AMENDED CLAIMS
[received by the International Bureau on 14 September 2004 (14.09.04); original claim 20 amended; remaining claims unchanged 1-19 and 21-29 (5 pages)]
Claims
1. A method for the identification of Mycobacterium in a sample comprising; forming a preparation comprising; a sample to be tested, polymerase chain reaction reagents and at least one oligonucleotide primer pair, characterised in that said oligonucleotide primer pair is selected from the group consisting of nucleic acid primers comprising;
5 tgggaaactgggaaactgggtctaata 3 5 cccgcacgcccaagttaagctgtgag 3 or;
5 cgacgaaggtccgggttctctcggattgac 3 5 gccatgcaccacctgcacacaggcccac 3 or modifications thereof, which modifications are the addition, deletion or substitution of at least one nucleotide base of at least one oligonucleotide primer of said pair, wherein said oligonucleotide or modified oligonucleotides hybridize to 16S ribosomal nucleic acid;
(ii) providing conditions suitable for 16S ribosomal nucleic acid" amplification; and optionally; i) detecting 16S ribosomal nucleic acid amplification products.
2. A method according to claim 1, wherein said oligonucleotide primer pair consists of;
5 tgggaaactgggaaactgggtctaata 3 5 cccgcacgcccaagttaagctgtgag 3 , and wherein said oligonucleotide pair enables the identification of both fast and slow growing Mycobacterium within said sample to be tested.
3. A method according to claim 1, wherein said oligonucleotide primer pair consists of;
5' cgacgaaggtccgggttctctcggattgac
V gccatgcaccacctgcacacaggcccac 3' , and wherein said oligonucleotide primer pair enables the identification of slow growing Mycobacterium within said sample to be tested.
4. A method according to claim 2 and 3, wherein said slow growing Mycobacterium group comprises; M.bovis, M.tuberculosis, M.kansaii, M.paratuberculosis, M.gordonae, M.leprae and M.celatum.
5. A method according to claims 1 to 3, wherein at least one Mycobacterium species- specific oligonucleotide primer pair is incorporated into said preparation.
6. A method according to claim 5, wherein said one Mycobacterium species-specific ' oligonucleotide primer pair is specific for a Mycobacterium species selected from the group comprising; M.abscessus, M.africanum, M.asiaticum, M.avium, M.bovis, M.celatum, M.chelonae, M.flavescens, M.fortuitum, M.gastri, M.gordonae, M.haemophilum. M.intracellulare, M.interjectum, M.intermedium, M.kansasii, M.malmoense, M.marinum, M.non-chromogenicum, M.paratuberculosis, M.phlei, M.shimodei, M.simiae, M.smegmatis, M.szulgai, M.terrae, M.trivale, M.tuberculosis, M.ulcerans orM.xenopi.
1. A method according to claim 6, wherein said Mycobacterium species is M.bovis.
8. A method according to claim 6 or 1, wherein said species-specific oligonucleotide primer pair hybridises with nucleic acid sequences in MPB64, MPB70 or Esat-6.
. A method according to claim 8, wherein said oligonucleotide primer pairs are selected from; acg gca teg teg tea gcc ag gtg att ggc ttg cga tag gc or; gaa caa tec gga gtt gac aa age acg ctg tea ate atg ta or; aca tga cag age age agt gg tga caa cct etc aga gtg eg
10. A method according to claim 1-9, wherein said sample is an environmental sample.
11. A method according to claim 10, wherein said environmental sample is from within a farm environment.
12. A method according to claim 11, wherein said sample is selected from the group consisting of; soil, vegetation, slurry, water, animal feed, ammal waste.
13. A method according to claim 12, wherein said vegetation is selected from the group consisting of; grass, hay or straw.
14. A method according to claim 1-9, wherem said sample is a cell/tissue/fluid sample.
15. A method according to claim 14, wherein said sample is a sample derived from an animal or human.
16. A method according to claim 14 or 15, wherein said biological sample is selected from the group consisting of; milk, sputum, respiratory tissue, respiratory exudates, blood, plasma, serum, cervical swab samples, biopsy tissue, gastrointestinal tissue, gastrointestinal fluids, urine, feces, semen or other biological samples.
17. A method according to claim 15, wherein said animal is selected from the group consisting of; human, cows, bulls, steers, oxen, goats, sheep, badgers, deer and opossums.
18. A method according to claim 17, wherein said animal is bovine.
19. A method for the identification of Mycobacterium in a sample comprising; forming a preparation to be tested comprising; a sample to be tested, polymerase chain reaction reagents and at least one oligonucleotide primer pair, characterised in that said oligonucleotide primer pair is selected from the group consisting of;
5 tgggaaactgggaaactgggtctaata 3 5 cccgcacgcccaagttaagctgtgag 3 and;
5 cgacgaaggtccgggttctctcggattgac 3 gccatgcaccacctgcacacaggcccac and; ii) providing conditions suitable for 16S nucleic acid amplification; and iii) detecting 16S nucleic acid amplification products.
20. A pair of oligonucleotides or modified oligonucleotides, wherem said modified oligonucleotides are modified by addition, deletion or substitution of at least one nucleotide base, and wherein the pair comprises a nucleic acid sequence selected from;
5 tgggaaactgggaaactgggtctaata 3 5 cccgcacgcccaagttaagctgtgag 3 or
5 cgacgaaggtccgggttctctcggattgac 3 5 gccatgcaccacctgcacacaggcccac 3 and the pair hybridises to 16S nucleic acid.
21. An oligonucleotide consisting of the nucleic acid sequence 5 tgggaaactgggaaactgggtctaata 3 or part thereof.
22. An oligonucleotide consisting of the nucleic acid sequence 5 cccgcacgcccaagttaagctgtgag 3 or part thereof.
23. An oligonucleotide consisting of the nucleic acid sequence 5' cgacgaaggtccgggttctctcggattgac or part thereof
24. An oligonucleotide consisting of the nucleic acid sequence gccatgcaccacctgcacacaggcccac or part thereof.
25. A kit comprising a DNA extraction kit, polymerase chain reaction agents and at least one oligonucleotide primer pair according to the invention
26. A kit according to claim 25, wherein said oligonucleotides are;
^tgggaaactgggaaactgggtctaata 3 5 cccgcacgcccaagttaagctgtgag 3
27. A kit according to claim 25, wherein said oligonucleotides are;
5 cgacgaaggtccgggttctctcggattgac 3 5 gccatgcaccacctgcacacaggcccac 3
28. A kit according to claim 25, wherein at least one of said oligonucleotide primer pairs are species-specific for Mycobacterium.
29. A kit according to claim 28, wherein said species-specific oligonucleotide primer pair is specific for M.bovis.