WO2004048412A2 - Procede de production d'anticorps agissant contre un antigene cible, avec utilisation d'animaux preselectionnes pour l'immunisation - Google Patents

Procede de production d'anticorps agissant contre un antigene cible, avec utilisation d'animaux preselectionnes pour l'immunisation Download PDF

Info

Publication number
WO2004048412A2
WO2004048412A2 PCT/EP2003/013315 EP0313315W WO2004048412A2 WO 2004048412 A2 WO2004048412 A2 WO 2004048412A2 EP 0313315 W EP0313315 W EP 0313315W WO 2004048412 A2 WO2004048412 A2 WO 2004048412A2
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
antibody
antibodies
peptide
animal
Prior art date
Application number
PCT/EP2003/013315
Other languages
English (en)
Other versions
WO2004048412A3 (fr
Inventor
Karin Ballas
Original Assignee
Antarus Lifescience Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Antarus Lifescience Gmbh filed Critical Antarus Lifescience Gmbh
Priority to AU2003292127A priority Critical patent/AU2003292127A1/en
Publication of WO2004048412A2 publication Critical patent/WO2004048412A2/fr
Publication of WO2004048412A3 publication Critical patent/WO2004048412A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies

Definitions

  • the present invention relates to a method of producing antibodies. More particularly, the present invention relates to a method of producing antibodies by injecting a sample of an antigen into a preselected animal having an allele of the DRB MHC II locus which is compatible with the amino acid sequence of the antigen used for immunization. Said antibodies are useful, e.g., for detecting the presence of, or for treating and/or preventing a disease or condition.
  • Antibodies are proteins produced by the vertebrate immune system as a defense against infection. They are produced by the host plasma cells in response to foreign molecules, each with a different binding site that recognizes the respective target molecule or antigen. The precise antigen specificity of antibodies makes them powerful tools for the biologist. They can be labeled with fluorescent dyes and used to detect and quantify specific proteins on cell surfaces or within the cell or to identify proteins in cell extracts separated in polyacrylamide gels .
  • the antibody molecule has two clearly separated functions. One is to bind the antigen and the other to bind to specialized cells or proteins of the immune system. These functions are structurally separated within the molecule.
  • the antigen binding region is highly variable from antibody to antibody due to the great number of structurally different antigens.
  • the region responsible for the effector mechanisms of the immune system does not show the same amount of variations and is therefore called the constant region of the antibody.
  • Polyclonal antibodies are produced by injecting a sample of an antigen into animals such as mice, rabbits or goats and then isolating the serum. These antisera contain heterogeneous mixtures of antibodies each produced by a different antibody- secreting cell.
  • MHC major histocompatibility complex
  • T cells For generating an immune response, MHC (major histocompatibility complex) molecules on the cell surface present peptide antigens to T cells. MHC molecules are classified as either class I or class II molecules. Class I MHC complexes are expressed on almost all nucleated cells and are recognized by cytotoxic T-lymphocytes . These cytotoxic T- lymphocytes recognize the antigen presented in form of a peptide either processed from the foreign protein by the cell or synthesized with allele specific binding motifs. Class II MHC complexes are expressed primarily on cells involved in initiating and sustaining immune response, such as B- lymphocytes, macrophages etc.. These complexes are recognized by T-helper lymphocytes.
  • antigenic peptides are either derived from exogenous proteins, which are processed into peptide fragments, or can be synthesized and injected into the animal to raise an antibody against a specific protein.
  • the length of the peptides bound to class II molecules is longer and more heterogeneous in size. The lengths vary from 13 to 25 amino acids.
  • the mechanism by which MHC class II molecules form tightly bound complexes with peptides of diverse sequences is likely to have two components (Brown, et al. (1993), Nature 368 : 33-39; Stern et al. (1994), Nature 364 : 215-221) .
  • MHC pocket interactions with specific side chains of the peptides (Hammer, et al. (1993), Cell 74 : 197-203/ Sette et al. (1993) J. Immunol. 151 : 3163-3170; Jardetzky et al . (1990) EMBO J. 9 : 1797-1803) .
  • Most of the MHC pockets are able to accommodate a number of different side chains, reducing the restrictions placed on the binding of a combinatorial set of peptide sequences.
  • the other component to peptide binding involves conserved MHC residue interactions with the peptide main chain, providing a set of interactions that are independent of the peptide ariS the MHC polymorphism. These interactions may underlie the conserved functional aspects of MHC peptide binding, such as the observed slow dissociation rates of bound peptides .
  • the MHC class II molecules itself are cell surface glycoproteins consisting of a constant chain and a highly variable ⁇ chain.
  • the human MHC class II system has three antigens designated DP, DQ and DR, where especially the DR antigen shows an extensive polymorphism in its ⁇ chain due to the wide variety of peptides to be presented.
  • DP human MHC class II system
  • DQ two expressed class II complexes
  • DR two expressed class II complexes
  • the structure of the MHC class II complexes in goats is thought to be similar to cattle, but there have been only a few reports about the DNA sequences of DRA and DRB goat genes with a high level of polymorphism in the DRB gene. Up to 22 alleles have been described in different breeds of goats. (A ills et al. (1995), Vet. Immunol. Immunopathol . 48 : 313-321; Takada et al. (1998), Immunogenetics 48 : 408-412)
  • Antibodies to small peptides have become essential tools in life science research with many applications including the detection and identification of gene products, diagnostic tests and protein localization. Despite careful selections of the appropriate peptide sequences it is still necessary to immunize multiple animals in order to generate successfully the respective antibodies. In other words, the generation of the desired antibody is a time (and money) consuming and laborious process .
  • the present invention is based on the unexpected finding that methods of producing a desired antibody can be improved by genotyping the animals, e.g., goats before injecting them with a peptide. Genotyping the animals allows to identify suitable breeds with a particular polymorphism of the DRB allele and to select the animal with an allele, compatible to the respective peptide, prior to injection. By reducing primarily the number of animals, which need to be immunized in order to generate the antibody, this procedure greatly saves time and money.
  • a method for preparing a polyclonal antibody having a desired specificity comprising the following steps:
  • step (b) selecting (an) animal (s) having a DRB allele which is compatible to the antigen of the following step (c) ;
  • the invention relates to a method for preparing a monoclonal antibody having a desired specificity, said method comprising steps (a) to (c) of the method described above and, in addition:
  • the non-human animal is a goat.
  • step (c) of the method of the invention an antigen is selected capable of raising antibodies that recognize the protein in its native state.
  • step (d) of the method of the invention said antigen-specific antibodies are purified by immunoaffinity.
  • step (a) of the method of the invention said animals are selected by determining the allele of exon 2 of the ⁇ l domain of the DRB locus.
  • determination of said allele is carried out by PCR.
  • affini ty is meant the strength of the interaction between an individual antigen binding site and an antigen-binding molecule and its corresponding site an the antigen.
  • antibody is meant a protein of the immunoglobulin family that is capable of combining, interacting or otherwise associating with an antigen.
  • antigen is used herein in its broadest sense to refer to a substance that is capable of reacting in and/or inducing an immune response. Typically, but not necessarily, antigens are foreign to the host animal in which they produce immune reactions.
  • antigen-binding molecule any molecule that has binding affinity for a target antigen. It will be understood that this term extends to immunoglobulins (e.g., polyclonal or monoclonal antibodies) , immunoglobulin fragments and non- immunoglobulin derived protein frameworks that exhibit antigen- binding activity.
  • antigenic molecule against which a particular immune response is directed.
  • antigens present several or even many antigenic determinants simultaneously.
  • biological sampl e refers to a sample that may be extracted, untreated, treated, diluted or concentrated from an animal.
  • carrier is meant any substance of typically high molecular weight to which a non- or poorly immunogenic substance (e.g., a hapten) is naturally or artificially linked to enhance its immunogenicity.
  • a non- or poorly immunogenic substance e.g., a hapten
  • diagnosis is used herein in its broadest sense to include detection of an antigen reactive to a sub- i munoglobulin antigen-binding molecule. Also included within its scope, is the analysis of disorder mechanisms associated with ocular disorders. Accordingly, the term “diagnosis” includes the use of monoclonal antibodies for research purposes as tools to detect and understand mechanisms associated with a disease or condition of interest.
  • immunogenici ty is used herein in its broadest sense to include the property of evoking an immune response within an organism. Inmunogenicity typically depends partly upon the size of the substance in question, and partly upon how unlike host molecules it is. It is generally considered that highly conserved proteins tend to have rather low immunogenicity.
  • patient refers to patients of human or other animal origin and includes any individual it is desired to examine or treat using the methods of the invention. However, it will be understood that “patient” does not imply that symptoms are present.
  • Suitable mammals that fall within the scope of the invention include, but are not restricted to, primates, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), laboratory test animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs) and captive wild animals (e.g., foxes, deer, dingoes).
  • pharmaceutically acceptable carrier is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration.
  • related disease or condi tion is used herein to refer to a disease or condition that is related anatomically, physiologically, pathologically and/or symptomatically to a reference disease or condition.
  • diseases or conditions may be related to one another by affecting similar anatomical locations (e.g., affecting the same organ or body part), affecting different organs or body parts with similar physiological function (e.g., the- oesophagus, duodenum and colon which rely an peristalsis to move food from one end of the alimentary canal to the other) , by having similar or overlapping pathologies (e.g., tissue damage or rupture, apoptosis, necrosis) or by having similar or overlapping symptoms (i.e., allergic response, inflammation, lymphocytosis) .
  • an antigen associated with ulcerated colitis may also be associated with perforation of the colon because these disease affects the same organ (i.e., colon) .
  • target antigen an antigen that is associated with a disease or condition for which treatment or diagnosis is sought.
  • treating is used herein in its broadest sense to include both therapeutic and prophylactic (i.e., preventative) treatment designed to ameliorate the disease or condition.
  • the present invention relates to a method for preparing a polyclonal antibody having a desired specificity, said method comprising the following steps:
  • step (b) selecting animals having a DRB allele which is compatible to the antigen of the following step (c) ;
  • the antibody having a desired specificity is directed against an antigen of interest.
  • the antigen is a biologically important protein or a sequence derived from such a protein, EST (expressed sequence tags) or ORESTES (open reading frame ESTs) (Leerkes et al. (2002), Genomics 79 : 257- 265) .
  • EST expressed sequence tags
  • ORESTES open reading frame ESTs
  • the detection of this protein with the antibody or application of the antibody to a mammal suffering from a disease or disorder can result in a therapeutic benefit in that mammal. It may be a transmembrane molecule (e.g. receptor), surface membrane protein, regulatory protein, tumor associated protein or ligand such as a growth factor.
  • Exemplary antigens include proteins such as a member of the G-protein coupled receptor superfamily (Carmeci et al. (1997), Genomics 45: 607- 617); a phosphatidylinositol synthase (Imoto et al . (1994), Exp. Cell Res. 222:151-154) ; an interleukin-1 receptor associated kinase 1; keratin 18 (Schaller et al. (1996), Clin. Cancer Res. 2 : 1879-1885); a fatty acid synthase (Oskouian (2000), Cancer Lett. 149 : 43-51); a DNA-dependent protein kinase (Zhao et al. (2000), Clin. Cancer Res.
  • proteins such as a member of the G-protein coupled receptor superfamily (Carmeci et al. (1997), Genomics 45: 607- 617); a phosphatidylinositol synthase (Imoto et al
  • TGF ⁇ l protein phosphatase 1G
  • protein phosphatase 1G protein phosphatase 1G
  • antigens are selected to raise antibodies that, preferably, will recognize the protein of interest in its native state.
  • Anti-peptide antibodies will always recognize the peptide, provided the sequence is not buried in the interior of the protein by folding.
  • Sequence epitopes in proteins generally consist of 6-12 amino acids and can be classified as continuous and discontinuous.
  • Continuous epitopes are composed of a contiguous sequence of amino acids in the protein. Anti-peptide antibodies will bind to these epitopes if they are on the surface of the protein. Discontinuous epitopes consist of a group of amino acids that are brought together by folding of the polypeptide chain or by the juxtaposition of two separate polypeptide chains. Anti-peptide antibodies can only recognize this class of epitopes if the peptide used for antibody generation has a secondary structure similar to this epitope or if the protein epitope has enough continuous sequence for the antibody to bind with a lower affinity. Therefore the sequences of the antigenic peptides have to be from the surface-oriented, hydrophilic part of the polypeptide chain. Often the C-termini or N-termini of the proteins are a good choice for generating antibodies against the intact protein, because they are often exposed and have a high degree of flexibility.
  • Algorithms for predicting protein structures such as hydrophilicity/hydrophobicity and secondary structure regions such as ⁇ -helix, ⁇ -sheet and ⁇ -turn that help selecting a potential sequence for the peptide are well known to the person skilled in the art.
  • Hydrophilic plots as described by Hopp and Woods (Hopp and Woods (1981), Proc. Natl. Acad. Sci. USA 78: 3824-3828) assign an average hydrophilicity value for each residue in the sequence.
  • the highest point of average hydrophilicity for a series of contiguous amino acids is usually at or close by an antigenic determinant.
  • Kyte and Doolittle ((1982), J. Mol. Biol. 157: 105-132) describe a slightly different algorithm.
  • the length of the peptide should be between 10 and 20 amino acids. Peptides of these lengths ensure that the peptides are still soluble in aqueous solutions, e.g. for conjugation with the carrier protein. Because any peptide selected must be synthesized chemically (The chemical synthesis of peptides, Jones, J., Clarendon Press (1991), Oxford), peptides with 10-20 residues can be obtained in high purity with minimal synthesis and purification problems .
  • Conjugation to a carrier is important because peptides are small molecules, which alone do not tend to be immunogenic, and therefore eliciting only a weak immune response.
  • the carrier protein contains many epitopes that stimulate T-helper cells, which help to induce the B-cell response.
  • Many different carrier proteins can be used for coupling to synthetic peptides. The most commonly selected carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA) . The higher immunogenicity of KLH often makes it the preferred choice. Coupling methods are used to link the synthetic peptide to a carrier protein, i.e. KLH.
  • N-terminal sequences should be coupled through the C-terminal amino acids and vice versa, internal sequences can be coupled at either end.
  • the peptides are activated with carbodiimide and mixed with the carrier protein (KLH) to produce the final conjugate.
  • Carbodiimides can activate the side chain carboxylic groups of aspartic and glutamic acid or the carboxyl terminal group to make them the reactive sites for the coupling with primary amines.
  • An alternative method is the coupling with the m-Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) and the thiol group of cysteine residue, preferable positioned on either end of the peptide.
  • MBS m-Maleimidobenzoyl-N-hydroxysuccinimide ester
  • Polyclonal antibodies are preferable raised in a non-human animal genetically different from the source of antigen, preferably in a goat. Immunization and subsequent production of antibodies can be carried out using standard protocols as for example described by Kohler and Milstein, 1976, Eur. J. Immunol . 6 (7) : 511-519) or by more recent modifications thereof as described, for example, in Coligan et al . (Current Protocols in Immunology,. John Wiley & Sons, Inc, 1991-1997) and in Toyama et al . ("Monoclonal Antibody, Experiment Manual", published by Kodansha Scientific, 1987) .
  • the injections are performed subcutaneously on multiple sites with the relevant peptide-conjugate and a adjuvant.
  • the antigen is combined with an adjuvant to improve the immune response by allowing a slow release of the antigen for continual stimulation.
  • an adjuvant such as "TiterMax” (CytRx Corporation, Los Angeles, CA, USA) is a good alternative to the use of complete Freund"s adjuvant in goat, arising comparable titers of antibody but without having the severe side effects for the health of the animals (Bennett et al. (1992), J. Immun. Methods 153: 31-40).
  • Another advantage is the need of only one boost injection at day 28.
  • a test bleed can be drawn to determine the quality of the immunization with an antibody titration, e.g., by ELISA.
  • an antibody titration e.g., by ELISA.
  • the production bleed will be performed at day 90.
  • the cellular immune response depends on antigen presentation to T-cells by the MHC molecules, the antigen presented being small peptides with amino acid limitations determined by the MHC alleles carried by particular individuals. In the study of the immune response it is of critical importance to take into consideration the laws governing which peptide can be presented by which MHC alleles. Each MHC allele exhibits a predilection for a set of peptides with distinct sequence characteristics.
  • the MHC genetic polymorphism is responsible for the differences between MHC molecules (Falk et al. (1993), Nature 351 : 290-296; Rammensee et al. (1995), Curr. Opin. Immunol. 7: 85-96).
  • MHC class II genes the polymorphism occurs primarily in limited short stretches of sequences which have been designated hypervariable regions. All of these sequences are in the ⁇ l domain and they are, almost without exception, amino acids which line the peptide binding groove of the class II MHC molecule, either on the floor or in the helical sides of the groove (Brown et al. (1993), Nature 364 : 33-39). In the ruminant species most information today is available for the MHC system of cattle. In goats the ⁇ l domain exon of the DRB locus is the most polymorphic domain of the MHC class II molecule (Takeda et al.
  • non-human animals preferably goats
  • compatible refers to the overall ability of a particular peptide to bind to a particular MHC. This binding ability can be calculated from the weighted sum of the pocket preferences for the amino acid residues of the potential binding peptide (Sturniolo et al . (1999), Nat. Biotechnol. 17:555-561; Kwok et al. (2001), Trends Immunol. 22:583-588.
  • the person skilled in the art can easily determine which kind of allele of the animal is most compatible with the antigen used according to standard procedures, e.g. the procedures described in the literature described above.
  • genotyping of the goats is conducted on the basis of the highly polymorphic ⁇ l domain of an MHC class II molecule.
  • DNA can be isolated from blood, drawn from the jugular vein of the goat, and, in a preferred embodiment of the method of the present invention, a PCR (polymerase chain reaction) is performed by amplifying the polymorphic region of
  • MHC exon 2 e.g., with biotinylated oligonucleotide primers.
  • both primers are derived from the homologous part of the exon 2 mRNA sequence.
  • the PCR reactions can be monitored by an agarose gel separation, the DNA can be subsequently denatured and diluted.
  • oligonucleotides can be synthesized and coupled on their 5 '-ends with a fluorescence label (e.g., FITC, fluorescein isothiocyanate) .
  • FITC fluorescein isothiocyanate
  • the biotinylated product will bind to the streptavidin surface of the microtiter plate, but only the bound FITC-labeled oligonucleotides can be detected by a signal detection procedure (i.e. anti-FITC horseradish peroxidase and substrate) . This procedure allows one to determine the DRB allele of the goat directly by detecting the double stranded
  • PCR product/oligonucleotide complexes via the fluorescence label of the bound oligonucleotide.
  • the PCR product will be sequenced and added to the procedure described above.
  • the nature and sequence of the alleles discussed above for genotyping can be determined by use of other suitable methods known to those skilled in the art.
  • the invention relates to a method for preparing a monoclonal antibody having a desired specificity, said method comprising steps (a) to (c) of the method described above and, in addition:
  • antibody-producing cells are removed from the animal immunized as described above for immortalisation.
  • Immortalisation of antibody-producing cells may be carried out using methods which are well-known in the art.
  • the immortalisation may be achieved by the transformation method using Epstein-Barr virus (EBV) (Kozbor et al . , 1986, Methods in Enzymology 121 : 140) .
  • EBV Epstein-Barr virus
  • antibody-producing cells are immortalized using the cell fusion method (described by Coligan et al . supra) , which is widely employed for the production of monoclonal antibodies.
  • somatic antibody- producing cells with the potential to produce antibodies, particularly B cells, are fused with a myeloma cell line.
  • somatic cells may be derived from the lymph nodes, spleens and peripheral blood of primed animals .
  • myeloma cell lines have been developed from lymphocytic tumors for use in hybridoma-producing fusion procedures (Kohler and Milstein, 1976, supra ; 30 Shulman et al., 1978, Na ture 276 : 269-270; Volk et al., 1982, J. Virol. 42 (1 ) : 220-227) .
  • Many myeloma cell lines may be used for the production of fused cell hybrids, including, e.g., P3X63-Ag8, P3X63-AG8.653, P3/NSl-Ag4-l (NS-1) , Sp2/0-Agl4 and S194/5.XXO.BU.1.
  • the P3X63-Ag8 and NS-1 cell lines have been described by Kohler and Milstein (1976, supra) .
  • Shulman et al . (1978, supra) developed the Sp2/0-Agl4 myeloma line.
  • the 5194/5. XXO. Bu.1 line was reported by Trowbridge (1978, J. Exp. Med. 1 48 (1 ) : 313-323) .
  • Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually involve mixing somatic cells with myeloma cells in a 10:1 proportion (although the proportion may vary from about 20:1 to about 1:1), respectively, in. the presence of an agent or agents (chemical, viral or electrical) that promotes the fusion of cell membranes. Fusion methods have been described by Kohler and Milstein, supra, Gefter et al . (1977, Somatic Cell Genet . 3 : 231-236), and Volk et al . (1982, supra). The • fusion-promoting agents used by those investigators were Sendai virus and polyethylene glycol (PEG) .
  • PEG polyethylene glycol
  • fusion procedures produce viable hybrids at very low frequency (e.g., when spleens are used as a source of somatic cells, only one hybrid is obtained for roughly every lxlO 5 spleen cells), it is preferable to have a means of selecting the fused cell hybrids from the remaining unfused cells, particularly the unfused myeloma cells.
  • a means of detecting the desired antibody-producing hybridomas among other resulting fused cell hybrids is also necessary.
  • the selection of fused cell hybrids is accomplished by culturing the cells in media that support the growth of hybridomas but prevent the growth of the unfused myeloma cells, which normally would go an dividing indefinitely.
  • the somatic cells used in the fusion do not maintain long-term viability in in vi tro culture and hence do not pose a problem.
  • myeloma cells lacking hypoxanthine phosphoribosyl transferase HPRT-negative
  • HPRT-negative hypoxanthine phosphoribosyl transferase
  • Selection against these cells is made in hypoxanthine/aminopterin/thymidine (HAT) medium, a medium in which the fused cell hybrids survive due to the HPRT-positive genotype of the spleen cells.
  • HAT hypoxanthine/aminopterin/thymidine
  • the use of myeloma cells with different genetic deficiencies (drug sensitivities, etc.) that can be selected against in media supporting the growth of genotypically competent hybrids is also possible.
  • each cell line may be propagated in either of two standard ways.
  • a suspension of the hybridoma cells can be injected into a histocompatible animal. The injected animal will then develop tumors that secrete the specific monoclonal antibody produced by the fused cell hybrid.
  • the body fluids of the animal such as serum or ascites fluid, can be tapped to provide monoclonal antibodies in high concentration.
  • the individual cell lines may be propagated in vi tro in laboratory culture vessels.
  • the culture medium containing high concentrations of a single specific monoclonal antibody can be harvested by decantation, filtration or centrifugation, and subsequently purified.
  • the present invention also contemplates the use and generation of fragments of monoclonal antibodies produced by the method of the invention including, for example, Fv, Fab, Fab' and F(ab')2 fragments.
  • fragments may be prepared by standard methods as for example described by Coligan et al . , (supra) .
  • Antibodies obtained by a method of the invention are useful, e.g., for diagnosing a disease or condition in a patient, which disease or condition is associated with an aberrant concentration of an antigen, e.g. an antigen predominantly present • in tumor tissue, that is immuno-interactive with an antibody of the invention.
  • This approach comprises contacting a biological sample obtained from the patient with a (monoclonal) antibody or analogue thereof, measuring the concentration of a complex comprising the antigen and the (monoclonal) antibody, or analogue, in said contacted sample, and relating the measured complex concentration to the concentration of antigen in said sample, wherein the presence of said aberrant concentration is indicative of said disease or condition.
  • an antigen-binding molecule according to the invention having a reporter molecule associated therewith may be utilized in i munoassays .
  • immunoassays include, but are not limited to, radioimmunoassays (RIAs) , enzyme-linked immunosorbent assays (ELISAs) and immunochromatographic techniques (ICTs) , Western blotting which are well known those of skill in the art.
  • RIAs radioimmunoassays
  • ELISAs enzyme-linked immunosorbent assays
  • ICTs immunochromatographic techniques
  • the present invention encompasses qualitative and quantitative immunoassays. Suitable immunoassay techniques are described for example in U.S. Patent Nos. 4,016,043, 4, 424,279 and 4,018,653. These include both single-site and two-site assays of the non-competitive types, as well as the traditional competitive binding assays. These assays also include direct binding of a labeled antigen-binding molecule to a target antigen.
  • An antibody obtained by a method of the present invention is also useful, e.g., for treating or preventing a disease or condition associated with an antigen, comprising an antibody, preferably a monoclonal antibody, that is immuno-interactive with the antigen or with analogue thereof, together with a pharmaceutically acceptable carrier.
  • said composition further comprises an adjuvant.
  • therapeutic agents may be formulated and administered systemically or locally.
  • Techniques for formulation and administration may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition. Suitable routes may, for example, include oral, rectal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.
  • the therapeutic agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art.
  • Intramuscular and subcutaneous injection is appropriate, for example, for administration of i munogenic compositions, vaccines and DNA vaccines.
  • the agents can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration.
  • Such carriers enable the compounds of the invention to be formulated in dosage forms such as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • These carriers may be selected from sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulphate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline, and pyrogen-free water.
  • Example is intended to illustrate, but not to limit the invention. While such an Example is typical of those that might be used, other methods known to those skilled in the art may alternatively be utilized.
  • SLSFLQDIQEVQGYV a 15 amino acid long peptide of the tumor antigen HER2/neu
  • the peptide has been chosen from the complete protein sequence because this peptide sequence yielded the highest score with the SYFPEITHI database for a human MHC class II complex, in this case: HLA-DRB1*0401.
  • the protein sequence of its binding pocket is comparable to the capra aegagrus Caae-DRB 13 gene.
  • a goat carrying this allele is the best choice for immunization with this peptide.
  • the automatic peptide synthesis is started from a special resin (Bachem, Bubendorf, Switzerland) on which the whole peptide sequence is synthesized sequentially by stepwise addition of the different amino acids (linear synthesis) .
  • the growing peptide chain stays fixed to the resin until the end of the synthesis.
  • Each single amino acid addition consists of three individual reaction steps: deprotection, activation, and coupling.
  • Fmoc-chemistry the alpha amino protection consists of a 9-Fluorenylmethyloxycarbonyl group.
  • this protecting group is that it can be cleaved under relatively mild basic conditions (piperidine) , so that the side chain protections and the resin linkage can be chosen to be cleavable under again mild, but acid (trifluoroacetic acid) conditions.
  • the analytical HPLC analysis allows to evaluate the purity of the peptide.
  • the identity of the peptide is checked with a MALDI-TOF mass spectrometer (MALDI-TOF: Matrix Assisted Laser Desorption Ionisation - Time Of Flight) , which gives the molecular mass of the obtained peptide.
  • MALDI-TOF Matrix Assisted Laser Desorption Ionisation - Time Of Flight
  • the EDC (l-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride) or carbodiimide method is used for coupling of the peptide to the carrier protein (KLH) .
  • Carbodiimides can activate the side chain carboxylic groups of aspartic and gluta ic acid as well as the carboxyl terminal group to make them reactive sites for coupling with primary amines.
  • the peptides are mixed with the EDC activated carrier protein to produce the final conjugate. Because the yield of the coupling reaction with carbodiimide is only about 50%, 10 mg of peptide have to be used in the reaction mix to obtain 5 mg carrier coupled peptide.
  • RNAfree genomic DNA of the samples is isolated with the Qiagen QIAamp DNA Blood midi kit (Quiagen, Hilden, Germany) according to the protocol of the manufacturer.
  • the yield obtained is between 10-50 ⁇ g DNA.
  • a 298 bp fragment of the exon 2 of the goat MHC DRB antigen is amplified with Taq-DNA polymerase from 500 ng genomic DNA with 5 '-biotinylated oligonucleotides.
  • Forward primer biotin- AGATCCAACCACATTTCCTGGAG
  • reverse primer biotin- CACAGTCACTGCAGGCTCCAC, in a semi-nested PCR protocol.
  • samples of the amplification products are run on a 2% agarose gel.
  • the biotin-labeled amplification products (100 ⁇ l) are denatured with an equal volume of 0.1 M NaOH, neutralized with 100 ⁇ l 0.1 M HC1 and diluted with 900 ⁇ l H 2 0.
  • 50 ⁇ l of PCR product and 10 pmol of the allele-specific oligonucleotide are incubated at 45°C for 45 min.
  • the allele-specific oligonucleotides have lengths around 12-18 nucleotides and were 5 '-labelled with FITC, e.g.
  • FITC-GCCGGCAGACCGCC nucleotides 248 - 261; GenBank, acc.no. AB008350
  • the plate is then washed at room temperature and finally with a specific wash step at 45°C.
  • the FITC-labeled oligonucleotides, bound to the respective PCR product, are visualized at 450 nm by the reaction of anti-FITC horseradish peroxidase and its substrate.
  • SLSFLQDIQEVQGYV a goat carrying an allele with a MHC pocket able to bind and present this peptide sequence is selected and used for immunization.
  • a high score, i.e., efficient binding of the peptide can be obtained for the human MHC class II gene DRB1*0401.
  • This allele has an uncharged, nonpolar amino acid of the hydrophobic pocket PI at position 86 (V) and polar amino acids of the P4 pocket at positions 70 and 71 (Q and R) .
  • a caprine MHC class II gene with a comparable amino acid sequence is, e.g., the capra hircus DRB*18 gene of the MHC class II DRB ⁇ l domain (pos.86: V, pos.70: S, pos.71: R) .
  • a goat carrying this gene would be the first choice for immunization.
  • the KLH conjugates are dissolved in PBS (phosphate buffer saline) at a concentration of 1 mg/ml . Most conjugates are readily soluble. Sometimes a higher salt concentration (0.9 M NaCl) is recommended for the maximum solubility of KLH coupled peptides.
  • the goats are tagged with an earmark and injected subcutaneously on multiple sites on their backs with the peptide-KLH conjugate and the adjuvant, total: 500 ⁇ g conjugate in PBS/500 ⁇ l adjuvant, PBS:TiterMax (1:2; v/v) .
  • one boost injection with 125 ⁇ g conjugate in PBS /500 ⁇ l TiterMax, (1:2; v/v) is applied subcutaneously on multiple sites on the back of the goat.
  • test bleeds with 5 ml sera are drawn to determine the quality of the immunization with an antibody titration by ELISA.
  • the production bleed is performed at day 90, taking 2x 450 ml of blood from the anaesthetized goat.
  • the blood from the production bleed is centrifuged at 2000 x g, 4°C to remove any particulates and contaminating red blood cells. After concentrating the serum in a centricon device it is diluted 1:2 with binding buffer (20mM sodium phosphate, 0.15M NaCl, pH 7.4) .
  • peptide antigen is bound covalently to a solid support (sepharose) .
  • a solid support solid support
  • the conjugation of the peptide to the sepharose affinity matrix is achieved through NH 2 linkage through NHS (N-hydroxy-succinimide) activated resins.
  • a basic coupling procedure using a NHS activated sepharose column includes the solubilisation of the antigen in the coupling buffer to the desired concentration: 5-10 mg/ml of ligands containing primary amino groups in one column..volume . After an incubation time of 30-60 min, the column is washed with high and low pH buffers and equilibrated with binding buffer.
  • the diluted serum is applied to the affinity column at a flow rate of 0.25-1 ml/min.
  • the absorbency at 280 nm is measured, unbound material is collected and retained for testing.
  • Acid elution is the most commonly employed desorption method. Glycine-HCl buffer (pH 3) is used to disrupt the antigen- antibody interactions. The pH of the elution buffer is stepwise decreased until no detectable material is removed from the column. All fractions are neutralized immediately after collection and the purity of the eluated antibody is analyzed on SDS-PAGE (Sodium dodecylsulfate polyacrylamide gel electrophoresis) . The appropriate fractions of the antibody are concentrated to 2-5 mg/ml and stored in aliquots at -80°C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne un procédé de production d'anticorps qui agissent contre un antigène cible, par immunisation d'un animal présélectionné porteur d'un allèle du locus DRB MHC II compatible avec la séquence d'acides aminés de l'antigène intervenant dans le processus d'immunisation.
PCT/EP2003/013315 2002-11-26 2003-11-26 Procede de production d'anticorps agissant contre un antigene cible, avec utilisation d'animaux preselectionnes pour l'immunisation WO2004048412A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003292127A AU2003292127A1 (en) 2002-11-26 2003-11-26 Method for the generation of antibodies against a desired antigen using preselected animals for immunization

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US42890202P 2002-11-26 2002-11-26
US60/428,902 2002-11-26

Publications (2)

Publication Number Publication Date
WO2004048412A2 true WO2004048412A2 (fr) 2004-06-10
WO2004048412A3 WO2004048412A3 (fr) 2004-11-04

Family

ID=32393480

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/013315 WO2004048412A2 (fr) 2002-11-26 2003-11-26 Procede de production d'anticorps agissant contre un antigene cible, avec utilisation d'animaux preselectionnes pour l'immunisation

Country Status (2)

Country Link
AU (1) AU2003292127A1 (fr)
WO (1) WO2004048412A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1020533A1 (fr) * 1997-02-17 2000-07-19 Riken Procede de determination de la possibilite de survenue de la leucemie du mouton
WO2001041787A1 (fr) * 1999-12-10 2001-06-14 Epimmune Inc. Induction de reponses immunes cellulaires a her2/neu a l'aide de compositions renfermant des peptides et des acides nucleiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1020533A1 (fr) * 1997-02-17 2000-07-19 Riken Procede de determination de la possibilite de survenue de la leucemie du mouton
WO2001041787A1 (fr) * 1999-12-10 2001-06-14 Epimmune Inc. Induction de reponses immunes cellulaires a her2/neu a l'aide de compositions renfermant des peptides et des acides nucleiques

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BRUNSBERG ULRICA ET AL: "Structure and organization of pig MHC class II DRB genes: Evidence for genetic exchange between loci" IMMUNOGENETICS, SPRINGER VERLAG, BERLIN, DE, vol. 44, no. 1, 1996, pages 1-8, XP002188283 ISSN: 0093-7711 *
HILTBOLD E M ET AL: "The mechanism of unresponsiveness to circulating tumor antigen MUC1 is a block in intracellular sorting and processing by dendritic cells." JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 1 OCT 2000, vol. 165, no. 7, 1 October 2000 (2000-10-01), pages 3730-3741, XP002293864 ISSN: 0022-1767 *
SALAZAR LUPE G ET AL: "Immunization of cancer patients with HER-2/neu-derived peptides demonstrating high-affinity binding to multiple class II alleles." CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. 15 NOV 2003, vol. 9, no. 15, 15 November 2003 (2003-11-15), pages 5559-5565, XP002293866 ISSN: 1078-0432 *
SOTIRIADOU R ET AL: "Peptide HER2(776-788) represents a naturally processed broad MHC class II-restricted T cell epitope." BRITISH JOURNAL OF CANCER. 16 NOV 2001, vol. 85, no. 10, 16 November 2001 (2001-11-16), pages 1527-1534, XP002293865 ISSN: 0007-0920 *
TAKADA T ET AL: "ANALYSIS OF GOAT MHC CLASS II DRA AND DRB GENES: IDENTIFICATION OF THE EXPRESSED GENE AND NEW DRB ALLELES" TRENDS IN GENETICS, ELSEVIER, AMSTERDAM, NL, vol. 48, no. 6, 1998, pages 408-412, XP001145630 ISSN: 0168-9525 cited in the application *

Also Published As

Publication number Publication date
WO2004048412A3 (fr) 2004-11-04
AU2003292127A1 (en) 2004-06-18

Similar Documents

Publication Publication Date Title
EP0453560B1 (fr) Localisation et caracterisation du gene tumoral de wilms
US4837306A (en) Method for selecting hybridomas producing antibodies specific to the P-glycoprotein cell suface antigen and a cDNA clone encoding the C-terminal portion of the antigen
CA1265649A (fr) Anticorps peptidiques et leur utilisation dans la detection des produits oncogenes
JPH0565155B2 (fr)
AU596952B2 (en) Peptide anitbodies and their use in detecting oncogene products
JPS63501721A (ja) 無細胞ｔ細胞抗原レセプタ−およびその臨床的利用
EP0203587A2 (fr) Peptides ras oncogènes et anticorps
PL177771B1 (pl) Linie komórek hybrydoma i preparaty przeciwciał
CA2868140A1 (fr) Utilisation d'antigenes a33 et de jam-it
US5866329A (en) Method and probe for detection of gene associated with liver neoplastic disease
KR101777254B1 (ko) En2 단백질을 특이적으로 인식하는 특정 항원으로부터 얻어진 단클론 항체 또는 이를 함유하는 전립선암 진단용 조성물
EP0177814A2 (fr) Anticorps contre les peptides et leurs utilisation dans la détection des produits d'oncogènes
US5051371A (en) Modified β2 -microglobulin
KR101309485B1 (ko) 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
US20080305499A1 (en) Anti-Synoviolin Antibody
JPWO2009044561A1 (ja) 抗ｐｒｏＮＴ／ＮＭＮモノクローナル抗体
US5175113A (en) Modified β2 -microglobulin
WO2004048412A2 (fr) Procede de production d'anticorps agissant contre un antigene cible, avec utilisation d'animaux preselectionnes pour l'immunisation
JP3888695B2 (ja) ヒトｌｅｃｔ２に対する抗体、それを産生する細胞、その測定法及び測定用キット
JPH0816679B2 (ja) 体液および組織におけるｒａｓタンパクの検出、定量および分類
WO2005037870A1 (fr) Anticorps et utilisation de celui-ci
CA2694001A1 (fr) Complexes composes de grp94 et d'immunoglobuline g humaine
KR100426029B1 (ko) 동종 및 이종 단백질에 대한 항체, 그 항체를 이용한 진단 및 치료방법 및 그 항체의 측정방법
KR101309386B1 (ko) 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
JP4314365B2 (ja) エンドセリン−２／ｖｉｃに対する特異的な抗体、作製方法、およびその用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP