TW201142038A - Method for identifying Mycobacterium - Google Patents

Abstract

The present invention provides a method for identifying Mycobacterium spp. Particularly, the present invention uses hybridization technology to identify the species of Mycobacterium tuberculosis complex and nontuberculous Mycobacteria.

Description

201142038 VI. Description of the Invention: [Technical Field] The present invention relates to a method for identifying mycobacteria spp.); in particular, the present invention relates to the use of a specific probe for the detection of mycobacteria method. [Prior Art] Tuberculosis caused by Mycobacterium tuberculosis (tubercu 〇sis) has about 9.2 million new cases every year and causes about 10,000 deaths. Taiwan has 14,500 to 16,500 cases of tuberculosis every year, so it is the world. The big problem of public health. Mycobacteria include absolute pathogenic bacteria 'facultative pathogens and saprophytic bacteria. Mesh 4 has isolated nearly 100 mycobacteria, of which more than 20 kinds of 'clinically common such as Mycobacterium tuberculosis group (10) / 〇A complex 'MTBC), Mycobacterium sinensis (M) ), Mw/ceraw, Mycobacterium tuberculosis (M Mwu·5" 5), and Mycobacterium avium (from aWwm complex), etc. (Murray et al., 2005, Medical Microbiology, fifth Ed , ν〇1· Elsevier

Mosby.). The Mycobacterium tuberculosis group includes the following strains: Mycobacterium tuberculosis (M less cohcien.wm a/Wca«), Mycobacterium tuberculosis bcG (Μ·BCG), Mycobacterium tuberculosis, Kabo tuberculosis, Mycobacterium tuberculosis (Μ· , M. tuberculosis (M wz.cr <?")

And Mycobacterium tuberculosis (Μ·iMZjercw/c^^KDjelouadji et al., 2008, PLoS

Neg]. Trop· Dis. 2:e253; Murray et al., 2007, Manual of 146866.doc 201142038 CLINICAL MICROBIOLOGY, f ed, ν〇1 υ, these strains are similar in shape to each other and cause human or animal tuberculosis Among them, tuberculosis rods, tubercle bacilli and tubercle bacilli in Africa cause human tuberculosis (Singleton and Sainsbury ' 2〇〇6 , Dicti〇nary 〇f

Microbiology and Molecular Bi〇I0gy, 3 states ed , v〇1 ), especially Mycobacterium tuberculosis. Correct identification of strains in MTBC contributes to the epidemiological investigation of tuberculosis, but the genetic similarity of MTBC members is very high (Sreevatsan, Ren, 1997, Proc. Natl. Acad. Sci. USA 94:9869-9874 ), there is 99-100% sequence similarity in the 16S rRNA gene, so the sequence of this gene is not easy to distinguish these species; in recent years, the target genes used to distinguish MTbc include cadaveric sinks, 0 sand and (10) p祁, /, 幻, etc. (Liebana et al. '1996, J, Clin. Microbiol. 34:933-938; Prabhakar et al.' 2004 'J. Clin. Microbiol. 42:2724-2732; Scorpio and Zhang '1996, Nat Med. 2: 662-667; Sreevatsan et al., 1996, J. Clin. Microbiol 34: 2007-2010), in which the illusion gene has been shown to be a better gene for distinguishing MTBC species (Chimara et al., 2004). ' Mem. Inst. Oswald. · Cruz. 99: 745-748; Goh et al., 2006 'Mol. Cell· Probes, 20: 182-190; Niemann et al., 2000, J. Clin. Microbiol. 38:3231- 3234) o Mycobacteria other than Mycobacterium tuberculosis, generally referred to as nontuberculous mycobacteria (nontuberculous mycoba) Cteria, NTM). Most NTMs are found in natural soil or water, and a small number can cause human or animal rickets (Field and Cowie, 2006 'Chest 129:1653- I46866.doc 201142038 1 672), when immune is low It is susceptible to infection and has a tendency to gradually increase the clinical rate of NTM in recent years (Griffith, 2007, Curr. Opin. Infect Dis. 20: 198-203). Since NTM cannot be distinguished from Rhizoctonia under the microscope, it is usually only after culture and isolation that strain identification is required, so it takes a long time to identify. There are several methods for combining molecular techniques, such as the use of IS67-restriction fragment length polymorphism (RFLP) (Kallenius et al., 1999, J. Clin. Microbiol. 37:3872-3878). Heat shock protein 65 λκ combined S# chain reaction and restriction enzyme assay (Telenti et al, 993, 】. (:1111·Microbiol· 31:175-178), multiple Point typing by mycobacterial interspersed repetitive-unit-variable-number tandem-repeat (MIRU-VNTR) or spacer oligonucleotide typing (Aranaz et al., 2004, j) ·

Clin. Microbiol·42:5388-5391; Cadmus et al., 2006, J. Clin. Microbiol. 44:29-34; Godreuil et al., 2007, J. Clin.

Microbiol. 45: 921-927; Kremer et al., 2〇〇5, j CHn Microbiol. 43:314-320; Kulkarni et al. '2〇〇5, Res Micr〇bi〇L 156:588-596; S〇 La et al, 2〇〇3, everywhere

Evol. 3Π25-13 3), but NTM is sometimes not further clinically identified.

Due to the slow growth of mycobacteria, it is generally clinically necessary to take 2 weeks to 8 weeks to identify mycobacteria, which takes a long time. In recent years, many molecular bioassays and kits have been developed, such as iNN〇 LipA 146866.doc 201142038

MYCOBACTERIA (Innogenetics, Ghent, Belgium), using rRNA operon of mycobacteria as the target sequence (Suffys et al, 2001 'J. Clin. Microbiol 39: 4477-4482; Tortoli et al, 2003, J. Clin. Microbiol. 41:4418-4420; Trombert-Paolantoni et al., 2004, Pathol. Biol. (Paris) 52: 462-468), distinguishes between Mycobacterium tuberculosis and 16 non-tuberculous mycobacteria; GenoType® Mycobacterium CM/AS ( Hain Lifesience GmbH > Nehren > Germany) used the 23 S rRNA gene as a target for its identification (Makinen et al., 2006, Clin. Microbiol. Infect. 12:481-483; Richter et al., 2006, J Clin. Microbiol. 44:1769-1775), distinguishes between Mycobacterium tuberculosis and 14 (GenoType® CM) or 16 (GenoType® Mycokcierz'Mm AS) non-tuberculous branching rods, Gen-Probe Amplified Mycobacterium tuberculosis Direct test (Gen-Probe, Inc., San Diego, CA, USA) detects the Mycobacterium tuberculosis group using 16S rRNA as the target (Chedore and Jamieson, 2002 ' Int. J. Tuberc. Lung Dis. 6: 913-919; Lemaitre et al. '2004, J. Clin. Microbiol. 42:4 307-4309; Sloutsky et al. '2004 'J. Clin. Microbiol. 42:1547-1551); and AmplicorTM nucleic acid amplification test (Roche Diagnostic Systems ' Inc., Branchburg, NJ, USA) targeting 16S rRNA Detection of Mycobacterium tuberculosis (Bergmann and Woods, 1996, J. Clin. Microbiol. 34: 1083-1085; Michos et al. '2006 'Diagn. Microbiol. Infect Dis. 54: 121-126). LCx MTB assay, ABBOTT LCx probe system (Abbott Laboratories, Abbott 146866.doc • 6 - 201142038

Park, 111.) (Rohner et al., 1998 'J. Clin·Microbiol. 36:3046-3047) Detection of Mycobacterium tuberculosis using a ligase linkage reaction; BD ProbeTec energy transfer (ET) system (DTB) (Becton Dickinson Biosciences Microbiology Products, Sparks, MD 'USA) (Barrett et al., 2002, J. Med. Microbiol. 51: 895-898) The detection of Mycobacterium tuberculosis using the IS67/0 and 16SrRNA genes as targets. At present, many studies have carried out the positive reaction of liquid medium BACTEC MGIT 960 and confirmed that acid-fast staining is positive, and then combined with molecular biological methods to identify mycobacteria. Including the use of gene double-plex PCR and restriction enzyme analysis (rpoB duplex PCR-restriction enzyme analysis), photoreactivity and two biochemical reactions, can distinguish 29 NTM (Shen et al, 2009, Int. J. Tuberc. Lung Dis 13:472-479). It has also been studied to use the MGIT-positive reaction tube positive for acid-fast staining, and the PCR reaction with IS6/Chuan as the standard was successfully carried out to identify MTBC. The detection time of positive and negative anti-acid staining by sputum smear can be shortened to

6.4 days and 14.3 days (Sun et al. 2009, J. Formos. Med. Assoc. 108: 119-125). Previously mentioned the use of PCR to amplify hpM and identify mycobacteria with RFLP technology. Although this technology has been widely used, it still takes a lot of time in the culture process. If the decontaminated clinical specimen is directly digested, it is often The sensitivity is reduced due to insufficient bacteria. Chang et al. combined capillary electrophoresis and nested polymerase chain reaction (nestec}-PCR) to increase /^/7 (5*5 and RFLP sensitivity (Chang et al., 2008, Talanta. 77: 182-188). Wu et al., from Lin Geng Chang Gung Hospital, Taiwan, showed that mt^C and some NTMs in sputum smear samples with 146866.doc 201142038 nested-PCR and RFLP 'have good results (Wu) Et al., 2008, J. Clin. Microbiol. 46:3591-3594) ° However, the above methods are often complicated and time consuming, and many methods cannot identify the bacteria. The correct rate and sensitivity are not so Satisfactory, the industry still has to develop a method for correctly identifying mycobacteria. SUMMARY OF THE INVENTION The object of the present invention is to provide a method for identifying mycobacteria, which has included a needle of Myc2 and Myc3 or a complementary strand thereof ( C〇mpiementary strands) is heterozygously reacted with the DNA in the sample to be tested, and if at least one heterozygous reaction occurs, the sample to be tested comprises mycobacteria. Another object of the present invention is to provide a probe comprising Choose the following probes and their mutual The group consisting of: Myc2, Myc3, Kenting BC2, MTBC4, MbovGl, MbovGWl, Mbovl, MbovWl, Mcanl, McanWl, Mcapl, McapWl, fused (6), paralysis, MtublR, MtubWlR, Mabsl, _, μ-3 , Mf〇ri,

Mgas2, Mgorl, Mint2, Mkanl, Msi/lel, Mma/ul2, Mnonl, Mperl, Mscrl, Msme3, Mszul, Mterl and Mxen2. It is still another object of the present invention to provide a kit for identifying a mycobacterium in a sample, the kit comprising the aforementioned probe. The correct rate identified by the method of the present invention is high, shortening the identification time and making the identification process consistent. 1 Easy to simplification, rapidization, and life automation can be clinically applied by correct identification. Treat with the right antibiotics. 146866.doc 201142038 [Embodiment] The object of the present invention is to provide a method for identifying mycobacteria, which comprises heterozygous reaction of a probe of Myc2 and Myc3 or a complementary strand thereof with a DNA in a sample to be tested, if any When at least one heterozygous reaction occurs, the sample to be tested contains mycobacteria. The probe information used in the present invention is shown in Table 1. Table 1

Name Sequence SEQID No. 1 target microorganism Mycobacterium Myc2 YCTGTAGTGGGCGAGAGCCGG 2 Myc3 CACACTGTTGGGTCCTGAGRCAACA 3 tuberculosis group MTBC2 GAAAACGCCCCAACTGGT 4 MTBC4 ATGACAACAAAGTTGGCCACC 5 Mycobacterium bovis group MbovGWl GGTCAACGGTGCGGTTCTGG 6 MbovGl GGTCAACGGTACGGTTCTGG 7 Mycobacterium bovis MbovWl GAAGGTCTGTAACGAACAGCTGA 8 Mbovl GAAGGTCTGTAATGAACAGCTGA 9 sill tuberculosis McanWl CGAAAGTCGTTGTGAACAAGGC 10 Mcanl CGAAAGTTGTTGTGAACAAGGC 11 Cobber tuberculosis McapWl CCTGGCCGCTGTGATCTC 12 Mcapl CCTGGCCGCGGTGATCTC 13 Mike tuberculosis MmicWl GGGTACGAGTGGTCTCAGGTTT 14 Mmicl GGGTATGAGTGGTCTCAGGTTT 15 Mycobacterium MtubWIR GACTTTCGAGTCGGTGGG 16 MtublR GACTTTCGCGTCGGTGGG 17 swollen ulcer Mabsl CCGTGGATGGGTAGTCG 18 Mycobacterium avium Mycobacterium chelonae Mavil GTTCCCGTCTGTAATGGACG 19 Mche3 CCCGTGGATAGGTAGTCGG 20 Accidental Mycobacterium Mforl ATTCGATTCCCCCGCCGT 21 Mycobacterium tuberculosis Mgas2 CAGCAAGCAAGCCAGACACACTATT 22 Mycobacterium genus Mgorl GCCGTGAAGGGTCATCGTCT 23 Mycobacterium intracellulare Mint2 GGGTGCACAACAGCGAATG 24 Mycobacterium kansii Mkanl TGGACGAAAGCCTGGTGAC 25 Mycobacterium marinum Msi/lel TTGGTGGAGTGTGAGCCGT 26 Mycobacterium marinum Mma/ul2 TAGTGGATGGAAGCCGGGT r 146866.doc -9- 201142038

27 Mycobacterium sinensis Mnonl GTGGTTGGGATACATTTCGCC 28 Mycobacterium phlei Mperl TGGTGGGTGTCGGCGTGTT 29 Mycobacterium Mscrl GGGGTTCTCGCCTGTAGTGG 30 Mycobacterium Msi/Iel TTGGTGGAGTGTGAGCCGT 31 Msme3 TGAGGAGCTGGATCGCTGTAGT 32 Mycobacterium Mszul CACGAAACGCATCCCAACTG 33 Bacillus subtilis Mterl CCGCCAGCAGCCTTGTGC 34 Cancer - Mma/ul2 TAGTGGATGGAAGCCGGGT 35 _ 分 枯 呈 呈 呈 M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M ", the first three lowercase English words in the mother's name (secies) - ^ ·, $ moxibustion _ $ force σ on the needle number, if the negative (anti-sense) probe will add large Wo Nian·· f mother R. There are 19 probes selected from the rRNA gene spacer (intergenic Sna〇)

Pacer regi〇I1,its); another 12 probes are used to distinguish the unique genes unique to the phantom genes of each species in the MTBC

Single nucleotide polymorphism (SNP), with two probes, a group of rabbits, a horse, a 'specific probe, named as the former iiji, another 1 4 solid 9 n/^ $ u Other probes of MTBC species other than the target strain, increase the letter W to make a difference.

The principle of needle & 4 is that the sequence of the probe is not often mutated and: 1. Probe long sound person # , X " in the range of 7 7~27 nucleotides is the most ideal range, the probe is too short Will cause difficulty in binding to the target DNA, too long to easily produce non-specific hybrid reactions; 2 · GC ratio between 40% and 60% to reduce the probability of secondary structure generation; Probe: ^ value ^, such as etting Temperature) The design is as close as possible to the hybridization temperature (hybridization 146866.doc 201142038 temperature) between 5 °C. For example, if the hybrid temperature is set at 5 ° ° C, the L value of the probe should be as much as 45 ° C ~ 55 ° C; 4. Try to avoid the hairpin l〇ops structure, palindrome Structure (palindrome) or repeats (repeats) structure; 5. Design the difference point in the middle of the probe, and add 8~10 thymine at the 3rd end of the probe to increase the probe. Combination of needle and nylon membrane; designed probe after BLAST search to determine no with GenBank

The sequences of other strains are similar. 'cr〇ss hybridization'

As used herein, the term "probe" refers to a molecule comprising at least 8 nucleotides in succession, preferably 10 to 50 nucleotides in length, more preferably 15 to 40 nucleotides in length, optimal. It is 17 to 27 nucleotides in succession. On the other hand, the car also has 8 to 1 thymidine bite. The probe can be hybridized with the target DNA under heterozygous conditions. Those of ordinary skill in the art to which the present invention pertains can determine the conditions of the hybrid reaction, wherein the preferred conditions for the heterocycle are about 4 Torr. 〇 to about 6 5 . In the middle of the battle. The term "a nucleic acid molecule complementary strand of a fully hybrid nucleic acid molecule" as used herein refers to a base which can be used with the probe according to the present invention and the base of the probe according to the present invention. Needle can be used to make a knife, because of the branching rod! w grows slowly, using traditional ones. It takes a long time to get into the house, and the mycobacteria of the Ministry is not easy to determine. The vouchers are not only developed, but the bacterial 16S rRNAi 23S rRNA two gene intervals W £ have a specificity in the sequence of seven] 46866.doc 201142038 (species-specific), sometimes more than the 16S rRNA gene sequencing method Can be distinguished to the level of the species. Moreover, the rRNA gene spacer sequence has a small susceptibility between different strains in the species (Gurtler and Stanisich, 1996, Microbiology 142 (Pt 1): 3-16). Therefore, the present invention mainly utilizes the rRNA gene spacer as a mycobacterial identification. The goal. Preferably, according to the method of the present invention, the Mycobacterium tuberculosis group and the non-tuberculous mycobacterial group can be further distinguished, which further comprises using a probe of MTBC2 & mtbc4 or a complementary strand thereof to carry out a heterozygous reaction with the DNA in the sample to be tested, If the DNA in the sample to be tested simultaneously produces a hybrid reaction with the probes of MTBC2 and MTBC4 or their complementary strands, the sample to be tested contains Mycobacterium tuberculosis; if the DNA in the sample is not simultaneously with MTBC2 and MTBC4 The probe or its complementary version produces a hybrid reaction, and the sample to be tested contains non-tuberculous mycobacteria. More preferably, the method according to the invention further identifies the species name of the toadstool that has been identified as a tuberculosis group. Since the rRNA gene spacer of the Mycobacterium tuberculosis group has a similarity of 1%, the town team has a plurality of single sites in the ^^ gene to identify the different strains in the group. According to the method of the present invention, it is preferred to carry out a heterozygous reaction with the DNA of the sample to be tested and the complementary strand of the MtubwiR, such as the strength of the heterozygous reaction between the DNA in the sample to be tested and MtublR or its complementary strand. And greater than the intensity of the heterozygous reaction of <DN^MtubwlR or its complementary strand in the sample to be tested, the sample to be tested comprises Mycobacterium tuberculosis (M(10)(10)"). The method according to the present invention preferably further comprises the use of MbovGl and MbovGWl The needle or its complementary strand is heterozygously reacted with the DNA in the sample to be tested, 146866.doc 201142038 If the DNA of the sample to be tested _ DNA* MbovG1 or its complementary strands is greater than the DNA of the sample to be tested The strength of the heterozygous reaction with MbovGW1 or its complementary strands, the sample to be tested comprises a population of Mycobacterium tuberculosis (from the group (10) to group). Preferably, the group of Mycobacterium tuberculosis comprises Mycobacterium tuberculosis (M hvb) 'bovine tuberculosis Bacillus BCG (M 0〇WiBCG) and Kappa knot = bacillus (M. In a preferred embodiment of the present invention, it is possible to identify: an individual strain of the Mycobacterium tuberculosis group. According to the method of the present invention, it is 2 Also includes probes using Mbov 1 and MbovWl or their complements Performing a hybrid reaction with the DNA in the sample to be tested, such as the intensity of the heterozygous reaction of dna with Mb〇vl or its complementary strand in the sample to be tested is greater than 2 in the sample to be tested or its complementary strand The intensity of the reaction, the sample to be tested comprises Mycobacterium tuberculosis or Mycobacterium tuberculosis BCG; the method according to the invention preferably comprises using a probe of Mcapl and McapW1 or a complementary ruthenium thereof and DNA in the sample to be tested. a heterozygous reaction, such as the intensity of the heterozygous reaction of the 2 capsule with MCap1 or its complementary strand in the sample to be tested is greater than the intensity of the heterozygous reaction of the DNA in the sample to be tested with McapW1 or its complementary strand, then the sample to be tested comprises Tuberculosis bacillus. According to the method of the present invention, it preferably further comprises using Mmicl and

The probe of MmiCW1 or its complementary strand is hybridized with the test in the sample to be tested, 'if the DNA in the sample to be tested reacts with the heart (6) or its complementary strands, the intensity is greater than the dna in the sample to be tested The sample to be tested contains M. microti, which is the intensity of the heterozygous reaction with the chimeric or complementary strand. According to the method of the present invention, the sample of the sample to be tested is combined with the probe or the complementary strand thereof using Mcani and 146866.doc • 13-201142038, such as the sample to be tested. In addition to the heterozygous reaction, 丄 、 /, Mcan 】 or its complementary strands of heterozygosity ... (4) the DNA of the mouth sample to be tested and the strength of McanWl or 苴 汉 汉 , 则 则 则 则 can can can can can can can can can can can can can can can can can can τ _

According to the method of the present invention, preferably, the method further comprises: using the first-group probe or the λ and the _ group probe or the complementary strand thereof to carry out a heterozygous reaction with the (10) VIII in the sample to be tested. The intensity of the heterozygous reaction between the sample in the sample to be tested and the group probe or its complementary strand is greater than the intensity of the heterozygous reaction between the DNA in the sample to be tested and the first group of probes or their complementary strands. The sample contains a non-W tuberculosis rod g (M coffee · (10) said), wherein the first group probe comprises MtublR, MbovG1, Mb〇vl, the heart is called 'MmicaMcani; the second group probe contains MtubW1R, MbovGW1, Mb() vW1, Meapwi, MmicWl, and McanWl. On the other hand, more preferably, the method according to the present invention can further identify the species name of the strain to be identified which has been identified as non-tuberculous mycobacteria, which is mainly carried out using a probe designed by the rRNA gene spacer. Preferably, the method according to the present invention further comprises using one or more selected from the group consisting of

Mabsl, Mavil, Mche3, Mforl, Mgas2, Mgorl, Mint2, Mkanl, Msi/lel, Mma/ul2, Mnonl, Mperl, Mscrl,

Msme3, Mszul, Mterl, Mxen2 and their complementary strand probes are heterozygous for the DNA in the sample to be tested; if the DNA in the sample to be tested is heterozygous with the Mabsl probe or its complementary strands' The sample to be tested comprises M. ulcerans 146866.doc 201142038 abscessus^); the DNA in the human sample such as 4 is heterozygous with the Mavil probe or its complementary strand. In response, the sample to be tested comprises Mycobacterium avium (Μ.; human if the DNA in the sample to be tested reacts with the Mche3 probe or its complementary strand, the sample to be tested comprises Mycobacterium marinum (M) ; as in the sample to be tested, 八8 and the Mf〇rl probe or its complementary strands produce a miscellaneous reaction', then the sample to be tested contains the genus Mycobacterium (M careful (4);

If the DNA in the sample to be tested is heterozygous with the ^382 probe or its complementary strand, the sample to be tested comprises Mycobacterium tuberculosis (MA such as DNA in a sample to be tested and a Mg〇rm needle or The complementary strands produce a heterogeneous reaction. The sample to be tested contains Mycobacterium gordonii (from "10"); the DNA in the sample to be tested is mixed with 2 probes or 2 complementary probes or their complementary strands. The reaction sample contains the intracellular mycobacteria (M intracelluiare^. If the DNA#Mkanl probe or its complementary strand in the sample to be tested produces a hybrid reaction Μ 4 sample to be tested contains Kansas branching rod® (Λ/. (_咖7); Eight as the sample to be tested. The DNA in S and the Msi/lel probe or its complementary strands produce a heterogeneous ~ then the sample to be tested contains Mycobacterium sputum (Λ/· hwke ) or M. kawaii (M !(10)i/7avum);

2. The DNA in the sample to be tested is heterozygous for the Mma/ul2 probe or its complementary strand. The sample to be tested contains Mycobacterium marinum (M-mycosis or Mycobacterium smegmatis (M)

If the DNA in the sample to be tested is heterozygously reacted with the Mnon1 probe or its complementary strand, the sample to be tested comprises Mycobacterium fortunei (M 146866.doc 15 201142038 n〇nchr〇m〇genicum); If the DNA in the sample to be tested produces a hybrid reaction with the Mper1 probe or its complementary strand, the sample to be tested comprises Mycobacterium phlei (M; such as the DNA in the sample to be tested and the Mscr! probe or The complementary strands produce a heterozygous reaction, and the sample to be tested comprises Mycobacterium phlei (from scrofulaceum); if the DNA in the sample to be tested and the Msme; 3 probe or its complementary strands produce a hybrid reaction, then the test is to be tested The sample comprises Mycobacterium smegmatis (M. Eagle; # if the DNA in the sample to be tested is heterozygous with the Mszul probe or its complementary strand. The reaction, the sample to be tested comprises Mycobacterium tuberculosis (from η"/",); if the DNA in the sample to be tested produces a hybrid reaction with the MterUf needle or its complementary strands', the sample to be tested contains Mycobacterium phlei (M); and ▲ as the sample to be tested. The Li Ba and the river produce a hybrid reaction with the vegetable needle or its complementary strand, and the sample to be tested contains the material branching rod g (M(四)零.) The sample to be tested according to the present invention may be a culture containing the culture to be identified, a sample taken from the patient, or further processed from the culture to be identified or from the patient to obtain DNA information therein. For the sample, the sample of the patient in the sputum is preferably sputum or blood, and the method for obtaining DNA information is preferably amplified by a polymerase chain reaction. Since the method of the present invention is separated by the rRNA gene The region or the gene set = the probe is identified. Therefore, the ship in the sample to be tested preferably contains the rRNA gene spacer or gene of the L ^ bacteria; more preferably, the DNA in the sample to be tested contains the linkage by the polymerase Reaction-amplified fragment. In a preferred embodiment of the present month, the dna in the sample to be tested is printed using 146866.doc •16-201142038 (SEQ ID NO. 36) and sp2 (SEQ ID N〇37) The primer is used to amplify the ANA gene spacer region of the strain to be identified; the magical 5 gene to be identified in the sample to be tested is preferably extended by Gblf (SEQ ID Ν〇. 38) and GMr (SEQ (1) ν〇39). Addition. In the preferred embodiment of the invention, the sample can be DNA-implemented labeling. The method of labeling DNA' is well known to those of ordinary skill in the art to which the present invention pertains. For example, when performing polymerase chain reaction amplification, the label contains a flag, preferably, The marker is digoxigenin ♦ (d-in), or the labeled dUTp can be used to introduce a label into the product. In a preferred embodiment of the invention, the method further comprises a positive control step. Any identifying probe for identifying a known microorganism is suitable for this positive control step. Preferably, the hybridization reaction according to the present invention can be carried out on a microarray wafer comprising a substrate onto which the probe is applied. Substrate materials and coating methods have been well established in the art, wherein the substrate is preferably nylon or glass. The probes according to the present invention are preferably arranged on the substrate in a microarray manner to allow identification of a plurality of microorganisms in a single operation, saving a lot of time, space and labor. Any of the commonly used gene expression detection methods in the art can be used in the present invention, which can replace the different biochemical reactions for different mycobacteria in the prior art to identify the species. In a specific embodiment of the present invention, 'bacteria are counted in a 〇lig〇nucieotide array, including six species belonging to the Mycobacterium tuberculosis group. From the internal transcribed region between the MS-23S rRNA gene of the bacterium and the 奵叻146866.doc 201142038 gene design probe, the probe was spotted on a nylon membrane by a micro-matrix dot machine, and the marker was ground. After the heterologous reaction of the pcR product of flavin, the reaction result is shown by an antibody labeled with a phosphate decomposing enzyme. b The sputum is first tested for the type strain and the reference strain, and further tested the clinical strain and finally directly tested the clinical specimen to evaluate the feasibility of the wafer for identifying (or detecting) the bacillus · The present invention tested a total of 25 target reference strains, including MTBC (15 strains) (Table 2) and 19 strains (73 strains) (Table 3), a total of 88 strains. The target clinical strains were also tested, including MTBC 8 strain (Table 2) and 121 strains, a total of 201 strains (Table 3). The wafer according to the present invention can complete the strain identification within 8 hours, and the reagents are used in a small amount, the cost is low, and the sensitivity and specificity are high. Therefore, the microarray wafer of the present invention can quickly and correctly identify different mycobacterial species' as an effective detection tool. Another object of the present invention is to provide a probe comprising a group selected from the group consisting of Myc2, Myc3, MTBC2, MTBC4,

MbovGl, MbovGWl, Mbovl, MbovWl, Mcanl, McanWl, Mcapl, McapWl 'Mmicl, MmicWl, MtublR, MtubWlR, Mabsl, Mavil, Mche3, Mforl, Mgas2, Mgorl, Mint2, Mkanl, Msi/lel, Mma/ul2, Mnonl, Mperl, Mscrl, Msme3, Mszul 'Mterl, Mxen2 and their complementary strands. It is still another object of the present invention to provide a kit for identifying a mycobacterium in a sample, the kit comprising the aforementioned probe. F46866.doc -18- 201142038 In accordance with the present invention, the kit further comprises reagents for obtaining the lateral a gene compartment or the # gene. The composition of the reagents is also well known to those of ordinary skill in the art to which the invention pertains. In the present invention - the preferred embodiment - the reagents are used in the polymerase chain reaction. In a preferred embodiment of the invention, the kit further comprises spl and sp2 primers and/or (31) 1 £ and (^^ primers. In another preferred embodiment of the invention, the kit is advanced The invention is described in detail by the following examples, which are not intended to limit the invention to the disclosure of the examples. Examples: Experimental strains, strain cultures, and strains £^ The reference strains used in the eight research institutes are from the United States ATCC (American

Type Culture Collection ’ Manassas, Virginia, USA), Taiwan > 4 BCRC (Bioresources Collection and Research Center,

Food Industry Research and Development Institute »

Hsinchu 'Taiwan', CCUG (Culture Collection, University of G0teborg, G6teborg, Sweden), CIP (Collection of the Institute Pasteur, rue du Docteur Roux, Paris 'France), Japan JCM (Japan Collection of Microorganism > RIKEN BioResource Center 1 Saitama >

Japan), British NCTC (National Collection of Type Cultures, Central Public Health Laboratory, London, UK). The target reference strains used in this study have a total of 25 (88 strains) of mycobacteria, including 6 MTBC (15 strains) (Table 2), and 19 NMS (73 strains) (Table 3) 146866.doc 19 201142038; The target clinical strains were also tested, including MTBC 80 strain (Table 2) and NTM 121 strain, a total of 201 strains (Table 3). Among the nontarget species, there were 37 species (38 strains) belonging to the genus Mycobacterium, and 35 strains (35 strains) of other bacteria (Table 4). Table 2 Mycobacterium tuberculosis bovine tuberculosis ϋ~ Bovine tuberculosis BCG TB tuberculosis 卡 #卡柏 TB Mycobacterium tuberculosis Mycobacterium tuberculosis total strain reference strain clinical strain total strain number ATCC 25420 » ATCC 35711 ATCC 27291 » ATCC 35734 ATCC 35731 > ATCC 35735 ATCC 35737 ATCC BAA-824 ATCC 19422 ATCC 35782 NCTC 8337 H37Rv, ATCC 25177, ATCC 35818 » ATCC 35828 MB 156, MB 217, KMUH 】 8709, KMUH 19297, KMUH 18702, KMUH 19149, KMUH 18886, KMUH 16758, KMUH 17123 » KMUH 17529 ' KMUH 17641, KMUH 18352, KMUH 16704, KMUH 17006 > KMUH 15546 * KMUH 14687, KMUH 16793, KMUH 15569, KMUH 14384 * KMUH 14821 » KMUH 15627, KMUH 15874, KMUH 12528, KMUH 13025 , KMUH 13115, KMUH 12961, KMUH 13638, KMUH 13790, KMUH 14288, KMUH 14303, KMUH 14494, KMUH 14685, KMUH 1432, KMUH 14551 > KMUH 14637 » KMUH 14155, KMUH 1469, KMUH 9880, KMUH 11037 > KMUH 12087 * KMUH 1118 BU KMUH 12566, KMUH 12569, KMUH 13295 * KMUH 12088 » KMUH 9798, KMUH 9388, KMUH 9776 , KMUH 8222 » KMUH 8127 » KMUH 6754, KMUH 6828, NCKUH 7290, NCKUH 7161 » NCKUH 7910 » NCKUH 7068, NCKUH 7096, NCKUH 7885, NCKUH 7476, NCKUH 7590, AUH 2 , AUH 3, AUH 4, AUH 5, AUH 7, AUH 丨丨* AUH 12, AUH 15, AUH 16 > AUH 20 * AUH 21 > AUH 22 * AUH 23, AUH 24, AUH 25, AUH 26, AUH 27, AUH 28, AUH 30, AUH 31 2 15 95 •20- 146866.doc 201142038 Table 3_ Strain type reference clinical strain total strain number of Mycobacterium tuberculosis CCUG 20993, CCUG 37454 AUH8, KMUHT13769, KMUHT13928, 17 , NCTC 10269, ATCC KMUHT12727 > KMUHT14817 > KMUHT14298 23003 - KMUH0729-31 - KMUH0903-49 - KMUH0903-51 > KMUH0903-92 > KMUH0903-48, KMUH0729-33, KMUH0903-96 Mycobacterium avium

Mycobacterium tuberculosis, Mycobacterium tuberculosis BCRC 1544, ATCC 19421, CCUG282] 6, CIP 103963, CIP 103964, CIP 103965 > CIP 103968 ATCC 35752, CCUG 37827 > ATCC 35749 ATCC 6841 > ATCC 19542 , BCRC 15320, CIP 104595 ,JCM 6387 MB 034,MB249,AUH 17,AUH 18,AUH 19,AUH 33,KMUHT12626,KMUHT12063 ,KMUHT13770,KMUH0729-19, KMUH0903-55 ' KMUH0903-28 MB 041 ' KMUHT12169 > KMUHT12117 > KMUHT11768 ' KMUHT12173 > KMUHT12172 MB 018, KMUHT1U69, KMUH0903_10, KMUH0903-16 > KMUH0903-45 > KMUH0903-9, KMUH0903-7, KMUH0729-17, KMUH0903-43 > KMUH0903-42 ' KMUH0903-56, KMUH0903-57, KMUHT14326 , KMUHT13902 ' KMUHT11588 19 9 20 Mycobacterium vaccae

CCUG 29062 * CCUG 27846, ATCC 25157 CCUG 21801 > ATCC 35759, CCUG 21805, CCUG 21806 Mycobacterium tuberculosis CCUG 28005 > CCUG 28000, ATCC 3576, ATCC 35763 MB 052, AUH AUH 14, KMUHT13139, KMUHT11696, KMUHT11697 KMUHT13314(0811) > KMUHT12221 ^ KMUHT13314(0818) » KMUH0903-15 > KMUH0729-1, KMUH0903-69, KMUH0729-2, KMUH0903-37 MB 084, MB 085, AUH 6, AUH 29, AUH 35, KMUH0903 -94, KMUH0903-36, KMUHO卯3·95, KMUH0903-60, KMUH0903-98, KMUHO卯3-90, KMUH0903-31, KMUH0729-14 > KMUH0729-16 > KMUH0903-54, KMUH0903-58, KMUH0903 -47, KMUH0903-99 > KMUH0903-100 > KMUH0903-27 » KMUH0903-40 » KMUHT12630 » KMUHTI2466 > KMUHT13858 18 28 I46866.doc -21 · 16201142038

Mycobacterium kansii ATCC 35775, CCUG 27783 MB078, AUH 10, KMUH0903-9 BU KMUH0903-74 » KMUH0903-33 » KMUH0903- CCUG 27785 30 » KMUH0903-4 ' KMUH0903-26 > KMUHT11533 » KMUHT10784 ^ KMUHT14060 * KMUHT12152 > KMUHT11418 CCUG 42422, CCUG 42423, CCUG 47901 AUH 13 Mycobacterium marinum ATCC 927, JCM12275, CCUG 32219 » CCUG 32220, CCUG 32221, ATCC 25039 AUH 36 » AUH 37 > AUH 38 Mycobacterium auxilis CCUG 28009, ATCC 25143, NCTC 10497 MB 059 Mycobacterium phlei CCUG 27976, CCUG 28064, ATCC 23049 MB 804, KMUH0903-n, KMUH0903-84 Mycobacterium phlei CCUG 29045 > CCUG 27782 > CCUG 29053 > CCUG 29055 Mycobacterium phlei CCUG 29114, ATCC 25273, ATCC 15080 MB 060 Mycobacterium smegmatis ATCC 19420 > BCRC 10708 , CCUG 21824, JCM 20379 MB 690 Mycobacterium tuberculosis CCUG 37675, NCTC 10829 , NCTC 10830 Mycobacterium CCUG 42429, CCUG 532, ATCC 25268, ATCC 25269 MB 066 Mycobacterium ulcerans NCTC ]0417, NCTC 10013, NCTC 10445 ATCC 25899 Mycobacterium tuberculosis CCUG 31306, ATCC 19970, ATCC 丨9973 MB 070, AUH9, AUH32 (uncertained non-tuberculous branch KMUH0729-23 * KMUH0903-17 > KMUH0903- bacillus) 78, KMUH0903-72, KMUH0729- 24, KMUH0903-81 » KMUH0903-22 » KMUH0903-85, KMUH0729-15, KMUH0903-25 Total strain 73 121 4 9 4 6 4 4 5 3 5 4 6 10 194 146866.doc -22· 201142038 Table 4

The number of total strains of microbial strains is not identified. The number of strains is not consistent. gri agri CCUG 37673 1 1 0 Μ. aichiense CCUG 37672 1 1 0 Μ. alvei CCUG 37585 ] 1 0 Μ. arupense CCUG 39146 1 1 0 Μ. asiaticum MB 031 1 1 0 Μ. brumae CCUG 37586 1 1 0 Μ. celatum CCUG 39185 ] 1 0 Μ. chitae CCUG 39504 1 1 0 Μ. chlorophenolicum BCRC 13726 1 ] 0 Μ chubuense CCUG 37670 1 1 0 Μ. confluent is CCUG 37513 1 1 0 Μ Diernhoferi BCRC 16395 1 1 0 Μ. fallax CCUG 37584 1 1 0 Μ flavescens MB 017 ] 1 0 Μ. gadium CCUG 37515 1 1 0 Μ. genavense MB 691 1 I 0 Μ. goodii CCUG 52054 1 0 1 Μ. haemophilum CCUG 47452,MB 074 2 2 0 Μ. hibermiae CCUG 39184 1 1 0 Μ. hodleri CCUG 38151 1 1 0 Μ. interjectvm MB 786 1 1 0 Μ. intermedium CCUG 37583 1 1 0 Μ mageritense CCUG 37984 1 1 0 Μ malmoense CIP 105775 1 1 0 Μ. neoaurum BCRC 17230 1 1 0 Μ. obuense CCUG 37669 1 I 0 Μ. phlei BCRC 10707 1 1 0 Μ. pulveris CCUG 37668 1 1 0 Μ. rhodesiae CCUG 37664 1 1 0 Μ. senegalense KMUH0729-23 1 ] 0 Μ septicum CCUG 43574 1 1 0 Μ. shimoidei CCUG 37517 1 1 0 Μ. sphagni BCRC 16397 ] ] 0 Μ. thermoresistibile CCUG 28008 1 1 0 Μ. vaccae BCRC 17229 1 1 0 rr τ ι Ο i 146866.doc -23 - 201142038 M. vanbaalenii Μ. wolinskyi Aeromonas hydrophila Bacillus cereus BCRC 16820 KMUH0903-17 BCRC 13880 BCRC 10446

Bacteroides fragilis Citrobacter freundii Edwardsiella tarda Enterobacter cloacae Enterococcus faecalis Escherichia coll Fusobacterium nudeatum Gordonia alkanivorans Gordonia amarae Gordonia nitida Gordonia terrae Gordonia westfalica Klebsiella oxytoca Klebsiella pneumoniae Listeria monocytogenes P eptostreptococcus anaerobicus CCUG 4856 BCRC 12291 BCRC 10670 BCRC 10401 ATCC 19433 BCRC 15513 JCM 11024 DSM 44187 BCRC 13728 DSM 44499 BCRC 13382 DSM 44215 BCRC 13985 BCRC 11644 BCRC 15339 CCUG 7835 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Plesiomonas shigelloides Propionibacterium acnes Proteus mirabilis Providencia rettgeri Pseudomonas aeruginosa Serratia marcescens Shigella boydii Shigella.sonnei Staphylococcus aureus Staphylococcus epidermidis Staphylococcus haemolyticus BCRC 14727 CCUG 1794 BCRC 10726 BCRC 13994 BCRC 10944 BCRC 10948 BCRC 15960 BCRC 15966 BCRC 15290 BCRC 15245 BCRC 15239

Staphylococcus saprophyticus BCRC 13978 Streptococcus pneumoniae ATCC 33400 Streptococcus pyogenes ATCC 14289 Vibrio parahaemolyticus BCRC 10806 Vibrio vulnificus BCRC 13846 Yersinia enterocoliiica BCRC 13999 Total 1 1 1 ] 1 1 1 1 1 1 1 1 1 1 1 1 1 1 71 I 0 1 0 ] 0 ] 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 ] 0 1 0 ] 0 I 0 70 1 146866.doc -24- 201142038 All strains are cultured according to the recommended medium for each species (eg BBLtm 7H11 Agar and L0wenstein-Jensen) (LJ) agar slants) and culture conditions for secondary culture. DNA extraction

The strain DNA extraction method is a boiled method (Millar et al., 2000, J. Microbiol. Methods. 42: 139-147): sterilized water is added to a microcentrifuge tube (Eppendorf), and colony suspension on the medium is taken. In a sterilized water, the mixture was heated to 100 ° C in a dry bath, and after 30 minutes, it was centrifuged at 12,500 rpm for 20 minutes. The supernatant contained bacterial DNA and stored at -70 °C. The rRNA gene spacer and the gyrB gene were amplified and sequenced using the spl (5'-ACCTC CTTTC TAAGG AGCAC C-3, SEQ ID NO. 36) and sp2 (5'-GATGC TCGCA ACCAC TATCC A-3, respectively). SEQ ID NO. 37) to amplify the rRNA gene spacer of mycobacteria (Roth et al. '2000, J, Clin_Microbiol 38: 1094-1104); primer Gblf (5,-TGGTT AACGC GCTAT CCAC-3, , SEQ ID NO. 38) & Gblr (5, -ACCAACTCTCGTGCCTTAC-3', SEQ ID NO. 39) used to amplify the illusion of mycobacteria; γβ gene, the primers were all produced by MDBio Inc. 'Taipei , Taiwan) synthesis. These two pairs of primers were used to increase the amplification by polymerase chain reaction. The amplified products of the primers on spl and sp2 were rRNA gene spacers. The product of the amplification of the primers on Gblf and Gblr is a partial sequence of the gene. PCR was performed with an Applied Biosystems 2720 thermal cycler (Applied Biosystems, Taipei, Taiwan); a total volume of 50 μM PCR reaction solution containing t46866.doc -25* 201142038

DNA template (approximately 50 ng), 75 mM Tris-HCl (pH 8.5), 20 mM ammonium sulfate, 1.5 mM MgCl, 0.8 mM deoxyribonucleoside triphosphates (0.2 mM each) ' 1 M (each) primer, and 1.25 U of GoTaq® Hot Start polymerase (Promega, Madison, WI, USA). The PCR reaction was initial denaturation (94 ° C, 3 mins), 40 cycles of denaturation

(denaturation, 94 ° C, 1 min), adhesion (annealing, 59 ° C, 1 min) and extension (extension, 72 ° C, 1_5 mins) reaction, and finally a 7-minute extension reaction (extension, 72 ° C, After 7 mins) (Gurtler ei α/· ' 2006), the products were analyzed by electrophoresis with 2% agar (agarose, AMRESCO®, OH, USA). If the PCR product is to be heterozygously reacted with the wafer, the primers are labeled with digoxigenin at the 5' end of one of the primers or the two primers of [(spl, sp2) and (Gblf, Gblr)]. The design of specific probes will be sequenced with reference strains, and a large number of rRNA gene spacers and gene sequences of mycobacteria collected on the GenBank database, using sequence alignment software Vector NTI (Invitrogen Corporation, Carlsbad, CA) , USA) After performing sequence alignment, find the differential sequences between species and interspecies, and sequence similar sequences of different intraspecies to design probes. The wafers in this study consisted of 32 probes, including one mycobacteria positive control (code-named PC) and 13 coordinate-labeled probes (position maker 'code M) and 31 strains. Specific probe (Figure 1). The positive control group was selected using the as much as possible collection of the mycobacteria 146866.doc -26- 201142038 rRNA gene spacer in the highly reserved region (c〇nserve (j regi〇n); coordinate marker probe selected marked There is no strain-specific nucleotide probe for foxglovein. Producing a simulated PCR product in the form of a site mutation, a very rare strain of M. tuberculosis (M. in the world) There is no supply at the center, so the sequence of the synthetic tuberculosis gene of the tuberculosis can be used to test whether the probe can identify Mycobacterium tuberculosis. The MTBC strain collected from GenBank found that the tuberculosis of Mycobacterium tuberculosis and Mycobacterium tuberculosis There is only one single nucleotide difference (SNp) between the gene sequences, so the genomic fragment of Mycobacterium tuberculosis H37Rv is selected, and then QuikChange® Π site-directed mutagenesis kit (Stratagene Products > Hwy > USA) 'in Mycobacterium tuberculosis The H1Rv strain has a single nucleotide difference in the same sequence of G. tuberculosis, and the PCR product of M. tuberculosis can be simulated. After confirming the correctness by sequencing, The bacterial plastids were collected from the Geneaid plasmid midi kit (Taiwan), and the mock fragments were collected and stored at -80 ° C for later use. Since the similarity of the rRNA gene spacer sequences of all strains in MTBC is i 〇〇 %, in the test of Mycobacterium tuberculosis, the heterozygous reaction was carried out by PCR products of the rRNA gene spacer of M. tuberculosis and Mycobacterium tuberculosis H37Rv. Mycobacterial wafer preparation separately used probes and tracking dyes Volume ratio 1:1 (vol/vol) mixed in a 96-well round bottom microplate (ELISA plate, Becton Drive, NJ 'USA) 'The final concentration of the probe except the positive and negative control group and the coordinate probe, all other 1 〇μΜ; positive control (PC) concentration is 5 146866.doc -27- 201142038 μΜ, coordinate probe concentration is 2.5 μΜ, negative control (negative control, NC) is from sterile water and dye, etc. The volume is mixed. Place the configured microplate in the EZSp〇tTM arrayer SR-A300 (Yuesheng Technology 'Taipei' Taiwan') using a solid needle ((·η) with a diameter of 400 μηι. Positive charge d

On the Nylon membrane, Roche ’ Mannheim, Germany, the center distance between the two points is 8〇〇 μηι. There are 49 points χ 7 d〇ts) on this wafer. The size is 6.8 mm x 6_8 mm. After the wafer is finished,

Shortwave UV (Stratalinker 1800; Stratagen, La Jolla, CA' USA) 3 W/cm2 of UV light was irradiated for 3 sec seconds, causing the probe to be attached to a nylon membrane and then stored in a dark dry place for later use. The microarray wafer probe locations are shown in Figure 1. Hybridizcition of the stalk cup _ 曰 曰 ) ) 于 制作 hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy hy The main steps of the hybridization reaction are as follows: After labeling the prepared wafer, use 0.5X SSC buffer [lx SSC buffer is 0.15 M NaCl and 0·015 M sodium citrate)-〇.-i % sodium dodecyl sulfate (SDS,

Boehringer Mannheim, Mannheim, Germany)] The cleaning wafer was oscillated 4 times with an oscillator for 3 minutes each time to wash away trace dye on the wafer, probes not bonded to the nylon membrane and other impurities. Buffer [hybridization solution, 5X SSC, 146866.doc -28- 201142038 1% (w/v) blocking reagent (Roche Diagnostics, Indianapolis ' IN 'USA), 0.1% N-laurylsarcosine and 0.02% SDS], at room temperature Prehybridization for 2 hours under shaking 3. Place each wafer sequentially into each well of a 24-well cell culture plate, and add 300 μΐ of hybrid buffer to each well. Liquid 4. Heat the PCR product with digoxigenin to 95 ° C for 5 minutes, use • to de-spin into a single-strand state, and immediately place on ice. 5. On the ice bath, respectively 10 μΐ of the PCR product of each single-stranded state was added to the wafer containing the hybrid buffer, and hybridization was carried out for 1.5 hours in a hybridization oven 'Firstek Scientific, Taipei, Taiwan (50 ° C, 60 rpm). Reaction 6_ with 0.25 x SSC buffer Wash buffer (wash buffer), wash 4 times '5 minutes each time, wash away unbound PCR product and hybrid buffer 7 · Remove wash buffer, add lx stuffing buffer [blocking buffer, 10% blocking reagent (Roche Diagnostics) diluted 10 times with maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl, pH 7.5), shaking at room temperature for 1 hour 8 · adding 2500 times dilution (diluted with 1 X blocking buffer) Acidase phosphatase (AP) anti-digoxigenin-AP Fab fragments (Roche), shaking at room temperature. Reaction 1 hour 146866.doc •29· 201142038 9. Remove antibody buffer' Wash the unbound antibody by buffer [〇3% (v/v) Tween 20 in ΐχ maieic acid buffer], and wash it 3 times at room temperature for 1 5 minutes 1 〇·Add detection buffer (detection Buffer, 0· 1 M Tris-HCl, 〇·15 M NaCl 'pH 9.5) After shaking for 5 minutes at room temperature, remove the detection buffer 11. If the assay buffer will alkaline phosphatase [st〇ck s 〇luti(m 〇f mtroblue tetrazolium chloride/5-bromo-4-chloro-3 -indolylp Hosphate (NBT/ BCIP), R0Che] diluted 50 times, add 40 μΐ to each wafer, and avoid light at 37 ° C for 25 minutes to 45 minutes. Do not shake during the reaction. 12. Clean the wafer 4 times with pure water for 5 minutes each time to wash off the NBT/BcIp to terminate the color reaction 13. After drying in an oven, the results of the hybrid reaction of the wafer can be judged by the naked eye. There are coordinate marks to identify the top, bottom, left and right, and the coordinate mark will be wafer

Knife ^ into two major areas. Probes in the upper half of the wafer were used to identify different halogen species in MTBC, and two negative control groups (negative(3)ntr〇丨, nc); probes in the lower half were used to identify NTM, and a positive control group ( Positive _r. Pc) #针, the probe can react with mycobacteria bacteria. The result of the wafer reaction must have no heterozygous reaction at the ^^0 point, and the PC point has a heterozygous sigma reaction before the result is interpreted. If both probes for the identification of mtbc are reactive, it indicates that there is elbow in the specimen (: exists, as for the elbow 8 (the 146866.doc • 30- 201142038 in a 'will be described in detail below). The identification of NTM is based on the heterozygous reaction of the NTM probe. The rRNA gene spacer, the 16S rRNA gene and the gyrB sequence are identified by the wafer if the species name does not match the species name of the center of the strain, or Or if the bacterial names identified by other sub-methods are inconsistent, the rRNA gene spacer, 16S rRNA gene, or sequence of the strain is sequenced as a third reference method. The purified PCR product is sequenced and used. The sequencing of the PRISM 3100 Sequencer (Applied Biosystems, • Taipei 'Taiwan)' and the BigDye Terminator cycle sequencing kit (version 3.7; Applied Biosystems). Sensitivity of Sensitivity, Specificity, and Detection Limits: To be identified The target strain is correctly identified. [sensitivity = (no. of target strains correctly identified/total no. of target strains tested) χ 100%] specificity (s Pecificity): non-target strain, % not identified [specificity = (no. of nontarget strains not 9 identified/total no. of nontarget strains tested) χ 100%] detection limit: the test strain can be The minimum amount of genomic DNA detected by the wafer.

Mycobacterium spp. is a control group (positive c〇ntr〇i, ρ〇 probe is a probe of Mycobacterium spp., which is a common sequence in the rRNA gene spacer sequence of Mycobacterium spp.) The probes are coded as Myc2 and Myc3. Since the probe Myc2 cannot 'cover all mycobacteria, design Myc3 I46866.doc 31 .201142038' for the species that cannot be covered, and then mix the two together for pc. This study towel, when this probe is a Mycobacterium bacterium. For the Mycobacterium sp. probe, the code is a heterozygous reaction, indicating that the test species is the bell bore of the Mycobacterium tuberculosis group (MTBC). The specific probe of the known bacterial group is divided into two parts, which are designed for the MTBC.

The cluster-specific probes, and the other part are strain probes designed for each species in MTBC.

There are two probes for the MTBC flora, which are 18 and 19 nucleotides of MTBC2 and MTBC4, respectively. The sequence is designed by (10) the sequence shared by the (10) octal spacer. There are great differences in ntm strains. (4) Those belonging to the Mycobacterium tuberculosis group, including Mycobacterium tuberculosis, cattle, 'σ nucleocapsid group, Mycobacterium tuberculosis, Mycobacterium tuberculosis, Mycobacterium tuberculosis' and Mycobacterium tuberculosis It will produce a heterozygous reaction with the second probe; the g species other than the Mycobacterium tuberculosis will not react with the two probes. There are 12 specific probes for MTBC strains. The probe codes MtublR and MtubWIR are used to identify Mycobacterium tuberculosis. If the strain is Mycobacterium tuberculosis, the hybrid signal of MtublR will be stronger than MtubwlR; Mb〇vG1&Mb〇vGwl is used to identify The Mycobacterium tuberculosis group, including Mycobacterium tuberculosis, Mycobacterium tuberculosis BCG, and the K. tuberculosis and Mb〇vG1 probes, has a heterozygous signal ratio and MbovGW 1 heterozygous signal, but cannot distinguish between the M. tuberculosis population. Species. Mbovl and MbovW1 are used to identify Mycobacterium bovis, including Mycobacterium tuberculosis and Mycobacterium tuberculosis BCG* Mb〇vl. The hybrid signal is stronger than the hybrid signal of Mb〇vW1; Mcapl and McapWl are probes of Mycobacterium tuberculosis Only Kappa tuberculosis will present Mcapl stronger than McapW1 146866.doc •32· 201142038 Hybrid signal; Mmicl and MmicWl are probes of M. tuberculosis, only M. tuberculosis will present Mmicl heterozygous than MmicWl Mcanl and McanWl are probes of Mycobacterium tuberculosis. Because the sequence of Mycobacterium tuberculosis and Mycobacterium tuberculosis are similar in the phantom gene, the heterozygous reaction of Mycobacterium tuberculosis will show a strong hybrid signal of MtublR than MtubWIR, and the ratio of Mcanl. McanWl strong response signal. The identification of MTBC strains first requires the microbial probes Mtbc2 and MTBC4 to react at the same time (ie, the tested species belong to MTBC), and then the identification is the one in the group, with a heterozygous map. The type (hybridizati〇n pattern) is used as a basis for consideration. Take Mycobacterium tuberculosis as an example, its pattern type is: MTBC2 and MTBC4 react at the same time, MtublIUf needle reaction is stronger than MtubWl R, and there are 1 probes for identifying mtbC strains, which also prove that it is not MTBC. The other species in the strain (ie, the probe with the "W" letter in the probe code reacted more strongly than the probe in the same group with no "W" code). K. tuberculosis was previously placed in the Bovine tuberculosis group and is now named K. tuberculosis (Aranaz et al., 2003, j Syst Evol. Microbi〇i. 53:1 785_1789). Its probe response profile is MbovGl reacts strongly with MbovGW1 (ie belongs to the population of Mycobacterium bovis), and Mcapl reacts more strongly than McapW1 (ie it is K. tuberculosis). Identification of non-tuberculous mycobacteria (NTM) There are 17 species of probes designed for non-tuberculous mycobacteria. Two of the vibrating needles are complex probes, and a total of 19 species can be identified. ^1 Target strains, respectively, Mycobacterium ulcerans, Mycobacterium avium, Mycobacterium marinum, Mycobacterium fortuitum, Mycobacterium vaccae, Mycobacterium gordonii, intracellular 146866.doc -33- 201142038 Mycobacterium 'M. kansii, Mycobacterium marinum, : Mycobacterium f, Mycobacterium phlei, Mycosis branch; = Twig, M. smegmatis, Syzygium, 眚瘟Gossip #八刀枝才干痛, Mycobacterium phlei, ^Guangdaozhi cup, and Mycobacterium sputum, of which Μηι_2 marine mycobacteria or ulcer branching rod g, M. aureus or Mycobacterium lanatus. - Come to Zhongding Branch

The results of the heterozygous reaction must be positive in the control group (PC), and then the reaction is observed. For example, two probes, PC and Mehe3, react, and the strain is identified as Mycobacterium. The only exception is that the intracellular mycobacteria will (4) the probe of the bird's branching rod (MaVll) has a slight crossover reaction, so Mint2 (the probe that identifies the intracellular ^ branch ^) #aMavil also reacts when the strain Zhong Ding is an intracellular bacterium, but the reaction of Mint2 is stronger than that of ^^. If there is a heterozygous reaction between Pc and m, it is identified as a bird branch (4). This is because Mycobacterium avium and intracellular branching rod g belong to the mycobacterium group (10)_(4) Please C〇mpleX) 'both in biochemical reaction and The rRNA gene spacer sequences are very similar. It is not easy to distinguish the two strains clinically. Usually only the avian flora is identified. The results of the test of the Fen Kao's wafer test are shown in Figure 2 and Figure 3. A total of 88 reference strains and one mimetic simulation sequence were tested, including MTBC 15 strain and NTM 73 strain. The target clinical strains were also tested, including 8 BC strains (Table 2) and NTM 121 strains (201) (Table 3). Sensitivity and specificity (speci^icity) of all the target strains of 289 strains, of which there are two strains (μ.々α, j/z· I46866.doc -34- 201142038 KMUH0903-4 and M. h«iflfi/zKMUH0903-26) Wafer identification error, so the wafer sensitivity was 99.3% (287/289) (Table 2 and Table 3). Among the 73 strains of nontarget species tested (Table 4), one of them was identified incorrectly (Λ/· CCUG 52054 was identified as, so the wafer specificity was 98.6% (72/73). <detection limit As the test strain, Mycobacterium tuberculosis H37Rv, Mycobacterium tuberculosis CCUG 20993τ and Mycobacterium tuberculosis JCM 6387 were used as test strains. The DNA concentration was 10 times serial dilution by 10 ng/μΐ. Mycobacterium tuberculosis H37Rv The detection limit is 10 fg/μΐ (ie 50 fg/per test), which is equivalent to the DNA content of 12 bacteria [(a £_Co" cells contain 4 fg DNA (Kubitschek and Friedman ' 1971)]. The detection limit of Mycobacterium CCUG 20993T and Occasional Mycobacterium 〇]\4 63 87 is 1〇〇“§41 (ie 5〇0[§/each test), which is equivalent to the DNA content of 120 bacteria. The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. The modifications and variations of the embodiments described above will be apparent to those skilled in the art without departing from the scope of the invention. The scope of the patent application mentioned later is listed. BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic view showing the position of a probe of a microarray wafer of the present invention. Fig. 2 is a diagram showing the hybrid reaction of a target strain of Mycobacterium tuberculosis: (1) Mycobacterium tuberculosis ATCC 25420 (2) Mycobacterium tuberculosis ATCC 3571 1 (3) Bovine tuberculosis ATCC 27291 146866.doc •35- 201142038 (4) Bovine tuberculosis ATCC 35734 (5) Bovine tuberculosis BCG ATCC 3573 1 (6) Bovine tuberculosis BCG ATCC 35735 (7) Bovine tuberculosis BCG ATCC 35737 ( 8) Mycobacterium tuberculosis ATCC BAA-824 (9) Mycobacterium tuberculosis (10) Mycobacterium tuberculosis ATCC 19422 (11) Mycobacterium tuberculosis ATCC 35782 • (12) Mycobacterium tuberculosis NCTC 8337 (13) Mycobacterium tuberculosis H37Rv (14) Mycobacterium tuberculosis ATCC 25177 (15) Mycobacterium tuberculosis ATCC 358 1 8 (16) Mycobacterium tuberculosis ATCC 35828 Figure 3 shows the heterozygous reaction diagram of non-tuberculous mycobacteria target bacteria (1-1 9) and non-target bacteria (20-32) (1) Mycobacterium tuberculosis CCUG 20993 ® (2) Mycobacterium avium BCRC 15441 (3) Mycobacterium tuberculosis CCUG 35749 (4) Mycobacterium tuberculosis BCRC 1 5320 (5) Mycobacterium tuberculosis CCUG 29062 (6) Mycobacterium gordon CCUG 21801 (7) Mycobacterium tuberculosis CCUG 28005 (8) Kansas Mycobacterium CCUG 27785 (9) Mycobacterium lanatus CCUG 47901 I46866.doc -36· 201142038 (10) Mycobacterium marinum ATCC 25039 (11) Mycobacterium fortuitosis CCUG 28009 (12) Mycobacterium phlei CCUG 27976 (13) Mycobacterium tuberculosis CCUG 29045 (14) Mycobacterium tuberculosis CCUG 29114 (15) Mycobacterium smegmatis ATCC 19420 (16) Mycobacterium tuberculosis NCTC 10829 (17) Mycobacterium phlei CCUG 42429 • ( 18) Mycobacterium ulcerans ATCC 25899 (19) Mycobacterium phlei ATCC 19973 (20) Mycobacterium Μ CCUG 37673 (21) Mycobacterium Μ. α/vez· CCUG 3 7585 (22) Mycobacterium M CCUG 39146 (23) Mycobacterium M. asiaticum MB 03 1 (24) Mycobacterium M. e/nke CCUG 39504 (25) Mycobacterium M. c/z/or<9/?/ze«o/z_cwwBCRC 13726

(26) Mycobacterium M. coV/weWb CCUG 375 1 3 (27) Mycobacterium M. Mountain 16395 (28) Mycobacterium M. gashan-wm CCUG 375 1 5 (29) Mycobacterium M. pw /wb CCUG 37668 (30) Mycobacterium M. /fl//ax CCUG 375 84 (31) Mycobacterium Μ//αναα«·5 MB 017 (32) Mycobacterium M. MB 691 146866.doc •37 - 201142038 Sequence Listing <110> National Cheng Kung University <120> Method for identifying mycobacteria <130> No <160 39 <170> Patentln version 3.3 <210> 1 <211> 21 <212&gt ; DNA <213> Manual Sequence <220>

<221> Variation <222>(1)..(21) <223> 丫 is (: or t <400> 1 21 25 yctgtagtgg gcgagagccg g <210> 2 <211> 25 <212&gt ; DNA <213> Artificial sequence <220>221>Variation<222>(1)..(25)<223> r is a or g <400> 2 cacactgttg ggtcctgagr caaca <210> 3 <211> 18 <212> DNA <213> artificial sequence <400> 3 gaaaacgccc caactggt 18 <210> 4 <211> 21 146866.doc 201142038 <212> DNA <213><400> 4 atgacaacaa agttggccac c <210> 5 <211> 20 <212>DNA <213> Artificial sequence <400> 5 ggtcaacggt gcggttctgg

<210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 ggtcaacggt acggttctgg <210> 7 <211> 23 <212> DNA <213> Artificial sequence<213> 400> 7 gaaggtctgt aacgaacagc tga <210> 8 <211> 23 <212> DNA <213> Artificial sequence <400> 8 gaaggtctgt aatgaacagc tga <210> 9 <211> 22 <212> DNA <213> Artificial sequence <400> 9 cgaaagtcgt tgtgaacaag gc 146866.doc 201142038 <210> 10 <211> 22 <212>DN A <213> Artificial sequence <400> 10 cgaaagttgt tgtgaacaag gc <;210> 11 <211> 18 <212> DNA <213> Manual Sequence <400> 11 cctggccgct gtgatctc

<210> 12 <211> 18 <212> DNA <213>Artificial sequence <400> 12 cctggccgcg gtgatctc <210> 13 <211> 22 <212> DNA <213> Artificial sequence <;400> 13

Gggtacgagt ggtctcaggt tt <210> 14 <211> 22 <212>DNA <213> Artificial sequence <400> 14 gggtatgagt ggtctcaggt tt <210> 15 <211> 18 <212> DNA <213>; Artificial sequence 146866.doc 18201142038

<400> 15 gactttcgag tcggtggg <210> 16 <211> 18 <212> DNA <213> Artificial sequence <400> 16 gactttcgcg tcggtggg <210> 17 <211> 17 <212> DNA <213> Artificial sequence <400> 17 ccgtggatgg gtagtcg <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 gttcccgtct gtaatggacg 18 17 20

<210> 19 <211> 19 <212> DNA <213> Artificial sequence <400> 19 cccgtggata ggtagtcgg 19 <210> 20 <211> 18 <212> DNA <213> Artificial sequence <400> 20 attcgattcc cccgccgt <210> 21 <211> 25 146866.doc 18 201142038 <212> DNA <213> Artificial sequence <400> 21 cagcaagcaa gccagacaca ctatt <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <400> 22 gccgtgaagg gtcatcgtct

<210> 23 <211> 19 <212> DNA <213> Artificial sequence <400> 23 gggtgcacaa cagcgaatg <210 24 <211> 19 <212> DNA <213> Artificial sequence < 400> 24 tggacgaaag cctggtgac <210> 25 <211> 19 <212> DNA <213> Artificial sequence <400> 25 ttggtggagt gtgagccgt <210> 26 <211> 19 <212> DNA <213> Manual sequence <400> 26 tagtggatgg aagccgggt 146866.doc 201142038 <210> 27 <211> 21 <212> DNA <213> Artificial sequence <400> 27 gtggttggga tacatttcgc c

<210> 28 <211> 19 <212> DNA <213> Artificial sequence <400> 28 tggtgggtgt cggcgtgtt <210> 30 <211> 19 <212> DNA <213> Artificial sequence

<210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 ggggttctcg cctgtagtgg <400> 30 ttggtggagt gtgagccgt <210> 31 <211> 22 <212> DNA <213> Artificial sequence <400> 31 tgaggagctg gatcgctgta gt <210> 32 <211> 20 <212>DNA <213> Artificial sequence 146866.doc 201142038 <400> 32 cacgaaacgc atcccaactg <210> 33 <211> 18 <212> DNA <213> artificial sequence <400> 33 ccgccagcag ccttgtgc <210> 34 <211> 19 <212>DNA <213>

<400> 34 tagtggatgg aagccgggt <210> 35 <211> 20 <212> DNA <213> Artificial sequence <400> 35 gtgtgagttc ggcgtgttgt <210> 36 <211> 21 <212>DNA <213>Artifical sequence <400> 36 acctcctttc taaggagcac c <210> 37 <211> 21 <212> DNA <213> Artificial sequence <400> 37 gatgctcgca accactatcc a <210> 38 <211> 19 146866.doc 201142038 <212>DN A <213> Artificial sequence <400> 38 tggttaacgc gctatccac <210> 39 <211> 19 <212> DNA <213> Artificial sequence <400>; 39 accaactctc gtgccttac

146866.doc

Claims (1)

.201142038 VII. Patent Application Range: 1. A method for identifying mycobacteria spp.), which comprises using Myc2 (SEQ ID No. 1) and Myc3 (SEQ ID No_2) probes or their complementary strands to be tested The DN A in the sample is subjected to a heterozygous reaction, and if at least one heterozygous reaction occurs, the sample to be tested contains mycobacteria. 2. The method of claim 1, further comprising hybridizing a probe using MTBC2 (SEQ ID Νο.3) and MTBC4 (SEQ ID Νο.4) or a complementary strand thereof with the DNA in the sample to be tested, For example, dn A φ in the sample to be tested is simultaneously with 1^丁8€2(3£()10 1^〇.3) and ]^丁6€4(8£(5 10 1'1〇.4) The probe or its complementary strands produce a hybrid reaction, and the sample to be tested comprises a Mycobacterium tuberculosis complex. 3. The method of claim 1, further comprising hybridizing a probe using MTBC2 (SEQ ID No. 3) and MTBC4 (SEQ ID No. 4) or a complementary strand thereof with the DNA in the sample to be tested, such as If the dn A in the sample to be tested does not simultaneously generate a hybrid reaction with the probe of MTBC2 (SEQ ID No. 3) and MTBC4 (SEQ ID No_4) or its complementary strand, the sample to be tested contains non-communicating M. tuberculosis ( Nontuberculous mycobacteria). 4. According to the method of claim 2, which further comprises using MtublR (SEQ ID >^〇.15) and ? ^1^\¥111(3£(5 10 1^〇.16) probe or its complementary strand is heterozygously reacted with the DNA in the sample to be tested, such as DNA and MtublR (SEQ ID) in the sample to be tested The intensity of the heterozygous reaction of No. 15) or its complementary strand is greater than the intensity of the heterozygous reaction of the DNA in the sample to be tested with MtubWIR (SEQ ID No. 16) or its complementary strand, and the sample to be tested comprises Mycobacterium tuberculosis (M. iw office ercw/osb) 〇 LSI 146866.doc 201142038 5. According to the method of ○monthly item 2, it additionally includes the use of Mb〇v(}i (SEQ ID >^.6) and 1^13( ^(5£1(5113>^〇5) probe or its complementary strand is heterozygously reacted with the DNA in the sample to be tested, such as the DNA in the sample to be tested and MbovGl (SEQ ID Νο· 6) The intensity of the heterozygous reaction of the complementary strands thereof is greater than the intensity of the heterozygous reaction between DNΑ and MbovGW1 (SEQ ID No. 5) or its complementary strands in the sample to be tested, then the sample to be tested contains the bovine name σ nucleus Halogen group (from gr〇Up) 6. According to the method of claim 5, wherein the bovine tuberculosis group comprises Bovine Mycobacterium tuberculosis (Μ., Bovine tuberculosis BCG (m_BCG) and Kabo tuberculosis #干_ (Μ · caprae) 7. According to D month The method of 5, which further comprises using a probe of Mbov 1 (SEQ ID Ν ο 8) and MbovWl (SEQ ID Ν ο 7) or a complementary strand thereof to carry out a heterozygous reaction with the DNA in the sample to be tested, such as the test The intensity of the heterozygous reaction of the DNA in the sample with Mbovl (SEQ ID No. 8) or its complementary strand is greater than the intensity of the heterozygous reaction of the DNA in the sample to be tested with MbovWl (SEQ ID No. 7) or its complementary strand, then the test is to be tested The sample comprises Mycobacterium tuberculosis or Mycobacterium tuberculosis BCG. 8. According to the method of claim 5, which further comprises using a probe of Mcapl (seq iD Νο.12) and McapWl (SEQ ID No. ll) or a complementary strand thereof The DNA in the sample to be tested is subjected to a heterozygous reaction, such as the DNA of the sample to be tested is heterozygous for Mcapl (SEQ ID N〇12) or its complementary strands to be greater than the DNA of the sample to be tested and McapWl (SEQ ID No. 1 1) The strength of the heterozygous reaction of the complementary strands thereof, the sample to be tested contains K. tuberculosis. 146866.doc 201142038 9. According to the method of claim 2, which additionally comprises using Mmic(R) (SEq No) .14) and the probe of MmicW1 (SEQ(1)N〇13) or its complementary strand is hybridized with the DNA in the sample to be tested, such as The DNA in the sample is heterozygous for the heterozygous reaction with Mmicl (SEQ ID No. 14) or its complementary strands, and the DNA in the sample to be tested is heterozygous for MmicW1 (SEQ ID No. 13) or its complementary strand. Intensity, the sample to be tested contains M. microti. 10. The method according to claim 2, further comprising using the probe of SEQ ID IE (10) and McanWl (SEQ ID No. 9) or the complementary strand thereof and the DNA in the sample to be tested The heterozygous reaction, such as the strength of the heterozygous reaction of the test sample and the ^3111 (SEQ ID N〇1〇) or its complementary strands is greater than the 2DN^McanWl (SEQ ID N〇9) in the sample to be tested. Or the strength of the heterozygous reaction of the complementary strands, the sample to be tested comprises Mycobacterium tuberculosis (Af. 11. According to the method of claim 2, which additionally comprises using the first-group probe or its complementary strand and the second group The probe or its complementary strand is hybridized with the DNA in the sample to be tested, such as the intensity of the heterozygous reaction between the DNA in the sample to be tested and the second group of probes or their complementary strands is greater than the sample to be tested The strength of the heterozygous reaction with the first-group probe or its complementary strands, then the sample to be tested: Contains Mycobacterium tuberculosis (M of which the _ group probe package #MtUblR (SEQ1DN〇, 15), Mb〇vGl (SEQiDN〇6) 'MbovKSEQ ID No. S). Mcapl (SEQ ID No. 12). Mmicl (SEQ ID Νο·Ι4) and Mcani (SEQ m N.i〇)' The second group of probes contains MtubW1R (SEq ID N〇16), Na (10), (4) (1) I" 146866.doc 201142038, MbovWl (SEQ ID No. 7), McapWl (SEQ ID No. ll), MmicWl (SEQ ID No. 13), and McanWl (SEQ ID No. 9) 12_ according to the method of claim 3, which further comprises using one or more selected from Mabsl (SEQ ID No. 17) 'Mavil (SEQ ID No. 18) ' Mche3 (SEQ ID No. 19), Mforl (SEQ ID No. 20), Mgas2 (SEQ ID No. 21) 'Mgorl (SEQ ID No. 22) ' Mint2 (SEQ ID No. 23), Mkan] (SEQ ID No. 24), Msi /lel (SEQ ID No_25), Mma/ul2 (SEQ ID No. 26), Mnonl (SEQ ID No. 27), Mperl (SEQ ID No. 28) ^ Mscrl (SEQ ID No. 29) ^ Msme3 (SEQ ID No. 31), Mszul (SEQ ID No. 32), Mterl (SEQ ID No. 33), Mxen2 (SEQ ID No. 35) and its complementary strand probe are heterozygous for the DNA in the sample to be tested. If the DNA in the sample to be tested produces a hybrid reaction with the Mabsl (SEQ ID No. 17) probe or its complementary strand, the sample to be tested comprises an ulcer swollen rod (from; such as the sample to be tested) The DNA in the case produces a heterozygous reaction with the Mavil (SEQ ID No. 18) probe or its complementary strand, and the sample to be tested contains the bird branch Bacillus (from avz'wm); if the DNA in the sample to be tested produces a heterozygous reaction with the Mche3 (SEQ ID N〇19) probe or its complementary strand, the sample to be tested comprises Mycobacterium marinum (from c/ Ze/owae); if the DNA in the sample to be tested and the Mf0rl (SEQ ID n〇2〇) probe, the heterozygous reaction occurs in the complement, then the sample to be tested contains the occasional mycobacteria (Λ/· /〇&quot ; heart _); 146866.doc 201142038 If the DNA in the sample to be tested produces a heterozygous reaction with the Mgas2 (SEQ ID Ν ο 21) probe or its complementary strand, the sample to be tested contains Mycobacterium tuberculosis If the DNA in the sample to be tested is heterozygous with the Mgorl (SEQ ID No. 22) probe or its complementary strand, the sample to be tested contains Gordon's branching bacteria (from ·; The DNA in the sample to be tested is heterozygously reacted with the Mint2 (SEQ ID No. 23) probe or its complementary strand, and the sample to be tested comprises intracellular mycobacteria (from (6)race//w/are); such as the sample to be tested The DNA in the hybridization with the Mkanl (SEq id No. 24) probe or its complementary strands, the sample to be tested contains the Kansas branch temple dry circumference (Λ/. moxibustion; The DNA in the sample is heterozygously reacted with the Msi/Iei (SEq m Ν〇25) probe or its complementary strand, and the sample to be tested comprises Mycobacterium sputum (Plus iz.mz.ae) or orchid branch Bacillus (M. ; If the DNA in the sample to be tested produces a heterozygous reaction with the Mma/ul2 (SEQ ID No. 26) probe or its complementary strand, the sample to be tested comprises Mycobacterium marinum (M. marh) or Mycobacterium ulcerans (Μ; if the DNA in the sample to be tested produces a heterozygous reaction with the Mnonl (SEQ m N〇27) probe or its complementary strand, the sample to be tested contains non-chromogenic branches. If the DNA of the sample to be tested t is heterozygous with the Mperl (SEQ m N〇28) probe or its complementary strand, the sample to be tested contains the force branching ^ ^ (M. peregrinum) \ 146866 .doc •201142038, if the DNA in the sample to be tested produces a heterozygous reaction with the MSCrl (SEq m Νο·29) probe or its complementary strand, the sample to be tested contains a sputum branching bacterium (Μ. scro/ Wace said; if the DNA in the sample to be tested is heterozygous with the Msme3 (SEQ ID No. 31) probe or its complementary strand, the sample to be tested contains smear-splitting branches ΐί {M. Smegmatis); if the DNA in the sample to be tested is heterozygously reacted with the MsZul (SEQ(1)N〇32) probe or its complementary strand, the sample to be tested comprises the St. Branch's W. izw/gin·); The DNA in the sample to be tested is heterozygously reacted with the Mter1 (SEQ ID N〇33) probe or its complementary strand, and the sample to be tested comprises Mycobacterium phlei (Af.; and DNA as in the sample to be tested) A heterozygous reaction with the Mxen2 (SE.Q ID Νο.35) probe or its complementary strand, the sample to be tested comprises Mycobacterium sputum. The method according to any one of claims 12 to wherein the sample to be tested comprises a DNA fragment amplified by a polymerase chain reaction. According to the method of claim 13, 'the use of spl (SEQ ID NO. 36) and sp2 (SEQ ID NO. 37) primers or Gblf (SEQ ID NO. 38) and Gblr (SEQ NO) NO. 39 ) primer amplification. 15. The method of claim 14, wherein the primer comprises a flag. The method of claim 15, wherein the flag is digoxigenin. The method of any one of claims 1 to 12, wherein the hybridization reaction is carried out on a microarray. 1 8. A probe comprising a population selected from the group consisting of Myc2 (SEQ ID No. 1), Myc3 (SEQ ID Νο. 2), MTBC2 (SEQ ID No. 3) 'MTBC4 (SEQ ID No. 4) 'MbovGl (SEQ ID No. 6), MbovGWl (SEQ ID No. 5), Mbovl (SEQ ID No. 8), MbovWl (SEQ ID No. 7), Mcanl (SEQ ID No. 10), McanWl (SEQ ID No. 9) 'Mcapl (SEQ ID No. 12)' • McaPwl (SEQ ID No. 1 1), Mmicl (SEQ ID No. 14), MmicWl (SEQ ID No_13), MtublR (SEQ ID No) .15), MtubWIR (SEQ ID No. 16), Mabsl (SEQ ID No. 17), Mavil (SEQ ID No. 18), Mche3 (SEQ ID No. 19), Mforl (SEQ ID No. 20) > Mgas2 (SEQ ID No. 21) 'Mgorl (SEQ ID No. 22), Mint2 (SEQ ID No. 23), Mkanl (SEQ ID No. 24), Msi/lel (SEQ ID No. 25) 'Mma/ul2 (SEQ ID No. 26) 'Mnonl (SEQ ID No. 27) ' Mperl (SEQ ID No 28) ® , Mscrl (SEQ ID No. 29), Msme3 (SEQ ID Νο. 31), Mszul (SEQ ID No, 32), Mterl (SEQ ID N〇. 33 WMxen2 (SEQ ID No. 35) and its complementary strands. 1 9. A kit for identifying mycobacteria in a sample, the set comprising according to claim 18 Probe. 20. According to The kit of claim 19, wherein the probe is applied to a microarray wafer. 21. The kit according to claim 19, further comprising a reagent for use in a polymerase chain reaction 146866.doc - 7 - 201142038. 22. The kit according to claim 21, which comprises spl (SEQ ID NO. 36) and sp2 (SEQ ID NO. 37) primers and/or Gblf (SEQ ID NO. 38) and Gblr (SEQ ID NO. 39). ) introduction. 146866.doc