorescence depolarization method, surface plasmon method, phage display method, ribosome
  • a conventional method known per se specifically, for example, yeast two-hybrid method, fluorescence depolarization method, surface plasmon method, phage display method, ribosome
  • the multiple display method is preferred to identify substances that interact specifically with the elephant protein.
  • the cells into which the cDNA of the present invention is introduced are not particularly limited, but human cultured cells and the like are particularly preferably used. Methods for introducing DNA into cells include those described in (2) above.
  • the phenotype of the transfected cells can be observed with a microscope, such as cell viability, cell growth rate, cell differentiation, neurite outgrowth when cells are neurons, and localization and translocation of intracellular proteins. And those that can be analyzed by biochemical experiments, such as changes in the expression of specific proteins in cells.
  • these phenotypes are splicing variants in which known variants exist, known phenotypes can be similarly introduced into cells, and phenotypes associated with the variants to be analyzed can be identified by comparative analysis.
  • the protein of the present invention has phosphatase activity, it is also preferable to analyze the protein by focusing on the phenotype and the like found in diseases associated with phosphatase.
  • the method can be efficiently carried out by a method using an oligonucleotide described below or an RNA interference method.
  • the target protein to be analyzed is a splicing variant in which a known variant is present, the same analysis is performed for the known variant and other variants, and the target protein is analyzed by comparative analysis. Specific functions can be identified.
  • This method of screening for a regulatory substance may be any method as long as it can obtain a substance that specifically binds to the protein of the present invention and has an activity of inhibiting, antagonizing or enhancing the activity of the protein. .
  • selection is performed using the binding property to the protein as an index, a method of selecting the test substance using the change in the activity of the protein of the present invention as an index can be used. .
  • the test substance may be any substance as long as it interacts with the protein of the present invention and may affect the activity possessed by the protein. , Peptides, proteins, non-peptidic compounds, low-molecular compounds, synthetic compounds, fermentation products, cell extracts, animal tissue extracts, and the like. These substances may be novel substances or known substances.
  • a method for analyzing the interaction between the test substance and the protein of the present invention a conventional method known per se can be used. Specifically, for example, the yeast two-hybrid method, the fluorescence depolarization method, the surface The plasmon method, the phage display method, the liposomal display method, or the competition analysis method with the antibody described in the above (4) can be used.
  • the substance found to bind to the protein of the present invention is then analyzed by analyzing how the activity of the protein of the present invention is affected in the presence of the substance. Whether it is used as a modulator or not is identified.
  • the substance screened by the above method may be selected as a drug candidate by screening in vivo in these organisms.
  • the substrate when analyzing a substance that regulates phosphatase activity, the substrate may be analyzed in the presence or absence of the substance selected in the phosphatase activity measurement method described in (5).
  • the dephosphorylation of the protein, peptide, or compound that results in is analyzed by commonly known methods known per se. If the protein dephosphorylation activity is increased as compared to the absence of the substance, the substance may function as a protein dephosphorylation activator, and if the substance is reduced or inhibited Act as a protein dephosphorylation inhibitor Can be identified.
  • the above-mentioned human homologous protein or orthologous protein for the DNA or recombinant protein of the present invention to be used.
  • the substances screened by the above method may be selected as drug candidates by screening in vivo.
  • Phosphatase like protein kinases, is involved in the regulation of signal transduction.
  • PTP1B phosphotyrosine phosphatase 1B
  • binding of insulin as a ligand causes autophosphorylation of cytosine synthase in cytoplasmic kinase domain, and its signal transduction is started.
  • increased PTP1B activity promotes dephosphorylation of phosphorylated phosphotyrosine, inhibits signal transduction, and eliminates the effects of insulin.
  • Signaling functions on pathways related to cancer Signaling functions on pathways related to myocardial development, Signaling functions on pathways controlling sperm differentiation and motility, Signaling on pathways controlling germ cell differentiation Function, Signal transduction on pathway that controls cell differentiation, Function to generate glycerol triphosphate, Signal transduction on pathway that controls the development, differentiation, proliferation, and survival of neurons, Controls the onset of Alzheimer's disease
  • it is a factor involved in pathway signaling functions that control the development, differentiation, growth, proliferation, survival, regeneration, cell functions, etc. of various cells. Therefore, it can be used as a target for screening for therapeutic agents for various diseases related to these signal transmissions.
  • Book Compounds that can be identified by the leaning method include anticancer agents, anti-inflammatory agents, therapeutic agents for neurodegenerative diseases, therapeutic agents for heart diseases, therapeutic agents for infertility, regenerating tissue inducers, therapeutic agents for Alzheimer's disease, therapeutic agents for obesity, therapeutic agents for diabetes, heart It can be used as a therapeutic agent for vascular diseases, a therapeutic agent for metabolic disorders, a therapeutic agent for anorexia, bulimia, and the like.
  • Such modulators can be used alone as the above active ingredients when applied to clinical applications, but can also be used as pharmaceutical compositions by blending with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • Such drugs can be administered in various forms, such as tablets, capsules, granules, powders, or syrups for oral administration, or injections, drops, ribosomes, Parenteral administration with suppositories and the like can be mentioned. In addition, the dose can be appropriately selected depending on symptoms, age, weight, and the like. (7) Screening of the DNA expression regulator of the present invention
  • Examples of the screening method include a method of analyzing the expression level of the protein of the present invention or the mRNA encoding it in the presence of a test substance.
  • a method of analyzing the expression level of the protein of the present invention or the mRNA encoding it in the presence of a test substance Specifically, for example, cells expressing the protein of the present invention described in (2) are cultured in an appropriate medium containing a test substance, and the amount of the protein of the present invention expressed in the cells is determined by ELISA or the like.
  • the analysis can be carried out by using the conventional method, or by analyzing the amount of mRNA encoding the protein of the present invention in the cells by a quantitative reverse transcription PCR method, a Northern plot method, or the like.
  • test substance those described in (6) can be used. According to this analysis, if the amount of the protein or raRNA expressed in the cells cultured in the absence of the test substance increases relative to the amount of the raRNA, the substance promotes the expression of the DNA of the present invention. When the substance has a possibility of functioning as a substance and is reduced, it can be determined that the substance can be used as a DNA expression inhibitor of the present invention.
  • Such an expression regulating substance uses the above-mentioned active ingredient alone for clinical application.
  • the compound can be used as a pharmaceutical composition by mixing with a pharmaceutically acceptable carrier. At this time, the ratio of the active ingredient to the carrier can be varied between 1 and 90% by weight.
  • the drug can be administered in various forms. Examples of the dosage form include tablet, capsule, granule, powder, syrup, and the like, oral administration, injection, drip, ribosome And parenteral administration with suppositories and the like. The dose can be appropriately selected depending on the condition, age, weight, and the like.
  • the introduced DNA containing the DNA of the present invention described in the above (1) is constructed, introduced into a fertilized egg of a mammal other than human, and transplanted into a female individual uterus to generate the present DNA.
  • a non-human mammal into which the DNA of the present invention has been introduced can be produced. More specifically, for example, a female individual is superovulated by hormone administration, then mated with a male, a fertilized egg is excised from the oviduct on the first day after mating, and the introduced DNA is introduced into the fertilized egg by a microphone. It will be introduced by methods such as induction.
  • the surviving fertilized eggs are transplanted into the uterus of a pseudopregnant female individual (foster parent) to give birth.
  • a pseudopregnant female individual foster parent
  • Whether or not the target DNA has been introduced into the newborn can be identified by performing Southern blot analysis of DNA extracted from cells of the individual. Examples of mammals other than humans include mice, rats, guinea pigs, hamsters, rabbits, goats, pigs, dogs, cats, and the like.
  • the thus-obtained DNA-introduced animal of the present invention is used to breed this individual and subculture them in a normal breeding environment while confirming that the introduced DNA is stably maintained, thereby obtaining the offspring.
  • the offspring can be obtained by repeating in vitro fertilization, and the strain can be maintained.
  • the non-human mammal into which the DNA of the present invention has been introduced can be used as an analysis of the function of the DNA of the present invention in a living body, or as a screening system for a substance regulating the function. (9) Other uses of the protein of the present invention and the DNA containing the nucleotide sequence encoding the same
  • the protein of the present invention can be used as a carrier having it bound on a substrate.
  • a nucleotide sequence encoding the protein of the present invention for example, a DNA having the nucleotide sequence of any one of SEQ ID NOS: 1 to 7, 23 or 24 and a partial fragment thereof are represented by SEQ ID NOs: 8 to 14, 2
  • the protein having the amino acid sequence according to any one of 5 and 26 and a partial fragment thereof can be used as a carrier obtained by binding them on a substrate.
  • proteins may be hereinafter referred to as “protein chips”, “DNA chips” or “DNA arrays” (DNA microarrays and DNA macroarrays).
  • DNA chips, DNA chips or arrays may contain other proteins and DNAs in addition to the protein-DNA of the present invention.
  • a resin substrate such as a nylon film or a polypropylene film, a nitrocellulose film, a glass plate, a silicon plate, or the like is used as a substrate on which proteins and DNAs are bound, but the detection of hybridization is non-RI.
  • a fluorescent substance or the like for example, a glass plate or a silicon plate containing no fluorescent substance is preferably used.
  • the binding of the protein or DNA to the substrate can be easily carried out by a commonly used method known per se.
  • tin chips, DNA chips, or DNA arrays are also included in the scope of the present invention.
  • the amino acid sequence of the protein of the present invention and the nucleotide sequence of DNA can also be used as sequence information.
  • the nucleotide sequence of the DNA of the present invention includes the nucleotide sequence of the corresponding RNA. That is, a database of amino acid sequences and nucleotide sequences can be constructed by storing the obtained amino acid sequences and nucleotide sequences in an appropriate recording medium in a computer-readable predetermined format. This database may include the nucleotide sequences of other types of proteins and the DNA that encodes them. In the present invention, the database also means a computer system that writes the above-mentioned sequence on an appropriate recording medium and searches according to a predetermined program. To taste.
  • Suitable recording media include, for example, magnetic media such as flexible disks, hard disks, and magnetic tapes, optical disks such as CD_ROM, MO, CD-R, CD-RW, DVD-R, DVD-RAM, and semiconductor memories. And so on.
  • magnetic media such as flexible disks, hard disks, and magnetic tapes
  • optical disks such as CD_ROM, MO, CD-R, CD-RW, DVD-R, DVD-RAM, and semiconductor memories. And so on.
  • mRNA-prepared mouse C57B LZ6
  • Each organ or tissue 0.5-: lg is homogenized with a 10 ml suspension, and the same amount of phenol / cloth as 1 ml of 2M sodium acetate at pH 4.0
  • a mixture of mouth form (volume ratio 5: 1) was added for extraction.
  • RNA separated and precipitated from the aqueous phase.
  • the precipitate was collected in a refrigerated centrifuge at 4,000 rpm for 15 minutes.
  • RNA was dissolved in 4 ml of 7 M guanidine_C1 by centrifugation at room temperature for 4 minutes at 15 minutes. After adding 2 volumes of ethanol, the mixture was incubated on ice for 1 hour, centrifuged at 4, OOO rpm for 15 minutes, and the resulting precipitate was washed with 70% ethanol to collect RNA. And the purity of the RNA was determined by reading the OD ratios 260/280 (> 1.8) and 230/260 ( ⁇ 0.45).
  • RNase-free water RNase-free water
  • Biotinylation of RNA diol A two-step reaction was performed to bind biotin to the diol site of RNA (present at both the 5 'end of the Cap structure and the 3' end of the poly A chain at the ribose). went. These are the oxidation of the diol group followed by the coupling reaction of biotin hydrazide with the oxidized RNA. First, 15 ⁇ g of the RNA-first strand cDNA complex obtained by the reverse transcription reaction was mixed with 6.6 mM sodium acetate buffer (PH4.5) and sodium periodate as an oxidizing agent. Processing was performed in ⁇ 1 of the reaction solution. This oxidation reaction was performed on ice for 45 minutes under light-shielded conditions.
  • RNA-DNA complex obtained in (3) above was treated with RNase I, which digests single-stranded RNA, so that complete cDNA extension was not obtained during the reverse transcription reaction. , And a labeled biotin residue at the 3, terminus of the mRNA were removed.
  • RNase I RNase I
  • lO XRNase I buffer 10 OmM Tris-HCl (pH 7.5), 5 OmM EDTA, 2 M NaOAc
  • Beads capturing the full-length cDNA were washed 4 times with a solution of 5 OmM EDTA and 2 M NaCl, 0.4% SDS, 50 ⁇ g / ⁇ l once with yeast tRNA, and 1 OmM NaC 1 , 0.2 mM EDTA, 1 OmMT ris_HCl (pH 7.5), once with 20% glycerol, 50 ⁇ l once with yeast tRNA aqueous solution, RNase H buffer (2 OmMT ris—HC 1 (pH 7.5), 1 OmM
  • the single-stranded full-length cDNA recovered in this manner is extracted with phenol black-mouthed form, and the volume of the solution is reduced to 100 // // or less with a speed bag, followed by G25ZGlOOS ephadex chromatography. Attached. Fractions having RI activity were collected in a silicon-treated microtube, and 2 ⁇ g of glycogen was added. The precipitate obtained by ethanol precipitation was dissolved in 30 ⁇ l of ultrapure water.
  • the second-strand cDNA in which the first-strand cDNA was converted into a type II was performed as follows.
  • the second strand low buffer (20 OmM T ris- HC 1 ( p H8. 75), 1 0 OmM KC 1, 1 0 OmM (NH 4) 2 S0 4, 20 mM Mg SO 4 , l% Triton X-100, l mg / ⁇ l BSA) 3 ⁇
  • second strand high buffer 200 mM Tris-HC1 (pH 9.2), 60 OmM KCl, 20 mM M g C 1 2) 3 ⁇ 1, d CTP, d AT P, d TTP, (10 Ding? each 0.
  • Second-strand cDNA was synthesized using 5 units, 150 units of thermostable DNA ligase (Amp1 igase; E picentre) and 3 units of metabolic RNase H (Hybridase; E picentre).
  • the double-stranded full-length cDNA obtained by the above method was inserted into a LZAPIII vector, and collected as a library.
  • the ⁇ ⁇ II vector is obtained by modifying SEQ ID NO: 17 which is a partial sequence of a multi-cloning site of ⁇ ⁇ ⁇ I (manufactured by STRATAGENE) vector into SEQ ID NO: 18 to obtain two Sfi I sites. Is newly introduced.
  • RI KEN LPS (RI KEN) vector
  • ⁇ PS RI KEN
  • ⁇ — FLC-1 What is FLC FULL— LENGTH c DNA
  • BamHI and Sa1I which are convenient for cDNA insertion, are introduced into cloning sites located on both sides of lOkbbpstuffer, respectively, and cDNA from 0.5 kb to about 13 kb is cloned. 6 kb DNA fragment inserted into Xba I site
  • RNA driver The mRNA prepared in Example 1 (1) (hereinafter, this may be referred to as "(a) RNA driver”) and the RNA prepared by the invitro transcription reaction were used as drivers.
  • the latter RNA is further divided into two types (hereinafter referred to as “(b) RNA driver” and “(c) RNA driver”).
  • cDNA was recovered from RNA-cDNA removed by normalization and cloned into a phage vector. After infection with Escherichia coli, 1000 to 2000 plaques are mixed per starting material into one library (mini-library) and converted to plasmid DNA by a conventional method. (The phage is infected again with E. coli together with helper phage.) Phagemid, and re-infected to obtain plasmid DNA).
  • RNA driver RNA driver.
  • a mini-library is created from each of nine types of tissues (pancreas, liver, lung, kidney, brain, spleen, testes, small intestine, stomach), and the nine types of mini-libraries are mixed. To obtain RNA.
  • RNA is cultured from a library (about 20,000 clones) that has already been stored as a non-overlapping clone, and the resulting DNA is subjected to (b) in vitro transcription reaction in the same manner as the RNA driver (c ) RNA driver was selected.
  • RNAs were labeled with biotin using the Label-ITB iotin Labeling Kit (manufactured by Mirus Corporation), and then added to tester cDNA at a ratio of 1: 1: 1. The reaction was performed at Rot 10 (42 ° C), and the second strand was synthesized from the supernatant collected after the treatment with streptavidin beads (CPG).
  • CPG streptavidin beads
  • One representative clone was selected from each cluster. Representative clones were selected using Q-bot (manufactured by GENETIXLIMITED), and were transformed into 384-well plates. At that time, E. coli was cultured in 50 ⁇ l of L ⁇ medium at 30 ° C for 18 to 24 hours. At this time, if the cDNA library has been introduced into the PS vector and E. coli DH10 ⁇ has been transformed, 10 OmgZm1 of ampicillin and 50 mg Zm1 of kanamycin are added and introduced into the Zap vector, When introduced into the SOLR system, 10 Omg / Zm 1 of ampicillin and 25 mg / m 1 of streptavidin were added.
  • Each clone cultured in (1) above is further cultured in 1.3 ml HT solution containing 10 Omg / m1 ampicillin, and after collecting cells by centrifugation, Q Plasmid DNA was recovered and purified using I Aprep 96 Turbo (manufactured by QIAGEN). In order to determine the length of the cDNA inserted into the obtained plasmid, 130 of the plasmid DNA obtained above was replaced with the restriction enzyme Pvu.
  • Plasmids were also divided into two categories: those with insertion sequences shorter than 2.5 kb and those with longer insertion sequences. Of these clones, the clone having an insertion sequence shorter than 2.5 kb was analyzed for the nucleotide sequence from both ends. At that time, the plasmid was prepared using the primers of SEQ ID NO: 19 (sense strand) and 20 (antisense strand) when the vector was PS, and SEQ ID NO: 21 (sense strand) when the vector was ZaP.
  • AB IP ris m377 and Z or AB IP ri sm3700 manufactured by Aplied B iosyst ems Inc.
  • Blg D yete rm inatorkit Blg D yete rm inatorkit
  • Cyclic Sequencing FS ready R eaction Kit Applied B iosyst ern
  • sequencing of clones having an inserted cDNA longer than 2.5 kb was performed by the shotgun method.
  • Shimadzu RISA 384 and 0 ⁇ Enam1cTeterminatorcyclesequencing kit manufactured by Amersham Pharmacia Biotech
  • 48 independent representative clones to create a shotgun library From this, 48 DNA fragments that were propagated by PCR were used. The ends of the amplified DNA fragments were blunt-ended with T4 DNA polymerase.
  • This DNA fragment was inserted into a pUC18 vector, and Escherichia coli DH10B was transformed with the recombinant vector. Plasmid was prepared from this E. coli in the same manner as in (2) above.
  • the base sequence is determined by base sequence analysis from both ends, and the base sequences are ligated on a computer, and then double-stroke-nearing device (t ⁇ orein c.). Nucleotide sequencing by the shotgun method was performed with duplication of 12 to 15 clones. The gap whose sequence could not be determined by the nucleotide sequence determination was determined by primer walking in the same manner as described above.
  • dnafo rm31429 was composed of 2554 bases, of which base numbers 296 to 1414 had an open reading frame (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 372 amino acid residues (SEQ ID NO: 8).
  • a homology search was performed using the BLAST for the amino acid sequence encoded by SEQ ID NO: 1.
  • the SPTR protein database SWISS—PROT protein sequence database and TrEMBL nucleic acid translation database integrated
  • P40371 Protein phospnatase 2C homolog 1 ( Schizosaccharomyces pombe; force 3 ⁇ 4, e- va
  • the protein (i) may be involved in the heat shock reaction based on literature information (Mol. Cell. Biol. 14: 3742-3751 (1994)) in the database.
  • the protein (ii) may be Literature information in (Mol. Cell. Biol.
  • amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1 was subjected to a protein feature search using HMM PFAM.
  • amino acid sequence encoded by nucleotide numbers 572 to 1312 in SEQ ID NO: 1 showed a sequence (pf am sequence as PP2C).
  • dnaform60475 was composed of 2477 bases, of which base numbers 243 to 2105 were an open reading frame (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 620 amino acid residues (SEQ ID NO: 9).
  • a homology search was performed using BLAST for the amino acid sequence encoded by SEQ ID NO: 2, and it was found in the SPTR protein database (integrated SWI SS-PROT protein sequence database and TrEMBL nucleic acid translation database).
  • SPTR protein database integrated SWI SS-PROT protein sequence database and TrEMBL nucleic acid translation database.
  • amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 2 was searched for protein characteristics using HMM PFAM.
  • amino acid sequence encoded by nucleotide numbers 762-2054 in SEQ ID NO: 2 showed a sequence (P sequence which is entered as PP2C in f am ).
  • dnafor m48918 was composed of 2683 bases, of which base numbers 83 to 1570 had an open reading frame (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 496 amino acid residues (SEQ ID NO: 10).
  • a homology search was performed on the amino acid sequence encoded by SEQ ID NO: 3 using BLAST. The results were in the S PTR protein database (integrated swi SS-PROT protein sequence database and Tr EMB L nucleic acid translation database).
  • a database registration symbol 031457 Protein ybfQ (Bacillus subtilis) is, e- value: with 2 X 10- 41, with 33% degree of coincidence over 301 ⁇ amino acid residues, also (ii) a database registration symbol Q9PJB6, protein TC0916 (Chlamydia muridarura) power e- value: at 5 X 10- 37, 35% degree of coincidence over the 296 amino acid residues, yet (iii) a database registration mark Q97T60, protein SP0095 (Arabidopsis thaliana), e-value: 5 X 10- ° 4 , with 31% identity over 121 amino acid residues. From these results, it was inferred that the protein consisting of the amino acid sequence shown in SEQ ID NO: 10 was a phosphatase.
  • amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 3 was subjected to protein characteristic search using HMM PFAM. As a result, the amino acid sequence encoded by nucleotides 959 to 1249 in SEQ ID NO: 3 showed a sequence (pf am
  • dnafo rm45743 consists of 3473 bases, as shown in SEQ ID NO: 4, of which base numbers 155 to 3472 have an open reading frame (a stop codon does not appear, and 3472 is the third base of the last codon in the base sequence). Has become).
  • the amino acid sequence predicted from the open reading frame consists of 1105 amino acid residues (SEQ ID NO: 11).
  • a homology search was performed for the amino acid sequence encoded by SEQ ID NO: 4 using BLAST. The homology was found in the SPTR protein database (SW ISS—PROT protein sequence database and TrEMBL nucleic acid translation database integrated). , (I) Database registration code Q9NZW4, Dentin
  • the protein consisting of the amino acid sequence shown in SEQ ID NO: 11 was phosphatase.
  • the protein of (i) may be involved in dentin generation based on literature information (Nat. Genet. 27: 201-204 (2001)) in the database, and the protein of (ii) may be From the literature information in the database (J. Biol. Chem. 270: 14587-14596 (1995)), it is implicated in the regulation of mitotic signal transduction. Information (J. Biol. Chem. 269: 30828-30834 (1994)) has revealed that each is involved in promoting protein folding.
  • dnafo rm65509 consists of 1104 bases, of which base numbers 98 to 745 constitute an open reading frame (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 215 amino acid residues (SEQ ID NO: 12).
  • a homology search was performed using BLAST for the amino acid sequence encoded by SEQ ID NO: 5, and the SPTR protein database (SWI SS—PROT protein sequence database and the TrEMBL nucleic acid translation database were integrated).
  • the protein of (i) is involved in the regulation of mitosis based on the literature information in the database (Biochem. J. 344: 819-825 (1999)), and the protein of (iii) is From the information in the literature (J. Neurosci. 15: 274-283 (1995)), it has been clarified that it is involved in the uptake of calcium ions into cells.
  • amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 5 was subjected to protein characteristic search using HMM PFAM.
  • amino acid sequence encoded by nucleotides 254 to 691 in SEQ ID NO: 6 showed a sequence (P fam).
  • dnafor m28618 was composed of 3298 bases, of which base numbers 46 to 1053 were open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 335 amino acid residues (SEQ ID NO: 13).
  • a homology search was performed using BLAST on the amino acid sequence encoded by SEQ ID NO: 6, and it was found in the S PTR protein database (integrated swi SS-PROT protein sequence database and Tr EMB L nucleic acid translation database).
  • a database registration mark Q9Z2C5 Myotubularin is, e- va 1 ue: in 2 X 1 (T 16, in 39% of the degree of coincidence over the 136 amino acid residues, also (ii) a database registration mark Q22712, 105.4 kDa protein T24A11, e - ⁇ a 1 ue: in 2 X 1 CT 9, 38% degree of coincidence over the 90 amino acid residues, and La (iii) a database registration mark P02466, Collagen alpha 2 (1) chain precursor. However, in e-va 1 ue: 1.7, a hit was obtained with a 40% coincidence over 80 amino acid residues. From these results, it was inferred that the protein consisting of the amino acid sequence shown in SEQ ID NO: 13 was a phosphatase.
  • the protein (i) is involved in signal transduction based on literature information (Hura. Mol. Genet. 7: 1703-1712 (1998)) in the database, and the literature information (Curr. Biol. 13 (6) 504-509 (2003)) that the protein is phosphoinositide phosphatase.
  • PtdIns3P phosphatidylinositol 3-phosphate
  • dnaform m52812 was composed of 2194 bases, of which base numbers 77 to 1855 were open reading frames (including a stop codon).
  • the amino acid sequence predicted from the open reading frame consists of 592 amino acid residues (SEQ ID NO: 14).
  • a homology search using BLAST was performed on the amino acid sequence encoded by SEQ ID NO: 7, and it was found in the SPTR protein database (integrated swi SS-PROT protein sequence database and TrEMBL nucleic acid translation database).
  • the protein of the above (i) is obtained from the literature information (Biochemistry 39: 2572-2580 (2000)) and that it is involved in the induction of apoptosis by Fas antigen, and that the protein of (ii) is described in the literature information in the database (Arch. Biochem. Biophys. 330: 229-237 ( 1996)) is involved in the binding of the skeletal structure to the plasma membrane, and the above-mentioned protein (iii) is derived from the literature information in the database (Biochim. Biophys. Acta 1216: 479-482 (1993)). It has been clarified that each is involved in the binding of actin to the membrane.
  • the protein encoded by the cDNA clone was synthesized using a cell-free protein synthesis system, and whether or not the protein had phosphatase activity was determined by the following biochemical I prayed by experiment.
  • the ORF fragment of the cDNA clone presumed to have phosphatase activity in Example 3 was prepared by using the following primers specific to each clone as primers on the 5, side, and the following common primers as primers on the 3 'side: Obtained by the R method.
  • RNA polymerase Promega
  • the method of cell-free protein synthesis using a wheat germ extract by a dialysis method followed the method described previously (Endo, Y. et al., J. Biotech., 25: 221-230 (1992)).
  • the reaction solution contains 24% of the wheat germ extract by volume and has the following composition according to the method of Erickson et al.
  • the dialysate was centrifuged at 1,600 rpm for 5 minutes, and the supernatant was separated.
  • This supernatant was diluted 5-fold with 50 mM Tris-HCl buffer (pH 8.5) containing 15 OmM sodium chloride and 1 OmM dithiothreitol, and then affinity buffered with the same buffer.
  • Glutathione Sepharose 4B (manufactured by Araersham Pharmacia Biotech) was added to an affinity column packed at room temperature to adsorb the target protein.
  • an affinity resin of 12 volumes of the obtained centrifugal supernatant was used for the column.
  • the column was washed with 2 units / ⁇ 1 concentration of PreScission protease (manufactured by Amersham Biosciences) in the same buffer.
  • the 5-fold diluted solution was added in the same volume as the affinity resin, and a cleavage reaction was carried out at 4 ° C. for 40 hours. Then, the target protein was eluted with the above buffer solution.
  • the fraction from which the protein was eluted from the column due to the cleavage of the PreScission protease (elution fraction) and the fraction in which the protein remained adsorbed on the daltathione beads (bead fraction) were subjected to SDS-polyacrylamide gel electrophoresis. Purity analysis was performed by electrophoresis. The protein concentrations of various purified phosphatase preparations were determined by image analysis of the gel after staining with Coomassie Priliant Blue (CBB), using serum albumin (BSA) as a standard.
  • Figure 1 shows the results of analysis by SDS-polyacrylamide gel electrophoresis.
  • Tissue expression analysis was performed as described in Miki, R., et al., Proc. Natl. Acad. Sci. USA, 98, 2199-2204 (2001).
  • the detection sensitivity of this DNA microarray was 1 to 3 copies of mRNA per cell.
  • the signal intensity of clones with approximately 80% match with the target sequence was 1/10 that of clones with perfect sequence match.
  • the signal intensity of clones with less than 80% match with the target sequence was reduced at the background level.
  • the mRNA level (Cy 3 label) in each tissue was expressed as a logarithm (1 og 2 ) of the ratio (Cy 3 ZCy 5) to the control 17.5-day-old fetal whole mRNA level (Cy 5 label). .
  • a positive value if the expression level of mRNA corresponding to the full-length cDNA of each mouse to be analyzed is higher in each tissue than in the control tissue, a positive value; Is indicated by 0.
  • Experiments were performed twice independently to increase the accuracy of the data, and reproducible results were used. The results are shown in Table 2.
  • an increase or decrease of about two-fold is regarded as an experimental error, so if the numerical value of the result is 1 or more, the amount of mRNA in a certain tissue is a control.
  • the amount of mRNA is more than twice as large as that of whole body of 5 day old fetus and significantly increased.Conversely, if the result is less than 11, the amount of mRNA in a certain tissue is This was less than one-half that of the whole fetal mRNA at 17.5 days of age, which was interpreted as significantly reduced.
  • PCR was performed according to a conventional method (Higuchi R, et al., Biotechnology, 11: 1026-30 (1993)). Was used to perform tissue expression analysis.
  • the expression of the following six mRNAs encoding the protein of the present invention was determined using a light cycler constant-quantity PCR device (Roche Diagnostics).
  • Quantification was performed using LightCycler-FastStart DNA Master SYBR Green I reagent according to the protocol attached to the product.
  • the synthetic DNA sequences used for quantitative PCR are shown below.
  • CTCTGCCATGCGMTTTTG SEQ ID NO: 35
  • side primer CAMGTGATTGGTCCGGMG (SEQ ID NO: 39) 3.
  • Side primer TTTCGCACAGTGTCACCATT (SEQ ID NO: 40)
  • 5'-side primer GGCATGGGTTGTTTCCMG (SEQ ID NO: 43)
  • Glyceraldehyde 3-phosphate dehydrogenase Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal standard. That is, the expression level (copy number / ⁇ 1) of the target gene in each tissue is divided by the expression level of GAPDH (copy number / ⁇ 1), and the constant (1 ⁇ 10 6 ) (Note: 10 to the sixth power) is calculated. It was raised and displayed. (See Table 3)
  • dnafo rm28618 was strongly expressed in kidney, lung, and fat, with high levels of expression in tissues examined.
  • dnafo rm31429 was strongly expressed in liver, kidney and brain, and was highly expressed in all tissues examined, but decreased in colon cancer.
  • Expression of dnafo rm45743 was observed in lung, eye and colon, but decreased in colon cancer.
  • dnafo rm48918 was strongly expressed in the knee, and was also strongly expressed in lung, fat, bone marrow and the like.
  • dnafo rm52812 was strongly expressed in lung and knee, and was also strongly expressed in fat, colon and brain.
  • dnaform m65509 was specifically and strongly expressed in the kidney and was also observed in the eyes and lungs, but the expression tended to decrease in diabetic kidney.
  • the cDNA of the clone and the protein encoded by the cDNA can be applied to the treatment and diagnosis of diabetes, cancer and the like. Further, the protein encoded by the cDNA may be involved in a tissue in which the above-mentioned fluctuations in mRNA expression are observed, in a large amount of mRNA expression, or in a tissue-related disease.
  • Table 3 Tissue expression analysis of mouse phosphatase gene using PCR method
  • Two-hybrid experiments on mammalian cells utilized Check Mat Mammalian two-hybridsystem (Prome gaf soil).
  • the sample for protein-protein interaction analysis was a plasmid vector pBIND in which the DNA binding region of the Ga14 gene was inserted downstream of the CMV promoter.
  • a plasmid vector pACT with the transcriptional activation region of the VP16 gene inserted downstream of the CMV promoter, and a plasmid with the reporter luciferase gene inserted downstream of the five Ga14 binding regions and the TATA box. was prepared as type III.
  • a fusion gene of the Ga14 gene and the nucleotide sequence of four mouse full-length cDNAs (dnafo rm45743, dnafo rm489 18, dnafor m60475, dnafo rm65509), and the VP16 gene and mouse cDNA library FAN TOM
  • the fusion gene of the full-length cDNA of each clone with the protein coding sequence is basically a protocol from Promega. And the two-step PCR method was used in combination.
  • mice After PCR-amplifying the protein coding sequence of the DNA using the F13 primer and the M13 universal primer, which have a common sequence on the 5 'side and a gene-specific sequence on the 3 side, the above amplification product and pBIND Alternatively, the PCR product of pACT is mixed with the PCR amplification product (with a common sequence added to the 3 'side), and the second-stage PCR amplification is performed using nested primers.
  • a vector expressing the protein (BIND sample) or a vector expressing the fusion protein of VP16 and mouse protein (ACT sample) was constructed.
  • the BIND and ACT samples prepared by PCR were used directly without further purification.
  • mice full-length cDNA base sequences (dnafo rm4574 3, dnafo rm489 18, dnafo rm60475, and dnafo rm6 5509) are encoded by the following specific proteins (mouse cDNA live). It was found that each of the Rally FAN TOMs had an interaction with a specific clone (a specific protein encoded by the protein coding sequence of the cDNA). Table 4:
  • This clone is a protein phosphatase 2C homologue, which is presumed to be involved in cell cycle regulation. From PPI analysis, EF-hand called grancalcin
  • L-plastin power is a grancalcin-binding protein (J. Mol. Biol. (2000) 300, 1271-1281). Synthetic chemoattractant
  • fMLP formyl-methiony ⁇ -leucyl-phenylalanine
  • This clone is presumed to be a phosphatase having a rhodanase homology domain.
  • MKP MAP kinase phosphatase
  • This clone has a dual-specificity phosphatase 4, a domain with homology, and is presumed to be involved in the regulation of mitotic signal transduction.
  • TRAF-interacting protein It has been shown to interact with TRAF-interacting protein, and is thought to be deeply involved in inflammation, apoptosis, cancer, cell differentiation and proliferation.
  • This clone has dual-specificity phosphatase 13 and a high homologous protein, and is presumed to be involved in the regulation of mitotic signal transduction.
  • This clone is a protein phosphatase 2C homolog, and is presumed to be involved in the heat shock reaction.
  • this clone was strongly expressed in the liver, kidney, and brain, and its expression level was high in all tissues examined. It is suggested that they have an important role, and it is also interesting to see the relationship between decreased expression of this gene and cell carcinogenesis. Based on these findings, this protein has functions related to cancer, liver dysfunction, diabetes, schizophrenia, depression, anxiety, Parkinson's disease, Alzheimer's disease, ischemic brain disease, etc. It was considered useful as a medicine.
  • This clone is a protein phosphatase 2C homologue, which is presumed to be involved in cell cycle regulation.
  • the protein synthesized by the wheat cell-free translation system was considered to be a PP2C homologue, since it actually showed phosphatase activity against phosphorylated serine / threonine-containing peptides.
  • fMLP iormyl-methionyl- ⁇ eucyl- phenylalanine
  • this clone showed high organ-specific expression in testis and muscle. On the other hand, the expression in the knee was significantly lower.
  • this protein is considered to have functions related to cancer, immune diseases, inflammatory diseases, allergic diseases, infertility, contraception, diabetes, etc., and is considered to be useful as a therapeutic drug for these. .
  • MKP MAP kinase phosphatase
  • MKP-1 has an action of inactivating activated JNK by dephosphorylating it.
  • this clone is considered to be deeply involved in inflammation, apoptosis, cell differentiation and proliferation.
  • This clone is strongly expressed in the arm, and is also strongly expressed in lung, fat, bone marrow, etc., suggesting a relationship with diabetes.
  • this protein has functions related to cancer, immune disease, inflammatory disease, allergic disease, diabetes and the like, and is useful as a therapeutic agent for these.
  • This clone has a dual-specificity phosphatase 4 and a domain with homozygosity, and is presumed to be involved in the regulation of mitotic signal transduction.
  • TRAF-interacting protein It has been shown to interact with TRAF-interacting protein, and is thought to be deeply involved in inflammation, apoptosis, cancer, cell differentiation and proliferation.
  • the present protein has functions related to cancer, immune diseases, inflammatory diseases, allergic diseases, and the like, and is useful as a therapeutic agent for these.
  • This clone has high homology with dua specificity phosphatase 13 and is presumed to be involved in the regulation of mitotic signal transduction. PPI analysis has revealed that it interacts with the Fos-related antigen homologue, suggesting a relationship with immune and allergic diseases.
  • This clone was specifically and strongly expressed in the spleen, and was also observed in the eyes and lungs.However, its expression tended to decrease in the diabetic spleen. It is strongly suggested that they are involved.
  • this protein has functions related to cancer, immune disease, inflammatory disease, allergic disease, diabetes and the like, and is useful as a therapeutic agent for these.
  • This clone is strongly expressed in the knee, lung, and fat, is highly expressed in tissues examined, and is considered to have an important function in maintaining homeostasis in living organisms.
  • this protein has functions related to diseases related to phosphatidylinositol such as myopathy and neuropathy, cancer, skin formation such as burns and leprosy, osteoporosis, diabetes, etc. It was considered to be useful as these therapeutic agents.
  • This clone has a phase
  • measurement of the phosphatase activity of the protein synthesized by the wheat cell-free translation system showed that this clone had higher substrate specificity for phosphorylated serine and threonine than for phosphorylated tyrosine.
  • This clone was strongly expressed in lung and knee, and was also strongly expressed in fat, colon and brain. Based on the above results, this protein has functions related to neurodegenerative diseases such as cancer, diabetes, Alzheimer's disease, Parkinson's disease, and chorea, and is considered to be useful as a therapeutic drug for these.
  • Example 10 Obtaining human orthologs
  • nucleotide sequence of SEQ ID NO: 23 would be translated into the amino acid sequence of SEQ ID NO: 25.
  • SEQ ID NO: 23 was considered to be a novel human ortholog to SEQ ID NO: 2.
  • the dnafo rm45743 human orthologue (SEQ ID NOS: 24 and 26)
  • the dnafo rm45743 nucleotide sequence (SEQ ID NO: 4) was used as a query, and the human genome draft sequence (NCB I Build 30;
  • nucleotide sequence of SEQ ID NO: 24 would be translated into the human amino acid sequence of SEQ ID NO: 26.
  • amino acid sequence of SEQ ID NO: 26 There was 80% homology over the 1130 amino acid sequence between the amino acid sequence of SEQ ID NO: 26 and the amino acid sequence (SEQ ID NO: 11) predicted from the open reading frame of dnafo am45743.
  • SEQ ID NO: 24 was considered to be a novel human ortholog to SEQ ID NO: 4.
  • Industrial applicability Since the protein of the present invention and the DNA encoding the protein have a phosphatase activity or the like, a substance that regulates the activity can be screened using the protein or the DNA encoding the protein, and diseases associated with the protein, etc. It is useful for the development of a medicament that can act on the skin.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette invention vise à proposer un procédé permettant d'utiliser des protéines sur la base de leurs activités physiologiques et des ADN codant ces protéines, en analysant les séquences de base des clones d'ADNc impliqués dans une bibliothèque d'ADNc pleine longueur catalogué et, concernant les clones d'ADNc ayant de nouvelles séquences parmi ceux analysés ci-dessus, de spécifier les activités physiologiques des protéines ainsi codées. Ainsi, les protéines suivantes sont produites : (a) une protéine comprenant une séquence d'acides aminés représentée par l'un des numéros d'identification de séquence 8 à 14, 25 et 26 ; et (b) une protéine comprenant une séquence d'acides aminés dérivée d'une séquence d'acides aminés représentée par l'un des numéros d'identification de séquence 8 à 14, 25 et 26, par suppression, substitution et/ou addition d'un ou de plusieurs acides aminés et comportant une activité de phosphatase.
PCT/JP2003/005175 2002-04-23 2003-04-23 Nouvelles proteines et adn codant ces proteines WO2003091428A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003235100A AU2003235100A1 (en) 2002-04-23 2003-04-23 Novel proteins and dnas encoding the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2002120709 2002-04-23
JP2002-120709 2002-04-23
JP2002-352308 2002-12-04
JP2002352308 2002-12-04

Publications (1)

Publication Number Publication Date
WO2003091428A1 true WO2003091428A1 (fr) 2003-11-06

Family

ID=29272320

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2003/005175 WO2003091428A1 (fr) 2002-04-23 2003-04-23 Nouvelles proteines et adn codant ces proteines

Country Status (2)

Country Link
AU (1) AU2003235100A1 (fr)
WO (1) WO2003091428A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001055425A1 (fr) * 2000-01-26 2001-08-02 Biodoor Gene Technology Ltd. Shanghai Nouveau polypeptide, proteine phosphatase humaine 2c26, et polynucleotide codant pour ce polypeptide
WO2001077290A2 (fr) * 2000-04-06 2001-10-18 Genetics Institute, Llc. Polynucleotides codant pour des nouvelles proteines secretees
WO2001096546A2 (fr) * 2000-06-16 2001-12-20 Incyte Genomics, Inc. Proteine-phosphatases
WO2001096571A2 (fr) * 2000-06-16 2001-12-20 Bayer Aktiengesellschaft Regulation de la proteine humaine phosphatase iic abi2
US20020115607A1 (en) * 2000-10-17 2002-08-22 Myriad Genetics, Inc. Protein-protein interactions in neurodegenerative diseases

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001055425A1 (fr) * 2000-01-26 2001-08-02 Biodoor Gene Technology Ltd. Shanghai Nouveau polypeptide, proteine phosphatase humaine 2c26, et polynucleotide codant pour ce polypeptide
WO2001077290A2 (fr) * 2000-04-06 2001-10-18 Genetics Institute, Llc. Polynucleotides codant pour des nouvelles proteines secretees
WO2001096546A2 (fr) * 2000-06-16 2001-12-20 Incyte Genomics, Inc. Proteine-phosphatases
WO2001096571A2 (fr) * 2000-06-16 2001-12-20 Bayer Aktiengesellschaft Regulation de la proteine humaine phosphatase iic abi2
US20020115607A1 (en) * 2000-10-17 2002-08-22 Myriad Genetics, Inc. Protein-protein interactions in neurodegenerative diseases

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HU M. C.-T. ET AL., GENE, vol. 278, 2001, pages 89 - 99, XP004322244 *
MORRISON D.F. ET AL., GENE, vol. 257, 2000, pages 195 - 208, XP004224842 *
YONEYA T. ET AL., GENE, vol. 194, 1997, pages 241 - 247, XP004086071 *

Also Published As

Publication number Publication date
AU2003235100A1 (en) 2003-11-10
AU2003235100A8 (en) 2003-11-10

Similar Documents

Publication Publication Date Title
US20020098511A1 (en) Protein-protein interactions
US20230035235A1 (en) Swi/snf family chromatin remodeling complexes and uses thereof
WO2003091428A1 (fr) Nouvelles proteines et adn codant ces proteines
JP5378202B2 (ja) 脳・神経に特異的あるいは神経分化に特異的なバイオマーカー
JP2004229643A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP7410480B2 (ja) がんにおける融合遺伝子
US20040038252A1 (en) Method of testing for allergic diseases
US20040235001A1 (en) Regulatory poly(A) polymerase and uses thereof
JP2005245274A (ja) 細胞増殖促進剤
WO2003091435A1 (fr) Nouvelles proteines et differents adn les codant
WO2004074485A1 (fr) Nouvelles proteines et adn codant pour ces proteines
JP2004229648A (ja) 新規タンパク質及びそれをコードするｄｎａ
US10125395B2 (en) Genetic alterations and methods of use thereof for the diagnosis and treatment of type I diabetes
WO2004099408A1 (fr) Nouvelle proteine et adn la codant
JP2004229649A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229646A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229644A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229650A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229653A (ja) 新規タンパク質及びそれをコードするｄｎａ
WO2003084992A1 (fr) Nouvelles proteines et adn les codant
JP2004041181A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229651A (ja) 新規タンパク質及びそれをコードするｄｎａ
WO2003089643A1 (fr) Nouvelles proteines et adn codant lesdites proteines
JP2004041180A (ja) 新規タンパク質及びそれをコードするｄｎａ
JP2004229641A (ja) 新規タンパク質及びそれをコードするｄｎａ

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase