Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C217/00—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton
  • C07C217/02—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having etherified hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton
  • C07C217/04—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having etherified hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being acyclic and saturated
  • C07C217/06—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having etherified hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being acyclic and saturated having only one etherified hydroxy group and one amino group bound to the carbon skeleton, which is not further substituted
  • C07C217/08—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having etherified hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being acyclic and saturated having only one etherified hydroxy group and one amino group bound to the carbon skeleton, which is not further substituted the oxygen atom of the etherified hydroxy group being further bound to an acyclic carbon atom
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C271/00—Derivatives of carbamic acids, i.e. compounds containing any of the groups, the nitrogen atom not being part of nitro or nitroso groups
  • C07C271/06—Esters of carbamic acids
  • C07C271/08—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms
  • C07C271/10—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms
  • C07C271/16—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms to carbon atoms of hydrocarbon radicals substituted by singly-bound oxygen atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
  • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
  • C07D209/48—Iso-indoles; Hydrogenated iso-indoles with oxygen atoms in positions 1 and 3, e.g. phthalimide
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
  • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
  • C07D233/64—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with substituted hydrocarbon radicals attached to ring carbon atoms, e.g. histidine
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
  • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
  • C07D311/78—Ring systems having three or more relevant rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
  • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
  • C07D311/78—Ring systems having three or more relevant rings
  • C07D311/80—Dibenzopyrans; Hydrogenated dibenzopyrans
  • C07D311/82—Xanthenes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
  • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
  • C07D405/06—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
  • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
  • C07D493/10—Spiro-condensed systems
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
  • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
  • C07D495/04—Ortho-condensed systems
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
  • C07F5/00—Compounds containing elements of Groups 3 or 13 of the Periodic System
  • C07F5/02—Boron compounds
  • C07F5/022—Boron compounds without C-boron linkages
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
  • C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y308/00—Hydrolases acting on halide bonds (3.8)
  • C12Y308/01—Hydrolases acting on halide bonds (3.8) in C-halide substances (3.8.1)
  • C12Y308/01005—Haloalkane dehalogenase (3.8.1.5)
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
  • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10S436/00—Chemistry: analytical and immunological testing
  • Y10S436/80—Fluorescent dyes, e.g. rhodamine

Definitions

• This invention relates to the field of biochemical assays and reagents. More specifically, this invention relates to mutant proteins covalently linked (tethered) to one or more functional groups and to methods for their use.
• Labels e.g., those that are covalently linked to a molecule of interest, permit the ready detection of that molecule in a complex mixture.
• the label may be one that is added by chemical synthesis in vitro or attached in vivo, e.g., via recombinant techniques. For instance, the attachment of fluorescent or other labels onto proteins has traditionally been accomplished by in vitro chemical modification after protein purification (Hermanson, 1996).
• green fluorescent protein from the jellyfish Aequorea victoria can be genetically fused with many host proteins to produce fluorescent chimeras in situ (Tsien, 1998; Chalfie et al., 1998).
• GFP-based indicators are currently employed in a variety of assays, e.g., measuring pH (Kneen et al., 1998; Llopis et al., 1998; Miesenb ⁇ ck et al, 1998), Ca 2+ (Miyawaki et al., 1997; Rosomer et al., 1997), and membrane potential (Siegel et al., 1997)
• the fluorescence of intrinsically labeled proteins such as GFP is limited by the properties of protein structure, e.g., a limited range of fluorescent colors and relatively low intrinsic brightness (Cubitt et al., 1995; Orm ⁇ et al., 1996).
• Griffen et al. synthesized a tight-binding pair of molecular components: a small receptor domain composed of as few as six natural amino acids and a small ( ⁇ 700 dalton), synthetic ligand that could be linked to various spectroscopic probes or crosslinks.
• the receptor domain included four cysteines at the i, i + 1, i + 4, and i + 5 positions of an ⁇ helix and the ligand was 4',5'-bis(l,3,2-dithioarsolan-2- yl)fluorescein (FLASH). Griffen et al.
• the ligand had relatively few binding sites in nontransfected mammalian cells, was membrane-permeant and was nonfluorescent until it bound with high affinity and specificity to a tetracysteine domain in a recombinant protein, resulting in cells being fluorescently labeled ("FLASH" labeled) with a nanomolar or lower dissociation constant.
• FLASH fluorescently labeled
• Stroffekova et al. disclose that FLASH-EDT 2 binds non-specifically to endogenous cysteine-rich proteins.
• labeling proteins by FLASH is limited by the range of fluorophores that may be used.
• Receptor-mediated targeting methods use genetically encoded targeting sequences to localize fluorophores to virtually any cellular site, provided that the targeted protein is able to fold properly.
• cDNA transfection was used to target a single-chain antibody (sFv) to a specified site in a cell.
• sFv single-chain antibody
• conjugates of a hapten (4- ethoxymethylene-2-phenyl-2-oxazolin-5-one, phOx) and a fluorescent probe e.g., BODIPY FI, tetramethylrhodamine, and fluorescein
• a fluorescent probe e.g., BODIPY FI, tetramethylrhodamine, and fluorescein
• the invention provides methods, compositions and kits for tethering (linking), e.g., via a covalent or otherwise stable bond, one or more functional groups to a protein of the invention or to a fusion protein (chimera) which includes a protein of the invention.
• a protein of the invention is structurally related to a wild-type (native) hydrolase but comprises at least one amino acid substitution relative to the corresponding wild-type hydrolase and binds a substrate of the corresponding wild-type hydrolase but lacks or has reduced catalytic activity relative to the corresponding wild-type hydrolase (which mutant protein is referred to herein as a mutant hydrolase).
• tethering occurs, for instance, in solution or suspension, in a cell, on a solid support or at solution/surface interfaces, by employing a substrate for a hydrolase which includes a reactive group and which has been modified to include one or more functional groups.
• a substrate includes a substrate having a reactive group and optionally one or more functional groups.
• a substrate which includes one or more functional groups is generally referred to herein as a substrate of the invention.
• a "functional group” is a molecule which is detectable or is capable of detection (e.g., a chromophore, fluorophore or luminophore), or can be bound or attached to a second molecule (e.g., biotin, hapten, or a cross-linking group) or includes one or more amino acids, e.g., a peptide or polypeptide including an antibody or receptor, one or more nucleotides, lipids including lipid bilayers, a solid support, e.g., a sedimental particle, and the like.
• a functional group may have more than one property such as being capable of detection and being bound to another molecule.
• a "reactive group” is the minimum number of atoms in a substrate which are specifically recognized by a particular wild-type or mutant hydrolase of the invention.
• the interaction of a reactive group in a substrate and a wild-type hydrolase results in a product and the regeneration of the wild-type hydrolase.
• a substrate e.g., a substrate of the invention, may also optionally include a linker, e.g., a cleavable linker.
• a substrate useful in the invention is one which is specifically bound by a mutant hydrolase, and preferably results in a bond formed with an amino acid, e.g., the reactive residue, of the mutant hydrolase which bond is more stable than the bond formed between the substrate and the corresponding amino acid of the wild-type hydrolase. While the mutant hydrolase specifically binds substrates which may be specifically bound by the corresponding wild-type hydrolase, no product or substantially less product, e.g., 2-, 10-, 100-, or 1000-fold less, is formed from the interaction between the mutant hydrolase and the substrate under conditions which result in product formation by a reaction between the corresponding wild-type hydrolase and substrate.
• the lack of, or reduced amounts of, product formation by the mutant hydrolase is due to at least one substitution in the mutant hydrolase, which substitution results in the mutant hydrolase forming a bond with the substrate which is more stable than the bond formed between the corresponding wild-type hydrolase and the substrate.
• the bond formed between a mutant hydrolase and a substrate of the invention has a half-life (i.e., fc / -) that is at least 2-fold, and more preferably at least 4- or even 10-fold, and up to 100-, 1000- or 10,000-fold, greater than the t /2 of the bond formed between a corresponding wild-type hydrolase and the substrate under conditions which result in product formation by the corresponding wild-type hydrolase.
• the bond formed between the mutant hydrolase and the substrate has a t / . of at least 30 minutes and preferably at least 4 hours, and up to at least 10 hours, and is resistant to disruption by washing, protein denaturants, and/or high temperatures, e.g., the bond is stable to boiling in SDS.
• the substrate is a substrate for a dehalogenase, e.g., a haloalkane dehalogenase or a dehalogenase that cleaves carbon-halogen bonds in an aliphatic or aromatic halogenated substrate, such as a substrate for Rhodococcus, Staphylococcus, Pseudomonas, Burkholderia, Agrobacterium or Xanthobacter dehalogenase, or a substrate for a serine beta-lactamase.
• a substrate of the invention optionally includes a linker which physically separates one or more functional groups from the reactive group in the substrate.
• a substrate of the invention can include a linker of sufficient length and structure so that the one or more functional groups of the substrate of the invention do not disturb the 3-D structure of the hydrolase (wild-type or mutant).
• a substrate of the invention for a dehalogenase includes a reactive group such as (CH 2 ) 2-3 X where X is a halide and a functional group such as tetramethylrhodamine (TAMRA), e.g., TAMRA- C 14 H 24 O 4 -Cl.
• TAMRA tetramethylrhodamine
• a linker is preferably 12 to 30 atoms in length.
• the linker may not always be present in a substrate of the invention, however, in some embodiments, the physical separation of the reactive group and the functional group may be needed so that the reactive group can interact with the reactive residue in the mutant hydrolase to form a covalent bond.
• the linker does not substantially alter, e.g., impair, the specificity or reactivity of a substrate having the linker with the wild-type or mutant hydrolase relative to the specificity or reactivity of a corresponding substrate which lacks the linker with the wild-type or mutant hydrolase.
• the presence of the linker preferably does not substantially alter, e.g., impair, one or more properties, e.g., the function, of the functional group.
• the invention provides a compound of formula (I): R-linker-A-X, wherein R is one or more functional groups, wherein the linker is a multiatom straight or branched chain including C, N, S, or O, wherein A-X is a substrate for a dehalogenase, and wherein X is a halogen.
• R is one or more functional groups
• the linker is a multiatom straight or branched chain including C, N, S, or O
• A-X is a substrate for a dehalogenase
• X is a halogen.
• an alkylhalide is covalently attached to a linker, L, which is a group or groups that covalently attach one or more functional groups to form a substrate for a dehalogenase.
• DhaA.H272F a mutant dehalogenase, DhaA.H272F
• DhaA wliich included 5-(and 6-) carboxy fluorescein (FAM), e.g., FAM- C 14 H 24 O 4 -CI, TAMRA, e.g., TAMRA-C 14 H 24 O 4 -Cl, and biotin, e.g., biotin- C 18 H 32 O 4 -Cl, and there was no significant quenching effect of this binding on FAM or TAMRA fluorescence or on biotin binding to streptavidin.
• FAM carboxy fluorescein
• the substrate is R-(CH 2 ) 2 O(CH 2 ) 2 O(CH 2 ) 2 O(CH 2 ) 6 Cl, wherein R is a functional group.
• a functional group may be reacted with a molecule such as NH(CH 2 ) 2 O(CH 2 ) 2 O(CH 2 ) 2 O(CH 2 ) 6 Cl.
• substrates of the invention are permeable to the plasma membranes of cells.
• the plasma membranes of prokaryotic (E. coli) and eukaryotic (CHO-K1) cells were permeable to TAMRA-C 14 H 24 O 4 -Cl and biotin-C 18 H 32 O 4 -Cl and, these substrates were rapidly and efficiently loaded into and washed out of cells in the absence of a mutant hydrolase. In the presence of a mutant hydrolase, at least a portion of the substrate was prevented from being washed out of the cells.
• the bound portion of the substrate can serve as a marker or as a means to capture the mutant hydrolase or a fusion thereof.
• the invention further provides methods for preparing a substrate for a hydrolase which substrate is modified to include one or more functional groups.
• exemplary functional groups for use in the invention include, but are not limited to, an amino acid, protein, e.g., enzyme, antibody or other immunogenic protein, a radionuclide, a nucleic acid molecule, a drug, a lipid, biotin, avidin, streptavidin, a magnetic bead, a solid support, an electron opaque molecule, chromophore, MRI contrast agent, a dye, e.g., a xanthene dye, a calcium sensitive dye, e.g., l-[2-amino-5-(2,7-dichloro-6-hydroxy-3-oxy-9-xanthenyl)- phenoxy]-2-(2'-amino-5'-methylphenoxy)ethane-N,N,N',N'-tetraacetic acid (Ffuo-3), a sodium sensitive dye,
• the invention also includes a mutant hydrolase which comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, which substitution(s) renders the mutant hydrolase capable of forming a bond, e.g., a covalent bond with a substrate for the corresponding hydrolase, e.g., a substrate of the invention, which is more stable than the bond formed between a corresponding wild-type hydrolase and the substrate.
• a mutant hydrolase which comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, which substitution(s) renders the mutant hydrolase capable of forming a bond, e.g., a covalent bond with a substrate for the corresponding hydrolase, e.g., a substrate of the invention, which is more stable than the bond formed between a corresponding wild-type hydrolase and the substrate.
• the mutant hydrolase of the invention comprises at least one amino acid substitution in a residue which, in the wild-type hydrolase, is associated with activating a water molecule, e.g., a residue in a catalytic triad or an auxiliary residue, wherein the activated water molecule cleaves the bond formed between a catalytic residue in the wild-type hydrolase and a substrate of the hydrolase.
• a water molecule e.g., a residue in a catalytic triad or an auxiliary residue
• an "auxiliary residue” is a residue which alters the activity of another residue, e.g., it enhances the activity of a residue that activates a water molecule.
• Residues which activate water within the scope of the invention include but are not limited to those involved in acid-base catalysis, for instance, histidine, aspartic acid and glutamic acid.
• the mutant hydrolase of the invention comprises at least one amino acid substitution in a residue which, in the wild-type hydrolase, forms an ester intermediate by nucleophilic attack of a substrate for the hydrolase.
• wild-type dehalogenase DhaA cleaves carbon-halogen bonds in halogenated hydrocarbons (HaloCs-Halo o).
• the catalytic center of DhaA is a classic catalytic triad including a nucleophile, an acid and a histidine residue.
• the amino acids in the triad are located deep inside the catalytic pocket of DhaA (about 10 A long and about 20 A 2 in cross section).
• the halogen atom in a halogenated substrate for DhaA for instance, the chlorine atom of a Cl- alkane substrate, is positioned in close proximity to the catalytic center of DhaA.
• DhaA binds the substrate, likely forms an ES complex, and an ester intermediate is formed by nucleophilic attack of the substrate by AsplO ⁇ (the numbering is based on the protein sequence of DhaA) of DhaA ( Figure 1). His272 of DhaA then activates water and the activated water hydrolyzes the intermediate, releasing product from the catalytic center.
• mutant DhaAs e.g., a DhaA.H272F mutant, which likely retains the 3-D structure based on a computer modeling study and basic physico-chemical characteristics of wild- type DhaA (DhaA.WT), were not capable of hydrolyzing one or more substrates of the wild-type enzyme, e.g., for Cl-alkanes, releasing the corresponding alcohol released by the wild-type enzyme.
• DhaA.WT basic physico-chemical characteristics of wild- type DhaA
• mutant serine beta-lactamases e.g., a blaZ.E166D mutant, a blaZ.N170Q mutant and a blaZ.E166D:N170Q mutant, were not capable of hydrolyzing one or more substrates of a wild-type serine beta-lactamase.
• a mutant hydrolase is a mutant dehalogenase comprising at least one amino acid substitution in a residue which, in the wild-type dehalogenase, is associated with activating a water molecule, e.g., a residue in a catalytic triad or an auxiliary residue, wherein the activated water molecule cleaves the bond formed between a catalytic residue in the wild-type dehalogenase and a substrate of the dehalogenase.
• at least one substitution is in a residue corresponding to residue 272 in DhaA from Rhodococcus rhodochrous.
• a "corresponding residue” is a residue which has the same activity (function) in one wild-type protein relative to a reference wild-type protein and optionally is in the same relative position when the primary sequences of the two proteins are aligned.
• a residue which forms part of a catalytic triad and activates a water molecule in one enzyme may be residue 272 in that enzyme, which residue 272 corresponds to residue 73 in another enzyme, wherein residue 73 forms part of a catalytic triad and activates a water molecule.
• a mutant dehalogenase of the invention has a phenylalanine residue at a position corresponding to residue 272 in DhaA from Rhodococcus rhodochrous.
• a mutant hydrolase is a mutant dehalogenase comprising at least one amino acid substitution in a residue corresponding to residue 106 in DhaA from Rhodococcus rhodochrous.
• a mutant dehalogenase of the invention has a cysteine or a glutamate residue at a position corresponding to residue 106 in DhaA from Rhodococcus rhodochrous.
• the mutant hydrolase is a mutant dehalogenase comprising at least two amino acid substitutions, one in a residue corresponding to residue 106 and one in a residue corresponding to residue 272 in DhaA from Rhodococcus rhodochrous.
• the mutant hydrolase is a mutant serine beta-lactamase comprising at least one amino acid substitution in a residue corresponding to residue 166 or residue 170 in a serine beta-lactamase of Staphylococcus aureus PCI.
• the mutant hydrolase may be a fusion protein, e.g., a fusion protein expressed from a recombinant DNA which encodes the mutant hydrolase and at least one protein of interest or a fusion protein formed by chemical synthesis.
• the fusion protein may comprise a mutant hydrolase and an enzyme of interest, e.g., luciferase, RNasin or RNase, and/or a channel protein, a receptor, a membrane protein, a cytosolic protein, a nuclear protein, a structural protein, a phosphoprotein, a kinase, a signaling protein, a metabolic protein, a mitochondrial protein, a receptor associated protein, a fluorescent protein, an enzyme substrate, a transcription factor, a transporter protein and/or a targeting sequence, e.g., a myristilation sequence, a mitochondrial localization sequence, or a nuclear localization sequence, that directs the mutant hydrolase, for example, a fusion protein, to a particular location.
• the protein of interest may be fused to the N-terminus or the C-terminus of the mutant hydrolase.
• the fusion protein comprises a protein of interest at the N-terminus, and another protein, e.g., a different protein, at the C-terminus, of the mutant hydrolase.
• the protein of interest may be a fluorescent protein or an antibody.
• the proteins in the fusion are separated by a connector sequence, e.g., preferably one having at least 2 amino acid residues, such as one having 13 to 17 amino acid residues. The presence of a connector sequence in a fusion protein of the invention does not substantially alter the function of either protein in the fusion relative to the function of each individual protein.
• the presence of a connector sequence does not substantially alter the stability of the bond formed between the mutant dehalogenase and a substrate therefor or the activity of the luciferase.
• a connector sequence is a sequence recognized by an enzyme, e.g., a cleavable sequence.
• the connector sequence may be one recognized by a caspase, e.g., DEVD (SEQ ID NO:64), or is a photocleavable sequence.
• the fusion protein may comprise a protein of interest at the N-terminus and, preferably, a different protein of interest at the C-terminus of the mutant hydrolase.
• fusions of a mutant DhaA with GST (at the N-terminus), a Flag sequence (at the C-terminus) and Renilla luciferase (at the N-terminus or C-terminus) had no detectable effect on bond formation between the mutant DhaA and a substrate for wild-type DhaA which includes a functional group.
• a fusion of a Flag sequence and DhaA.H272F could be attached to a solid support via a streptavidin-biotin- C 18 H 32 O 4 -DhaA.H272F bridge (an SFlag-ELISA experiment).
• a fusion of Renilla luciferase (R.Luc) and DhaA.H272F could be attached to MagnesilTM particles coated with a substrate for wild-type DhaA which includes a functional group.
• the attached fusion comprising R.Luc was shown to be enzymatically active.
• Exemplary proteins of interest include, but are not limited to, an immunogenic protein, fluorescent protein, selectable marker protein, membrane protein, cytosolic protein, nuclear protein, structural protein, enzyme, e.g., RNase, enzyme substrate, receptor protein, transporter protein, transcription factor, channel protein, e.g., ion channel protein, phospho-protein, kinase, signaling protein, metabolic protein, mitochondrial protein, receptor associated protein, nucleic acid binding protein, extracellular matrix protein, secreted protein, receptor ligand, serum protein, or a protein with reactive cysteines.
• an immunogenic protein e.g., fluorescent protein, selectable marker protein, membrane protein, cytosolic protein, nuclear protein, structural protein, enzyme, e.g., RNase, enzyme substrate, receptor protein, transporter protein, transcription factor, channel protein, e.g., ion channel protein, phospho-protein, kinase, signaling protein, metabolic protein, mitochondrial protein, receptor associated protein, nucleic acid binding protein, extracellular matrix protein, secret
• the invention also includes compositions and kits comprising a substrate for a hydrolase which includes a linker, a substrate for a hydrolase which includes one or more functional groups and optionally a linker, a linker which includes one or more functional groups, a substrate for a hydrolase which lacks one or more functional groups and optionally includes a linker, a linker, or a mutant hydrolase, or any combination thereof.
• the invention includes a solid support comprising a substrate of the invention, a kit comprising a substrate of the invention, a kit comprising a vector encoding a dehalogenase of the invention, or a kit comprising a vector encoding a serine beta-lactamase of the invention.
• an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a hydrolase.
• the isolated nucleic acid molecule comprises a nucleic acid sequence which is optimized for expression in at least one selected host.
• Optimized sequences include sequences which are codon optimized, i.e., codons wliich are employed more frequently in one organism relative to another organism, e.g., a distantly related organism, as well as modifications to add or modify Kozak sequences and/or introns, and/or to remove undesirable sequences, for instance, potential transcription factor binding sites.
• the polynucleotide includes a nucleic acid sequence encoding a dehalogenase, which nucleic acid sequence is optimized for expression is a selected host cell.
• the optimized polynucleotide no longer hybridizes to the corresponding non- optimized sequence, e.g., does not hybridize to the non-optimized sequence under medium or high stringency conditions.
• the polynucleotide has less than 90%, e.g., less than 80%, nucleic acid sequence identity to the corresponding non-optimized sequence and optionally encodes a polypeptide having at least 80%, e.g., at least 85%, 90% or more, amino acid sequence identity with the polypeptide encoded by the non-optimized sequence.
• Constructs e.g., expression cassettes, and vectors comprising the isolated nucleic acid molecule, as well as kits comprising the isolated nucleic acid molecule, construct or vector are also provided.
• the method comprises introducing to a host cell a recombinant nucleic acid molecule encoding a mutant hydrolase of the invention so as to express the mutant hydrolase.
• the mutant hydrolase may be isolated from the cell.
• the mutant hydrolase may be expressed transiently or stably, constitutively or under tissue-specific or drug-regulated promoters, and the like.
• an isolated host cell comprising a recombinant nucleic acid molecule encoding a mutant hydrolase of the invention.
• the invention provides a method to detect or determine the presence or amount of a mutant hydrolase.
• the method includes contacting a mutant hydrolase with a hydrolase substrate which comprises one or more functional groups.
• the mutant hydrolase comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, wherein the at least one amino acid substitution results in the mutant hydrolase forming a bond with the substrate which is more stable than the bond formed between the corresponding wild-type hydrolase and the substrate, and wherein the at least one amino acid substitution in the mutant hydrolase is a substitution at an amino acid residue in the corresponding wild-type hydrolase that is associated with activating a water molecule which cleaves the bond formed between the corresponding wild-type hydrolase and the substrate or at an amino acid residue in the corresponding wild-type hydrolase that forms an ester intermediate with the substrate.
• the presence or amount of the functional group is detected or determined, thereby detecting or determining the presence or amount of the mutant hydrolase.
• the mutant hydrolase is in or on the surface of a cell. In another embodiment, the mutant hydrolase is in a cell lysate.
• a mutant hydrolase and a substrate for a corresponding hydrolase which includes one or more functional groups e.g., to isolate a molecule or to detect or determine the presence or amount of, location, e.g., intracellular, subcellular or extracellular location, or movement of certain molecules in cells.
• a method to isolate a molecule of interest in a sample includes contacting a sample with a fusion protein comprising a mutant hydrolase and a protein which binds a molecule of interest with a hydrolase substrate which comprises one or more functional groups.
• the mutant hydrolase comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, wherein the at least one amino acid substitution results in the mutant hydrolase forming a bond with the substrate wliich is more stable than the bond formed between the corresponding wild-type hydrolase and the substrate, and wherein the at least one amino acid substitution in the mutant hydrolase is a substitution at an amino acid residue in the corresponding wild-type hydrolase that is associated with activating a water molecule which cleaves the bond formed between the corresponding wild-type hydrolase and the substrate or at an amino acid residue in the corresponding wild-type hydrolase that forms an ester intermediate with the substrate.
• at least one functional group is a solid support or a molecule which binds to a solid support.
• the sample contains intact cells while in another embodiment, the sample is a cell lysate or subcellular fraction. Then the molecule of interest is isolated.
• the invention includes method to isolate a protein of interest.
• the method includes contacting a fusion protein comprising a mutant hydrolase and a protein of interest with a hydrolase substrate which comprises at least one functional group.
• the mutant hydrolase comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, wherein the at least one amino acid substitution results in the mutant hydrolase forming a bond with the substrate which is more stable than the bond formed between the wild- type hydrolase and the substrate, and wherein the at least one amino acid substitution in the mutant hydrolase is a substitution at an amino acid residue in the wild-type hydrolase that is associated with activating a water molecule which cleaves a bond formed between the wild-type hydrolase and the substrate or at an amino acid residue in the wild-type hydrolase that forms an ester intermediate with the substrate.
• at least one functional group is a solid support or a molecule which binds to a solid support. Then the protein of interest is isolated.
• the invention includes a method to identify an agent that alters the interaction of a protein of interest with a molecule suspected of interacting with the protein of interest.
• the method includes contacting at least one agent with the molecule suspected of interacting with the protein of interest, a fusion protein comprising mutant hydrolase and the protein of interest, and a hydrolase substrate which comprises one or more functional groups.
• the mutant hydrolase comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, wherein the at least one amino acid substitution results in the mutant hydrolase forming a bond with the substrate which is more stable than the bond formed between the corresponding wild-type hydrolase and the substrate, and wherein the at least one amino acid substitution in the mutant hydrolase is a substitution at an amino acid residue in the corresponding wild-type hydrolase that is associated with activating a water molecule wliich cleaves a bond formed between the corresponding wild-type hydrolase and the substrate at an amino acid residue in the wild-type hydrolase that forms an ester intermediate with the substrate.
• at least one functional group is a solid support or a molecule which binds to a solid support. Then it is determined whether the agent alters the interaction between the protein of interest and the molecule suspected of interacting with the protein of interest.
• a substrate of the invention bound to a solid support or a mutant hydrolase bound to a solid support may be used to generate protein arrays, cell arrays, vesicle/organelle arrays and cell membrane arrays.
• the invention thus provides methods to monitor the expression, location and/or movement (trafficking) of proteins in a cell as well as to monitor changes in microenvironments within a cell.
• the use of a mutant hydrolase and a substrate of the invention permits functional analysis of proteins, e.g., ion channels.
• the use of two pairs of a mutant hydrolase/substrate permits multiplexing, simultaneous detection, and FRET- or BRET-based assays.
• mutant dehalogenases with substitutions at different residues of a catalytic triad may each preferentially bind certain substrates of the invention but not others or a mutant dehalogenase and a mutant beta-lactamase may be employed with their respective substrates, thus permitting multiplexing.
• Other applications include capturing the stable complex which results from contacting the mutant hydrolase with a corresponding substrate of the invention, on a solid substrate for analytical or industrial purposes (e.g., to study kinetic parameters of the tethered enzyme, to generate enzyme chains/arrays, to metabolize industrial components, and the like), to detect protein-protein interactions, to determine the effect of different compounds/drugs on an interaction between a fusion protein comprising a protein of interest and a mutant hydrolase with other molecules, to isolate or purify molecules which bind to a protein of interest fused to the mutant hydrolase, or to isolate or purify cells, organelles or fragments thereof.
• a protein of interest may be fused to a mutant hydrolase and then linked to a solid support via the specific interaction of a functional group which is a ligand for an acceptor group and is present in a substrate of the invention, with an acceptor group present on the solid support.
• a substrate may be contacted with the fusion protein prior to contact with the solid support, contacted with the solid support prior to contact with the fusion protein, or simultaneously contacted with the fusion protein and the solid support.
• Such a system permits the resulting complex to be employed to detect or isolate molecules which bind to the protein of interest.
• the binding molecule may be a protein, e.g., a fusion of the binding protein and a functional group, e.g., GFP, luciferase, an antibody, e.g., one conjugated to horseradish peroxidase (HRP), alkaline phosphatase (AP) or a fluorophore.
• a functional group e.g., GFP, luciferase
• an antibody e.g., one conjugated to horseradish peroxidase (HRP), alkaline phosphatase (AP) or a fluorophore.
• the mutant hydrolase may be expressed on the outside surface of cells (e.g., via a fusion with a plasma membrane protein).
• the mutant hydrolase is expressed on the cytosolic surface of the organelle of interest.
• the mutant hydrolase is fused with an extracellular matrix component or an outer membrane protein and tethered to a three-dimensional cell culture or a platform for tissue engineering.
• primary neurons or embryonic stem cells may be grown on the platform to form a feeder layer.
• Other applications include detecting or labeling cells.
• the use of a mutant hydrolase and a corresponding substrate of the invention permits the detection of cells, for instance, to detect cell migration in vitro or in vivo after implantation or injection into animals (e.g., angiogenesis/chemotaxis assays, migration of implanted neurons, normal, malignant, or recombinantly modified cells implanted/injected into animals, and the like), and live cell imaging followed by immunocytochemistry.
• the invention provides a method to label newly synthesized proteins. For example, cells comprising a vector which expresses a mutant hydrolase of the invention or a fusion thereof, are contacted with a substrate for the hydrolase which lacks a functional group.
• Cells are then contacted with an agent, e.g., an inducer of gene expression, and a substrate for the hydrolase which contains one or more functional groups.
• an agent e.g., an inducer of gene expression
• a substrate for the hydrolase which contains one or more functional groups e.g., an inducer of gene expression
• the presence, amount or location of the mutant hydrolase or fusion thereof is then detected or determined.
• the presence, amount or location of the mutant hydrolase or fusion thereof is due to newly synthesized mutant hydrolase or a fusion thereof.
• cells comprising a vector wliich expresses a mutant hydrolase of the invention or a fusion thereof, are contacted with a substrate for the hydrolase having a functional group, e.g., a green fluorophore, then contacted with an agent and a substrate havinga different functional group, e.g., a red fluorophore.
• the mutant hydrolase is fused to a membrane localization signal and so can be
• the invention provides a method to label a cell.
• the method includes contacting a cell comprising a mutant hydrolase with a hydrolase substrate which comprises one or more functional groups.
• the mutant hydrolase comprises at least one amino acid substitution relative to a corresponding wild-type hydrolase, wherein the at least one amino acid substitution results in the mutant hydrolase forming a bond with the substrate which is more stable than the bond formed between the corresponding wild-type hydrolase and the substrate, and wherein the at least one amino acid substitution in the mutant hydrolase is a substitution at an amino acid residue in the corresponding wild-type hydrolase that is associated with activating a water molecule wliich cleaves a bond formed between the corresponding wild-type hydrolase and the substrate or at an amino acid residue in the corresponding wild-type hydrolase that forms an ester intermediate with the substrate.
• Cells expressing selectable marker proteins are used to stably transform cells with foreign DNA. It may be desirable to observe which cells contain selectable marker proteins as well as fluorescently labeled molecules. For instance, it may be preferable to label the selectable marker protein with a fluorescent molecule that is added exogenously to living cells. By this method, the selectable marker protein becomes visible when only when needed by addition of the fluorophore, and the fluorescence will subsequently be lost when selectable marker proteins are naturally regenerated through cellular metabolism.
• the invention provides a method for labeling a cell which expresses a selectable marker protein.
• the method includes providing a cell comprising an expression cassette comprising a nucleic acid sequence encoding a fusion protein.
• the fusion protein comprises a selectable marker protein, e.g., one which confers resistance to at least one antibiotic, and a second protein that is capable of stably and optionally irreversibly binding a substrate or a portion thereof which includes an optically detectable molecule.
• the protein may be an alkyl transferase which irreversibly transfers an alkyl group and an optically detectable molecule from a substrate to itself, thereby labeling the alkyl transferase, e.g., an alkyl transferase such as O -alkylguanine DNA alkyltransferase.
• an alkyl transferase such as O -alkylguanine DNA alkyltransferase.
• Exemplary proteins useful in this embodiment of the invention include, but are not limited to, alkyl transferases, peptidyl glycine- alpha-amidating monoxygenases, type I topoisomerases, hydrolases, e.g., serine and epoxide hydrolases as well as the mutant hydrolases described herein, aminotransferases, cytochrome P450 monooxygenases, acetyl transferases, decarboxylases, oxidases, e.g., monoamine oxidases, reductases, e.g., ribonucleotide reductase, synthetases, e.g., cyclic ADP ribose synthetase or thymidylate synthetase, dehydrogenases, e.g., aldehyde dehydrogenase, synthases, e.g., nitric oxide synthase (NOS),
• a stable bond i.e., one which is formed between a substrate and a wild-type or mutant enzyme, has a t 2 of at least 30 minutes and preferably at least 4 hours, and up to at least 10 hours, and is resistant to disruption by washing, protein denaturants, and/or high temperatures, e.g., the bond is stable to boiling in SDS.
• the cell which expresses the fusion protein is contacted with the substrate so as to label the cell.
• the cell is fixed prior to contact with the substrate.
• the substrate and fixative are contacted with the cell at the same time.
• the fixative is added to the cell after the cell is contacted with the substrate.
• the fusion protein forms an ester bond with the substrate. In another embodiment, the fusion protein forms a thioester bond with the substrate. Also provided is a fusion gene encoding the fusion protein, and a cell which expresses the fusion protein.
• a preservative such as paraformaldehyde, acetone or methanol which generally maintains most features of cellular structure.
• fixative such as paraformaldehyde, acetone or methanol which generally maintains most features of cellular structure.
• Such fixed cells are then often analyzed by adding fluorescent stains or fluorescently labeled antibodies to reveal specific structures within the cells.
• Another method to fluorescently label cells is to express a fluorescent protein, e.g., GFP, in cells prior to fixation.
• GFP fluorescent protein
• the invention provides a method for labeling a cell with a functional group, e.g., fluorophore.
• the method includes providing a cell which expresses a mutant hydrolase of the mvention or a fusion thereof, and contacting the cell with a hydrolase substrate which includes at least one functional group.
• the cell is fixed prior to contact with the substrate.
• the substrate and fixative are contacted with the cell at the same time.
• the fixative is added to the cell after the cell is contacted with the substrate. Then the presence or location of the mutant hydrolase, or fusion thereof, in the cell is detected or determined.
• the mutant hydrolase forms an ester bond with the substrate, while in another embodiment, the mutant hydrolase forms a thioester bond with the substrate.
• the invention also provides processes and intermediates disclosed herein that are useful for preparing compounds, compositions, nucleic acids, proteins, or other materials of the invention.
• Figure 1 is a schematic of a reaction in the catalytic triad of Rhodococcus rhodochrous dehalogenase with an alkylhalide substrate.
• Figure 2 shows a three-dimensional model of a wild-type DhaA
• Rhodococcus rhodochrous dehalogenase and four mutant DhaAs (H283Q, G, A or F).
• a cyan ribbon is a 3-D model of the DhaA.WT based on the crystal structure of this protein (Newman et al., 1999) (panel A).
• the purple ribbon is a 3-D model of the H272Q, H272G and H272A mutants (panel A), or a 3-D model of the H272F mutant (panel B).
• Three-dimensional models were generated by calculating a Molecular Probability Density Function followed by several optimization steps including Restrained Stimulated Annealing Molecular Dynamics (MD) scheme. 3-D modeling was done on Silicon Graphics computer-station using software Insightll (USA).
• Figure 3 shows the purification of wild-type and mutant DhaA proteins.
• GST-DhaA.WT-Flag (odd numbered lanes) and GST-DhaA.H272F-Flag (even numbered lanes) fusion proteins were found to be soluble and efficiently purified on GSS-Sepharose 4FF (lanes 3 and 4-crude E. coli supernatant; lanes 5 and 6- washes; lanes 7 through 10- ⁇ urified proteins).
• Treatment of the fusion proteins with Factor Xa led to the formation of two proteins, GST and DhaA (WT or mutant; lanes 11 and 12, respectively).
• GST was efficiently removed on GSS-Sepharose 4FF (WT or mutant; lanes 13 and 14, respectively). All proteins had the predicted molecular weight.
• Figure 4 illustrates the hydrolysis of 1-Cl-butane by wild-type DhaA and mutant DhaAs.
• Figure 5 shows precipitation of DhaA.WT and DhaA.H272F/A/G/ Q mutants with various concentrations of (NH 4 ) 2 SO 4 .
• Panel A lanes 1-4, DhaA.WT; lanes 5-8, DhaA.H272G; and lanes 9- 12, DhaA.H272Q.
• Panel B lanes ⁇ -A, DhaA.WT; lanes 5-8, DhaA.H272F; and lanes 9-12, DhaA.H272A.
• Figure 6 depicts the substrate specificity of wild-type DhaA. Using a phenol red-based assay (Esss), the initial rate of the reaction was determined during the first 60 seconds after enzyme addition by four 15 second readings.
• Figure 7 shows substrates for DhaA which include a functional group (e.g., 5-(and 6-)-carboxyfluorescein (FAM), Anth (anthracene) or biotin) and a linker.
• Figure 8A shows a HPLC separation of products of FAM-C 1 H 24 O 4 -Cl hydrolysis by wild-type DhaA.
• Figure 8B shows a HPLC analysis of product (as a percent of substrate) produced by wild-type DhaA hydrolysis of FAM-C 14 H 2 O -Cl over time.
• Figure 9 shows SDS-PAGE analysis of the binding of wild-type DhaA (lanes 1, 3, and 5 in panel A and lanes 1-8 in panel B) and mutant DhaA (DhaA.H272F); (lanes 2, 4, and 6 in panel A and lanes 9-14 in panel B), to TAMRA-C 14 H 24 O 4 -Cl (lanes 1 and 2 in panel A); ROX-C 14 H 24 O 4 -Cl (lanes 3 and 4 in panel A); FAM-C 14 H 24 O 4 -Cl (lanes 5 and 6 in panel A); or biotin- C 18 H 32 O 4- Cl (panel B).
• the concentration of biotin-C 18 H 32 O 4 -Cl in panel B as: 0 ⁇ M (lanes 1 and 8), 125 ⁇ M (lanes 2 and 9) 25 ⁇ M (lanes 3 and 10), 5 ⁇ M (lanes 4 and 11), 1 ⁇ M (lanes 5 and 12), 0.2 ⁇ M (lanes 6 and 13), and 0.04 ⁇ M (lanes 7 and 14).
• Figure 10 illustrates that pretreatment of a mutant DhaA with a substrate, biotin-C 18 H 3 O 4 -Cl, blocks binding of another substrate.
• Samples 2, 4, 6, 8, and 10 were pretreated with biotin- C 18 H 32 O 4 -Cl.
• Figure 11 shows MALDI-TOF analysis of enzyme substrate complexes. Mass spectra of GST-DhaA.WT or GST-DhaA.H272F incubated with FAM- C H 2 O -Cl.
• Figure 12 illustrates SDS-PAGE analysis of the binding properties of DhaA mutants with substitutions at residue 106, and DhaA mutants with substitutions at residue 106 and residue 272, to TAMRA-C 14 H 2 O 4 -Cl.
• 2 ⁇ g of protein and 25 ⁇ M TAMRA-C 14 H 2 O 4 -Cl in 32 ⁇ l were incubated for one hour at room temperature. 10 ⁇ l of each reaction was loaded per lane.
• the gel was imaged with a 570 nm filter.
• Figure 13 depicts analysis of Renilla luciferase activity in samples having a fusion of luciferase and a mutant DhaA tethered to a solid support (a streptavidin coated plate). Capture of the fusion was accomplished using a substrate of DhaA (i.e., biotin-C 18 H 32 O -Cl). No activity was found in fractions with a fusion of Renilla luciferase and wild-type DhaA.
• DhaA i.e., biotin-C 18 H 32 O -Cl
• Figure 14 shows SDS-PAGE analysis of two-fold serial dilutions of E. coli expressing either wild-type DhaA (DhaA.WT-Flag, lanes 1-4 of each panel) or mutant DhaA.H272F (DhaA.H272F-Flag, lanes 5-7 of each panel) treated with biotin-C 1 sH 32 O 4 -Cl (panel A) or TAMRA-C 12 H 24 ⁇ 4 -Cl (panel B) in vivo. Arrows mark proteins with M r corresponding to M r of DhaA-Flag.
• Figure 15 shows the binding of TAMRA-C 12 H 24 O 4 -Cl to eukaryotic cell proteins in vivo.
• Two-fold serial dilutions of proteins from CHO-K1 cells expressing either DhaA.WT-Flag (lanes 1-4) or DhaA.H272F-Flag (lanes 5-8) were treated with TAMRA-C 12 H 2 O 4 -Cl.
• Figure 16 illustrates the permeability of TAMRA-C 12 H 24 O 4 -Cl to CHO- Kl cells.
• CHO-K1 cells A, bright field image
• TAMRA- C 12 H 28 0 -C1 25 ⁇ M, for 5 minutes at 37°C
• Panel C shows the cells after the washing procedure.
• Figure 17 shows images of cells transfected with GFP-connector- DhaA.WT-Flag or GFP-connector-DhaA.H272F-Flag.
• CHO-K1 cells were transfected with DNA coding GFP-connector-DhaA.WT-Flag (panels A-C) or GFP-connector-DhaA.H272F-Flag (panels D-F) and treated with TAMRA- C 12 H 28 O 4 -Cl.
• Panels A D-bright field
• panels B E-GFP filter set
• panels C F-TAMRA filter set.
• Figure 18 shows Western blot analysis of proteins from cells transfected with GFP-connector-DhaA.WT-Flag (lanes 1-4) or GFP-connector- DhaA.H272F-Flag (lanes 5-8).
• CHO-K1 cells were transfected with either GFP- connector-DhaA.WT-Flag or GFP-connector-DhaA.H272F-Flag and then treated with TAMRA-C 14 H 24 O 4 -Cl (25 ⁇ M) for 0, 5, 15 or 60 minutes, washed with PBS (4 x 1.0 ml), and collected in SDS-sample buffer. The samples were resolved on SDS-PAGE, and analyzed on a fluoroimager.
• Figure 19 illustrates the toxicity of selected substrates (panel A, TAMRA and panel B, ROX) for CHO-K1 cells.
• Figure 20 illustrates a reaction scheme for a serine beta-lactamase.
• the reaction begins with the formation of a precovalent encounter complex (Figure 19A), and moves through a high-energy acylation tetrahedral intermediate (Figure 19B) to form a transiently stable acyl-enzyme intermediate, forming an ester through the catalytic residue Ser70 ( Figure 19C).
• the acyl- enzyme is attacked by hydrolytic water (Figure 19D) to form a high-energy deacylation intermediate (Figure 19E) (Minasov et al., 2002), which collapses to form the hydrolyzed product ( Figure 19F).
• the product is then expelled, regenerating free enzyme.
• Figure 21 shows hydrolysis of FAP by GST-blaZ over time.
• Figure 22 shows the binding of bocellin to fusions of GST and blaZ.E166D, blaZ.N170Q or blaZ.E166D:N170Q.
• Figure 23 shows the binding of CCF2 to fusions of GST and blaZ.E166D, blaZ.N170Q or blaZ.E166D:N170Q.
• Figure 24 provides fluorescence and DIG images of living CHO-K1 cells transfected with a construct encoding GFP-connector-DhaA.H272F-NLS3 and stained with TAMRA-C 14 H 24 O 4 -Cl.
• NLS3 tandem repeat of a nuclear localization sequence from SV40 T antigen.
• Figure 25 shows fluorescence images of living CHO-K1 cells transfected with a construct encoding GFP- ⁇ -arrestin2 (left) and a construct encoding DhaA.H272F- ⁇ -arrestin2 and stained with TAMRA-C 14 H 24 O 4 (right).
• Figure 26 shows an SDS-PAGE analysis of DhaA expression inE. coli.
• the arrow indicates the location of the DhaA protein, -s, lysate before centrifugation;
• Figure 27 shows an immunoblot analysis of DhaA containing lysates.
• Lanes 1, Wild-type DhaA crude lysate; 2, Wild-type DhaA cell-free lysate; 3, DhaA.H272F crude lysate; 4, DhaA.H272F cell-free lysate; 5, vector control crude lysate; 6, vector control cell-free lysate; 7, Molecular weight standards; 8, DhaA.E130Q CI mutant crude lysate; 9, DhaA.E130Q CI mutant cell-free lysate; 10, DhaA.E130L A5 mutant crude lysate; 11, DhaA.E130L A5 mutant cell-free lysate; 12, DhaA.E130A A12 mutant crude lysate; 13, DhaA.E130A A12 mutant cell-free lysate; 14, Molecular weight standards.
• the arrow indicates the location of the DhaA protein.
• Figure 28 provides ffuoroimage analysis of in vitro covalent alkyl- enzyme formation. Lanes: 1, Fluorescent molecular weight standards; 2, DhaA wild-type; 3, DhaA.H272F mutant; 4, DhaA- (vector only control); 5, DhaA.E130Q mutant; 6, DhaA.E130L mutant; 7, DhaA.E130A mutant.
• the arrow indicates the location of the fluorescent enzyme-alkyl covalent intermediate.
• Figure 29 provides fluoroimage analysis of covalent alkyl-enzyme formation in whole cells.
• Lanes 1, Fluorescent molecular weight standards; 2, DhaA wild-type; 3, DhaA.H272F mutant; 4, DhaA- (vector only control); 5, DhaA.E130Q mutant; 6, DhaA.E130L mutant; 7, DhaA.E130A mutant; 8, Fluorescent molecular weight standards.
• the arrow indicates the location of the fluorescent enzyme-alkyl covalent intermediate.
• Figures 30 A-B show Western blot analyses of DhaA-Flag captured on streptavidin (SA) coated beads.
• SA streptavidin
• DhaA.H272F-Flag were treated with (A) or without (B) biotin-C 18 H 32 O 4 -Cl (25 ⁇ M, 0.1% DMSO, 60 minutes, 37°C). Excess biotin-C 18 H 32 O 4 -Cl was washed out, cells were lysed, and 10 ⁇ l of cell lysate was incubated with 5 ⁇ l of SA- coated beads (Pierce) for 60 minutes at room temperature (RT). Cell lysates (lane 1), proteins which were not bound to beads (lane 2), and proteins which were bound to beads (lane 3) were resolved on SDS-PAGE, transferred to nitrocellulose membrane, and probed with anti-Flag antibody (Sigma).
• Figures 30 C-D illustrate analyses of hRXuc-DliaA captured on SA coated beads.
• CHO-K1 cells transiently expressing hR.Luc-connector- DhaA.H272F-Flag were treated with or without biotin-C 18 H 32 O 4 -Cl (25 ⁇ M, 0.1% DMSO, 60 minutes, 37°C).
• Cells were lysed, and 10 ⁇ l of cell lysate was incubated with 5 ⁇ l of SA-coated beads (Pierce) for 60 minutes at room temperature.
• nucleophile is a molecule which donates electrons.
• a "selectable marker protein” encodes an enzymatic activity that confers to a cell the ability to grow in medium lacking what would otherwise be an essential nutrient (e.g., the TRP1 gene in yeast cells) or in a medium with an antibiotic or other drug, i.e., the expression of the gene encoding the selectable marker protein in a cell confers resistance to an antibiotic or drug to that cell relative to a corresponding cell without the gene.
• the marker is said to be a positive selectable marker (e.g., antibiotic resistance genes which confer the ability to grow in the presence of the appropriate antibiotic).
• Selectable markers can also be used to select against host cells containing a particular gene (e.g., the sacB gene wliich, if expressed, kills the bacterial host cells grown in medium containing 5% sucrose); selectable markers used in this manner are referred to as negative selectable markers or counter-selectable markers.
• Common selectable marker gene sequences include those for resistance to antibiotics such as ampicillin, tetracycline, kanamycin, puromycin, bleomycin, streptomycin, hygromycin, neomycin, ZeocinTM, and the like.
• Selectable auxotrophic gene sequences include, for example, hisD, which allows growth in histidine free media in the presence of histidinol.
• Suitable selectable marker genes include a bleomycin-resistance gene, a metallothionein gene, a hygromycin B- phosphotransferase gene, the AURI gene, an adenosine deaminase gene, an aminoglycoside phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a xanthine-guanine phosphoribosyltransferase gene, and the like.
• nucleic acid is a covalently linked sequence of nucleotides in wliich the 3' position of the pentose of one nucleotide is joined by a phosphodiester group to the 5' position of the pentose of the next, and in which the nucleotide residues (bases) are linked in specific sequence, i.e., a linear order of nucleotides.
• a "polynucleotide”, as used herein, is a nucleic acid containing a sequence that is greater than about 100 nucleotides in length.
• oligonucleotide or “primer”, as used herein, is a short polynucleotide or a portion of a polynucleotide.
• the term “oligonucleotide” or “oligo” as used herein is defined as a molecule comprised of 2 or more deoxyribonucleotides or ribonucleotides, preferably more than 3, and usually more than 10, but less than 250, preferably less than 200, deoxyribonucleotides or ribonucleotides.
• the oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, amplification, e.g., polymerase chain reaction (PCR), reverse transcription (RT), or a combination thereof.
• a “primer” is an oligonucleotide wliich is capable of acting as a point of initiation for nucleic acid synthesis when placed under conditions in which primer extension is initiated.
• a primer is selected to have on its 3' end a region that is substantially complementary to a specific sequence of the target (template).
• a primer must be sufficiently complementary to hybridize with a target for primer elongation to occur.
• a primer sequence need not reflect the exact sequence of the target. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the target.
• Non-complementary bases or longer sequences can be interspersed into the primer provided that the primer sequence has sufficient complementarity with the sequence of the target to hybridize and thereby form a complex for synthesis of the extension product of the primer.
• Primers matching or complementary to a gene sequence may be used in amplification reactions, RT-PCR and the like.
• Nucleic acid molecules are said to have a "5'-terminus” (5' end) and a "3'-terminus” (3' end) because nucleic acid phosphodiester linkages occur to the 5' carbon and 3' carbon of the pentose ring of the substituent mononucleotides.
• the end of a polynucleotide at which a new linkage would be to a 5' carbon is its 5' terminal nucleotide.
• the end of a polynucleotide at which a new linkage would be to a 3' carbon is its 3' terminal nucleotide.
• a terminal nucleotide, as used herein, is the nucleotide at the end position of the 3'- or 5'-terminus.
• DNA molecules are said to have "5' ends” and "3' ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage. Therefore, an end of an oligonucleotides referred to as the "5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end” if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring.
• a nucleic acid sequence even if internal to a larger oligonucleotide or polynucleotide, also may be said to have 5' and 3' ends.
• discrete elements are referred to as being "upstream” or 5' of the "downstream” or 3' elements. This terminology reflects the fact that transcription proceeds in a 5' to 3' fashion along the DNA strand.
• promoter and enhancer elements that direct transcription of a linked gene are generally located 5' or upstream of the coding region.
• enhancer elements can exert their effect even when located 3' of the promoter element and the coding region.
• Transcription termination and polyadenylation signals are located 3' or downstream of the coding region.
• the term "codon” as used herein, is a basic genetic coding unit, consisting of a sequence of three nucleotides that specify a particular amino acid to be incorporation into a polypeptide chain, or a start or stop signal.
• the term "coding region" when used in reference to structural gene refers to the nucleotide sequences that encode the amino acids found in the nascent polypeptide as a result of translation of a mRNA molecule.
• the coding region is bounded on the 5' side by the nucleotide triplet "ATG” which encodes the initiator methionine and on the 3' side by a stop codon (e.g., TAA, TAG, TGA).
• ATG nucleotide triplet
• TGT stop codon
• the coding region is also known to initiate by a nucleotide triplet "TTG”.
• isolated and/or purified refer to in vitro preparation, isolation and/or purification of a nucleic acid molecule, a polypeptide, peptide or protein, so that it is not associated with in vivo substances.
• isolated when used in relation to a nucleic acid, as in “isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one contaminant with which it is ordinarily associated in its source. An isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids (e.g., DNA and RNA) are found in the state they exist in nature.
• isolated nucleic acid e.g., DNA and RNA
• a given DNA sequence e.g., a gene
• RNA sequences e.g., a specific mRNA sequence encoding a specific protein
• RNA sequences are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins.
• the "isolated nucleic acid molecule” which includes a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, the "isolated nucleic acid molecule” (1) is not associated with all or a portion of a polynucleotide in which the "isolated nucleic acid molecule” is found in nature, (2) is operably linked to a polynucleotide wliich it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence.
• the isolated nucleic acid molecule may be present in single-stranded or double-stranded form.
• the nucleic acid When a nucleic acid molecule is to be utilized to express a protein, the nucleic acid contains at a minimum, the sense or coding strand (i.e., the nucleic acid may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the nucleic acid may be double-stranded).
• wild-type refers to a gene or gene product that has the characteristics of that gene or gene product isolated from a naturally occurring source.
• a wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the "wild-type” form of the gene.
• mutant refers to a gene or gene product that displays modifications in sequence and/or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
• the term "recombinant DNA molecule” means a hybrid DNA sequence comprising at least two nucleotide sequences not normally found together in nature.
• vector is used in reference to nucleic acid molecules into which fragments of DNA may be inserted or cloned and can be used to transfer DNA segment(s) into a cell and capable of replication in a cell. Vectors may be derived from plasmids, bacteriophages, viruses, cosmids, and the like.
• the terms "recombinant vector”, “expression vector” or “construct” as used herein refer to DNA or RNA sequences containing a desired coding sequence and appropriate DNA or RNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism.
• Prokaryotic expression vectors include a promoter, a ribosome binding site, an origin of replication for autonomous replication in a host cell and possibly other sequences, e.g. an optional operator sequence, optional restriction enzyme sites.
• a promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and to initiate RNA synthesis.
• Eukaryotic expression vectors include a promoter, optionally a polyadenylation signal and optionally an enhancer sequence.
• a polynucleotide having a nucleotide sequence "encoding a peptide, protein or polypeptide” means a nucleic acid sequence comprising the coding region of a gene, or a fragment thereof which encodes a gene product having substantially the same activity as the corresponding full-length peptide, protein or polypeptide.
• the coding region may be present in either a cDNA, genomic DNA or RNA form.
• the oligonucleotide may be single-stranded (i.e., the sense strand) or double-stranded.
• Suitable control elements such as enhancers/promoters, splice junctions, polyadenylation signals, etc.
• the coding region utilized in the expression vectors of the present invention may contain endogenous enhancers/promoters, splice junctions, intervening sequences, polyadenylation signals, etc.
• the coding region may contain a combination of both endogenous and exogenous control elements.
• transcription regulatory element refers to a genetic element or sequence that controls some aspect of the expression of nucleic acid sequence(s).
• a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region.
• Other regulatory elements include, but are not limited to, transcription factor binding sites, splicing signals, polyadenylation signals, termination signals and enhancer elements.
• Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription.
• Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells.
• Promoter and enhancer elements have also been isolated from viruses and analogous control elements, such as promoters, are also found in prokaryotes. The selection of a particular promoter and enhancer depends on the cell type used to express the protein of interest. Some eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types.
• the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been widely used for the expression of proteins in mammalian cells.
• Two other examples of promoter/enhancer elements active in a broad range of mammalian cell types are those from the human elongation factor 1 gene (Uetsuki et al., 1989; Kim et al., 1990; and Mizushima and Nagata, 1990) and the long terminal repeats of the Rous sarcoma virus (Gorman et al., 1982); and the human cytomegalovirus (Boshart et al., 1985).
• promoter/enhancer denotes a segment of DNA containing sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element as described above).
• promoter/promoter may be "endogenous” or “exogenous” or “heterologous.”
• An “endogenous” enhancer/promoter is one that is naturally linked with a given gene in the genome.
• an “exogenous” or “heterologous” enhancer/promoter is one that is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of the gene is directed by the linked enhancer/promoter.
• Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook et al., 1989).
• a commonly used splice donor and acceptor site is the splice junction from the 16S RNA of SV40.
• Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.
• the term "poly(A) site” or "poly(A) sequence” as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable, as transcripts lacking a poly(A) tail are unstable and are rapidly degraded.
• the poly(A) signal utilized in an expression vector may be "heterologous” or "endogenous.”
• An endogenous poly(A) signal is one that is found naturally at the 3' end of the coding region of a given gene in the genome.
• a heterologous poly(A) signal is one which has been isolated from one gene and positioned 3' to another gene.
• a commonly used heterologous poly(A) signal is the SV40 poly(A) signal.
• the SV40 poly(A) signal is contained on a 237 bp Bam ⁇ . VBcl I restriction fragment and directs both termination and polyadenylation (Sambrook et al., 1989).
• Eukaryotic expression vectors may also contain "viral replicons "or "viral origins of replication.”
• Viral replicons are viral DNA sequences which allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors.
• Vectors containing either the S V40 or polyoma virus origin of replication replicate to high copy number (up to 10 4 copies/cell) in cells that express the appropriate viral T antigen.
• vectors containing the replicons from bovine papillomavirus or Epstein-Barr virus replicate extrachromosomally at low copy number (about 100 copies/cell).
• the term "in vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment.
• in vitro environments include, but are not limited to, test tubes and cell lysates.
• in situ refers to cell culture.
• in vivo refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
• expression system refers to any assay or system for determining (e.g., detecting) the expression of a gene of interest.
• Those skilled in the field of molecular biology will understand that any of a wide variety of expression systems maybe used.
• a wide range of suitable mammalian cells are available from a wide range of sources (e.g., the American Type Culture
• Expression systems include in vitro gene expression assays where a gene of interest (e.g., a reporter gene) is linked to a regulatory sequence and the expression of the gene is monitored following treatment with an agent that inhibits or induces expression of the gene. Detection of gene expression can be through any suitable means including, but not limited to, detection of expressed mRNA or protein (e.g., a detectable product of a reporter gene) or through a detectable change in the phenotype of a cell expressing the gene of interest.
• a gene of interest e.g., a reporter gene
• Detection of gene expression can be through any suitable means including, but not limited to, detection of expressed mRNA or protein (e.g., a detectable product of a reporter gene) or through a detectable change in the phenotype of a cell expressing the gene of interest.
• Expression systems may also comprise assays where a cleavage event or other nucleic acid or cellular change is detected.
• gene refers to a DNA sequence that comprises coding sequences and optionally control sequences necessary for the production of a polypeptide from the DNA sequence.
• the polypeptide can be encoded by a full- length coding sequence or by any portion of the coding sequence so long as the portion encodes a gene product with substantially the same activity as the full- length polypeptide.
• Nucleic acids are known to contain different types of mutations.
• a "point" mutation refers to an alteration in the sequence of a nucleotide at a single base position from the wild-type sequence. Mutations may also refer to insertion or deletion of one or more bases, so that the nucleic acid sequence differs from a reference, e.g., a wild-type, sequence.
• hybridize and “hybridization” refer to the annealing of a complementary sequence to the target nucleic acid, i.e., the ability of two polymers of nucleic acid (polynucleotides) containing complementary sequences to anneal through base pairing.
• annealed and “hybridized” are used interchangeably throughout, and are intended to encompass any specific and reproducible interaction between a complementary sequence and a target nucleic acid, including binding of regions having only partial complementarity.
• Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine.
• nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the complementary sequence, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
• the stability of a nucleic acid duplex is measured by the melting temperature, or "T m ".
• T m melting temperature
• the T m of a particular nucleic acid duplex under specified conditions is the temperature at which on average half of the base pairs have disassociated.
• stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted.
• hybridization conditions are generally evident to one skilled in the art and is usually guided by the purpose of the hybridization, the type of hybridization (DNA-DNA or DNA-RNA), and the level of desired relatedness between the sequences (e.g., Sambrook et al., 1989; Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington D.C, 1985, for a general discussion of the methods).
• the stability of nucleic acid duplexes is known to decrease with an increased number of mismatched bases, and further to be decreased to a greater or lesser degree depending on the relative positions of mismatches in the hybrid duplexes.
• the stringency of hybridization can be used to maximize or minimize stability of such duplexes.
• Hybridization stringency can be altered by: adjusting the temperature of hybridization; adjusting the percentage of helix destabilizing agents, such as formamide, in the hybridization mix; and adjusting the temperature and/or salt concentration of the wash solutions.
• the final stringency of hybridizations often is determined by the salt concentration and/or temperature used for the post-hybridization washes.
• High stringency conditions when used in reference to nucleic acid hybridization include conditions equivalent to binding or hybridization at 42 °C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
• 5X SSPE 43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH
• SDS 5X Denhardt's reagent
• 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42°
• “Medium stringency conditions” when used in reference to nucleic acid hybridization include conditions equivalent to binding or hybridization at 42 °C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
• Low stringency conditions include conditions equivalent to binding or hybridization at 42° C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt's reagent [50X Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V; Sigma)] and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42 °C when a probe of about 500 nucleotides in length is employed.
• nucleic acid molecules of the invention encode a variant (mutant) of a naturally-occurring (wild-type) protein or fragment thereof which has substantially the same activity as the full length mutant protein.
• a mutant protein has an amino acid sequence that is at least 85%, preferably 90%, and most preferably 95% or 99%, identical to the amino acid sequence of a corresponding wild-type protein.
• Polypeptide molecules are said to have an "amino terminus” (N-terminus) and a “carboxy terminus” (C-terminus) because peptide linkages occur between the backbone amino group of a first amino acid residue and the backbone carboxyl group of a second amino acid residue.
• N-terminal and C-terminal in reference to polypeptide sequences refer to regions of polypeptides including portions of the N-terminal and C-terminal regions of the polypeptide, respectively.
• a sequence that includes a portion of the N-terminal region of polypeptide includes amino acids predominantly from the N-terminal half of the polypeptide chain, but is not limited to such sequences.
• an N-terminal sequence may include an interior portion of the polypeptide sequence including bases from both the N-terminal and C-terminal halves of the polypeptide.
• C-terminal regions may, but need not, include the amino acid defining the ultimate N-terminus and C-terminus of the polypeptide, respectively.
• isolated when used in relation to a polypeptide, as in "isolated protein” or “isolated polypeptide” refers to a polypeptide that is identified and separated from at least one contaminant with which it is ordinarily associated in its source.
• an isolated polypeptide (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of human proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.
• non-isolated polypeptides e.g., proteins and enzymes
• isolated polypeptide include a polypeptide, peptide or protein encoded by cDNA or recombinant RNA including one of synthetic origin, or some combination thereof.
• recombinant protein or “recombinant polypeptide” as used herein refers to a protein molecule expressed from a recombinant DNA molecule.
• native protein is used herein to indicate a protein isolated from a naturally occurring (i.e., a nonrecombinant) source. Molecular biological techniques may be used to produce a recombinant form of a protein with identical properties as compared to the native form of the protein.
• fusion polypeptide refers to a chimeric protein containing a protein of interest (e.g., luciferase, an affinity tag or a targeting sequence) joined to a different protem, e.g., a mutant hydrolase.
• a protein of interest e.g., luciferase, an affinity tag or a targeting sequence
• the term "antibody” refers to a protein having one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes.
• the recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad of immunoglobulin variable region genes.
• Light chains are classified as either kappa or lambda.
• Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
• the basic immunoglobulin (antibody) structural unit is known to comprise a tetramer.
• Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kD) and one "heavy” chain (about 50-70 kD).
• the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
• the terms variable light chain (Y ) and variable heavy chain (V # ) refer to these light and heavy chains respectively.
• Antibodies may exist as intact immunoglobulms, or as modifications in a variety of forms including, for example, FabFc 2 , Fab, Fv, Fd, (Fab') 2 , an Fv fragment containing only the light and heavy chain variable regions, a Fab or (Fab)' fragment containing the variable regions and parts of the constant regions, a single-chain antibody, e.g., scFv, CDR-grafted antibodies and the like.
• the heavy and light chain of a Fv may be derived from the same antibody or different antibodies thereby producing a chimeric Fv region.
• the antibody may be of animal (especially mouse or rat) or human origin or may be chimeric or humanized. As used herein the term "antibody" includes these various forms.
• transformed cell is meant a cell into which (or into an ancestor of which) has been introduced a nucleic acid molecule of the invention.
• a nucleic acid molecule of the invention may be introduced into a suitable cell line so as to create a stably transfected cell line capable of producing the protein or polypeptide encoded by the nucleic acid molecule.
• Vectors, cells, and methods for constructing such cell lines are well known in the art.
• the words “transformants” or “transformed cells” include the primary transformed cells derived from the originally transformed cell without regard to the number of transfers.
• progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Nonetheless, mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.
• the term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). Homology is often measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group. University of Wisconsin Biotechnology Center. 1710 University Avenue. Madison, WI 53705). Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, insertions, and other modifications.
• Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
• purified or “to purify” means the result of any process that removes some of a contaminant from the component of interest, such as a protein or nucleic acid. The percent of a purified component is thereby increased in the sample.
• operably linked refers to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced.
• the term also refers to the linkage of sequences encoding amino acids in such a manner that a functional (e.g., enzymatically active, capable of binding to a binding partner, capable of inhibiting, etc.) protein or polypeptide, or a precursor thereof, e.g., the pre- or prepro-form of the protein or polypeptide, is produced.
• poly-histidine tract refers to a molecule comprising two to ten histidine residues, e.g., a poly-histidine tract of five to ten residues.
• a poly-histidine tract allows the affinity purification of a covalently linked molecule on an immobilized metal, e.g., nickel, zinc, cobalt or copper, chelate column or through an interaction with another molecule (e.g., an antibody reactive with the His tag).
• pure means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present.
• a substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, about 90%, about 95%, and about 99%.
• the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.
• Mutant hydrolases within the scope of the invention include but are not limited to those prepared via recombinant techniques, e.g., site-directed mutagenesis or recursive mutagenesis, and comprise one or more amino acid substitutions which render the mutant hydrolase capable of forming a stable, e.g., covalent, bond with a substrate, such as a substrate modified to contain one or more functional groups, for a corresponding nonmutant (wild-type) hydrolase.
• Hydrolases within the scope of the invention include, but are not limited to, peptidases, esterases (e.g., cholesterol esterase), glycosidases (e.g., glucosamylase), phosphatases (e.g., alkaline phosphatase) and the like.
• esterases e.g., cholesterol esterase
• glycosidases e.g., glucosamylase
• phosphatases e.g., alkaline phosphatase
• hydrolases include, but are not limited to, enzymes acting on ester bonds such as carboxylic ester hydrolases, thiolester hydrolases, phosphoric monoester hydrolases, phosphoric diester hydrolases, triphosphoric monoester hydrolases, sulfuric ester hydrolases, diphosphoric monoester hydrolases, phosphoric triester hydrolases, exodeoxyribonucleases producing 5'- phosphomonoesters, exoribonucleases producing 5'-phos ⁇ homonoesters, exoribonucleases producing 3'-phosphomonoesters, exonucleases active with either ribo- or deoxyribonucleic acid, exonucleases active with either ribo- or deoxyribonucleic acid, endodeoxyribonucleases producing 5'- phosphomonoesters, endodeoxyribonucleases producing other than 5'- phosphomonoesters, site-specific endodeoxyribon
• hydrolases acting on halide bonds include, but are not limited to, alkylhalidase, 2-haloacid dehalogenase, haloacetate dehalogenase, thyroxine deiodinase, haloalkane dehalogenase, 4-chlorobenzoate dehalogenase, 4-chlorobenzoyl-CoA dehalogenase, and atrazine chlorohydrolase.
• hydrolases that act on carbon-nitrogen bonds in cyclic amides include, but are not limited to, barbirurase, dihydropyrimidinase, dihydroorotase, carboxymethylhydantoinase, allantoinase, ⁇ -lactamase, imidazolonepropionase, 5-oxoprolinase (ATP- hydrolysing), creatininase, L-lysine-lactamase, 6-aminohexanoate-cyclic-dimer hydrolase, 2,5-dioxopiperazine hydrolase, N-methylhydantoinase (ATP- hydrolysing), cyanuric acid amidohydrolase, maleimide hydrolase.
• Beta- lactamase as used herein includes Class A, Class C and Class D beta-lactamases as well as D-ala carboxypeptidase/transpeptidase, esterase EstB, penicillin binding protein 2X, penicillin binding protein 5, and D-amino peptidase.
• the beta-lactamase is a serine beta-lactamase, e.g., one having a catalytic serine residue at a position corresponding to residue 70 in the serine beta-lactamase of S. aureus PCI, and a glutamic acid residue at a position corresponding to residue 166 in the serine beta-lactamase of S.
• the mutant hydrolase is a haloalkane dehalogenase, e.g., such as those found in Gram-negative (Keuning et al., 1985) and Gram- positive haloalkane-utilizing bacteria (Keuning et al., 1985; Yokota et al., 1987; Scholtz et al., 1987; Sallis et al., 1990).
• Haloalkane dehalogenases including DhlA from Xanthobacter autotrophicus GJ10 (Janssen et al., 1988, 1989) and DhaA from Rhodococcus rhodochrous, are enzymes wliich catalyze hydrolytic dehalogenation of corresponding hydrocarbons.
• Halogenated aliphatic hydrocarbons subject to conversion include C 2 -C 10 saturated aliphatic hydrocarbons which have one or more halogen groups attached, wherein at least two of the halogens are on adjacent carbon atoms.
• Such aliphatic hydrocarbons include volatile chlorinated aliphatic (VGA) hydrocarbons.
• VGA's include, for example, aliphatic hydrocarbons such as dichloroethane, 1,2-dichloro- ⁇ ropane, 1,2-dichlorobutane and 1,2,3-trichloropro ⁇ ane.
• halogenated hydrocarbon as used herein means a halogenated aliphatic hydrocarbon.
• halogen includes chlorine, bromine, iodine, fluorine, astatine and the like.
• a preferred halogen is chlorine.
• the invention includes a fusion protein comprising a mutant hydrolase and amino acid sequences for a protein of interest, e.g., sequences for a marker protein or affinity tag, e.g., luciferase, GFP, or a polyhistidine sequence, a nucleic acid binding protein, an extracellular matrix protein, a secreted protein, a receptor ligand, a serum protein, an immunogenic protein, a fluorescent protein, a protein with reactive cysteines, a receptor protein, e.g., NMDA receptor, a channel protein, e.g., a sodium-, potassium- or a calcium-sensitive channel protein including a HERG channel protein, or a transporter protein, e.g., EAAT1-4 glutamate transporter, as well as targeting signals, e.g., a plastid targeting signal, a nuclear localization signal or a myristilation sequence.
• a marker protein or affinity tag e.g., luciferase, G
• a nucleic acid molecule comprising a nucleic acid sequence encoding a hydrolase or a fusion thereof is optionally optimized for expression in a particular host cell and also optionally operably linked to transcription regulatory sequences, e.g., one or more enhancers, a promoter, a transcription termination sequence or a combination thereof, to form an expression cassette.
• transcription regulatory sequences e.g., one or more enhancers, a promoter, a transcription termination sequence or a combination thereof
• a nucleic acid sequence encoding a hydrolase or a fusion thereof is optimized by replacing codons in a wild-type or mutant hydrolase sequence with codons which are preferentially employed in a particular (selected) cell.
• Preferred codons have a relatively high codon usage frequency in a selected cell, and preferably their introduction results in the introduction of relatively few transcription factor binding sites for transcription factors present in the selected host cell, and relatively few other undesirable structural attributes.
• the optimized nucleic acid product has an improved level of expression due to improved codon usage frequency, and a reduced risk of inappropriate transcriptional behavior due to a reduced number of undesirable transcription regulatory sequences.
• An isolated and optimized nucleic acid molecule of the invention may have a codon composition that differs from that of the corresponding wild-type nucleic acid sequence at more than 30%, 35%, 40% or more than 45%, e.g., 50%, 55%, 60% or more of the codons.
• Preferred codons for use in the invention are those wliich are employed more frequently than at least one other codon for the same amino acid in a particular organism and, more preferably, are also not low-usage codons in that organism and are not low-usage codons in the organism used to clone or screen for the expression of the nucleic acid molecule.
• preferred codons for certain amino acids may include two or more codons that are employed more frequently than the other (non-preferred) codon(s).
• the presence of codons in the nucleic acid molecule that are employed more frequently in one organism than in another organism results in a nucleic acid molecule which, when introduced into the cells of the organism that employs those codons more frequently, is expressed in those cells at a level that is greater than the expression of the wild-type or parent nucleic acid sequence in those cells.
• the codons that are different are those employed more frequently in a mammal, while in another embodiment the codons that are different are those employed more frequently in a plant.
• Preferred codons for different organisms are known to the art, e.g., see www.kazusa.or.ip./codon/.
• a particular type of mammal e.g., a human, may have a different set of preferred codons than another type of mammal.
• a particular type of plant may have a different set of preferred codons than another type of plant.
• the majority of the codons that differ are ones that are preferred codons in a desired host cell.
• preferred codons for organisms including mammals (e.g., humans) and plants are known to the art (e.g., Wada et al., 1990; Ausubel et al., 1997).
• preferred human codons include, but are not limited to, CGC (Arg), CTG (Leu), TCT (Ser), AGC (Ser), ACC (Thr), CCA (Pro), CCT (Pro), GCC (Ala), GGC (Gly), GTG (Val), ATC (He), ATT (He), AAG (Lys), AAC (Asn), CAG (Gin), CAC (His), GAG (Glu), GAC (Asp), TAC (Tyr), TGC (Cys) and TTC (Phe) (Wada et al., 1990).
• synthetic nucleic acid molecules of the invention have a codon composition which differs from a wild type nucleic acid sequence by having an increased number of the preferred human codons, e.g., CGC, CTG, TCT, AGC, ACC, CCA, CCT, GCC, GGC, GTG, ATC, ATT, AAG, AAC, CAG, CAC, GAG, GAC, TAC, TGC, TTC, or any combination thereof.
• the preferred human codons e.g., CGC, CTG, TCT, AGC, ACC, CCA, CCT, GCC, GGC, GTG, ATC, ATT, AAG, AAC, CAG, CAC, GAG, GAC, TAC, TGC, TTC, or any combination thereof.
• the nucleic acid molecule of the invention may have an increased number of CTG or TTG leucine-encoding codons, GTG or GTC valine-encoding codons, GGC or GGT glycine-encoding codons, ATC or ATT isoleucine-encoding codons, CCA or CCT proline-encoding codons, CGC or CGT arginine-encoding codons, AGC or TCT serine-encoding codons, ACC or ACT threonine-encoding codon, GCC or GCT alanine-encoding codons, or any combination thereof, relative to the wild-type nucleic acid sequence.
• preferred C preferred C.
• elegans codons include, but are not limited, to UUC (Phe), UUU (Phe), CUU (Leu), UUG (Leu), AUU (He), GUU (Val), GUG (Val), UCA (Ser), UCU (Ser), CCA (Pro), ACA (Thr), ACU (Thr), GCU (Ala), GCA (Ala), UAU (Tyr), CAU (His), CAA (Gin), AAU (Asn), AAA (Lys), GAU (Asp), GAA (Glu), UGU (Cys), AGA (Arg), CGA (Arg), CGU (Arg), GGA (Gly), or any combination thereof.
• preferred Drosophilia codons include, but are not limited to, UUC (Phe), CUG (Leu), CUC (Leu), AUC (He), AUU (He), GUG (Val), GUC (Val), AGC (Ser), UCC (Ser), CCC (Pro), CCG (Pro), ACC (Thr), ACG (Thr), GCC (Ala), GCU (Ala), UAC (Tyr), CAC (His), CAG (Gin), AAC (Asn), AAG (Lys), GAU (Asp), GAG (Glu), UGC (Cys), CGC (Arg), GGC (Gly), GGA (gly), or any combination thereof.
• Preferred yeast codons include but are not limited to UUU (Phe), UUG (Leu), UUA (Leu), CCU (Leu), AUU (He), GUU (Val), UCU (Ser), UCA (Ser), CCA (Pro), CCU (Pro), ACU (Thr), ACA (Thr), GCU (Ala), GCA (Ala), UAU (Tyr), UAC (Tyr), CAU (His), CAA (Gin), AAU (Asn), AAC (Asn), AAA (Lys), AAG (Lys), GAU (Asp), GAA (Glu), GAG (Glu), UGU (Cys), CGU (Trp), AGA (Arg), CGU (Arg), GGU (Gly), GGA (Gly), or any combination thereof.
• nucleic acid molecules having an increased number of codons that are employed more frequently in plants have a codon composition which differs from a wild-type or parent nucleic acid sequence by having an increased number of the plant codons including, but not limited to, CGC (Arg), CTT (Leu), TCT (Ser), TCC (Ser), ACC (Thr), CCA (Pro), CCT (Pro), GCT (Ser), GGA (Gly), GTG (Val), ATC (He), ATT (He), AAG (Lys), AAC (Asn), CAA (Gin), CAC (His), GAG (Glu), GAC (Asp), TAC (Tyr), TGC (Cys), TTC (Phe), or any combination thereof (Murray et al., 1989).
• Preferred codons may differ for different types of plants (Wada et al., 1990).
• an optimized nucleic acid sequence encoding a hydrolase or fusion thereof has less than 100%, e.g., less than 90% or less than 80%, nucleic acid sequence identity relative to a non-optimized nucleic acid sequence encoding a corresponding hydrolase or fusion thereof.
• an optimized nucleic acid sequence encoding DhaA has less than about 80% nucleic acid sequence identity relative to non-optimized (wild-type) nucleic acid sequence encoding a corresponding DhaA, and the DhaA encoded by the optimized nucleic acid sequence optionally has at least 85% amino acid sequence identity to a corresponding wild-type DhaA.
• the activity of a DhaA encoded by the optimized nucleic acid sequence is at least 10%, e.g., 50% or more, of the activity of a DhaA encoded by the non-optimized sequence, e.g., a mutant DhaA encoded by the optimized nucleic acid sequence binds a substrate with substantially the same efficiency, i.e., at least 50%, 80%, 100% or more, as the mutant DhaA encoded by the non-optimized nucleic acid sequence binds the same substrate.
• the nucleic acid molecule or expression cassette may be introduced to a vector, e.g., a plasmid or viral vector, which optionally includes a selectable marker gene, and the vector introduced to a cell of interest, for example, a prokaryotic cell such as E. coli, Streptomyces spp., Bacillus spp., Staphylococcus spp. and the like, as well as eukaryotic cells including a plant (dicot or monocot), fungus, yeast, e.g., Pichia, Saccharomyces or Schizosaccharomyces, or mammalian cell.
• a vector e.g., a plasmid or viral vector, which optionally includes a selectable marker gene
• a cell of interest for example, a prokaryotic cell such as E. coli, Streptomyces spp., Bacillus spp., Staphylococcus spp. and the like, as well as
• Preferred mammalian cells include bovine, caprine, ovine, canine, feline, non-human primate, e.g., simian, and human cells.
• Preferred mammalian cell lines include, but are not limited to, CHO, COS, 293, Hela, CV- 1, SH-SY5Y (human neuroblastoma cells), HEK293, and NIH3T3 cells.
• the expression of the encoded mutant hydrolase may be controlled by any promoter capable of expression in prokaryotic cells or eukaryotic cells.
• Preferred prokaryotic promoters include, but are not limited to, SP6, T7, T5, tac, bla, trp, gal, lac or maltose promoters.
• Preferred eukaryotic promoters include, but are not limited to, constitutive promoters, e.g., viral promoters such as CMV, SV40 and RSV promoters, as well as regulatable promoters, e.g., an inducible or repressible promoter such as the tet promoter, the hsp70 promoter and a synthetic promoter regulated by CRE.
• Preferred vectors for bacterial expression include pGEX-5X-3, and for eukaryotic expression include pCrneo-CMV.
• nucleic acid molecule, expression cassette and/or vector of the invention may be introduced to a cell by any method including, but not limited to, calcium-mediated transformation, elecfroporation, microinjection, lipofection, particle bombardment and the like. III. Functional Groups
• Functional groups useful in the substrates and methods of the invention are molecules that are detectable or capable of detection.
• a functional group within the scope of the invention is capable of being covalently linked to one reactive substituent of a bifunctional linker or a substrate for a hydrolase, and, as part of a substrate of the invention, has substantially the same activity as a functional group which is not linked to a substrate found in nature and is capable of forming a stable complex with a mutant hydrolase.
• Functional groups thus have one or more properties that facilitate detection, and optionally the isolation, of stable complexes between a substrate having that functional group and a mutant hydrolase.
• functional groups include those with a characteristic electromagnetic spectral property such as emission or absorbance, magnetism, electron spin resonance, electrical capacitance, dielectric constant or electrical conductivity as well as functional groups which are ferromagnetic, paramagnetic, diamagnetic, luminescent, electrochemiluminescent, fluorescent, phosphorescent, chromatic, antigenic, or have a distinctive mass.
• a functional group includes, but is not limited to, a nucleic acid molecule, i.e., DNA or RNA, e.g., an oligonucleotide or nucleotide, a protein, e.g., a luminescent protein, a peptide, for instance, an epitope recognized by a ligand, e.g., biotin or streptavidin, a hapten, an amino acid, a lipid, a lipid bilayer, a solid support, a fluorophore, a chromophore, a reporter molecule, a radionuclide, an electron opaque molecule, a MRI contrast agent, e.g., manganese, gadolinium (III) or iron-oxide particles, and the like.
• a nucleic acid molecule i.e., DNA or RNA
• a protein e.g., a luminescent protein
• a peptide for instance, an epi
• a nucleic acid molecule can be detected by hybridization, amplification, binding to a nucleic acid binding protein specific for the nucleic acid molecule, enzymatic assays (e.g., if the nucleic acid molecule is a ribozyme), or, if the nucleic acid molecule itself comprises a molecule which is detectable or capable of detection, for instance, a radiolabel or biotin, it can be detected by an assay suitable for that molecule.
• enzymatic assays e.g., if the nucleic acid molecule is a ribozyme
• the nucleic acid molecule itself comprises a molecule which is detectable or capable of detection, for instance, a radiolabel or biotin, it can be detected by an assay suitable for that molecule.
• Exemplary functional groups include haptens, e.g., molecules useful to enhance immunogenicity such as keyhole limpet hemacyanin (KLH), cleavable labels, for instance, photocleavable biotin, and fluorescent labels, e.g., N- hydroxysuccinimide (NHS) modified coumarin and succinimide or sulfonosuccinimide modified BODIPY (which can be detected by UV and/or visible excited fluorescence detection), rhodamine, e.g., R110, rhodols, CRG6, Texas Methyl Red (TAMRA), Rox5, FAM, or fluoroscein, coumarin derivatives, e.g., 7 aminocoumarin, and 7-hydroxycoumarin, 2-amino-4-methoxynapthalene, 1-hydroxypyren ⁇ , resoruf ⁇ n, phenalenones or benzphenalenones (U.S.
• KLH keyhole
• Patent No. 4,812,409 acridinones (U.S. Patent No. 4,810,636), anthracenes, and derivatives of ⁇ - and ⁇ -napthol, fluorinated xanthene derivatives including fluorinated fluoresceins and rhodols (e.g., U.S. Patent No. 6,162,931), and bioluminescent molecules, e.g., luciferase or GFP.
• a fluorescent (or bioluminescent) functional group linked to a mutant hydrolase by virtue of being linked to a substrate for a corresponding wild-type hydrolase, may be used to sense changes in a system, like phosphorylation, in real time.
• a fluorescent molecule such as a chemosensor of metal ions, e.g., a 9- carbonylanthracene modified glycyl-histidyl-lysine (GHK) for Cu
• a substrate of the invention may be employed to label proteins which bind the substrate.
• a bioluminescent or fluorescent functional group such as BODIPY, rhodamine green, GFP, or infrared dyes, also finds use as a functional group and may, for instance, be employed in interaction studies, e.g., using BRET, FRET, LRET or electrophoresis.
• Another class of functional group is a molecule that selectively interacts with molecules containing acceptor groups (an "affinity" molecule).
• an affinity molecule a substrate for a hydrolase which includes an affinity molecule can facilitate the separation of complexes having such a substrate and a mutant hydrolase, because of the selective interaction of the affinity molecule with another molecule, e.g., an acceptor molecule, that may be biological or non-biological in origin.
• the specific molecule with which the affinity molecule interacts referred to as the acceptor molecule
• the acceptor molecule could be a small organic molecule, a chemical group such as a sulfhydryl group (-SH) or a large biomolecule such as an antibody or other naturally occurring ligand for the affinity molecule.
• the binding is normally chemical in nature and may involve the formation of covalent or non-covalent bonds or interactions such as ionic or hydrogen bonding.
• the acceptor molecule might be free in solution or itself bound to a solid or semi-solid surface, a polymer matrix, or reside on the surface of a solid or semi-solid substrate.
• the interaction may also be triggered by an external agent such as light, temperature, pressure or the addition of a chemical or biological molecule that acts as a catalyst.
• the detection and/or separation of the complex from the reaction mixture occurs because of the interaction, normally a type of binding, between the affinity molecule and the acceptor molecule.
• affinity molecules include molecules such as immunogenic molecules, e.g., epitopes of proteins, peptides, carbohydrates or lipids, i.e., any molecule which is useful to prepare antibodies specific for that molecule; biotin, avidin, streptavidin, and derivatives thereof; metal binding molecules; and fragments and combinations of these molecules.
• affinity molecules include His5 (HHHHH) (SEQ ID NO: 19), HisX6 (HHHHHH) (SEQ ID NO:20), C-myc (EQKLISEEDL) (SEQ ID NO:21), Flag (DYKDDDDK) (SEQ ID NO:22), SteptTag (WSHPQFEK) (SEQ ID NO:23), HA Tag (YPYDVPDYA) (SEQ ID NO:24), thioredoxin, cellulose binding domain, chitin binding domain, S-peptide, T7 peptide, calmodulin binding peptide, C-end RNA tag, metal binding domains, metal binding reactive groups, amino acid reactive groups, inteins, biotin, streptavidin, and maltose binding protein.
• a substrate for a hydrolase wliich includes biotin is contacted with a mutant hydrolase.
• the presence of the biotin in a complex between the mutant hydrolase and the substrate permits selective binding of the complex to avidin molecules, e.g., streptavidin molecules coated onto a surface, e.g., beads, microwells, nitrocellulose and the like.
• Suitable surfaces include resins for chromatographic separation, plastics such as tissue culture surfaces or binding plates, microtiter dishes and beads, ceramics and glasses, particles including magnetic particles, polymers and other matrices.
• the treated surface is washed with, for example, phosphate buffered saline (PBS), to remove molecules that lack biotin and the biotin-containing complexes isolated.
• PBS phosphate buffered saline
• these materials may be part of biomolecular sensing devices such as optical fibers, chemfets, and plasmon detectors.
• an affinity molecule is dansyllysine.
• Antibodies which interact with the dansyl ring are commercially available (Sigma Chemical; St. Louis, MO) or can be prepared using known protocols such as described in Antibodies: A Laboratory Manual (Harlow and Lane, 1988).
• the anti-dansyl antibody is immobilized onto the packing material of a chromatographic column. This method, affinity column chromatography, accomplishes separation by causing the complex between a mutant hydrolase and a substrate of the invention to be retained on the column due to its interaction with the immobilized antibody, while other molecules pass through the column. The complex may then be released by disrupting the antibody- antigen interaction.
• chromatographic column materials such as ion- exchange or affinity Sepharose, Sephacryl, Sephadex and other chromatography resins are commercially available (Sigma Chemical; St. Louis, MO; Pharmacia Biotech; Piscataway, N. J.). Dansyllysine may conveniently be detected because of its fluorescent properties.
• separation can also be performed through other biochemical separation methods such as immunoprecipitation and immobilization of antibodies on filters or other surfaces such as beads, plates or resins.
• complexes of a mutant hydrolase and a substrate of the invention may be isolated by coating magnetic beads with an affinity molecule-specific or a hydrolase-specific antibody. Beads are oftentimes separated from the mixture using magnetic fields.
• Another class of functional molecules includes molecules detectable using electromagnetic radiation and includes but is not limited to xanthene fluorophores, dansyl fluorophores, coumarins and coumarin derivatives, fluorescent acridinium moieties, benzopyrene based fluorophores, as well as 7- nitrobenz-2-oxa- 1 ,3 -diazole, and 3 -N-(7-nitrobenz-2-oxa- 1 ,3 -diazol-4-yl)-2,3 - diamino-propionic acid.
• the fluorescent molecule has a high quantum yield of fluorescence at a wavelength different from native amino acids and more preferably has high quantum yield of fluorescence that can be excited in the visible, or in both the UV and visible, portion of the spectrum.
• the molecule Upon excitation at a preselected wavelength, the molecule is detectable at low concentrations either visually or using conventional fluorescence detection methods.
• Electrochemiluminescent molecules such as ruthenium chelates and its derivatives or nitroxide amino acids and their derivatives are detectable at femtomolar ranges and below.
• a variety of molecules with physical properties based on the interaction and response of the molecule to electromagnetic fields and radiation can be used to detect complexes between a mutant hydrolase and a substrate of the invention. These properties include absorption in the UV, visible and infrared regions of the electromagnetic spectrum, presence of chromophores which are Raman active, and can be further enhanced by resonance Raman spectroscopy, electron spin resonance activity and nuclear magnetic resonances and molecular mass, e.g., via a mass spectrometer.
• Methods to detect and/or isolate complexes having affinity molecules include chromatographic techniques including gel filtration, fast-pressure or high-pressure liquid chromatography, reverse-phase chromatography, affinity chromatography and ion exchange chromatography.
• Other methods of protein separation are also useful for detection and subsequent isolation of complexes between a mutant hydrolase and a substrate of the invention, for example, electrophoresis, isoelectric focusing and mass spectrometry.
• Linkers including gel filtration, fast-pressure or high-pressure liquid chromatography, reverse-phase chromatography, affinity chromatography and ion exchange chromatography.
• linker refers to a group or groups that covalently attach one or more functional groups to a substrate which includes a reactive group or to a reactive group.
• a linker as used herein, is not a single covalent bond.
• the structure of the linker is not crucial, provided it yields a substrate that can be bound by its target enzyme.
• the linker can be a divalent group that separates a functional group (R) and the reactive group by about 5 angstroms to about 1000 angstroms, inclusive, in length.
• linkers include linkers that separate R and the reactive group by about 5 angstroms to about 100 angstroms, as well as linkers that separate R and the substrate by about 5 angstroms to about 50 angstroms, by about 5 angstroms to about 25 angstroms, by about 5 angstroms to about 500 angstroms, or by about 30 angstroms to about 100 angstroms.
• the linker is an amino acid.
• the linker is a peptide.
• the linker is a divalent branched or unbranched carbon chain comprising from about 2 to about 30 carbon atoms, which chain optionally includes one or more (e.g., 1 , 2, 3, or 4) double or triple bonds.
• the linker is a divalent branched or unbranched carbon chain comprising from about 2 to about 30 carbon atoms.
• the linker is a divalent branched or unbranched carbon chain comprising from about 2 to about 20 carbon atoms, which chain optionally includes one or more (e.g., 1, 2, 3, or 4) double or triple bonds.
• (C ! -C 3 o)alkyl can be methyl, ethyl, propyl, isopropyl, butyl, iso-butyl, sec-butyl, pentyl, 3-pentyl, hexyl, heptyl, octyl, nonyl, or decyl;
• (C 3 - C 8 )cycloalkyl can be cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl;
• (C 2 - C 3 o)alkenyl can be vinyl, allyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, 3- butenyl, 1,-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1- hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl
• amino acid when used with reference to a linker, comprises the residues of the natural amino acids (e.g., Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Hyl, Hyp, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val) in D or L form, as well as unnatural amino acids (e.g., phosphoserine, phosphothreonine, phosphotyrosine, hydroxyproline, gamma-carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, l,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine, ornithine, citruline, ⁇ -methyl-alanine, para-benzoylphenylalanine, phenylglycine, propargylglycine, sarco
• the term also includes natural and unnatural amino acids bearing a conventional amino protecting group (e.g., acetyl or benzyloxycarbonyl), as well as natural and unnatural amino acids protected at the carboxy terminus (e.g. as a ( -C ⁇ alkyl, phenyl or benzyl ester or amide).
• a conventional amino protecting group e.g., acetyl or benzyloxycarbonyl
• natural and unnatural amino acids protected at the carboxy terminus e.g. as a ( -C ⁇ alkyl, phenyl or benzyl ester or amide.
• Other suitable amino and carboxy protecting groups are known to those skilled in the art (see for example, Greene, Protecting Groups In Organic Synthesis; Wiley: New York, 1981, and references cited therein).
• An amino acid can be linked to another molecule through the carboxy terminus, the amino terminus, or through any other convenient point of attachment, such as, for example, through the sulfur of
• peptide when used with reference to a linker, describes a sequence of 2 to 25 amino acids (e.g. as defined hereinabove) or peptidyl residues.
• the sequence may be linear or cyclic.
• a cyclic peptide can be prepared or may result from the formation of disulfide bridges between two cysteine residues in a sequence.
• a peptide can be linked to another molecule through the carboxy terminus, the amino terminus, or through any other convenient point of attachment, such as, for example, through the sulfur of a cysteine.
• a peptide comprises 3 to 25, or 5 to 21 amino acids.
• Peptide derivatives can be prepared as disclosed in U.S. Patent Numbers 4,612,302; 4,853,371; and 4,684,620. Peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right.
• a substrate of the invention for a dehalogenase which has a linker has the formula (I):
• A-X is a haloaliphatic or haloaromatic substrate for a dehalogenase.
• A is CH CH 2 or CH 2 CH 2 CH 2 .
• a linker in a subsfrate for a dehalogenase such as a Rhodococcus dehalogenase, is a multiatom straight or branched chain including C, N, S, or O, and preferably 11-30 atoms when the functional group R includes an aromatic ring system or is a solid support.
• a substrate of the invention for a dehalogenase which has a linker has formula (II):
• R is one or more functional groups, such as a fluorophore, biotin, luminophore, or a fluorogenic or luminogenic molecule, or is a solid support, including microspheres, membranes, glass beads, and the like.
• R is a radiolabel, or a small detectable atom such as a spectroscopically active isotope
• the linker can be 0-30 atoms.
• the CH 2 C1 2 reaction mixture was then washed with a 2% sodium hydroxide (w/w) solution until noj->-nitrophenol was observed in the organic layer.
• the dichloromethane was dried with sodium sulfate, filtered, and evaporated under reduced pressure.
• Triethylammonium 3- [5- [2-(4-tert-Butyl-7-diethylan ⁇ ino-chromen-2- ylidene)-ethylidene]-3-(5- ⁇ 2-[2-(6-chlorohexyloxy)-ethoxy]-ethylcarbamoyl ⁇ - pentyl)-2 ? 4,6-trioxo-tetrahydro ⁇ yriinidin-l-yl]-propane-l-sulfonic cid anion.
• the title compound was prepared using the above methodology. Purification was accomplished using preparative scale HPLC. Mass spectrum, m/e Calcd for C 42 H 62 C1N 4 O 10 S": 849.4(100%), 850.4(48.8%), 851.4(36.4%). Found: 849.6, 850.5, 851.5.
• 2-(2- ⁇ 2-[2-(2-Chloroethoxy)-ethoxy]-ethoxy ⁇ -ethyl)-isoindole-l,3-dione 2-(2- ⁇ 2-[2-(2-Hydroxy-ethoxy)-ethoxy]-ethoxy ⁇ -ethyl)-isoindole-l,3-dione (0.5 g, 1.55 mmol) was prepared by the method of Nielsen, J. and Janda, K.D. (Methods: A Companion to Methods in Enzymology 6, 361-371 (1994)).
• a mutant hydrolase and a corresponding subsfrate which includes a functional group are employed to label a cell, e.g., a cell in an organism or cell culture, or a cellular component.
• a cell e.g., a cell in an organism or cell culture, or a cellular component.
• cells are contacted with a vector encoding the mutant hydrolase, such as one encoding a fusion between the mutant hydrolase and a nuclear localization signal.
• the expression of the vector in the cell may be transient or stable.
• the cell is contacted with a substrate of the invention recognized by the mutant hydrolase.
• cells are concurrently contacted with the vector and the substrate.
• the substrates of the invention are preferably soluble in an aqueous or mostly aqueous solution, including water and aqueous solutions having a pH greater than or equal to about 6. Stock solutions of substrates of the invention, however, may be dissolved in organic solvent before diluting into aqueous solution or buffer.
• organic solvents are aprotic polar solvents such as DMSO, DMF, N-methylpyrrolidone, acetone, acetonitrile, dioxane, tetrahydrofuran and other nonhydroxylic, completely water-miscible solvents.
• the amount of substrate of the invention employed is the minimum amount required to detect the presence of the functional group in the sample comprising a mutant hydrolase or a fusion thereof, within a reasonable time, with minimal background or undesirable labeling.
• concentration of a substrate of the invention and a corresponding mutant hydrolase to be used is dependent upon the experimental conditions and the desired results.
• concentration of a substrate of the invention typically ranges from nanomolar to micromolar.
• concentration for the substrate of the invention with a corresponding mutant hydrolase is determined by systematic variation in substrate until satisfactory labeling is accomplished. The starting ranges are readily determined from methods known in the art.
• a subsfrate which includes a functional group with optical properties is employed with a mutant hydrolase to label a sample.
• a substrate is combined with the sample of interest comprising the mutant hydrolase for a period of time sufficient for the mutant hydrolase to bind the substrate, after which the sample is illuminated at a wavelength selected to elicit the optical response of the functional group.
• the sample is washed to remove residual, excess or unbound substrate.
• the labeling is used to determine a specified characteristic of the sample by further comparing the optical response with a standard or expected response.
• the mutant hydrolase bound substrate is used to monitor specific components of the sample with respect to their spatial and temporal distribution in the sample.
• the mutant hydrolase bound subsfrate is employed to determine or detect the presence or quantity of a certain molecule.
• the mutant hydrolase bound substrate is used to analyze the sample for the presence of a molecule that responds specifically to the functional group.
• a detectable optical response means a change in, or occurrence of, a parameter in a test system that is capable of being perceived, either by direct observation or instrumentally. Such detectable responses include the change in, or appearance of, color, fluorescence, reflectance, chemiluminescence, light polarization, light scattering, or x-ray scattering.
• the detectable response is a change in fluorescence, such as a change in the intensity, excitation or emission wavelength distribution of fluorescence, fluorescence lifetime, fluorescence polarization, or a combination thereof.
• the detectable optical response may occur throughout the sample comprising a mutant hydrolase or a fusion thereof or in a localized portion of the sample comprising a mutant hydrolase or a fusion thereof. Comparison of the degree of optical response with a standard or expected response can be used to determine whether and to what degree the sample comprising a mutant hydrolase or a fusion thereof possesses a given characteristic.
• the functional group is a ligand for an acceptor molecule.
• the subsfrate comprises a functional group that is a member of a specific binding pair (a ligand)
• the complementary member is immobilized on a solid or semi-solid surface, such as a polymer, polymeric membrane or polymeric particle (such as a polymeric bead).
• Representative specific binding pairs include biotin and avidin (or streptavidin or anti-biotin), IgG and protein A or protein G, drug and drug receptor, toxin and toxin receptor, carbohydrate and lectin or carbohydrate receptor, peptide and peptide receptor, protein and protein receptor, enzyme substrate and enzyme, sense DNA or RNA and antisense (complementary) DNA or RNA, hormone and hormone receptor, and ion and chelator.
• Ligands for which naturally occurring receptors exist include natural and synthetic proteins, including avidin and streptavidin, antibodies, enzymes, and hormones; nucleotides and natural or synthetic oligonucleotides, including primers for RNA and single- and double- stranded DNA; lipids; polysaccharides and carbohydrates; and a variety of drugs, including therapeutic drugs and drugs of abuse and pesticides.
• the functional group is a chelator of calcium, sodium, magnesium, potassium, or another biologically important metal ion
• the subsfrate comprising such a functional group functions as an indicator of the ion.
• such a subsfrate may act as a pH indicator.
• the detectable optical response of the ion indicator is a change in fluorescence.
• the sample comprising a mutant hydrolase or a fusion thereof is typically labeled by passive means, i.e., by incubation with the substrate.
• any method of introducing the substrate into the sample comprising a mutant hydrolase or a fusion thereof such as microinjection of a substrate into a cell or organelle, can be used to introduce the substrate into the sample comprising a mutant hydrolase or a fusion thereof.
• the substrates of the present invention are generally non-toxic to living cells and other biological components, within the concentrations of use.
• the sample comprising a mutant hydrolase or a fusion thereof can be observed immediately after contact with a substrate of the invention.
• the sample comprising a mutant hydrolase or a fusion thereof is optionally combined with other solutions in the course of labeling, including wash solutions, permeabilization and/or fixation solutions, and other solutions containing additional detection reagents. Washing following contact with the subsfrate generally improves the detection of the optical response due to the decrease in non-specific background after washing. Satisfactory visualization is possible without washing by using lower labeling concentrations.
• fixatives and fixation conditions are known in the art, including formaldehyde, paraformaldehyde, formalin, glutaraldehyde, cold methanol and 3:1 methanol: acetic acid.
• Fixation is typically used to preserve cellular morphology and to reduce biohazards when working with pathogenic samples. Selected embodiments of the substrates are well retained in cells. Fixation is optionally followed or accompanied by permeabilization, such as with acetone, ethanol, DMSO or various detergents, to allow bulky substrates of the invention, to cross cell membranes, according to methods generally known in the art.
• the use of a substrate may be combined with the use of an additional detection reagent that produces a detectable response due to the presence of a specific cell component, intracellular substance, or cellular condition, in a sample comprising a mutant hydrolase or a fusion thereof. Where the additional detection reagent has spectral properties that differ from those of the substrate, multi-color applications are possible.
• the sample comprising a mutant hydrolase or a fusion thereof is illuminated with a wavelength of light that results in a detectable optical response, and observed with a means for detecting the optical response. While some substrates are detectable colorimetrically, using ambient light, other substrates are detected by the fluorescence properties of the parent fluorophore.
• the substrates, including subsfrates bound to the complementary specific binding pair member display intense visible absorption as well as fluorescence emission.
• Selected equipment that is useful for illuminating the substrates of the invention includes, but is not limited to, hand-held ultraviolet lamps, mercury arc lamps, xenon lamps, argon lasers, laser diodes, and YAG lasers. These illumination sources are optionally integrated into laser scanners, fluorescence microplate readers, standard or mini fluorometers, or chromatographic detectors.
• This colorimetric absorbance or fluorescence emission is optionally detected by visual inspection, or by use of any of the following devices: CCD cameras, video cameras, photographic film, laser scanning devices, fluorometers, photodiodes, quantum counters, epifluorescence microscopes, scanning microscopes, flow cytometers, fluorescence microplate readers, or by means for amplifying the signal such as photomultiplier tubes.
• the instrument is optionally used to distinguish and discriminate between the substrate comprising a functional group which is a fluorophore and a second fluorophore with detectably different optical properties, typically by distinguishing the fluorescence response of the substrate from that of the second fluorophore.
• examination of the sample comprising a mutant hydrolase or a fusion thereof optionally includes isolation of particles within the sample comprising a mutant hydrolase or a fusion thereof based on the fluorescence response of the substrate by using a sorting device.
• intracellular movements may be monitored using a fusion of the mutant hydrolase of the invention.
• beta-arrestin is a regulator of G-protein coupled receptors, that moves from the cytoplasm to the cell membrane when it is activated.
• a cell containing a fusion of a mutant hydrolase and beta-arrestin and a subsfrate of the invention allows the detection of the movement of beta-arrestin from the cytoplasm to the cell membrane as it associates with activated G-protein coupled receptors.
• FRET may be employed with a fusion of the mutant hydrolase and a fluorescent protein, e.g., GFP, or a fusion with a protein that binds fluorescent molecules, e.g., O-alkylguanine-DNA alkyltransferase (AGT) (Keppler et al., 2003).
• a fusion of a mutant hydrolase and a protein of interest and a second fusion of a fluorescent protein and a molecule suspected of interacting with the protein of interest may be employed to study the interaction of the protein of interest with the molecule, e.g., using FRET.
• One cell may contain the fusion of a mutant hydrolase and a protein of interest while another cell may contain the second fusion of a fluorescent protein and a molecule suspected of interacting with the protein of interest.
• a population with those two cells may be contacted with a subsfrate and an agent, e.g., a drug, after which the cells are monitored to detect the effect of agent administration on the two populations.
• the mutant hydrolase is fused to a fluorescent protein.
• the fusion protein can thus be detected in cells by detecting the fluorescent protein or by contacting the cells with a substrate of the invention and detecting the functional group in the subsfrate.
• the detection of the fluorescent protein may be conducted before the detection of the functional group.
• the detection of the functional group may be conducted before the detection of the fluorescent protein.
• those cells can be contacted with additional substrates, e.g., those having a different functional group, and the different functional group in the cell detected, which functional group is covalently linked to mutant hydrolase not previously bound by the first subsfrate.
• a fusion of a mutant hydrolase and a transcription factor may be employed to monitor activation of transcription activation pathways.
• a fusion of a mutant hydrolase to a transcription factor present in the cytoplasm in an inactive form but which is translocated to the nucleus upon activation can monitor transcription activation pathways.
• biotin is employed as a functional group in a substrate and the fusion includes a mutant hydrolase fused to a protein of interest suspected of interacting with another molecule, e.g., a protein, in a cell.
• a mutant hydrolase fused to a protein of interest suspected of interacting with another molecule, e.g., a protein, in a cell.
• the use of such reagents permits the capture of the other molecule wliich interacts in the cell with the protein fused to the mutant hydrolase, thereby identifying and/or capturing (isolating) the interacting molecule(s).
• the mutant hydrolase is fused to a protein that is secreted. Using that fusion and a substrate of the invention, the secreted protein may be detected and/or monitored. Similarly, when the mutant hydrolase is fused to a membrane protein that is transported between different vesicular compartments, in the presence of the substrate, protein processing within these compartments can be detected. In yet another embodiment, when the mutant hydrolase is fused to an ion channel or transport protein, or a protein that is closely associated with the channel or transport protein, the movement of ions across cell or organelle membranes can be monitored in the presence of a substrate of the invention which contains an ion sensitive fluorophore. Likewise, when the mutant hydrolase is fused to proteins associated with vesicals or cytoskeleton, in the presense of the subsfrate, transport of proteins or vesicals along cytoskeletal structures can be readily detected.
• the functional group is a drug or toxin.
• a drug or toxin By combining a substrate with such a functional group with a fusion of a mutant hydrolase and a targeting molecule such as an antibody, e.g., one which binds to an antigen associated with specific tumor cells, a drug or toxin can be targeted within a cell or within an animal.
• the functional group may be a fluorophore which, when present in a substrate and combined with a fusion of a mutant hydrolase and a targeting molecule such as a single chain antibody, the targeting molecule is labeled, e.g., a labeled antibody for in vitro applications such as an ELISA.
• a mutant hydrolase on the cell surface when fused to a protein expressed on the cell surface, when combined with a substrate of the invention, e.g., one which contains a fluorophore, may be employed to monitor cell migration (e.g., cancer cell migration) in vivo or in vitro.
• the substrate of the invention is one that has low or no permeability to the cell membrane.
• such a system can be used to monitor the effect of different agents, e.g., drugs, on different pools of cells.
• the mutant hydrolase is fused to a HERG channel. Cells expressing such a fusion, in the presence of a subsfrate of the invention which includes a K+-sensitive fluorophore, may be employed to monitor the activity of the HERG channel, e.g., to monitor drug-toxicity.
• the substrate of the invention includes a functional group useful to monitor for hydrophobic regions, e.g., Nile Red, in a cell or organism.
• mutant hydrolases and subsfrates of the invention are useful in a wide variety of assays, e.g., phage display, panning, ELISA, Western blot, fluorometric microvolume assay technology (FMAT), and cell and subcellular staining.
• assays e.g., phage display, panning, ELISA, Western blot, fluorometric microvolume assay technology (FMAT), and cell and subcellular staining.
• oligonucleotides were synthesized, purified and sequenced by Promega Corporation (Madison, WI) or the University of Iowa DNA Facility (Iowa City, Iowa). Restriction enzymes and DNA modifying enzymes were obtained from Promega Corporation (Madison, WI), New England Biolabs, Inc. (Beverly, MA) or Stratagene Cloning Systems (La Jolla, CA), and were used according to the manufacturer's protocols. Competent E. coli JM109 were provided by Promega Corporation or purchased from Stratagene Cloning Systems. Small-scale plasmid DNA isolations were done using the Qiagen Plasmid Mini Kit (Qiagen Inc., Chatsworth, CA). DNA ligations were performed with pre-tested reagent kits purchased from Stratagene Cloning Systems. DNA fragments were purified with QIAquick Gel Extraction Kits or QIAquick PCR purification Kits purchased from Qiagen Inc.
• the vectors used for generating DhaA mutants and their fusions were as follows: pET21 (Invitrogen, Carlsbad, CA), pRL-null (Promega, Madison, WI), pGEX-5x-3 (Amersham Biosciences; Piscataway, NJ), and EGFP and DsRED2 (both from CLONTECH, Palo Alto, CA),.
• Sigma- Aldrich was the source of Anti Flag R monoclonal antibody antibodies (anti FLAG R M2 monoclonal antibody (mouse) (F3165)), Anti FLAG R M2 HRP Conjugate and Anti FLAG R M2 FITC conjugate (A8592 and F4049, respectively).
• Chemicon was the source of monoclonal anti-Renilla luciferase antibody (MAB4410).
• Promega Corp. was the source of HRP conjugated goat anti-mouse IgG and HRP-conjugated streptavidin (W4021 and G714, respectively).
• Glutathione Sepharose 4 FF, glutathione, MonoQ and Sephadex G-25 prepackaged columns were from Amersham Biosciences.
• Luria-Broth (“LB”) was provided by Promega Corporation. Methods PCR reactions. DNA amplification was performed using standard polymerase chain reaction buffers supplied by Promega Corp. Typically, 50 ⁇ l reactions included lx concentration of the manufacturer's supplied buffer, 1.5 mM MgCl 2 , 125 ⁇ M dATP, 125 ⁇ M dCTP, 125 ⁇ M dGTP, 125 ⁇ M dTTP, 0.10- 1.0 ⁇ M forward and reverse primers, 5 U AmpliTaq® DNA Polymerase and ⁇ 1 ng target DNA. Unless otherwise indicated, the thermal profile for amplification of DNA was 35 cycles of 0.5 minutes at 94°C; 1 minute at 55°C; and 1 minute at 72°C.
• TBST buffer 10 mM Tris-HCI, 150 mM NaCl, pH 7.6, containing 0.05% Tween 20
• blocking solution 3% dry milk or 1% BSA in TBST buffer
• membranes were washed with 50 ml of TBST buffer and incubated with anti-FLAG R monoclonal antibody M2 (dilution 1 :5,000), aaXi-Renilla luciferase monoclonal antibody (dilution 1 :5,000), or HRP-conjugated streptavidin (dilution 1 : 10,000) for 45 minutes at room temperature.
• Protein concentration was measured by the microtiter protocol of the Pierce BCA Protein assay (Pierce, Rockford, IL) using bovine serum albumin (BSA) as a standard.
• Rhodococcus rodochorus was kindly provided by Dr. Clifford J. Unkefer (Los Alamos National Laboratory, Los Alamos, NM) (Schindler et al., 1999; Newman et al., 1999). Bacteria were cultured in LB using a premixed reagent provided by Promega Corp. Freezer stocks of E. coli BL21 ( ⁇ DE3) pET3a (stored in 10% glycerol, -80°C) were used to inoculate Luria-Bertani agar plates supplemented with ampicillin (50 ⁇ g/ml) (Sambrook et al., 1989).
• Single colonies were selected and used to inoculate two 10 ml cultures of Luria-Bertani medium containing 50 ⁇ g/ml ampicillin.
• the cells were cultured for 8 hours at 37°C with shaking (220 rpm), after which time 2 ml was used to inoculate each of two 50 ml of Luria-Bertani medium containing 50 ⁇ g/ml ampicillin, which were grown overnight at 37°C with shaking.
• Ten milliliters of this culture was used to inoculate each of two 0.5 L Luria-Bertani medium with ampicillin.
• IPTG isopropyl- 1-thio- ⁇ -D- galactopyranoside
• CHO-K1 cells (ATCC-CCL61) were cultured in a 1:1 mixture of Ham's F12 nutrients and Dulbecco's modified minimal essential medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin, in an atmosphere of 95% air and 5% CO 2 at 37°C.
• Rat hippocampal (El 8) primary neurons were isolated as described below. Briefly, fragments of embryonic (El 8) rat hippocampus in HibernateTM E media (GIBCO, Invitrogen, Carlsbad, CA), obtained from Dr.
• Fluorescence Fluorescence in cells in 96 well plates was measured on fluorescent plate reader CytoFluorll (Beckman) at an E ex /E em appropriate for particular fluorophores (e.g., E ex /Eem for TAMRA is 540/575 nm).
• Example II A DhaA-Based Tethering System A. Wild-Type and Mutant DhaA Proteins and Fusions Thereof A halo-alkane dehydrogenase from Rhodococcus rhodochrous is a product of the DhaA gene (MW about 33 kDa). This enzyme cleaves carbon- halogen bonds in aliphatic and aromatic halogenated compounds, e.g., HaloC 3 - HaloCio.
• the catalytic center of DhaA is a typical "catalytic triad", comprising a nucleophile, an acid and a histidine residue.
• mutant DhaA vectors Promega' s in vitro mutagenesis kit which is based on four primer overlap-extension method was employed (Ho et al., 1989) to produce DhaA.H272 to F, A, G, or H mutations.
• the external primers were oligonucleotides 5'-
• GST-DhaA (WT or H272F/A/G/H mutants) fusion cassettes were constructed by cloning the appropriate DhaA coding regions into SaWNotl sites of pGEX5x3 vector. Two primers (5'-
• the resulting fragments were inserted into the SaWNotl site of pGEX- 5X-3, a vector containing a glutathione S-transferase (GST) gene, a sequence encoding a Factor Xa cleavage site, and multiple cloning sites (MCS) followed by a stop codon.
• GST glutathione S-transferase
• MCS multiple cloning sites
• Two complementary oligonucleotides (5'- CCGGTGACTACAAGGACGATGACGACAAGTGAAGC-3', sense, SEQ ID NO:9, and 5'-GCTTCACTTGTCGTCATCGTCCTTGTAGTCA-3', antisense, SEQ ID NO: 10) coding the Flag peptide (Kodak Imaging Systems, Rochester, NY) were annealed.
• the annealed DNA had an Agel site at the 5' end and an EcoR4711l at the 3' end.
• the annealed DNA was digested with Agel and EcoR47lll and then subcloned into the GST-DhaA.WT or GST-DhaA.H272F mutant constructs at the Agel and EcoR47lll sites. All gene fusion constructs were confirmed by DNA sequencing.
• enzyme expression was induced by the addition of isopropyl-b-D-thiogalactopyranoside (at a final concentration of0.5 mM) when the culture reached an optical density of 0.6 at 600 nm.
• the cells were harvested in Buffer A (10 mM Tris-SO 4 , 1 mM EDTA, 1 mM ⁇ - mercaptoethanol, and 10 % glycerol, pH 7.5), and disrupted by sonication using a Vibra CellTM sonicator (Sonics & Materials, Danbury, CT, USA). Cell debris was removed by centrifugation at 19,800 x g for 1 hour.
• the crude extract was further purified on a GSS-Sepharose 4 fast flow column (Amersham
• the reaction buffer for a pH-indicator dye system consisted of 1 mM HEPES-SO 4 (pH 8.2), 20 mM Na 2 SO 4 , and 1 mM EDTA. Phenol red was added to a final concentration 25 ⁇ g/ml. The halogenated compounds were added to apparent concentrations that could insure that the dissolved fraction of the substrate was sufficient for the maximum velocity of the dehalogenation reaction.
• the substrate-buffer solution was vigorously mixed for 30 seconds by vortexing, capped to prevent significant evaporation of the substrate and used within 1-2 hours. Prior to each kinetic determination, the phenol red was titrated with a standardized solution of HCl to provide an apparent extinction coefficient.
• the steady-state kinetic constants for DhaA were determined at 558 nm at room temperature on a Beckman Du640 spectrophotometer (Beckman Coulter, Fullerton, CA). Kinetic constants were calculated from initial rates using the computer program SigmaPlot.
• One unit of enzyme activity is defined as the amount required to dehalogenate 1.0 mM of substrate/minute under the specific conditions. Results As shown in Figure 4, using 0.1 mg/ml of enzyme and 10 mM subsfrate at pH 7.0-8.2, no catalytic activity was found with any of four mutants. Under these conditions, the wild-type enzyme had an activity with 1-Cl-butane of 5 units/mg of protein. Thus, the activity of the mutants was reduced by at least 700-fold.
• DhaA.H272F mutant was precipitated by 45-70% of (NH 4 ) 2 SO 4 . No precipitation of these proteins was observed at low (NH 4 ) 2 SO 4 concentrations.
• the DhaA.H272Q, DhaA.H272G and DhaA.H272A mutants could be precipitated by 10% (NH 4 ) 2 SO 4 . This is a strong indication of the significant change of the physico-chemical characteristics of the DhaA.H272Q,
• the chlorine atom of Cl-alkane is likely positioned in close proximity to the catalytic amino acids of DhaA (WT or mutant) ( Figure 2).
• the crystal structure of DhaA indicates that these amino acids are located deep inside of the catalytic pocket of DhaA (approximately 10 A long and about 20 A 2 in cross section).
• a linker was designed to connect the Cl- containing substrate with a functional group so that the functional group is located outside of the catalytic pocket, i.e., so as not to disturb/destroy the 3-D structure of DhaA.
• DhaA.WT was contacted with various Cl-alkane alcohols. As shown in Figure 6, DhaA.WT can hydrolyze 1 -Cl-alkane alcohols with 4-10 carbon atoms. Moreover, the initial rate of hydrolysis (IRH) of Cl- alkanes had an inverse relationship to the length of a carbon chain, although poor solubility of long-chain Cl-alkanes in aqueous buffers may affect the efficiency of the enzyme-substrate interaction.
• Ethanol extracts of Cl-alkanes or products of Cl-alkane hydrolysis were analyzed using analytical reverse phase C 18 column (Adsorbosphere HS, 5 ⁇ , 150 x 4.6 mm; Hewlett-Packard, Clifton, NJ) with a linear gradient of 10 mM ammonium acetate (pH 7.0):ACN (acetonitrile) from 25:75 to 1:99 (v/v) applied over 30 minutes at 1.0 ml/minute. Quantitation of the separated compounds was based on the integrated surface of the collected peaks.
• Figure 8 A shows the complete separation of the substrate and the product of the reaction.
• Figure 8B indicates that wild-type DhaA very efficiently hydrolyzed FAM-C 14 H 2 O 4 -Cl. Similar results were obtained when TAMRA- C 14 H 24 O 4 -Cl or ROX.5-C 14 H 2 O 4 -Cl were used as subsfrates (data not shown). Taken together these data confirm the results of the pH-indicator dye-based assay showing complete inactivation of DhaA by the DhaA.H272F mutation.
• C Covalent Tethering of Functional Groups to DhaA Mutants In Vitro Materials and Methods
• MALDI analysis of proteins was performed at the University of Wisconsin Biotechnology Center using a matrix assisted laser desorption/ionization time-of-life (MALDI-TOF) mass spectrometer Bruker Biflex III (Bruker, USA.).
• MALDI-TOF matrix assisted laser desorption/ionization time-of-life
• Oligonucleotides employed to prepare DhaA.D106 mutants include for DhaA.D106C:
• DhaA.D106E 5'-CTTGGGTTTGGAAGAGGTCGTCCTGGTCATCCACGAATGGGGC-3' (SEQ ID NO:52) and 5'-CTTGGGTTTGGAAGAGGTCGTCCTGGTCATCCACGAATGGGGC-3' (SEQ ID NO:52) and 5'-CTTGGGTTTGGAAGAGGTCGTCCTGGTCATCCACGAATGGGGC-3' (SEQ ID NO:52) and 5'-
• the annealed oligonucleotides contained a Styl site at the 5' end and the Blpl site at the 3' end.
• the annealed oligonucleotides were digested with Styl and Blpl and subcloned into GST-DhaA. WT or GST-DhaA.H272F at Styl and Blpl sites. All mutants were confirmed by DNA sequencing. Results
• the gels containing proteins were incubated with FAM ⁇ C 1 H 2 O - CI, TAMRA-C 1 H 2 O 4 -Cl, or ROX.5-C 14 H 24 O 4 -Cl and were analyzed by fluoroimager (Hitachi, Japan) at an E ex /Eem appropriate for each fluorophore. Gels containing proteins incubated with biotin-C 18 H 32 O 4 -Cl were transferred to a nitrocellulose membrane and probed with HRP conjugated streptavidin.
• TAMRA-C 1 H 2 O 4 -Cl (lanes 1 and 2 in panel A), FAM-C 14 H 24 O 4 -Cl (lanes 3 and 4 in panel A), and ROX.5-C 14 H 24 O 4 -Cl (lanes 5 and 6 in panel A) bound to DhaA.H272F (lanes 2, 4 and 6 in panel A) but not to DhaA.WT (lanes 1, 3 and 5 in panel A).
• Biotin-C 18 H 34 O -Cl bound to DhaA.H272F (lanes 9-14 in panel B) but not to DhaA.WT (lanes 1-8 in panel B).
• DhaA.H272 mutants bind the substrates in a highly specific manner, since pretreatment of the mutants with one of the substrates (biotin-C 18 H 3 O 4 -Cl) completely blocked the binding of another substrate (TAMRA-C 14 H 24 O 4 -Cl) ( Figure 10).
• DhaA mutants at another residue in the catalytic triad, residue 106 were prepared.
• the residue at position 106 in wild-type DhaA is D, one of the known nucleophilic amino acid residues.
• D at residue 106 in DhaA was substituted with nucleophilic amino acid residues other than D, e.g., C, Y and E, which may form a bond with a substrate which is more stable than the bond formed between wild-type DhaA and the substrate.
• cysteine is a known nucleophile in cysteine-based enzymes, and those enzymes are not known to activate water.
• a control mutant, DhaA.D106Q, single mutants DhaA.D106C, DhaA.D106Y, and DhaA.D106E, as well as double mutants DhaA.D106C:H272F, DhaA.D106E:H272F, DhaA.D106Q:H272F, and DhaA.D106Y:H272F were analyzed for binding to TAMRA-C 14 H 24 O -Cl ( Figure 12). As shown in Figure 12, TAMRA-C 14 H 24 O 4 -Cl bound to
• the bond formed between TAMRA-C 14 H 24 O -Cl and cysteine or glutamate at residue 106 in a mutant DhaA is stable relative to the bond formed between TAMRA-C 14 H 24 O 4 -Cl and wild-type DhaA.
• Other substitutions at position 106 alone or in combination with substitutions at other residues in DhaA may yield similar results.
• certain substitutions at position 106 alone or in combination with substitutions at other residues in DhaA may result in a mutant DhaA that forms a bond with only certain substrates.
• phRLuc-linker-DhaA.WT-Flag and phRLuc-linker-DhaA.H272F-Flag fusion cassettes were constructed by cloning the phRLuc coding region into the Nhel/Sall sites of the pCIneo vector which contains a myristic acid attachment peptide coding sequence (MAS).
• MAS myristic acid attachment peptide coding sequence
• Two primers (5'- GCTTCACTTGTCGTCATCGTCCTTGTAGTCA-3'; SEQ ID NO: 11) and (5'- GCTTCACTTGTCGTCATCGTCCTTGTAGTCA-3'; SEQ ID NO: 12) were designed to add Nhel and Sail sites to the 5' and 3' coding regions, respectively, of phRLuc and to amplify a 900 bp fragment from a phRLuc template (pGL3 vector, Promega).
• FIG. 13 A shows Renilla luciferase activity captured on the plate. Analysis of these data indicated that only the fusion containing the mutant DhaA was captured. The efficiency of capturing was very high (more than 50% of Renilla luciferase activity added to the plate was captured). In contrast, the efficiency of capturing of fusions containing wild-type DhaA as well as Renilla luciferase was negligibly small ( ⁇ 0.1%).
• Prefreatment of RXuc-connector- DhaA.H272F with a non-biotinylated substrate (TAMRA-C 14 H 24 O 4 -Cl) decreased the efficiency of capturing by about 80%. Further, there was no effect of prefreatment with a nonbiotinylated substrate on the capturing of the R.Luc- connector-DhaA.WT or Renilla luciferase.
• DhaA.WT-Flag and DhaA.H272F-Flag coding regions were excised from pGEX-5X-3.DhaA.WT-Flag or pGEX-5X-3.DhaA.H272F-Flag, respectively, gel purified, and inserted into Sall/Notl restriction sites of pCIneo.CMV vector (Promega). The constructs were confirmed by DNA sequencing.
• CHO-K1 cells were plated in 24 well plates (Labsystems) and transfected with a pCIneo-CMV.DhaA.WT-Flag or pCIneo-CMV.DhaA.H272F-Flag vector.
• Figures 14A and B show the binding of biotin-C 18 H 32 O 4 -Cl (A) and TAMRA-C 12 H 24 O 4 -Cl (B) to E. coli proteins in vivo.
• the low molecular band on Figure 14A is an E. coli protein recognizable by HRP-SA, while the fluorescence detected in the bottom part of Panel B was fluorescence of free TAMRA-C 12 H 24 O 4 -Cl.
• Figure 15 shows the binding of TAMRA-C 12 H 24 O 4 -Cl to eukaryotic cell proteins in vivo.
• CHO-K1 Cells ATCC-CCL61 were cultured in a 1:1 mixture of Ham's F12 nutrients and Dulbecco's modified minimal essential medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin, in an atmosphere of 95% air and 5% CO 2 at 37°C.
• FBS fetal bovine serum
• penicillin 100 U/ml penicillin
• streptomycin 100 mg/ml streptomycin
• the level of fluorescence in cells in 96 well plates was measured on fluorescent plate reader CytoFluor II (Beckman) at E ex /E em equal 480/520 nm and 540/575 nm for FAM- and TAMRA-modified subsfrates, respectively. Fluorescent images of the cells were taken on inverted epifluorescent microscope Axiovert-100 (Carl Zeiss) with filter sets appropriate for detection of FITC and TAMRA. Results
• CHO-K1 cells freated with TAMRA-C 14 H 28 O 4 - Cl could be quickly and efficiently loaded with TAMRA-C 14 H 28 O 4 -Cl.
• Image analysis indicated that the fluorescent dye crossed the cell membrane.
• Figure 16 also shows that TAMRA-C 14 H 28 O 4 -Cl could be efficiently washed out of the cells. Taken together these data indicate that the plasma membrane of CHO-K1 cells is permeable to TAMRA-C 1 H 28 O 4 -Cl.
• FAM-C 14 H 24 O 4 -Cl did not cross the plasma membrane of CHO-K1 cells, even when cells were prefreated with FAM-C 14 H 24 O -Cl at high concenfrations (i.e., 100 ⁇ M) and for much longer periods of time (60 minutes) (data not shown).
• the different permeabilities of the cell plasma membrane for various substrates of the invention e.g., TAMRA-C ⁇ H O -Cl and FAM-C 1 H 24 O 4 -Cl, provides a unique opportunity to label proteins expressed on the cell surface and proteins expressed inside the cell with different fluorophores, thereby allowing biplexing.
• a GFP-connector-DhaA fusion cassette was constructed by replacing the
• Cells transiently expressing GFP-connector-DhaA.WT-Flag or GFP- connector-DhaA.H272F-Flag fusion proteins were plated in LT-II chambers (Nunc) at a density of 30,000 cells/cm 2 . The next day, media was replaced with fresh media containing 25 ⁇ M of TAMRA-C 14 H 24 O 4 -Cl and the cells were placed back into in a CO 2 incubator for 60 minutes. At the end of the incubation, media containing substrates was removed, cells were quickly washed with PBS (pH 7.4; four consecutive washes: 1.0 ml/cm 2 ; 5 seconds each) and new media was added to the cells.
• PBS pH 7.4; four consecutive washes: 1.0 ml/cm 2 ; 5 seconds each
• the cells were placed back into in a CO 2 incubator and after 60 minutes the cells were quickly washed with PBS (pH 7.4; four consecutive washes: 1.0 ml/cm ; 5 seconds each). Fluorescent images of the cells were taken on inverted epifluorescent microscope Axiovert- 100 (Carl Zeiss) with filter sets appropriate for detection of GFP and TAMRA. Results
• cells transfected with either GFP- connector-DhaA.WT-Flag or GFP-connector-DhaA.H272F-Flag showed robust expression of the protein(s) with light emitting characteristics of GFP.
• Analysis of the images of the same cells taken with a TAMRA-filter set showed that cells expressing GFP-connector-DhaA.WT-Flag were dark and could not be distinguished from cells that do not express this fusion protein.
• cells expressing GFP-connector-DhaA.H272F-Flag were very bright and unmistakably recognizable.
• DhaA-based fusion proteins (see Table II) with DhaA at the C- or N-terminus of the fusion and a connector sequence, e.g., one having 13 to 17 amino acids, between the two proteins, were prepared. The data showed that the functional activity of both proteins in the fusion was preserved.
• CHO-K1 cells were plated in 96 well plates to a density of 5,000 cells per well. The next day, media was replaced with fresh media containing 0-100 ⁇ M concenfrations of Cl-alkanes and the cells were placed back into a CO 2 incubator for different periods of time. Viability of the cells was measured with CellTiter-GloTM Luminescence Cell Viability Assay (Promega) according to the manufacturer's protocol. Generally, 100 ⁇ l of CellTiter-GloTM reagent was added directly to the cells and the luminescence was recorded at 10 minutes using a DYNEX MLX microtiter plate luminometer.
• TAMRA-C 14 H 4 O -Cl showed no toxicity on CHO-Kl cells even after a 4 hour treatment at a 100 ⁇ M concentration the (the highest concentration tested). After a 24 hour treatment, no toxicity was detected at concentrations of 6.25 ⁇ M (the "maximum non-toxic concentration"). At concentrations > 6.25 ⁇ M, the relative luminescence in CHO-Kl cells was reduced in a dose-dependent manner with an IC 50 of about 100 ⁇ M. No toxicity of biotin-C 18 H 34 O 4 -Cl was observed even after 24 hours of treatment at 100 ⁇ M.
• ROX5-C 14 H 24 O 4 -Cl had a pronounced toxic effect as a reduction of the RLU in CHO-Kl cells could be detected after a 1 hour freatment.
• the IC50 value of this effect was about 75 ⁇ M with no apparent ATP reduction at a 25 ⁇ M concentration.
• the IC 50 value of ROX5-C 14 H 2 O 4 -Cl toxicity and the "maximum non-toxic concenfration" of ROX5-C 14 H 4 O 4 -Cl decreased in a time-dependent manner reaching 12.5 ⁇ M and 6.25 ⁇ M, respectively.
• TKO lipid was diluted by adding 7 ⁇ l of lipid per 100 ⁇ l of serum-free DMEM:F 12 media, and then 1.2 ⁇ g of transfection-grade DhaA.D106C DNA was added per 100 ⁇ l of lipid containing media. The mixture was incubated at room temperature for 15 minutes, and then 25 ⁇ l aliquots were transferred into individual culture chambers (0.3 ⁇ g DNA). Cells were returned to the incubator for 5-6 hours, washed two times with growth media, 300 ⁇ l of fresh growth media was added, and then cells were incubated for an additional 24 hours. Transfected or non-transfected control cells were incubated with 12.5 ⁇ M
• the PBS was replaced with 50% methanol in PBS and cells were incubated for 15 minutes, followed by a 15 minute incubation in 95% methanol.
• a third set of images was captured and then an equal volume mixture of methanol and acetone was applied to the cells and incubated for 15 minutes.
• the media was replaced with PBS and a fourth set of images was collected.
• the plasmid pTS32 harboring Staphylococcus aureus PCI blaZ gene was kindly provided by Dr. O. Herzberg (University of Maryland Biotechnology Institute).
• the blaZ gene has the following sequence: AGCTTACTAT GCCATTATTA ATAACTTAGC CATTTCAACA CCTTCTTTCA AATATTTATAATAAACTATT GACACCGATA TTACAATTGT AATATTATTG ATTTATAAAA ATTACAACTGTAATATCGGA GGGTTTATTT TGAAAAAGTT AATATTTTTA ATTGTAATTG CTTTAGTTTTAAGTGCATGT AATTCAAACA GTTCACATGC CAAAGAGTTA AATGATTTAG AAAAAAAATATAATGCTCAT ATTGGTGTTT ATGCTTTAGA
• CTATTTTGTTAGAACAAGTA CCTTATAATA AGTTAAATAA AAAAGTACAT ATTAACAAAG ATGATATAGTTGCTTATTCT CCTATTTTAG AAAAATATGT AGGAAAAGAT ATCACTTTAA AAGCACTTATTGAGGCTTCA ATGACATATA GTGATAATAC AGCAAACAAT AAAATTATAA AAGAAATCGGTGGAATCAAA AAAGTTAAAC AACGTCTAAA AGAACTAGGA GATAAAGTAA CAAATCCAGTTAGATATGAG ATAGAATTAA ATTACTATTC ACCAAAGAGC AAAAAAGATA CTTCAACACCTGCTGCCTTC GGTAAGACCC TTAATAAACT TATCGCCAAT GGAAAATTAA GCAAAGAAAACAAAAAATTC TTACTTGATT TAATGTTAAA TAATAAAAGC GGAGATACTT TAATTAAAGACGGTGTTCC A AAAGACTATA AGGTTGCTGA TAAAAGTGGT CAAGCAATAA CATATGCTTCTAGAAATG
• GST-blaZ (WT and E166D, N170Q, or E166D:N170Q mutants) fusion cassettes were constructed by infroducing point mutations into the blaZ gene and cloning the blaZ coding regions into SaWAgel sites of pGEX5x3 vector.
• the internal mutagenic primers were as follows: E166D (5'- CCAGTTAGATATGACATAGAATTAAATTACTATTCACC-3', SEQ ID NO:56; 5'-GGTGAATAGTAATTTAATTCTATGTCATATCTAACTGG-3', SEQ ID NO:57); N170Q (5'- CCAGTTAGATATGAGATAGAATTACAGTACTATTCACC-3 ' , SEQ ID NO:58; and 5'-GGTGAATAGTACTGTAATTCTATCTCTAACTGG- 3', SEQ ID NO:59); and E166D:N170Q
• SEQ ID NO:63 were designed to add N-terminal Sail site and a Kozak sequence to the 5' coding region, add sa. Agel site to the 3' coding regions ofblaZ, and to amplify a 806 bp fragment from a blaZ.W ⁇ template. The resulting fragment was inserted into the SaWAgel site of the vector pGEX-5X-3 containing a glutathione S-transferase (GST) gene, a sequence coding a Factor Xa cleavage site, and multiple cloning sites (MCS) followed by a sequence coding for Flag and stop codons. These gene fusion constructs were confirmed by DNA sequencing.
• GST glutathione S-transferase
• MCS multiple cloning sites
• the GST-blaZ (WT or mutants) fusion proteins were overexpressed in competent E. coli BL21 ( ⁇ DE3) cells and purified essentially as described for DhaA and GST-DhaA fusion proteins (except the potassium phosphate buffer (0.1 M, pH 6.8) was used instead of Buffer A). Homogeneity of the proteins was verified by SDS-PAGE.
• the cephalosporin core links a 7-hydroxycoumarin to a fluorescein.
• excitation of the coumarin results in FRET to the fluorescein, which emits green light (E em - 520 nm).
• Cleavage of CCF2 by ⁇ -lactamase results in spatial separation of the two dyes, disrupting FRET such that excitation of coumarin now gives rise to blue fluorescence (E ex - 447 nm).
• CCF2 was purchased from Aurora Biosciences Corporation (San Diego, CA). Reduction of the FRET signal and an increase in blue fluorescence were measured on Fluorescence Multi-well Plate Reader CytoFluorll (PerSeptive Biosystems, Framingham, MA, USA). Results
• All ⁇ -lactamases including ⁇ -lactamase from Staphylococcus aureus PCI, hydrolyze ⁇ -lactams of different chemical structure. The efficiency of hydrolysis depends on the type of the enzyme and chemical structure of the substrate. Penicillin is considered to be a preferred subsfrate for ⁇ -lactamase from Staphylococcus aureus PCI.
• the bond between blaZ mutants and fluorescent subsfrates was very strong, and probably covalent, since boiling with SDS followed by SDS-PAGE did not disrupt the bond.
• the binding efficiency of double mutant b/ ⁇ Z.E166D:N170Q was much higher than binding efficiency of either of the single mutants, and the binding efficiency of b Z.N170Q was higher than binding efficiency of blaZ.El66D.
• an amino acid substitution at position 166 or 170 e.g., Glul66Asp or Asnl70Gly enables the mutant beta-lactamase to trap a substrate and therefore tether the functional group of the substrate to the mutant beta-lactamase via a stable, e.g., covalent, bond.
• mutation of an amino acid that has an auxiliary effect on H O activation increased the efficiency of tethering.
• a GFP-connector-DhaA.H272F-NLS3 fusion cassette was constructed by inserting a sequence encoding NLS3 (three tandem repeats of the Nuclear Localization Sequence (NLS) from simian virus large T-antigen) into the Agel/BamHl sites of a pCIneo.GFP-connector-DhaA.H272F-Flag vector.
• NLS3 Nuclear Localization Sequence from simian virus large T-antigen
• a DhaA.H272F- ⁇ -arr ⁇ s ⁇ in2 fusion cassette was constructed by replacing the pGFP coding region in Packard's vector encoding GFP - ⁇ -arrestin2 (Packard #6310176- 1 F 1 ) with the DhaA.H272F-Flag coding region.
• Two primers (5'-ATTATGCTGAGTGATATCCC-3'; SEQ ID NO:39, and 5*-
• CTCGGTACCAAGCTCCTTGTAGTCA-3'; SEQ ID NO:40) were designed to add a Kpnl site to the 3 ' coding region of DhaA, and to amplify a 930 bp fragment from a ⁇ GEX5X-3.DhaA.H272F-Flag template.
• the pGFP 2 coding region was excised with Nhel and Kpnl restriction enzymes, then the 930 bp fragment containing encoding DhaA.H272F was inserted into the Mel and Kpnl sites of the GFP 2 - ⁇ -arrestin2 coding vector.
• the sequence of the fusion construct was confirmed by DNA sequencing.
• CHO-Kl or 3T3 cells transiently expressing GFP-connector- DhaA.H272F-NLS3, GFP - ⁇ -arrestin2 or DhaA.H272F- ⁇ -arrestin2 fusion proteins were plated in LT-II chambers (Nunc) at a density of 30,000 cells/cm 2 . The next day, media was replaced with fresh media containing 25 ⁇ M of TAMRA-C 1 H 24 O -Cl and the cells were placed back into a CO 2 incubator for 60 minutes.
• GFP and TAMRA were co- localized in the cell nucleus of cells expression GFP-connector-DhaA.H272F- NLS3 and contacted with TAMRA-C 14 H 24 O 4 -Cl.
• GFP- ⁇ -arrestin2 expressing cells have a typical ⁇ -arrestin2 cytosolic localization.
• a fluoroscan of the SDS-PAGE gel of DhaA.H272F- ⁇ -arrestin2 showed strong binding of a TAMRA containing DhaA substrate to cells expressing DhaA.H272F- ⁇ -arrestin2.
• Haloalkane dehalogenases use a three-step mechanism for cleavage of the carbon-halogen bond. This reaction is catalyzed by a triad of amino acid residues composed of a nucleophile, base and acid which, for the haloalkane dehalogenase from Xanthobacter autotrophicus (DhlA), are residues Aspl24, His289 and Asp260, respectively (Franken et al., 1991), and in Rhodococcus dehalogenase enzyme (DhaA), Aspl06, His272 and Glul30 (Newman et al., 1999).
• DhlA Rhodococcus dehalogenase enzyme
• the role of the third member of the catalytic triad is not yet fully understood.
• the catalytic acid is hydrogen bonded to the catalytic His residue and may assist the His residue in its function by increasing the basicity of nitrogen in the imidazole ring.
• Krooshof et al. (1997), using site-directed mutagenesis to study the role of the DhlA catalytic acid Asp260, demonstrated that a D260N mutant was catalytically inactive. Furthermore, this residue apparently had an important structural role since the mutant protein accumulated mainly in inclusion bodies.
• haloalkane dehalogenase from Sphinogomonas paucimobilis is the enzyme involved in ⁇ -hexachlorocyclohexane degradation (Nagata et al., 1997).
• Hynkova et al., (1999) replaced the putative catalytic residue (Glu-132) of the LinB with glutamine (Q) residue.
• Glu-132 putative catalytic residue
• Q glutamine
• coli strain JM109 (e!4-(McrA-) recAl endAl gyrA96 thi-1 hsdR17(tK- mK+) supE44 relAl A(lac-proAB) [F' traD36 proAB lacPZ ⁇ Ml ⁇ ]) was used as the host for gene expression and whole cell enzyme labeling studies.
• a mutant plasmid containing a H272F mutation in DhaA designated pGEX5X3DhaAH272F-FLAG, was used as a positive control in labeling studies and the cloning vector ⁇ GEX5X3 was used as a negative control.
• oligonucleotides used for mutagenesis is shown below.
• the underlined nucleotides indicate the position of the altered codons.
• the oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA) at the 100 nmole scale and modified by phosphorylation at the 5' end.
• Site-directed mutagenesis was performed using the QuikChange Multi kit according to the manufacturer's instructions (Stratagene, La Jolla, CA). The mutagenesis reactions were introduced into competent E. coli XL10 Gold cells and transformants were selected on LB agar plates containing ampicillin (100 ⁇ g/mL). Plasmid DNA isolated from individual transformants was initially screened for the loss of an Ec RI site due to replacement of the glutamate codon (GAAttc). Clones suspected of containing the desired codon change from each reaction were selected and subjected to DNA sequence analysis (SeqWright, Houston, TX). The primer used to confirm the sequence of the mutants in the pGEX5X3 vector was as follows: 5' GGGCTGGCAAGCCACGTTTGGTG 3' (SEQ ID NO:44).
• DhaA mutant analysis The three DhaA El 30 substitution mutants were compared to the following constructs: Wild-type DhaA, DhaA.H272F, and a DhaA negative control (pGEX5X3 vector only).
• Overnight cultures of each clone were grown in 2 mL of LB containing ampicillin (100 ⁇ g/mL) by shaking at 30°C. The overnight cultures were diluted 1 :50 into a sterile flask containing 50 mL fresh LB medium and ampicillin (100 ⁇ g/mL). The cultures were incubated with shaking at 25°C to minimize the production of insoluble protein species.
• IPTG 0.1 mM
• TAMRA tetramethylrhodamine
• the cell density of each culture was adjusted to prior to adding subsfrate to a concentration of 15 ⁇ M.
• the cells were incubated with gentle agitation at 4°C for approximately 18 hours.
• 20 ⁇ l of cells from each labeling reaction was added to 6 ⁇ l of 4X SDS loading dye and the samples were boiled for about 3 minutes prior to being loaded onto a 4-20% acrylamide gel (Tris glycine).
• a 25 ⁇ l sample of each labeling reaction was added to 6 ⁇ l of 4X SDS loading dye and the samples were boiled for about 3 minutes prior to being loaded onto a 4-20% acrylamide gel (Tris glycine).
• the gels were imaged using a Fluorlmager SI instrument (Amersham Biosciences, Piscataway, NJ) set to detect emission at 570 nm.
• DhaA catalytic acid was probed by site-directed mutagenesis.
• the DhaA codon El 30 was replaced with a codon for glutamine (Q), leucine (L) or alanine (A), as these substitutions would likely be least disruptive to the structure of the enzyme.
• restriction endonuclease screening and DNA sequence analysis was used to verify the desired codon changes. Sequence verified DhaA.E130Q, DhaA.E130L and DhaA.E OA clones, designated CI, A5 and A12, respectively, were chosen for further analysis.
• the E130 mutants were analyzed for protein expression and for their ability to form a covalent alkyl- enzyme intermediate with a TAMRA labeled haloalkane subsfrate.
• the three El 30 gene variants were over-expressed inE. coli JM109 cells following induction with IPTG. SDS-PAGE analysis of crude cell lysates showed that cultures expressing the wild-type and mutant dhaA genes accumulated protein to approximately the same level ( Figure 26; lanes 2, 4, 6, 8, 10, and 12).
• the DhaA.E130 mutants were also examined for their ability to generate an alkyl-enzyme covalent intermediate. Crude lysates prepared from IPTG induced cultures of the various constructs were incubated in the presence of the TAMRA labeled substrate. Figure 28 showed that the DhaA.H272F mutant (lane 3) was very efficient at producing this intermediate. No such product could be detected with either the WT DhaA or negative control lysates. Upon initial examination, the DhaA.E130 mutants did not appear to produce detectable levels of the covalent product. However, upon closer inspection of the fluoroimage extremely faint bands were observed that could potentially represent minute amounts of the covalent intermediate ( Figure 28; lanes 5-7). Based on these results, the ability of whole cells to generate a covalent, fluorescent alkyl- enzyme intermediate was investigated.
• Figure 29 shows the results of an in vivo labeling experiment comparing each of the DhaA.E130 mutants with positive (DhaA.H272F mutant) and negative (DhaA-) controls.
• the DhaA.H272F mutant was capable of generating a covalent alkyl-enzyme intermediate as evidenced by the single fluorescent band near the molecular weight predicted for the GST-DhaA-Flag fusion ( Figure 29, lane 3).
• no such product could be detected with either the wild-type or negative control cultures ( Figure 29, lanes 2 and 3) but very faint fluorescent bands migrating at the correct position were again detected with all three DhaA.E130 substituted mutants ( Figure 29, lanes 5-7).
• the cells were lysed by trituriation through a needle (IM1 23GTW).
• IM1 23GTW IM1 23GTW
• cell lysates were incubated with MagnaBind Streptavidin coated beads (Pierce #21344) according to the manufacturer's protocol. Briefly, cell lysates were incubated with beads for 60 minutes at room temperature (RT) using a rotating disk.
• Biotin-C 18 H 32 O -Cl was efficiently hydrolyzed by wild-type DhaA, and covalently bound to DhaA.H272F and DhaA.H272F fusion proteins in vitro and in vivo. Moreover, binding was observed both in E. coli and in mammalian cells. Control experiments indicated that about 80% of the DhaA.H272F-Flag protein expressed in CHO-Kl cells was labeled after a 60 minute treatment. CHO-Kl cells transiently expressing DhaA.H272F-Flag were treated with biotin-C 18 H 32 O 4 -Cl.
• Biotin-C 18 H 32 O -Cl treated cells were lysed and cell lysates were incubated with SA-coated beads. Binding of DhaA.H272F to beads was analyzed by Western blot using anti-Flag R antibody. As shown in Figure 30D, DhaA.H272F-Flag capturing was not detected in the absence of biotin- C 18 H 32 O 4 -Cl freatment. At the same time, more than 50% of the DhaA.H272F- Flag expressed in cells was captured on SA-coated beads if the cells were treated with biotin-Ci 8 H 32 O -Cl.
• a synthetic DhaA.H272F gene was prepared which had a human codon bias, low CG content, selected restriction enzyme recognition sites and a reduced number of transcription regulatory sites.
• the amino acid sequence of a codon-optimized DhaA gene and flanking sequences included: 1) a Gly inserted at position 2, due to introduction of an improved Kozak sequence (GCCACCATGG; SEQ ID NO:45) and a BamHl site (thus the H272F active site mutation in DhaA mutants with the Gly insertion is at position 273); 2) a A292G substitution due to introduction of a Smal/Xmal/Aval site wliich, in the DhaA mutant with the Gly insertion, is at position 293; 3) the addition of Ala-Gly at the C-terminus due to infroduction of
• SEQ ID NO:51 has the following sequence: atgtcagaaatcggtacaggcttccccttcgacccccattatgtggaag cctgggcgagcgtat gcactacgtcgatgttggaccgcgggatggcacgcctgtgctgttcctgcacggtaacccgacct cgtcctacctgtggcgcaacatcatcccgcatgtagcaccgagtcatcggtgcattgctccagac ctgatcgggatgggaaaatcggacaaaccagacctcgattattttcttcgacgaccacgtccgcta cctcttcatcgaagcctttttgggtttgggaagctctttcatcgaagcctttttga
• Codon usage data was obtained from the Codon Usage Database (http://www.kazusa.or.jp/codon ), wliich is based on: GenBank Release 131.0 of 15 August 2002 (See, Nakamura et al., 2000). Codon usage tables were downloaded for: HS: Homo sapiens [gbpri] 50,031 CDS's (21,930,294 codons); MM: Mus musculus [gbrod] 23,113 CDS's (10,345,401 codons); EC:
• HS and MM were compared and found to be closely similar, thus the HS table was used.
• EC and EC K12 were compared and found to be closely similar, therefore the EC KI 2 table was employed.
• codons The overall strategy for selecting codons was to adapt codon usage for optimal expression in mammalian cells while avoiding low-usage E. coli codons. One "best" codon was selected for each amino acid and used to back-translate the desired protein sequence to yield a starting gene sequence. Another selection criteria was to avoid high usage frequency HS codons which contain CG dinucleotides, as methylation of CG has been implicated in transcriptional gene regulation and can cause down-regulation of gene expression in stable cell lines. Thus, all codons containing CG (8 human codons) and TA (4 human codons, except for Tyr codons) were excluded. Codons ending in C were also avoided as they might form a CG with a downstream codon. Ofthe remaining codons, those with highest usage in HS were selected, unless a codon with a slightly lower usage had substantially higher usage in E. coli. DhaA Gene Sequences
• DhaA.v2.1 codon usage tables in Vector NTI 8.0 (Informax) were employed.
• the DhaA.v2.1 protein sequence (SEQ ID NO:48) was back translated to create a starting gene sequence, hD ? «A.v2.1-0, and flanking regions were then added, as described above, to create hD/z ⁇ A.v2.1- 0F (SEQ ID NO:49).
• promoter modules i.e., 2 transcription factor binding sites with defined orientation
• eukaryotic transcription regulatory sites including a Kozak sequence, splice donor/acceptor sequences, polyA addition sequences
• prokaryotic transcription regulatory sequences including E. coli promoters
• Matrix name (core similarity threshold/matrix similarity threshold): U$AatII (0.75/1.00), U$BamHI (0.75/1.00), U$BglI (0.75/1.00), U$BglII (0.75/1.00), U$BsaI (0.75/1.00), U$BsmAI (0.75/1.00), U$BsmBI (0.75/1.00), U$BstEII (0.75/1.00), U$BstXI (0.75/1.00), U$Csp45I (0.75/1.00), U$CspI (0.75/1.00), U$DraI (0.75/1.00), U$EC-P-10 (1.00/Optimized), U$EC- P-35 (1.00/Optimized), U$EC-Prom (1.00/Optimized), U$EC-RBS (0.75/1.00), U$EcoRI (0.75/1.00), U$EcoRV (0.75/1.00), U$
• SequenceShaper remaining thresholds e.g. 0.70/Opt-0.05.
• C'AATTG A unique Munl/Mfel (C'AATTG) site was introduced to allow removal of the C-terminal 34 amino acids, including a putative myristylation site (GSEIAR) near the C-terminus. Another unique site, a Nrul site, was introduced to allow removal ofthe C-terminal 80-100 amino acids.
• Vertebrate transcription factor binding sequence families (core similarity: 0.75/matrix similarity: opt) and promoter modules (default parameters: optimized threshold or 80% of maximum score) found in different DhaA genes are shown in Table V.
• the remaining transcription factor binding sequence matches in hDhaA.v2.1-6F included in the 5' flanking region: Family: V$NEUR (NeuroD, Beta2, HLH domain), best match: DNA binding site for NEURODl (BETA-2 / E47 dimer) (MEDLINE 9108015): in the open reading frame: Family: VSGATA (GATA binding factors), best match: GATA-binding factor 1 (MEDLINE 94085373). Family: V$PCAT (Promoter CCAAT binding factors), best match: cellular and viral CCAAT box, (MEDLINE 90230299).
• VSRXRF Farnesoid X - activated receptor
• RXR FXR dimer Farnesoid X - activated receptor
• V$HNF1 Hepatic Nuclear Factor 1
• VSBRNF Brn POU domain factors
• POU transcription factor Brn-3 MEDLINE 9111308
• V$RBIT (Regulator of B-Cell IgH transcription), best match: Bright, B cell regulator of IgH franscription (MEDLINE 96127903).
• V$CREB Camp-Responsive Element Binding proteins
• E4BP4, bZIP domain transcriptional repressor
• Family: V$HOMS Homeodomain subfamily S8
• Family: V$NKXH NKX/DLX - Homeodomain sites
• Family: V$TBPF Tiata- Binding Protein Factor
• V$NKXH NKX/DLX - Homeodomain sites
• Prostate-specific homeodomain protein NKX3.1 MEDLINE 10871312.

Priority Applications (4)

Applications Claiming Priority (4)

Publications (3)

Family

ID=32871922

Family Applications (1)

Country Status (7)

Cited By (28)

Families Citing this family (35)

Citations (2)

Family Cites Families (55)

• 2004
  • 2004-01-30 WO PCT/US2004/002607 patent/WO2004072232A2/en active Search and Examination
  • 2004-01-30 JP JP2006503174A patent/JP4748685B2/ja not_active Expired - Lifetime
  • 2004-01-30 EP EP11005045.7A patent/EP2455458B1/en not_active Expired - Lifetime
  • 2004-01-30 EP EP10075510.7A patent/EP2341134B1/en not_active Expired - Lifetime
  • 2004-01-30 EP EP04707032.1A patent/EP1594962B1/en not_active Expired - Lifetime
  • 2004-01-30 KR KR1020057014186A patent/KR20050109934A/ko not_active Application Discontinuation
  • 2004-01-30 US US10/768,976 patent/US7238842B2/en not_active Ceased
  • 2004-01-30 AU AU2004211584A patent/AU2004211584B2/en not_active Ceased
  • 2004-01-30 CA CA002514564A patent/CA2514564A1/en not_active Abandoned
  • 2004-01-30 EP EP10075509.9A patent/EP2369006B1/en not_active Expired - Lifetime
  • 2004-01-30 EP EP11005044.0A patent/EP2455457B1/en not_active Expired - Lifetime
• 2007
  • 2007-04-12 US US11/786,792 patent/US7867726B2/en not_active Expired - Lifetime
• 2008
  • 2008-09-17 US US12/284,010 patent/USRE42931E1/en not_active Expired - Lifetime
• 2010
  • 2010-12-21 US US12/975,020 patent/US8257939B2/en not_active Expired - Lifetime
• 2012
  • 2012-04-18 US US13/450,217 patent/US8921620B2/en not_active Expired - Lifetime
  • 2012-04-18 US US13/450,233 patent/US8895787B2/en not_active Expired - Lifetime
• 2014
  • 2014-12-29 US US14/584,834 patent/US9540402B2/en not_active Expired - Lifetime
• 2016
  • 2016-12-12 US US15/376,139 patent/US10240184B2/en active Active
• 2019
  • 2019-03-20 US US16/359,581 patent/US11028424B2/en not_active Expired - Lifetime

Patent Citations (2)

Non-Patent Citations (11)

Also Published As

Similar Documents

Legal Events