WO2004050705A2 - Complexes of receptors - Google Patents

Complexes of receptors Download PDF

Info

Publication number
WO2004050705A2
WO2004050705A2 PCT/GB2003/005104 GB0305104W WO2004050705A2 WO 2004050705 A2 WO2004050705 A2 WO 2004050705A2 GB 0305104 W GB0305104 W GB 0305104W WO 2004050705 A2 WO2004050705 A2 WO 2004050705A2
Authority
WO
WIPO (PCT)
Prior art keywords
tcr
complex
chain
native
tcr complex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2003/005104
Other languages
English (en)
French (fr)
Other versions
WO2004050705A3 (en
Inventor
Bent Karsten Jakobsen
Meir Glick
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Avidex Ltd
Original Assignee
Avidex Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0228112A external-priority patent/GB0228112D0/en
Priority claimed from GB0304090A external-priority patent/GB0304090D0/en
Priority claimed from GB0308309A external-priority patent/GB0308309D0/en
Priority claimed from GB0314113A external-priority patent/GB0314113D0/en
Priority claimed from GB0316354A external-priority patent/GB0316354D0/en
Priority to EP03777006A priority Critical patent/EP1567553A2/en
Priority to US10/535,965 priority patent/US20060135418A1/en
Application filed by Avidex Ltd filed Critical Avidex Ltd
Priority to JP2004570696A priority patent/JP2006523437A/ja
Priority to AU2003286263A priority patent/AU2003286263A1/en
Publication of WO2004050705A2 publication Critical patent/WO2004050705A2/en
Publication of WO2004050705A3 publication Critical patent/WO2004050705A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/088Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins conjugates with carriers being peptides, polyamino acids or proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to a multivalent T cell receptor complex comprising at least two T cell receptors linked by a non-peptidic polymer chain or a peptidic linker sequence, and to the use of such complexes in medicine, particularly the diagnosis and treatment of autoimmune disease and cancer.
  • WO 99/60120 TCRs mediate the recognition of specific Major Histocompatibility Complex (MHC)-peptide complexes by T cells and, as such, are essential to the functioning of the cellular arm of the immune system.
  • MHC Major Histocompatibility Complex
  • Antibodies and TCRs are the only two types of molecules which recognise antigens in a specific manner, and thus the TCR is the only receptor for particular peptide antigens presented in MHC, the alien peptide often being the only sign of an abnormality within a cell.
  • T cell recognition occurs when a T-cell and an antigen presenting cell (APC) are in direct physical contact, and is initiated by ligation of antigen-specific TCRs with peptide-MHC (pMHC) complexes.
  • APC antigen presenting cell
  • the native TCR is a heterodimeric cell surface protein of the immunoglobulin superfamily which is associated with invariant proteins of the CD3 complex involved in mediating signal transduction.
  • TCRs exist in ⁇ and ⁇ forms, which are structurally similar but have quite distinct anatomical locations and probably functions.
  • the MHC class I and class II ligands are also immunoglobulin superfamily proteins but are specialised for antigen presentation, with a highly polymorphic peptide binding site which enables them to present a diverse array of short peptide fragments at the APC cell surface.
  • CDl antigens are MHC class I-related molecules whose genes are located on a different chromosome from the classical MHC class I and class II antigens. CDl molecules are capable of presenting peptide and non-peptide (eg lipid, glycolipid) moieties to T cells in a manner analogous to conventional class I and class II-MHC- pep complexes.
  • Bacterial superantigens are soluble toxins which are capable of binding both class II MHC molecules and a subset of TCRs.(Fraser (1989) Nature 339 221-223) Many superantigens exhibit specificity for one or two Vbeta segments, whereas others exhibit more promiscuous binding. In any event, superantigens are capable of eliciting an enhanced immune response by virtue of their ability to stimulate subsets of T cells in a polyclonal fashion.
  • the extracellular portion of native heterodimeric ⁇ and ⁇ TCRs consists of two polypeptides each of which has a membrane-proximal constant domain, and a membrane-distal variable domain.
  • Each of the constant and variable domains includes an intra-chain disulfide bond.
  • the variable domains contain the highly polymorphic loops analogous to the complementarity determining regions (CDRs) of antibodies.
  • CDR3 of ⁇ TCRs interact with the peptide presented by MHC
  • CDRs 1 and 2 of ⁇ TCRs interact with the peptide and the MHC.
  • the diversity of TCR sequences is generated via somatic rearrangement of linked variable (V), diversity (D), joining (J), and constant (C) genes
  • ⁇ and ⁇ chain polypeptides are formed by rearranged V-J-C regions, whereas ⁇ and ⁇ chains consist of V-D-J-C regions.
  • the extracellular constant domain has a membrane proximal region and an immunoglobulin region.
  • TRAC and TRDC single ⁇ and ⁇ chain constant domains
  • TRBCl and TRBC2 BVIGT nomenclature
  • TCR extracellular domains The extent of each of the TCR extracellular domains is somewhat variable. However, a person skilled in the art can readily determine the position of the domain boundaries using a reference such as The T Cell Receptor Facts Book, Lefranc & Lefranc, Publ. Academic Press 2001.
  • Recombinant TCRs The production of recombinant TCRs is beneficial as these provide soluble TCR analogues suitable for the following purposes:
  • Single-chain TCRs are artificial constructs consisting of a single amino acid strand, which like native heterodimeric TCRs bind to MHC-peptide complexes.
  • scTCRs Single-chain TCRs
  • TCRs can be recognised by TCR-specific antibodies, none were shown to recognise its native ligand at anything other than relatively high concentrations and/or were not stable.
  • a soluble TCR is described which is correctly folded so that it is capable of recognising its native ligand, is stable over a period of time, and can be produced in reasonable quantities.
  • This TCR comprises a TCR ⁇ or ⁇ chain extracellular domain dimerised to a TCR ⁇ or ⁇ chain extracellular domain respectively, by means of a pair of C-terminal dimerisation peptides, such as leucine zippers. This strategy of producing TCRs is generally applicable to all TCRs.
  • TCRs as targeting moieties capable of localising to cells affected by disease processes.
  • Such targeting moieties could be utilised either to directly block the 'miss-directed' action of the immune system responsible for auto-immune disease or as a means of delivering cytotoxic agents to cancerous cells.
  • Such molecules should have good affinities for their target ligands and adequate plasma stabilities.
  • This invention makes available novel multivalent TCR complexes having an increased plasma half- life and improved affinity for their cognate ligands compared to the corresponding monovalent TCR molecules.
  • the TCRs are linked by non-peptidic polymer chains or by peptidic linkers.
  • the TCRs in the complexes may be scTCRs or dTCRs.
  • the present invention provides a multivalent T cell receptor (TCR) complex comprising at least two TCRs, linked by a non-peptidic polymer chain or a peptidic linker sequence.
  • TCR T cell receptor
  • the TCRs in the complex are constituted by amino acid sequences corresponding to extracellular constant and variable region sequences of native TCRs
  • polymer chain or peptidic linker sequence extends between amino acid residues of each TCR which are not located in a variable region sequence of the TCR.
  • the TCRs in the complex may be linked by, for example a polyalkylene glycol chain such as a polyethylene glycol chain, or a peptidic linker derived from a human multimerisation domain.
  • a divalent alkylene spacer radical for example a -CH 2 - or -CH 2 CH 2 -.radical, is located between the polyalkylene glycol chain and its point of attachment to a TCR of the complex.
  • Multimeric TCR complexes of the invention may be, for example divalent, trivalent or tetravalent, but divalent complexes (ie those which contain only two TCRs) are presently preferred.
  • the TCR molecules may be single chain T cell receptor (scTCR) polypeptides or, preferably, dimeric TCR (dTCR) polypeptide pairs.
  • scTCR polypeptide, or dTCR polypeptide pairs may be constituted by TCR amino acid sequences corresponding to TCR extracellular constant and variable region sequences, with a variable region sequence of the scTCR corresponding to a variable region sequence of one TCR chain being linked by a linker sequence to a constant region sequence corresponding to a constant region sequence of another TCR chain; the variable region sequences of the dTCR polypeptide pair or scTCR polypeptide are mutually orientated substantially as in native TCRs; and in the case of the scTCR polypeptide a disulfide bond which has no equivalent in native T cell receptors links residues of the polypeptide.
  • variable region sequences of the ⁇ and ⁇ segments are mutually orientated substantially as in native ⁇ T cell receptors
  • Interactions with pMHC complexes can be measured using a BIAcore 3000TM or BIAcore 2000TM instrument.
  • WO99/6120 provides detailed descriptions of the methods required to analyse TCR binding to MHC-peptide complexes.
  • scTCR polypeptides present in the complexes of the invention are preferably those which have, for example, a first segment constituted by an amino acid sequence corresponding to a TCR ⁇ or ⁇ chain variable region sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant region extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR ⁇ or ⁇ chain variable region fused to the N terminus of an amino acid sequence corresponding to TCR ⁇ chain constant region extracellular sequence, a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, and a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native ⁇ or ⁇ T cell receptors, the length of the linker sequence and the position of the disulfide bond being such that the variable region sequences of the first and second segments are mutually orientated substantially as in native ⁇ or ⁇ T cell receptors.
  • dTCRs present in the complexes of the invention are preferably those which are constituted by a first polypeptide wherein a sequence corresponding to a TCR ⁇ or ⁇ chain variable region sequence is fused to the N terminus of a sequence corresponding to a TCR ⁇ chain constant region extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR ⁇ or ⁇ chain variable region sequence fused to the N terminus a sequence corresponding to a TCR ⁇ chain constant region extracellular sequence, the first and second polypeptides being linked by a disulfide bond which has no equivalent in native ⁇ or ⁇ T cell receptors.
  • the constant region extracellular sequences present in the above preferred scTCRs or dTCRs preferably correspond to those of a human TCR, as do the variable region sequences.
  • the correspondence between such sequences need not be 1:1 on an amino acid level.
  • N- or C-truncation, and/or amino acid deletion and/or substitution relative to the corresponding human TCR sequences is acceptable, provided the overall result is mutual orientation of the ⁇ and ⁇ variable region sequences, or ⁇ and ⁇ variable region sequences is as in native ⁇ , or ⁇ T cell receptors respectively.
  • the constant region extracellular sequences present in the first and second segments are not directly involved in contacts with the ligand to which the scTCR or dTCR binds, they may be shorter than, or may contain substitutions or deletions relative to, extracellular constant domain sequences of native TCRs.
  • the constant region extracellular sequence present in one of the dTCR polypeptide pair, or in the first segment of a scTCR polypeptide may include a sequence corresponding to the extracellular constant Ig domain of a native TCR ⁇ chain, and/or the constant region extracellular sequence present in the other member of the pair or second segment may include a sequence corresponding to the extracellular constant Ig domain of a native TCR ⁇ chain.
  • One member of the polypeptide pair or the first segment of the scTCR polypeptide may correspond to substantially all the variable region of a TCR ⁇ chain fused to the N terminus of substantially all the extracellular domain of the constant region of an TCR ⁇ chain; and/or the other member of the pair or second segment corresponds to substantially all the variable region of a TCR ⁇ chain fused to the N terminus of substantially all the extracellular domain of the constant region of a TCR ⁇ chain.
  • the constant region extracellular sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to the constant regions of the ⁇ and ⁇ chains of a native TCR truncated at their C termini such that the cysteine residues which form the native inter-chain disulfide bond of the TCR are excluded. Alternatively those cysteine residues may be substituted by another amino acid residue such as serine or alanine, so that the native disulfide bond is deleted.
  • the native TCR ⁇ chain contains an unpaired cysteine residue and that residue may be deleted from, or replaced by a non-cysteine residue in, the ⁇ sequence of the scTCR of the invention.
  • the TCR ⁇ and ⁇ chain variable region sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may together correspond to the functional variable domain of a first TCR, and the TCR ⁇ and ⁇ chain constant region extracellular sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a second TCR, the first and second TCRs being from the same species.
  • ⁇ and ⁇ chain variable region sequences present in dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a first human TCR
  • the ⁇ and ⁇ chain constant region extracellular sequences may correspond to those of a second human TCR.
  • A6 Tax sTCR constant region extracellular sequences can be used as a framework onto which heterologous ⁇ and ⁇ variable domains can be fused.
  • the TCR ⁇ and ⁇ chain variable region sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide respectively may together correspond to the functional variable domain of a first TCR, and the TCR ⁇ and ⁇ chain constant region extracellular sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide respectively, may correspond to those of a second TCR, the first and second TCRs being from the same species.
  • ⁇ and ⁇ chain variable region sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a first human TCR
  • the ⁇ and ⁇ chain constant region extracellular sequences may correspond to those of a second human TCR.
  • A6 Tax sTCR constant region extracellular sequences can be used as a framework onto which heterologous ⁇ and ⁇ variable domains can be fused.
  • the TCR ⁇ and ⁇ , or ⁇ and ⁇ chain variable region sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may together correspond to the functional variable domain of a first human TCR, and the TCR ⁇ and ⁇ chain constant region extracellular sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a second non-human TCR,
  • the ⁇ and ⁇ , or ⁇ and ⁇ chain variable region sequences present dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a first human TCR, and the ⁇ and ⁇ chain constant region extracellular sequences may correspond to those of a second non- human TCR.
  • murine TCR constant region extracellular sequences can be used as a framework onto which heterologous human ⁇ and ⁇ TCR variable domains can be fused.
  • a linker sequence may link the first and second TCR segments, to form a single polypeptide strand.
  • the linker sequence may, for example, have the formula -P- AA-P- wherein P is proline and AA represents an amino acid sequence wherein the amino acids are glycine and serine.
  • the first and second segments must be paired so that the variable region sequences thereof are orientated for such binding.
  • the linker should have sufficient length to span the distance between the C terminus of the first segment and the N terminus of the second segment, or vice versa.
  • excessive linker length should preferably be avoided, in case the end of the linker at the N-terminal variable region sequence blocks or reduces bonding of the scTCR to the target ligand.
  • the linker may consist of from 26 to 41, for example 29, 30, 31 or 32 or 33, 34, 35 or 36 amino acids, and a particular linker has the formula -PGGG-(SGGGG) 5 - P- or -PGGG-(SGGGG) 6 -P-wherein P is proline, G is glycine and S is serine.
  • a principle characterising feature of the scTCRs of the present complexes, and preferably a feature of the dTCRs, is a disulfide bond between the constant region extracellular sequences of the dTCR polypeptide pair or first and second segments of the scTCR polypeptide. That bond may correspond to the native inter-chain disulfide bond present in native dimeric ⁇ TCRs, or may have no counterpart in native TCRs, being between cysteines specifically incorporated into the constant region extracellular sequences of dTCR polypeptide pair or first and second segments of the scTCR polypeptide. In some cases, both a native and a non-native disulfide bond may be desirable.
  • the position of the disulfide bond is subject to the requirement that the variable region sequences of dTCR polypeptide pair or first and second segments of the scTCR polypeptide are mutually orientated substantially as in native ⁇ or ⁇ T cell receptors.
  • the disulfide bond may be formed by mutating non-cysteine residues on the first and second segments to cysteine, and causing the bond to be formed between the mutated residues.
  • Residues whose respective ⁇ carbons are approximately 6 A (0.6 nm) or less, and preferably in the range 3.5 A (0.35 nm) to 5.9 A (0.59 nm) apart in the native TCR are preferred, such that a disulfide bond can be formed between cysteine residues introduced in place of the native residues. It is preferred if the disulfide bond is between residues in the constant immunoglobulin region, although it could be between residues of the membrane proximal region.
  • Preferred sites where cysteines can be introduced to form the disulfide bond are the following residues in exon 1 of TRAC*01 for the TCR ⁇ chain and TRBC1*01 or TRBC2*01 for the TCR ⁇ chain:
  • the TCR chains may not have a region which has 100% identity to the above motifs.
  • those of skill in the art will be able to use the above motifs to identify the equivalent part of the TCR ⁇ or ⁇ chain and hence the residue to be mutated to cysteine. Alignment techniques may be used in this respect.
  • ClustalW available on the European Bioinformatics Institute website (http://www.ebi.ac.uk/index.html) can be used to compare the motifs above to a particular TCR chain sequence in order to locate the relevant part of the TCR sequence for mutation.
  • the present invention includes within its scope complexes of ⁇ and ⁇ -analogue scTCRs, as well as those of other mammals, including, but not limited to, mouse, rat, pig, goat and sheep.
  • scTCRs as well as those of other mammals, including, but not limited to, mouse, rat, pig, goat and sheep.
  • those of skill in the art will be able to determine sites equivalent to the above-described human sites at which cysteine residues can be introduced to form an inter-chain disulfide bond.
  • the following shows the amino acid sequences of the mouse C ⁇ and C ⁇ soluble domains, together with motifs showing the murine residues equivalent to the human residues mentioned above that can be mutated to cysteines to form a TCR interchain disulfide bond (where the relevant residues are shaded):
  • Murine equivalent of human ⁇ Chain Thr 45 KTMESGTFIT / DKTVLDMKAM
  • Murine equivalent of human ⁇ Chain Tyr 10 YIQNPEPAVYQLKDPRSQDS
  • Murine equivalent of human ⁇ Chain Ser 15 AVYQLKDPR ⁇ QDSTLCLFTD
  • Murine equivalent of human ⁇ Chain Ser 77 KESNYSYCLSSRLRVSATFW Murine equivalent of human ⁇ Chain Ser 17: PPKVSLFEPSKAEIANKQKA
  • Murine equivalent of human ⁇ Chain Glu 15 VTPPKVSLF ⁇ PSKAEIANKQ
  • the A6 Tax sTCR extracellular constant regions can be used as framework onto which heterologous variable domains can be fused. It is preferred that the heterologous variable region sequences are linked to the constant region sequences at any point between the disulfide bond and the N termini of the constant region sequences. In the case of the A6 Tax TCR ⁇ and ⁇ constant region sequences, the disulfide bond may be formed between cysteine residues introduced at amino acid residues 158 and 172 respectively. Therefore it is preferred if the heterologous ⁇ and ⁇ chain variable region sequence attachment points are between residues 159 or 173 and the N terminus of the ⁇ or ⁇ constant region sequences respectively.
  • a label or another moiety, such as a toxic or therapeutic moiety, may be included in a multivalent TCR complex of the present invention.
  • the label or other moiety may be included in a mixed molecule multimer.
  • An example of such a multimeric molecule is a tetramer containing three TCR molecules and one peroxidase molecule. This could be achieved by mixing the TCR and the enzyme at a molar ratio of 3:1 to generate tetrameric complexes, and isolating the desired complex from any complexes not containing the correct ratio of molecules.
  • These mixed molecules could contain any combination of molecules, provided that steric hindrance does not compromise or does not significantly compromise the desired function of the molecules.
  • the positioning of the binding sites on the streptavidin molecule is suitable for mixed tetramers since steric hindrance is not likely to occur.
  • the TCR complex of the present invention may bind a peptide MHC complex, or a given MHC type or types, or a superantigen or a peptide- MHC/superantigen complex, or a CDl -antigen complex.
  • One embodiment the present invention makes available TCR complexes comprising high affinity TCRs.
  • the term 'high affinity TCR' refers to a mutated scTCR or dTCR which interacts with a specific TCR ligand and either: has a Kd for the said TCR ligand less than that of a corresponding native TCR as measured by Surface Plasmon Resonance, or has an off-rate (k 0ff ) for the said TCR ligand less than that of a corresponding native TCR as measured by Surface Plasmon Resonance.
  • High affinity scTCRs or dTCRs present in complexes of the present invention are preferably mutated relative to the native TCR in at least one complementarity determining region and/or framework region.
  • the TCR complex comprises at least two dTCR polypeptide pairs linked by a polyalkylene glycol chain, wherein a divalent alkylene spacer radical is optionally located between the polyalkylene glycol chain and its point of attachment to a dTCR of the complex, and wherein each said dTCR pair is constituted by:
  • a first polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence
  • the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBCl *01 or TRBC2*01 or the non-human equivalent thereof, the point of attachment of the polyalkylene linker to each dTCR of the complex being via the thiol group of a cysteine residue at the C-terminus of the dTCR.
  • TCR Linkers In the complexes of the invention, at least two TCR molecules are linked via linker moieties to form multivalent complexes.
  • the TCRs are linked by non-peptidic polymer chains or by peptidic linker sequences.
  • the complexes are water soluble, so the linker moiety should be selected accordingly.
  • the linker moiety should be capable of attachment to defined positions on the TCR molecules, so that the structural diversity of the complexes formed is minimised. Since the complexes of the invention may be for use in medicine, the linker moieties should be chosen with due regard to their pharmaceutical suitability, for example their immunogenicity.
  • linker moieties which fulfil the above desirable criteria are known in the art, for example the art of linking antibody fragments.
  • linker There are two classes of linker that are preferred for use in the production of multivalent TCR molecules of the present invention.
  • the first are hydrophilic polymers such as polyalkylene glycols.
  • the most commonly used of this class are based on polyethylene glycol or PEG, the structure of which is shown below.
  • n is about 3 to about 3500.
  • suitable, optionally substituted, polyalkylene glycols include polypropylene glycol, and copolymers of ethylene glycol and propylene glycol.
  • Such polymers may be used to treat or conjugate therapeutic agents, particularly polypeptide or protein therapeutics, to achieve beneficial changes to the PK profile of the therapeutic, for example reduced renal clearance, improved plasma half-life, reduced immunogenicity, and improved solubility.
  • therapeutic agents particularly polypeptide or protein therapeutics
  • Such improvements in the PK profile of the PEG-therapeutic conjugate are believe to result from the PEG molecule or molecules forming a 'shell' around the therapeutic which sterically hinders the reaction with the immune system and reduces proteolytic degradation.
  • the size of the hydrophilic polymer used my in particular be selected on the basis of the intended therapeutic use of the TCR complex.
  • the polymer used can have a linear or branched conformation.
  • Branched PEG molecules, or derivatives thereof, can be induced by the addition of branching moieties including glycerol and glycerol oligomers, pentaerythritol, sorbitol and lysine.
  • the polymer will have a chemically reactive group or groups in its structure, for example at one or both termini, and/or on branches from the backbone, to enable the polymer to link to target sites in the TCR.
  • This chemically reactive group or groups may be attached directly to the hydrophilic polymer, or there may be a spacer group/moiety between the hydrophilic polymer and the reactive chemistry as shown below:
  • spacer used in the formation of constructs of the type outlined above may be any organic moiety that is a non-reactive, chemically stable, chain, Such spacers include, by are not limited to the following:
  • hydrophilic polymers linked, directly or via a spacer, to reactive chemistries that may be of use in the present invention. These suppliers include Nektar Therapeutics (CA, USA), NOF Corporation (Japan), Sunbio (South Korea) and Enzon Pharmaceuticals (NJ, USA).
  • hydrophilic polymers linked, directly or via a spacer, to reactive chemistries that may be of use in the present invention include, but are not limited to, the following:
  • coupling chemistries can be used to couple polymer molecules to protein and peptide therapeutics.
  • the choice of the most appropriate coupling chemistry is largely dependant on the desired coupling site.
  • the following coupling chemistries have been used attached to one or more of the termini of PEG molecules (Source: Nektar Molecular Engineering Catalogue 2003):
  • non-PEG based polymers also provide suitable linkers for multimerising the TCRs of the present invention.
  • linkers for multimerising the TCRs of the present invention.
  • moieties containing maleimide termini linked by aliphatic chains such as BMH and BMOE (Pierce, products Nos. 22330 and 22323) can be used.
  • Peptidic linkers are the other class of TCR linkers. These linkers are comprised of chains of amino acids, and function to produce simple linkers or multimerisation domains onto which TCR molecules can be attached.
  • the biotin / streptavidin system has previously been used to produce TCR tetramers (see WO/99/60119) for in-vitro binding studies.
  • stepavidin is a microbially-derived polypeptide and as such not ideally suited to use in a therapeutic.
  • the multivalent TCR complexes of the invention have the advantage of exhibiting preferential association with target cells expressing the cognate TCR ligand for the TCR they incorporate. These complexes are also capable of penetrating tumour mass, most probably via the tumour blood supply.
  • Example 10 herein provides experimental exemplification of the tumour penetrating and localising characteristics of an NY-ESO TCR dimer. These characteristics make the multivalent TCR complexes of the present invention suitable moieties for the delivery of therapeutic and/or imaging agents to cells expressing a given TCR ligand.
  • the TCR complex of the present invention may be associated with (e.g. covalently or otherwise linked to) a therapeutic agent which may be, for example, a toxic moiety for use in cell killing, or an immunostimulating agent such as an interleukin, a cytokine, or an immunostimulatory peptide or polypeptide.
  • a therapeutic agent which may be, for example, a toxic moiety for use in cell killing, or an immunostimulating agent such as an interleukin, a cytokine, or an immunostimulatory peptide or polypeptide.
  • Example immunostimulatory polypeptides include the NY-ESO polypeptide and the SLLMWITQC peptide loaded by HLA-A2 molecules on cancerous cells that contain the NY-ESO polypeptide, or the GILGFVFTL peptide loaded by HLA-A2 by cells infected with influenza.
  • the said immuno-stimulatory polypeptides will preferably contain one or more peptide epitopes in a form than can
  • the immunostimulatory peptide may comprise a synthetic non-naturally occurring peptide, capable to being loaded by an HLA polypeptide.
  • a recombinant TCR could then be produced that recognised the HLA-synthetic peptide complex for use in multivalent TCR complexes of the present invention.
  • a plurality of said therapeutic agents might be associated with a multivalent TCR complex of the present invention.
  • a multivalent TCR complex of the present invention may have enhanced binding capability for a cognate ligand compared to a non-multimeric T cell receptor heterodimer.
  • the multivalent TCR complexes according to the invention are particularly useful for tracking or targeting cells presenting particular antigens in vitro or in vivo, and are also useful as intermediates for the production of further multivalent TCR complexes having such uses.
  • the TCR or multivalent TCR complex may therefore be provided in a pharmaceutically acceptable formulation for use in vivo.
  • the invention also provides a method for delivering a therapeutic agent to a target cell, which method comprises contacting potential target cells with a multivalent TCR complex in accordance with the invention under conditions to allow attachment of the multivalent TCR complex to the target cell, said multivalent TCR complex being specific for the cognate ligand (eg MHC -peptide complex, CDl -antigen complex, superantigen or MHC-peptide/superantigen complex) and having the therapeutic agent associated therewith.
  • a cognate ligand eg MHC -peptide complex, CDl -antigen complex, superantigen or MHC-peptide/superantigen complex
  • TCR complexes of the present invention for example TCR-PEG dimers or such dimers linked to a therapeutic agent
  • distribution of such complexes is in many cases is largely confined to the viable areas of the tumours indicating that multimeric TCR complexes of the invention may be selectively targeted to this area of tumours.
  • This is an important, and unexpected benefit, as it is these viable areas that a successful therapeutic must target and less of the complex may be required for a given effect if it is not wasted in targeting dead tumour cells.
  • such complexes are capable of rapid tumour penetration. Rapid internalisation indicates an active ingress mechanism.
  • this active mechanism may involve the internalisation of pMHC on tumour cells in response to interactions with TCR complexes, for example dimers. This internalisation may lead to the complexes associated with pMHC being "pulled into” the tumour cells. Furthermore, it has previously been suggested that internalisation of pMHC may lead to apoptosis, providing a further unexpected mode-of-action for such multivalent TCR complex therapeutics. This assertion is supported by a number of studies that demonstrate antigen presenting cells undergo apoptosis in response to the binding of anti-HLA antibodies. (See for example, (Wallen-Ohman et al, (1997) J.
  • the multivalent TCR complex can be used to deliver therapeutic agents to the location of cells presenting a particular antigen. This is useful in many situations and, in particular, against tumours.
  • a therapeutic agent can be delivered such that it exercises its effect locally, but not only on the cell it binds to.
  • one particular strategy uses anti-tumour molecules linked to multivalent TCR complexes of the invention specific for tumour antigens.
  • therapeutic agents may be employed for this use, for instance radioactive compounds, enzymes (perform, for example) or chemotherapeutic agents (cisplatin, for example).
  • radioactive compounds for instance radioactive compounds, enzymes (perform, for example) or chemotherapeutic agents (cisplatin, for example).
  • chemotherapeutic agents cisplatin, for example.
  • toxin may be inside a liposome linked to streptavidin so that the compound is released slowly. This prevents damaging effects during the transport in the body and ensures that the toxin has maximum effect after binding of the multivalent TCR complex to the relevant antigen presenting cells.
  • Suitable therapeutic agents include:
  • small molecule cytotoxic agents i.e. compounds with the ability to kill mammalian cells having a molecular weight of less than 700 daltons. Such compounds could also contain toxic metals capable of having a cytotoxic effect. Furthermore, it is to be understood that these small molecule cytotoxic agents also include pro-drugs, i.e. compounds that decay or are converted under physiological conditions to release cytotoxic agents.
  • agents include cis-platin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodiumphotofrin II, temozolmide, topotecan, trimetreate glucuronate, auristatin E vincristine and doxorubicin;
  • peptide cytotoxins i.e. proteins or fragments thereof with the ability to kill mammalian cells.
  • examples include ricin, diphtheria toxin, pseudomonas bacterial exotoxin A, DNAase and RNAase; • radio-nuclides, i.e. unstable isotopes of elements which decay with the concurrent emission of one or more of ⁇ or ⁇ particles, or ⁇ rays.
  • radio-nuclides i.e. unstable isotopes of elements which decay with the concurrent emission of one or more of ⁇ or ⁇ particles, or ⁇ rays.
  • examples include iodine 131, rhenium 186, indium 111, yttrium 90 and complexes incorporating 90 Yt such as 90 Yt-DOTA-Biotin, bismuth 210 and 213, actinium 225 and astatine 213;
  • prodrugs such as antibody directed enzyme pro-drugs
  • immuno-stimulants i.e. moieties which stimulate immune response.
  • examples include cytokines such as IL-2, chemokines such as IL-8, platelet factor 4, melanoma growth stimulatory protein, etc, antibodies or fragments thereof, complement activators, xenogeneic protein domains, allogeneic protein domains, viral/bacterial protein domains and viral/bacterial peptides.
  • Soluble multivalent TCR complexes of the invention may be linked to an enzyme capable of converting a prodrug to a drug. This allows the prodrug to be converted to the drug only at the site where it is required (i.e. targeted by the sTCR).
  • MHC-peptide targets for the TCR include, but are not limited to, viral epitopes such as HTLV-1 epitopes (e.g. the Tax peptide restricted by HLA-A2; HTLV-1 is associated with leukaemia), HIV epitopes, EBV epitopes, CMV epitopes; melanoma epitopes (e.g. MAGE-1 HLA-Al restricted epitope) and other cancer-specific epitopes (e.g. the renal cell carcinoma associated antigen G250 restricted by HLA-A2); and epitopes associated with autoimmune disorders, such as rheumatoid arthritis.
  • viral epitopes such as HTLV-1 epitopes (e.g. the Tax peptide restricted by HLA-A2; HTLV-1 is associated with leukaemia), HIV epitopes, EBV epitopes, CMV epitopes; melanoma epitopes (e.g. MAGE-1 HLA-Al restricted
  • a multitude of disease treatments can potentially be enhanced by localising the drug through the specificity of soluble TCRs.
  • Viral diseases for which drugs exist would benefit from the drug being released or activated in the near vicinity of infected cells.
  • the localisation in the vicinity of tumours or metastasis would enhance the effect of toxins or immunostimulants.
  • immunosuppressive drugs could be released slowly, having more local effect over a longer time-span while minimally affecting the overall immuno-capacity of the subject.
  • the effect of immunosuppressive drugs could be optimised in the same way.
  • the vaccine antigen could be localised in the vicinity of antigen presenting cells, thus enhancing the efficacy of the antigen.
  • the method can also be applied for imaging purposes.
  • the soluble multivalent TCR complexes of the present invention may be used to modulate T cell activation by binding to specific cognate ligands and thereby inhibiting T cell activation.
  • Autoimmune diseases involving T cell-mediated inflammation and/or tissue damage would be amenable to this approach, for example type I diabetes.
  • Knowledge of the specific peptide epitope presented by the relevant pMHC is required for this use.
  • An alternative means of treating autoimmune disease is to use multivalent TCR complexes of the present invention that comprise TCRs capable of binding to HLA molecules of a given type loaded with a wide range of, or any, suitable peptide.
  • the TCR complexes of the present invention maybe used to modulate T cell activation by binding to specific TCR ligand and thereby inhibitmg T cell activation.
  • Autoimmune diseases involving T cell-mediated inflammation and/or tissue damage would be amenable to this approach, for example type I diabetes.
  • Knowledge of the specific peptide epitope presented by the relevant pMHC is required for this use.
  • Therapeutic or imaging TCR complexes in accordance with the invention will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier.
  • This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage fonns.
  • the pharmaceutical composition may be adapted for administration by any appropriate route, for example parenteral, transdermal or via inhalation, preferably a parenteral (including subcutaneous, intramuscular, or, most preferably intravenous) route.
  • a parenteral route for example parenteral, transdermal or via inhalation, preferably a parenteral (including subcutaneous, intramuscular, or, most preferably intravenous) route.
  • Such compositions may be prepared by any method known in the art of pharmacy, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.
  • Dosages of the substances of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used.
  • the multivalent TCR complexes of the present invention have applications relating to the imaging, tracking and targeting of cells and cell masses. Moieties that facilitate imaging of these cells can be associated with these complexes. Such labelled multivalent TCR complexes can be used to analyse the distribution of cells expressing the cognate TCR ligand for the TCR incorporated within a given multivalent TCR complex. This imaging can be carried out either in-vivo or ex-vivo. There is a range of imaging agents, known to those skilled in the art, which could be associated with the multivalent TCR complexes of the present invention. These imaging agents include, but are not limited to, the following: Radionuclides (e.g. 125 I, 201 T1, 67 Ga, 17 F, 131 I and 99m Tc, )
  • Electro-dense particles e.g. gold
  • Fluorescent labels e.g. FITC, PE, CY-3 and CY-5)
  • Multivalent TCR complexes associated with such labelling moieties are useful in methods for the diagnosis of cancer and infectious diseases, as well as for monitoring progression of the disease or cancer.
  • the soluble multivalent TCRs present in complexes of the present invention may obtained by expression in a bacterium such as E. coli as inclusion bodies, and subsequent refolding in vitro.
  • a TCR with correct conformation is achieved by refolding solubilised TCR chains in a refolding buffer comprising a solubilising agent, for example urea.
  • a solubilising agent for example urea.
  • the urea may be present at a concentration of at least 0.1M or at least 1M or at least 2.5M, or about 5M.
  • An alternative solubilising agent which may be used is guanidine, at a concentration of between 0.1M and 8M, preferably at least 1M or at least 2.5M.
  • a reducing agent is preferably employed to ensure complete reduction of cysteine residues.
  • denaturing agents such as DTT and guanidine may be used as necessary.
  • Different denaturants and reducing agents may be used prior to the refolding step (e.g. urea, ⁇ -mercaptoethanol).
  • Alternative redox couples may be used during refolding, such as a cystamine/cysteamine redox couple, DTT or ⁇ -mercaptoethanol/atmospheric oxygen, and cysteine in reduced and oxidised forms.
  • Folding efficiency may also be increased by the addition of certain other protein components, for example chaperone proteins, to the refolding mixture. Improved refolding has been achieved by passing protein through columns with immobilised mini-chaperones (Altamirano, et al. (1999). Nature Biotechnology 17: 187-191; Altamirano, et al. (1997). Proc Natl Acad Sci U S A 94(8): 3576-8).
  • multivalent TCR complexes of the present invention may obtained by expression in a eukaryotic cell system, such as insect cells.
  • Purification of the multivalent TCR complexes may be achieved by many different means.
  • Alternative modes of ion exchange may be employed or other modes of protein purification may be used such as gel filtration chromatography or affinity chromatography.
  • Figures la and lb show respectively the nucleic acid sequences of the ⁇ and ⁇ chains of a soluble A6 TCR, mutated so as to introduce a cysteine codon. The shading indicates the introduced cysteine codons;
  • Figure 2a shows the A6 TCR ⁇ chain extracellular amino acid sequence, including the T 8 -> C mutation (underlined) used to produce the novel disulphide inter-chain bond
  • Figure 2b shows the A6 TCR ⁇ chain extracellular amino acid sequence, including the S 57 -> C mutation (underlined) used to produce the novel disulphide inter-chain bond;
  • Figures 3 a and 3b show respectively the nucleic acid sequences of the ⁇ and ⁇ chains of a soluble NY-ESO TCR, mutated so as to introduce a cysteine codon.
  • Figure 4a shows the NY-ESO TCR ⁇ chain extracellular amino acid sequence, including the T 48 — » C mutation used to produce the novel disulphide inter-chain bond
  • Figure 4b shows the A6 TCR ⁇ chain extracellular amino acid sequence, including the S 57 -» C mutation used to produce the novel disulphide inter-chain bond;
  • Figure 5 shows the nucleic acid sequence of the ⁇ chain of a soluble NY-ESO TCR, further mutated so as to introduce codon causing the addition of a cysteine residue on the C-terminus of the encoded polypeptide.
  • Figure 6 shows the amino acid sequence of the ⁇ chain of a soluble NY-ESO TCR, further mutated so as to introduce a cysteine residue on the C-terminus of the polypeptide.
  • Figures 7a and 7b show respectively the nucleic acid sequences of the ⁇ and ⁇ chains of a soluble A6 TCR, further mutated so as to introduce codon causing the addition of a cysteine residue on the C-terminus of the encoded polypeptide.
  • Figures 8a and 8b show respectively the amino acid sequences of the ⁇ and ⁇ chains of a soluble A6 TCR, further mutated so as to introduce a cysteine residue on the C- terminus of the polypeptide.
  • Figure 9 is a chromatogram of an dimeric NY-ESO TCR 3.4kd Mal-PEG-Mal complex run on a Superdex 75 HRlO/30 gel-filtration column pre-equilibrated in PBS.
  • Figure 10 is an SDS PAGE gel of fractions collected from the gel-filtration gel illustrated in Figure 9 run under reducing and non-reducing conditions.
  • Figure 11a is a BIACore trace that shows the interaction between monomeric NY- ESO TCR and immobilised HLA-A2-NY-ESO.
  • Figure 1 lb is a BIACore trace that shows the interaction between a dimeric NY-ESO TCR 3.4kd Mal-PEG-Mal complex and immobilised HLA-A2-NY-ESO.
  • Figure 12a is a BIACore trace that shows the interaction between monomeric A6 TCR and immobilised HLA-A2-Tax.
  • Figure 12b is a BIACore trace that shows the interaction between a dimeric A6 TCR 3.4kd Mal-PEG-Mal complex and immobilised HLA-A2-Tax
  • Figure 12c is a BIACore trace that shows a single injection of a dimeric A6 TCR 3.4kd Mal-PEG-Mal complex flowed over immobilised HLA-A2-Tax.
  • Figure 13 shows the DNA and amino acid sequences of the linker used in the construction of the A6 scTCR.
  • FIG. 14 Outlines the cloning of TCR ⁇ and ⁇ chains into phagmid vectors.
  • the diagram describes a phage display vector.
  • RSB is the ribosome-binding site.
  • SI or S2 are signal peptides for secretion of proteins into periplasm of E. coli.
  • the * indicates translation stop codon.
  • Either of the TCR ⁇ chain or ⁇ chain can be fused to phage coat protein, however in this diagram only TCR ⁇ chain is fused to phage coat protein.
  • Figures 15a and 15b detail the DNA and amino acid sequence of phagmid pEX746:A6 respectively.
  • Figure 16 illustrates the distribution of radioactivity in tissues at 20 minutes following
  • Figure 17 illustrates the distribution of radioactivity in tissues at 48 hours following a single intravenous administration of dimer-[ 125 I]-mTCR (pegylated) to nude female rats bearing tumours.
  • Figure 18 is a BIAcore trace that shows the interaction between a PEG-linked A6 TCR tetramer and immobilised HLA-A2-Tax.
  • Figure 19a illustrates an H&E stained cryostat tumour section.
  • Figure 19b illustrates an anti-HLA-A2 stained cryostat tumour section.
  • Figure 19c illustrates a control IgG stained cryostat tumour section.
  • Figure 20a illustrates an H&E and anti-TCR ⁇ chain antibody stained formalin-fixed paraffin-embedded tumour section.
  • Figure 20b illustrates an H&E and anti-NY-ESO TCR antibody stained formalin- fixed paraffin-embedded tumour section.
  • Figure 20c illustrates an H&E and anti-NY-ESO antibody/NY-ESO TCR control stained formalin-fixed paraffin-embedded tumour section.
  • Figure 20d illustrates an H&E and omission control stained formalin-fixed paraffm- embedded tumour section.
  • Figure 21 illustrates an H&E and anti-NY-ESO TCR antibody stained formalin-fixed paraffin-embedded tumour section.
  • Figure 22a details the DNA sequence of the high affinity A6 TCR ⁇ chain; including the introduced cysteine codon at the 3' end.
  • Figure 22b details the amino acid sequence of the A6 TCR ⁇ chain; including the introduced cysteine codon at the 3' end.
  • Figure 23 a details the DNA sequence of the high affinity A6 TCR ⁇ chain; the mutated nucleic acids are indicated in bold.
  • Figure 23b details the amino acid sequence of the A6 TCR ⁇ chain; the mutated amino acids are indicated in bold.
  • Figure 24 is a BIAcore trace that shows the interaction between a high affinity A6 TCR and immobilised HLA-A2-Tax.
  • Figure 25 is a BIAcore trace that shows the interaction between a divalent high affinity A6 TCR 3.4KD Mal-PEG-Mal complex and immobilised HLA-A2-Tax.
  • Figure 26 is a BIAcore trace that shows the interaction between A6 TCR PEG complexes and immobilised HLA-A2-Tax:
  • Figure 27a illustrates the specific staining of PP cells pulsed with Tax peptide at 10 ⁇ 4 M by high affinity clone 134 A6 TCR 20KD PEG dimers
  • Figure 27b illustrates the specific staining of PP cells pulsed with Tax peptide at IO "5 M by high affinity clone 134 A6 TCR 20KD PEG dimers
  • Expression plasmids containing the genes for the A6 Tax TCR ⁇ or ⁇ chain were mutated using the ⁇ -chain primers or the ⁇ -chain primers respectively, as follows. 100 ng of plasmid was mixed with 5 ⁇ l 10 mM dNTP, 25 ⁇ l lOxPfu-buffer (Stratagene), 10 units Pfu polymerase (Stratagene) and the final volume was adjusted to 240 ⁇ l with H 2 O. 48 ⁇ l of this mix was supplemented with primers diluted to give a final concentration of 0.2 ⁇ M in 50 ⁇ l final reaction volume.
  • the reaction mixture was subjected to 15 rounds of denaturation (95°C, 30 sec), annealing (55°C, 60 sec), and elongation (73 °C, 8 min.) in a Hybaid PCR express PCR machine.
  • the product was then digested for 5 hours at 37°C with 10 units of Dpnl restriction enzyme (New England Biolabs). 10 ⁇ l of the digested reaction was transformed into competent XLl-Blue bacteria and grown for 18 hours at 37°C.
  • Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and the sequence was verified by automated sequencing at the sequencing facility of Department of Biochemistry, Oxford University. The respective mutated nucleic acid and amino acid sequences are shown in Figures la and 2a for the ⁇ chain and Figures lb and 2b for the ⁇ chain.
  • Example 2 Production of soluble NY-ESO TCR containing a novel disulphide bond.
  • cDNA encoding NY-ESO TCR was produced by treatment of the mRNA with reverse transcriptase.
  • the ⁇ chain of the soluble A6 TCR prepared in Example 1 contains in the native sequence a Bglll restriction site (AAGCTT) suitable for use as a ligation site.
  • AAGCTT Bglll restriction site
  • PCR mutagenesis was carried as detailed below to introduce a BamHl restriction site (GGATCC) into the ⁇ chain of soluble A6 TCR, 5' of the novel cysteine codon.
  • GGATCC BamHl restriction site
  • A6 TCR plasmids containing the ⁇ chain BamHI and ⁇ chain Bglll restriction sites were used as templates.
  • the following primers were used:
  • NY-ESO TCR ⁇ and ⁇ -chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the NY-ESO TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing.
  • Figures 3 a and 3b show the DNA sequence of the mutated ⁇ and ⁇ chains of the NY-ESO TCR respectively, and Figures 4a and 4b show the resulting amino acid sequences.
  • Example 3 Production of soluble NY-ESO TCR containing a novel disulphide interchain bond, and an additional cysteine residue on the C-terminus of the ⁇ -chain.
  • NY-ESO TCR ⁇ and ⁇ -chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the NY-ESO TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing.
  • Figure 5 shows the DNA sequence of the mutated ⁇ chains of the NY- ESO TCR
  • Figure 6 shows the resulting amino acid sequence.
  • Example 4 Production of soluble A6 TCR containing a novel disulphide inter-chain bond, and an additional cysteine residue on the C-terminus of the ⁇ -chain.
  • Plasmids encoding the A6 TCR containing the ⁇ chain BamHI and ⁇ chain Bglll restriction sites, prepared as described in Example 2 were used as a starting point.
  • the following primers were used to produce a soluble A6 TCR incorporating a novel disulphide bond and a cysteine residue on the C-temiinus of the ⁇ chain as described in Example 3:
  • Figures 7a and 8a show the DNA and amino acid sequence of the ⁇ chain of the mutated A6 TCR
  • Figures 7b and 8b show the DNA and amino acid sequence of the ⁇ chain of the mutated A6 TCR
  • Example 5 Expression and refolding of soluble A6 and NY-ESO TCRs containing a novel disulphide inter-chain bond, and an additional cysteine residue on the C- terminus of the ⁇ -chain
  • Cell pellets were re- suspended in a buffer containing 50mM Tris-HCI, 25% (w/v) sucrose, ImM NaEDTA, 0.1% (w/v) NaAzide, lOmM DTT, pH 8.0. After an overnight freeze-thaw step, re-suspended cells were sonicated in 1 minute bursts for a total of around 10 minutes in a Milsonix XL2020 sonicator using a standard 12mm diameter probe. Inclusion body pellets were recovered by centrifugation for 30 minutes at 13000rpm in a Beckman J2-21 centrifuge. Three detergent washes were then carried out to remove cell debris and membrane components.
  • the inclusion body pellet was homogenised in a Triton buffer (50mM Tris-HCI, 0.5% Triton-XlOO, 200mM NaCI, lOmM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0) before being pelleted by centrifugation for 15 minutes at 13000rpm in a Beckman J2-21. Detergent and salt was then removed by a similar wash in the following buffer: 50mM Tris-HCI, lmM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0. Finally, the inclusion bodies were divided into 30 mg aliquots and frozen at -70°C. Inclusion body protein yield was quantitated by solubilising with 6M guanidine-HCl and measurement with a Bradford dye-binding assay (PerBio).
  • the redox couple (2-mercaptoethylamine and cystamine (to final concentrations of 6.6mM and 3.7mM, respectively) were added approximately 5 minutes before addition of the denatured TCR chains. The protein was then allowed to refold for approximately 5 hours ⁇ 15 minutes with stirring at 5°C ⁇ 3°C.
  • the refolded TCR was dialysed in Spectrapor 1 membrane (Spectrum; Product No. 132670) against 10 L 10 mM Tris pH 8.1 at 5°C ⁇ 3°C for 18-20 hours. After this time, the dialysis buffer was changed to fresh 10 mM Tris pH 8.1 (10 L) and dialysis was continued at 5°C ⁇ 3°C for another 20-22 hours.
  • sTCR was separated from degradation products and impurities by loading the dialysed refold onto a POROS 50HQ anion exchange column and eluting bound protein with a gradient of 0-500mM NaCI over 50 column volumes using an Akta purifier (Pharmacia). Peak fractions were stored at 4°C and analysed by Coomassie-stained SDS-PAGE before being pooled and concentrated. Finally, the sTCR was purified and characterised using a Superdex 200HR gel filtration column pre-equilibrated in HBS-EP buffer (10 mM HEPES pH 7.4, 150 mM NaCI, 3.5 mM EDTA, 0.05% nonidet p40). The peak eluting at a relative molecular weight of approximately 50 kDa was then pooled and concentrated.
  • Example 6 Diimerisation of TCRs using a 3.4kdMal-PEG-Mal linker.
  • NY-ESO TCRs containing a novel disulphide inter-chain bond, and an additional cysteine residue on the C-terminus of the ⁇ -chain were cross-linked using non-branched bifunctional maleimide-PEG (MAL-PEG-MAL, MW 3.4KD, Shearwater corp.).
  • MAL-PEG-MAL non-branched bifunctional maleimide-PEG
  • the maleimide groups on the termini of this linker confer free thiol binding specificity to the linker.
  • a reducing agent 0.2mM DTT (room temperature, overnight), in order to reduce the free cysteine on the soluble TCRs ⁇ chains without reducing the disulphide TCR interchain bonds.
  • the soluble TCRs were then re-purified by gel- filtration chromatography (Superdex 75) in PBS buffer containing lOmM EDTA.
  • Cross-linking was achieved by adding MAL-PEG-MAL (lOmM in DMF) at an approximately 2: 1 (protein to cross-linker) molar ratio and subsequently incubating overnight at room temperature.
  • the product was then purified using Superdex 75 HR10/30 gel- filtration column pre-equilibrated in PBS (Figure 9). Three distinct peaks were observed after the cross-linking, of which one corresponded with the position of intact "monomeric" TCR and the other two corresponded with higher molecular mass species. The material in the peaks was further analysed by SDS- PAGE.
  • Example 7 - BIAcore surface plasmon resonance characterisation of divalent A6 TCR and NY-ESO TCR 3.4KD Mal-PEG-Mal complexes binding to specific pMHC
  • a surface plasmon resonance biosensor (BIAcore 3000TM ) was used to analyse the binding of the divalent A6 and NY-ESO TCR PEG complexes to their cognate peptide-MHC ligands. This was facilitated by producing single pMHC complexes
  • Such immobilised pMHC complexes are capable of binding both T-cell receptors and the coreceptor CD8 ⁇ , both of which may be injected in the soluble phase.
  • Biotinylated class I HLA-A2 - peptide complexes were refolded in vitro from bacterially-expressed inclusion bodies containing the constituent subunit proteins and synthetic peptide, followed by purification and in vitro enzymatic biotinylation (O'Callaghan et al. (1999) Anal Biochem. 266: 9-15).
  • HLA-heavy chain was expressed with a C-terminal biotinylation tag which replaces the transmembrane and cytoplasmic domains of the protein in an appropriate construct.
  • Inclusion body expression levels of ⁇ 75 mg/litre bacterial culture were obtained.
  • the HLA light- chain or ⁇ 2-microglobulin was also expressed as inclusion bodies in E.coli from an appropriate construct, at a level of ⁇ 500 mg/litre bacterial culture.
  • E. coli cells were lysed and inclusion bodies are purified to approximately 80% purity. Protein from inclusion bodies was denatured in 6 M guanidine-HCl, 50 mM Tris pH 8.1, 100 mM NaCI, 10 mM DTT, 10 mM EDTA, and was refolded at a concentration of 30 mg/litre heavy chain, 30 mg/litre ⁇ 2m into 0.4 M L-Arginine-HCl, 100 mM Tris pH 8.1, 3.7 mM cystamine, mM cysteamine, 4 mg/ml peptide (e.g. tax 11-19), by addition of a single pulse of denatured protein into refold buffer at ⁇ 5°C. Refolding was allowed to reach completion at 4°C for at least 1 hour.
  • Buffer was exchanged by dialysis in 10 volumes of 10 mM Tris pH 8.1. Two changes of buffer were necessary to reduce the ionic strength of the solution sufficiently.
  • the protein solution was then filtered through a 1.5 ⁇ m cellulose acetate filter and loaded onto a POROS 50HQ anion exchange column (8 ml bed volume). Protein was eluted with a linear 0-500 mM NaCI gradient. HLA- A2 -peptide complex eluted at approximately 250 mM NaCI, and peak fractions were collected, a cocktail of protease inhibitors (Calbiochem) was added and the fractions were chilled on ice.
  • Biotinylation tagged pMHC complexes were buffer exchanged into 10 mM Tris pH 8.1, 5 mM NaCI using a Pharmacia fast desalting column equilibrated in the same buffer. Immediately upon elution, the protein-containing fractions were chilled on ice and protease inhibitor cocktail (Calbiochem) was added. Biotinylation reagents were then added: 1 mM biotin, 5 mM ATP (buffered to pH 8), 7.5 mM MgC12, and 5 ⁇ g/ml BirA enzyme (purified according to O'Callaghan et al. (1999) Anal. Biochem. 266: 9- 15). The mixture was then allowed to incubate at room temperature overnight.
  • Biotinylated pMHC complexes were purified using gel filtration chromatography. A Pharmacia Superdex 75 HR 10/30 column was pre-equilibrated with filtered PBS and 1 ml of the biotinylation reaction mixture was loaded and the column was developed with PBS at 0.5 ml/min. Biotinylated pMHC complexes eluted as a single peak at approximately 15 ml. Fractions containing protein were pooled, chilled on ice, and protease inhibitor cocktail was added. Protein concentration was determined using a Coomassie-binding assay (PerBio) and aliquots of biotinylated pMHC complexes were stored frozen at -20°C. Streptavidin was immobilised by standard amine coupling methods.
  • PerBio Coomassie-binding assay
  • SPR surface plasmon resonance
  • the probe flow cells were prepared by immobilising the HLA-A2 peptide complexes (1000 response units) in separate flow cells via binding between the biotin cross linked onto ⁇ 2m and streptavidin which have been chemically cross linked to the activated surface of the flow cells.
  • the assay was then performed by passing sTCR, or the divalent A6 PEG complexes, over the surfaces of the different flow cells at a constant flow rate, measuring the SPR response in doing so. Injections of soluble sTCR at constant flow rate and different concentrations over the peptide-MHC complex were used to define the background resonance.
  • a streptavidin-coated Biacore chip was loaded with biotinylated HLA A2 refolded in the presence of NY-ESO peptide (1000 response units).
  • a series of dilutions of NY- ESO TCR was then injected and the response measured (Figure 11a).
  • Dilutions of TCR-PEG-TCR dimers were injected in the same way except longer dissociation phase was allowed ( Figure 1 lb).
  • the values for affinity (Kd) and dissociation half- time were calculated using Origin software. The dimers exhibited a dramatic avidity effect resulting in a 20x increase in dissociation half-time compared with free NY- ESO TCR.
  • Example 8 Design, Expression and testing of a single-chain A6 TCR incorporating a novel disulphide inter-chain bond.
  • the present example details the methods used in the production of a single-chain A6 TCR incorporating a novel disulphide inter-chain bond.
  • Single-chain constructs of this design could also be used as the TCR monomers for the production of divalent TCR - PEG complexes using the methods described in Example 6.
  • the scDiS A6 TCR contains a 30 amino acid linker sequence between the C-terminus of the TCR ⁇ chain and the N-terminus of the ⁇ chain.
  • Figure 13 shows the DNA and amino acid sequence of this linker.
  • the cloning strategy employed to produce the scDiS A6 TCR is summarised in Figure 14.
  • alpha and beta chains of the A6 dsTCR were amplified by PCR using primers containing restriction sites as shown in figure 14, ie.:
  • Alpha 5' primer ccaaggccatatgcagaaggaagtggagcagaactct
  • Beta 5' primer tcccccgggggcggatccggcgggcccaacgctggtgtcactcag
  • Beta 3' primer gggaagcttagtctgctctaccccaggcctcg
  • the two fragments thus generated were PCR stitched using the 5' alpha and 3' beta primers to give a single-chain TCR with a short linker containing the sites Xmal- BamHI- Apal. This fragment was cloned into pGMT7. The full length linker was then inserted in two stages, firstly a 42bp fragment was inserted using the Xmal and BamHI sites:
  • a 48bp fragment was inserted using the BamHI and Apal sites to create a 90bp linker between the 3' end of the alpha chain and the 5' end of the beta chain.
  • the 48bp fragment was made by PCR extension of a mixture of the following oligos:
  • the product of this extension was digested with BamHI and Apal and ligated into the digested plasmid containing the 42bp linker fragment.
  • An additional cysteine codon can be added immediately prior to the 'stop' codon at the 3' terminus of the DNA encoding the above A6 scTCR to produce a molecule suitable for dimer production as described in Example 6.
  • Single-chain disulphide linked A6 TCR The expression plasmid containing the single-chain disulphide linked A6 TCR was transformed into E.coli strain BL21pLysS, and single ampicillin-resistant colonies were grown at 37°C in TYP (ampicillin lOO ⁇ g/ml) medium to OD 600 of 0.4 before inducing protein expression with 0.5mM IPTG. Cells were harvested three hours post-induction by centrifugation for 30 minutes at 4000rpm in a Beckman J-6B.
  • TYP ampicillin lOO ⁇ g/ml
  • Cell pellets were re-suspended in a buffer containing 50mM Tris-HCI, 25% (w/v) sucrose, lmM NaEDTA, 0.1% (w/v) NaAzide, lOmM DTT, pH 8.0. After an overnight freeze-thaw step, re-suspended cells were sonicated in 1 minute bursts for a total of around 10 minutes in a Milsonix XL2020 sonicator using a standard 12mm diameter probe. Inclusion body pellets were recovered by centrifugation for 30 minutes at 13000rpm in a Beckman J2-21 centrifuge. Three detergent washes were then carried out to remove cell debris and membrane components.
  • the inclusion body pellet was homogenised in a Triton buffer (50mM Tris-HCI, 0.5% Triton-XlOO, 200mM NaCI, lOmM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0) before being pelleted by centrifugation for 15 minutes at 13000rpm in a Beckman J2-21. Detergent and salt was then removed by a similar wash in the following buffer: 50mM Tris-HCI, ImM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0. Finally, the inclusion bodies were divided into 30 mg aliquots and frozen at -70°C. Inclusion body protein yield was quantitated by solubilising with 6M guanidine-HCl and measurement with a Bradford dye-binding assay (PerBio).
  • Triton buffer 50mM Tris-HCI, 0.5% Triton-XlOO, 200mM NaCI, lOmM NaED
  • the redox couple (2-mercaptoethylamine and cystamine (to final concentrations of 6.6mM and 3.7mM, respectively) were added approximately 5 minutes before addition of the denatured TCR chains.
  • the protein was then allowed to refold for approximately 5 hours ⁇ 15 minutes with stirring at 5°C ⁇ 3 °C.
  • the refold was then dialysed twice, firstly against 10 litres of 1 OOmM urea, secondly against 10 litres of lOOmM urea, lOmM Tris pH 8.0. Both refolding and dialysis steps were carried out at 6-8°C.
  • scTCR was separated from degradation products and impurities by loading the dialysed refold onto a POROS 50HQ anion exchange column and eluting bound protein with a gradient of 0-500mM NaCI over 50 column volumes using an Akta purifier (Pharmacia). Peak fractions were stored at 4°C and analysed by Coomassie- stained SDS-PAGE before being pooled and concentrated. The sTCR was then purified and characterised using a Superdex 200HR gel filtration column ( Figure 8) pre-equilibrated in HBS-EP buffer (10 mM HEPES pH 7.4, 150 mM NaCI, 3.5 mM EDTA, 0.05% nonidet p40). Peak fractions were stored at 4°C and analysed by Coomassie-stained SDS-PAGE before being pooled and concentrated.
  • the activity in the collected fractions was then estimated by scintillation counting.
  • TLC was then carried out on samples from each of the fractions to allow quantitation of the protein/iodine content present.
  • Example 10 In-vivo tumour targeted using divalent NY-ESO TCR 3.4KD Mal-PEG- Mal complexes.
  • the rats then received the following i.v. bolus dosage of the divalent NY-ESO TCR 3.4KD Mal-PEG-Mal complexes:
  • A6 TCRs containing a novel disulphide inter-chain bond, and an additional cysteine residue on the C-terminus of the ⁇ -chain were tetramerised using a tetrameric maleimide-PEG (4arm MAL-PEG, MW 20KD, Shearwater Corporation).
  • the maleimide groups on the termini of this linlcer confer free thiol binding specificity to the linker.
  • the TCR was pretreated with a reducing agent, 0.5mM DTT (37°C, 1 hour), in order to reduce the free cysteine on the soluble TCRs ⁇ chains without reducing the disulphide TCR interchain bonds.
  • the soluble TCRs were then re-purified by gel-filtration chromatography (Superdex 75) in PBS buffer containing lOmM EDTA. Tetramerisaton was achieved by adding the 4ann MAL-PEG (lOmM in DMF) at an approximately 4:1 (protein to cross-linker) molar ratio and subsequent incubation overnight at room temperature. The product was then purified using Superdex 75 HRlO/30 gel- filtration column pre- equilibrated in PBS. The eluted fractions were further analysed by SDS-PAGE.
  • Samples from the fractions were pre-treated with standard SDS sample buffer (BioRad) without DTT (non-reducing) or with 15mM DTT (reducing), and were run on a gradient 4-20% PAGE and stained with Coomassie blue stain.
  • Example 12 - BIAcore surface plasmon resonance characterisation of tetravalent A6 TCR PEG complexes binding to specific pMHC
  • tumours were removed from three of the rats used in Example 10. The tumours were cut in half and then one half was prepared by formalin-fixed paraffin embedding and the other half by cryostat preparation using the following methods:
  • tumour samples were snap frozen in liquid nitrogen and then sliced into 6 ⁇ m sections using a cryostat. These sections were used for IF studies..
  • tumour samples were fixed in 10% neutral formalin and embedded in paraffin wax. 3 ⁇ m sections were then sliced from the embedded tumour sections using a microtome. These sections were used for IHC studies.
  • Protocol 1 Sections were warmed for 10 minutes at 40 C.
  • blocking serum 100 ⁇ l was added to each section and left for 30 minutes.
  • the blocking serum is prepared from the species in which the secondary antibody is raised. This step is carried out to block non-specific binding of mouse IgG to the section so that when the secondary Ab is applied, it only binds to the primary antibody.
  • DAB diaminobenzidine tetrahydrochloride
  • the distribution of HLA-A2 within the cryostat prepared tumour sections was evaluated by a standard Immunofluorescent technique. Briefly, the cryostat-prepared sections to be imaged were bathed in a saturating concentration of an anti-HLA-A2 antibody that was labelled with a FITC fluorescent marker. The excess unbound antibody was then washed off and the sample was then prepared for imaging. This method was also repeated using a FITC-labelled non-specific IgG as a control.
  • H&E staining was carried out on formalin-fixed, paraffin-embedded tumour sections using the following method:
  • Sections were deparaffinised in Histoclear for 10 minutes and re-hydrate by immersing for 5 minutes each in 100% (IMS), 70%IMS/H 2 O, H 2 O.
  • Sections were immersed in haematoxylin for 10-15 minutes. 3. Sections were thoroughly washed in tap water and then in distilled H O. 4. The slides were de-stained by dipping for a few seconds in acid/alcohol (1% HCl/70% LMS ).
  • the slides were de-hydrated by dipping for 2 minutes in each of 70% IMS/ H 2 O and 100% IMS.
  • the stained tumour sections were then imaged using light (H&E stain) or fluorescence (TCR / HLA stains) microscopy.
  • NY-ESO TCR distribution was directly compared in the viable and necrotic tissue (determined by H&E staining) within the tumour. This comparison revealed that NY- ESO TCR was predominately found within the viable areas of the tumour. (See Figure 21)
  • HLA-A2 distribution was directly compared in the viable and necrotic tissue (determined by H&E staining) within the tumour. This comparison revealed that HLA-A2 was predominately found within the viable areas of the tumour. (See Figures 19a- 19c)
  • a high affinity soluble heterodimeric A6 TCR was expressed and refolded using the methods described in Example 5.
  • This soluble A6 TCR contains the TCR ⁇ chain previously described, except that a cysteine residue was added to the C terminal of this chain to facilitate dimerisation .
  • the ⁇ chain of this TCR contains mutations in the Complimentarity Determining Region 3 (CDR 3), which confer increased affinity for its cognate HLA-A2-Tax ligand.
  • CDR 3 Complimentarity Determining Region 3
  • a PEG dimer of the high affinity soluble heterodimeric A6 TCR produced as described in Example 15 was prepared using the methods as described in Example 6.
  • TCR-PEG-TCR 3,400 K linear PEG
  • 1.0 A280/ml in PBS working dilution: 17.6 ml in 400 ml final
  • the m for the interaction between the high affinity A6 TCR and HLA-A2 Tax was calculated to be 41 minutes.
  • the T ⁇ /2 for the interaction between the high affinity A6 TCR 3.4KD PEG dimer and HLA-A2 Tax was calculated to be in the order of 22 to 78 hours. (See Figure 25)
  • the dimerisation of the high affinity A6 TCR increased the interaction T ⁇ / 2 from 41 minutes to between 22-78 hours.
  • the use of the high affinity mutant A6 TCR in a PEG dimer increased the interaction T ⁇ 2 from 35-79 minutes (native A6 TCR PEG dimer) to 22-78 hours.
  • Example 17 Dimerisation of high affinity A6 TCRs using a 20KD Mal-PEG-Mal linker.
  • the dimeric high affinity A6 TCR 20KD Mal-PEG-Mal complexes produced were then re-purified using an altered method as follows: Anion-exchange chromatography was used to carry out the initial re-purification step for the high affinity A6 TCR 20KD Mal-PEG-Mal complexes :
  • the dimer eluted in the middle of the gradient (at approxiamtatly 0.25M NaCI) as a single peak.
  • the divalent high affinity A6 TCR 20KD PEG complexes had a disassociation half- live of 9.5 days with respect to HLA- A2 -Tax. This compares to a disassociation half- live of 22-78 hours for the high affinity divalent A6 3.4KD Mal-PEG-Mal complexes for the same interaction.
  • Example 19 Dimerisation ofA6 TCRs using a 5KD forked Mal-PEG-Mal linker.
  • A6 TCRs containing a novel disulphide inter-chain bond, and an additional cysteine residue on the C-terminus of the ⁇ -chain were cross-linked using a 5KD forked bifunctional maleimide-PEG (MAL-PEG-MAL, MW 5KD, Shearwater Corporation) using the production and re-purification methods described in Example 6.
  • Example 20 -BIAcore surface plasmon resonance comparison of the dimeric A6 TCR 5KD forked Mal-PEG-Mal complex, dimeric A6 TCR 3.4KD linear Mal-PEG- Mai complex and a monomeric 3.4KD linear A6 TCR complex binding to HLA-A2 Tax
  • Example 20 Cell staining using high affinity clone 134 A6 TCR 20KD PEG dimers
  • PP antigen presenting cells were pulsed with Tax peptide at a range of concentrations (IO "5 - 10 "9 M) for 90 minutes at 37"C. Controls, also using T2 cells were pulsed with 10 "5 M Flu peptide or incubated without peptide (unpulsed). After pulsing the cells were washed in serum-free RPMI and 1 x 10 5 cells were incubated with high affinity clone 134 A6 TCR 20KD PEG dimer labelled with Alexa 488 (Molecular probes, The Netherlands) for 10 minutes at room temperature. After washing the cells, the binding of the labelled TCR dimers was examined by flow cytometry using a FACS Vantage SE (Becton Dickinson).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Communicable Diseases (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Optics & Photonics (AREA)
  • Genetics & Genomics (AREA)
  • Endocrinology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Emergency Medicine (AREA)
  • Pain & Pain Management (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
PCT/GB2003/005104 2002-12-03 2003-11-25 Complexes of receptors Ceased WO2004050705A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU2003286263A AU2003286263A1 (en) 2002-12-03 2003-11-25 Complexes of receptors
JP2004570696A JP2006523437A (ja) 2002-12-03 2003-11-25 レセプター複合体
EP03777006A EP1567553A2 (en) 2002-12-03 2003-11-25 Complexes of receptors
US10/535,965 US20060135418A1 (en) 2002-12-03 2003-11-25 Receptors

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
GB0228112.9 2002-12-03
GB0228112A GB0228112D0 (en) 2002-12-03 2002-12-03 Receptors
GB0304090A GB0304090D0 (en) 2003-02-22 2003-02-22 Receptors
GB0304090.4 2003-02-22
GB0308309.4 2003-04-10
GB0308309A GB0308309D0 (en) 2003-04-10 2003-04-10 Receptors
US47590603P 2003-06-05 2003-06-05
US60/475,906 2003-06-05
GB0314113.2 2003-06-18
GB0314113A GB0314113D0 (en) 2003-06-18 2003-06-18 Receptors
GB0316354.0 2003-07-11
GB0316354A GB0316354D0 (en) 2003-07-11 2003-07-11 Receptors

Publications (2)

Publication Number Publication Date
WO2004050705A2 true WO2004050705A2 (en) 2004-06-17
WO2004050705A3 WO2004050705A3 (en) 2004-11-25

Family

ID=32475869

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/005104 Ceased WO2004050705A2 (en) 2002-12-03 2003-11-25 Complexes of receptors

Country Status (5)

Country Link
US (1) US20060135418A1 (https=)
EP (1) EP1567553A2 (https=)
JP (1) JP2006523437A (https=)
AU (1) AU2003286263A1 (https=)
WO (1) WO2004050705A2 (https=)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006037960A3 (en) * 2004-10-01 2006-08-03 Avidex Ltd T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
EP1969005A1 (en) * 2005-12-20 2008-09-17 Erasmus University Medical Center Rotterdam Apoptosis-inducing protein complexes and therapeutic use thereof
WO2009004315A1 (en) 2007-06-29 2009-01-08 King's College London Isolated peptides and uses thereof
WO2010026377A1 (en) * 2008-09-04 2010-03-11 Immunocore Ltd. Diabetes t cell receptors
US8088379B2 (en) 2006-09-26 2012-01-03 The United States Of America As Represented By The Department Of Health And Human Services Modified T cell receptors and related materials and methods
WO2012091564A2 (en) 2010-12-27 2012-07-05 Apo-T B.V. A cross-linking polypeptide that induces apoptosis
WO2012091563A1 (en) 2010-12-27 2012-07-05 Apo-T B.V. A polypeptide that binds aberrant cells and induces apoptosis
US8217144B2 (en) * 2005-06-01 2012-07-10 Immunocore Ltd. High affinity Melan-A T cell receptors
US8217009B2 (en) * 2006-06-20 2012-07-10 Helmholtz Zentrum Munchen Deutsches Forschungszentrum fur Gesundheit und Umwelt Allorestricted peptide-specific T cells
EP2894164A1 (en) 2006-07-05 2015-07-15 F-Star Biotechnologische Forschungs- und Entwicklungsges.m.b.H Method for engineering T-cell receptors
US9651559B2 (en) 2007-06-26 2017-05-16 F-star Biotechnologische Forschungs— und Entwicklungsges.m.b.H Display of binding agents
US9856311B2 (en) 2005-01-05 2018-01-02 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
US10125197B2 (en) 2008-05-02 2018-11-13 F-Star Biotechnologische Forschungs-Und Entwicklungsges.M.B.H Cytotoxic immunoglobulin
WO2020018715A1 (en) 2018-07-17 2020-01-23 Massachusetts Institute Of Technology Soluble multimeric immunoglobulin-scaffold based fusion proteins and uses thereof
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US11098115B2 (en) 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
US11827720B2 (en) 2006-07-05 2023-11-28 F-Star Therapeutics Limited Multivalent immunoglobulins

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8772451B2 (en) * 2003-11-10 2014-07-08 Altor Bioscience Corporation Soluble TCR molecules and methods of use
US20060122783A1 (en) * 2004-08-24 2006-06-08 Ishikawa Muriel Y System and method for heightening a humoral immune response
US20060047434A1 (en) * 2004-08-24 2006-03-02 Ishikawa Muriel Y System and method related to improving an immune system
US20060182742A1 (en) * 2004-08-24 2006-08-17 Ishikawa Muriel Y System and method for magnifying a humoral immune response
US20060047435A1 (en) * 2004-08-24 2006-03-02 Ishikawa Muriel Y System and method related to augmenting an immune system
US20060095211A1 (en) * 2003-12-05 2006-05-04 Searete Llc, A Limited Liability Corporation Of The State Of Delaware System and method for modulating a cell mediated immune response
US20060116824A1 (en) * 2004-12-01 2006-06-01 Ishikawa Muriel Y System and method for modulating a humoral immune response
US20060047433A1 (en) * 2004-08-24 2006-03-02 Ishikawa Muriel Y System and method related to enhancing an immune system
US20060047437A1 (en) * 2004-08-25 2006-03-02 Ishikawa Muriel Y System and method for heightening an immune response
US20060047436A1 (en) * 2004-08-25 2006-03-02 Ishikawa Muriel Y System and method for magnifying an immune response
US20060122784A1 (en) * 2004-12-03 2006-06-08 Ishikawa Muriel Y System and method for augmenting a humoral immune response
US20070196362A1 (en) * 2004-08-24 2007-08-23 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Computational methods and systems to bolster an immune response
US20060047439A1 (en) * 2004-08-24 2006-03-02 Searete Llc, A Limited Liability Corporation Of The State Of Delaware System and method for improving a humoral immune response
US20070265818A1 (en) * 2004-08-24 2007-11-15 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Computational methods and systems for heightening cell-mediated immune response
US20070207492A1 (en) * 2004-08-24 2007-09-06 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Computational methods and systems to adjust a humoral immune response
US20070198196A1 (en) * 2004-08-24 2007-08-23 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Computational systems and methods relating to ameliorating an immune system
US20070265819A1 (en) * 2004-08-24 2007-11-15 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Computational methods and systems for improving cell-mediated immune response
GB0427585D0 (en) * 2004-12-16 2005-01-19 Avidex Ltd Assay
CN106279404A (zh) * 2015-05-20 2017-01-04 广州市香雪制药股份有限公司 一种可溶且稳定的异质二聚tcr
US11453726B2 (en) * 2016-09-15 2022-09-27 Quadrucept Bio Limited Multimers, tetramers and octamers

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4625275A (en) * 1984-04-03 1986-11-25 Republic Money Orders, Inc. Apparatus for dispensing money orders
CA2250166A1 (en) * 1996-03-28 1997-10-02 The Johns Hopkins University Soluble divalent and multivalent heterodimeric analogs of proteins
US6211342B1 (en) * 1996-07-18 2001-04-03 Children's Hospital Medical Center Multivalent MHC complex peptide fusion protein complex for stimulating specific T cell function
AU6685698A (en) * 1997-03-07 1998-09-22 Sunol Molecular Corporation Fusion proteins comprising bacteriophage coat protein and a single-chain t cell receptor
WO1999060120A2 (en) * 1998-05-19 1999-11-25 Avidex Limited Soluble t cell receptor
ES2293748T3 (es) * 1998-10-21 2008-03-16 Altor Bioscience Corporation Moleculas de fijacion poliespecificas y usos de las mismas.
WO2001062908A2 (en) * 2000-02-22 2001-08-30 Ahuva Nissim Chimeric and tcr phage display libraries, chimeric and tcr reagents and methods of use thereof
EP2322228B1 (en) * 2000-06-05 2018-01-10 Altor BioScience Corporation T cell receptor fusion proteins and conjugates and methods of use thereof
US6811785B2 (en) * 2001-05-07 2004-11-02 Mount Sinai School Of Medicine Of New York University Multivalent MHC class II—peptide chimeras

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006037960A3 (en) * 2004-10-01 2006-08-03 Avidex Ltd T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
US10385118B2 (en) 2005-01-05 2019-08-20 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
US9856311B2 (en) 2005-01-05 2018-01-02 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
US8217144B2 (en) * 2005-06-01 2012-07-10 Immunocore Ltd. High affinity Melan-A T cell receptors
EP1969005A1 (en) * 2005-12-20 2008-09-17 Erasmus University Medical Center Rotterdam Apoptosis-inducing protein complexes and therapeutic use thereof
US20090208502A1 (en) * 2005-12-20 2009-08-20 Ralph Alexander Willemsen Apoptosis-inducing protein complexes and therapeutic use thereof
US8633020B2 (en) 2006-06-20 2014-01-21 Helmholtz Zentrum Munchen Deutsches Forschungszentrum fur Gesundheit und Umwelt Allorestricted peptide-specific T cells
US8217009B2 (en) * 2006-06-20 2012-07-10 Helmholtz Zentrum Munchen Deutsches Forschungszentrum fur Gesundheit und Umwelt Allorestricted peptide-specific T cells
US11827720B2 (en) 2006-07-05 2023-11-28 F-Star Therapeutics Limited Multivalent immunoglobulins
EP2894164A1 (en) 2006-07-05 2015-07-15 F-Star Biotechnologische Forschungs- und Entwicklungsges.m.b.H Method for engineering T-cell receptors
US9128080B2 (en) 2006-09-26 2015-09-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Modified T cell receptors and related materials and methods
US8088379B2 (en) 2006-09-26 2012-01-03 The United States Of America As Represented By The Department Of Health And Human Services Modified T cell receptors and related materials and methods
US9651559B2 (en) 2007-06-26 2017-05-16 F-star Biotechnologische Forschungs— und Entwicklungsges.m.b.H Display of binding agents
US8906383B2 (en) 2007-06-29 2014-12-09 King's College London T cell receptor having binding affinity for a peptide-MHC complex and uses thereof
WO2009004315A1 (en) 2007-06-29 2009-01-08 King's College London Isolated peptides and uses thereof
US10125197B2 (en) 2008-05-02 2018-11-13 F-Star Biotechnologische Forschungs-Und Entwicklungsges.M.B.H Cytotoxic immunoglobulin
WO2010026377A1 (en) * 2008-09-04 2010-03-11 Immunocore Ltd. Diabetes t cell receptors
US20180071398A1 (en) * 2010-12-27 2018-03-15 Apo-T B.V. Polypeptide that binds aberrant cells and induces apoptosis
US9821073B2 (en) 2010-12-27 2017-11-21 Apo-T B.V. Polypeptide that binds aberrant cells and induces apoptosis
WO2012091564A3 (en) * 2010-12-27 2012-08-23 Apo-T B.V. A cross linking polypeptide comprising an hexameric single chain antibody binding mhc-mage complex that induces apoptosis
US9512231B2 (en) 2010-12-27 2016-12-06 Apo-T B.V. Cross-linking polypeptide that induces apoptosis
WO2012091564A2 (en) 2010-12-27 2012-07-05 Apo-T B.V. A cross-linking polypeptide that induces apoptosis
EP3613773A1 (en) 2010-12-27 2020-02-26 Apo-T B.V. A cross linking polypeptide comprising an hexameric single chain antibody binding mhc-mage complex that induces apoptosis
EP3778642A1 (en) 2010-12-27 2021-02-17 Apo-T B.V. A polypeptide that binds aberrant cells and induces apoptosis
WO2012091563A1 (en) 2010-12-27 2012-07-05 Apo-T B.V. A polypeptide that binds aberrant cells and induces apoptosis
US11098115B2 (en) 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
WO2020018715A1 (en) 2018-07-17 2020-01-23 Massachusetts Institute Of Technology Soluble multimeric immunoglobulin-scaffold based fusion proteins and uses thereof

Also Published As

Publication number Publication date
US20060135418A1 (en) 2006-06-22
AU2003286263A1 (en) 2004-06-23
AU2003286263A8 (en) 2004-06-23
EP1567553A2 (en) 2005-08-31
WO2004050705A3 (en) 2004-11-25
JP2006523437A (ja) 2006-10-19

Similar Documents

Publication Publication Date Title
US20060135418A1 (en) Receptors
EP1885754B1 (en) T cell receptors which specifically bind to vygfvracl-hla-a24
US7666604B2 (en) Modified soluble T cell receptor
US20210061878A1 (en) High affinity ny-eso t cell receptors
US8217144B2 (en) High affinity Melan-A T cell receptors
US7569664B2 (en) Single chain recombinant T cell receptors
JP5885220B2 (ja) 高親和性hivt細胞レセプター
US8017730B2 (en) T cell receptors which specifically bind to VYGFVRACL-HLA-A24
EP1758935B1 (en) High affinity telomerase t cell receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003777006

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004570696

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2003777006

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006135418

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10535965

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10535965

Country of ref document: US