WO2004035806A2 - Methods and nucleic acids for the analysis of cpg dinucleotide methylation status associated with the calcitonin gene - Google Patents
Methods and nucleic acids for the analysis of cpg dinucleotide methylation status associated with the calcitonin gene Download PDFInfo
- Publication number
- WO2004035806A2 WO2004035806A2 PCT/US2003/025044 US0325044W WO2004035806A2 WO 2004035806 A2 WO2004035806 A2 WO 2004035806A2 US 0325044 W US0325044 W US 0325044W WO 2004035806 A2 WO2004035806 A2 WO 2004035806A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- recited
- dna
- seq
- methylation
- cpg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Definitions
- the present invention relates to human DNA sequences that exhibit altered methylation patterns (hypermethylation or hypomethylation) in cancer patients. These novel methylation- altered DNA sequences are useful as diagnostic, prognostic and therapeutic markers for human cancer.
- 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. Current use of bisulfite modification to assess CpG methylation status.
- a relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior.
- 5- methylcytosine remains unmodified under these conditions.
- the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, et al., A modified and improved method for bisulfite based cytosine methylation analysis, Nucleic Acids Res. 24:5064-6, 1996).
- This method it is possible to analyze individual cells, which illustrates the potential of the method.
- it is possible to analyze individual cells, which illustrates the potential of the method.
- currently only individual regions of a length of up to approximately 3000 base pairs are analyzed, and a global analysis of cells for thousands of possible methylation events is possible.
- Aberrant DNA methylation within CpG 'islands' is characterized by hyper- or hypomethylation of CpG dinucleotide sequences leading to abrogation or overexpression of a broad spectrum of genes, and is among the e arliest and m ost c ornmon a Iterations found i n, a nd c orrelated with h uman m alignancies. Additionally, abnormal methylation has been shown to occur in CpG-rich regulatory elements in intronic and coding parts of genes for certain tumors.
- aberrant DNA methylation constitutes one of the most prominent alterations and inactivates many tumor suppressor genes such as pl4ARF, pl6INK4a, THBS1, MINT2, and MINT31 and DNA mismatch repair genes such as hMLHl .
- hypomethylation of DNA In contrast to the specific hypermethylation of tumor suppressor genes, an overall hypomethylation of DNA can be observed in tumor cells. This decrease in global methylation can be detected early, far before the development of frank tumor formation. A correlation between hypomethylation and increased gene expression has been determined for many oncogenes.
- CIMP-positive tumors which constitute about 15% of all sporadic colorectal cancers, are characterized by microsatellite instability (MIN) due to hypermethylation of the hMLHl promoter and o ther DNA m ismatch r epair g enes.
- MIN microsatellite instability
- CTN genetic instability pathway
- These colon cancer subtypes in addition to displaying varying frequencies of molecular alteration (e.g., MIN vs CTN), can be subclassified into two significantly different clinical classes.
- MIN tumors Almost all MIN tumors originate in the proximal colon (ascending and transversum), whereas 70% of CTN tumors are located in the distal colon and rectum. This spatial distinction has been attributed to the varying prevalence of different carcinogens in different sections of the colon. Methylating carcinogens, which constitute the prevailing carcinogen in the proximal colon are implicated in the pathogenesis of MIN cancers, whereas CTN tumors appear to be frequently caused by adduct-forming carcinogens that occur more frequently in distal parts of the colon and rectum. Moreover, MIN tumors have a better prognosis than do tumors with a CENT phenotype and respond better to adjuvant chemotherapy. Breast cancer.
- Breast cancer is defined as the uncontrolled proliferation of cells within breasts tissues. Breasts are comprised of 15 to 20 lobes joined together by ducts. Cancer arises most commonly in the duct, but is also found in the lobes with the rarest type of cancer, termed inflammatory breast cancer.
- Breast cancer is currently the second most common type of cancer amongst women. For example, in 2001, over 190,000 new cases of invasive breast cancer and over 47, 000 additional cases of in situ breast cancer were diagnosed in the United States. Incidence and death rates increase with age. For example, during the period from 1994-1998 the incidence of breast cancer among women 20-24 years of age was only 1.5 per 100,000 population. The risk increases to 489.7 per 100,000 population within the 75-79 year age group. Mortality rates have decreased by approximately 5% over the last decade and factors affecting 5-year survival rates include age, stage of cancer, socioeconomic factors and race.
- Methods of treatment include the use of surgery, radiation therapy, chemotherapy and hormone t herapy, w hich a re also u sed as a djunct t herapies t o s urgery.
- the first s tep o f a ny treatment is the assessment of the patient's condition, comparative to defined classifications of the disease.
- breast cancers are staged according to size, location and occurrence of metastasis.
- the value of such a system is inherently dependant upon the quality of the classification and, in contrast to the detection of some other common cancers such as cerv and dermal, there are inherent difficulties in classifying and detecting breast cancers.
- Additional predictors e.g., histological analysis, estrogen receptor markers, etc.
- Additional predictors e.g., histological analysis, estrogen receptor markers, etc.
- patient response to treatment is often not accurately predictable, and prediction of overall outcome is problematic.
- hereditary breast cancers account for only 5% to 10% of cases, and epigenetic mechanisms, as well as environmental factors influence the development of breast cancers.
- the calcitonin gene The short (“P") arm of chromosome 11 is the location of several tumor suppressor genes, including the calcitonin gene. Carcinogenesis in multiple types of cancers has been associated with hypomethylation of this region.
- the alpha-calcitonin gene encodes a small family of peptides comprising calcitonin, katacalcin, and calcitonin gene-related peptide (CGRP).
- Calcitonin and katacalcin are produced from one precursor, and CGRP from another.
- Calcitonin and katacalcin are primarily produced in/from the thyroid, while CGRP is present in both the thyroid and the central nervous system. Calcitonin is involved with skeletal integrity, and the secretion of calcitonin is, at least in part, oestrogen dependent.
- Calcitonin gene has revealed that hypermethylation of the promoter region of the gene is present in neoplastic cells of several cancer types, including acute leukaemia's.
- Examples of research carried out using restriction enzyme based methods on the calcitonin gene promoter and or first exon include the following: colon cancer (Hiltunen et al., Br J Cancer, 76:1124-30, 1997; Silverman et al., Cancer Res., 49:3468-7, 1989); leukaemia (Roman et al., Br J Haematol, 113:329-3, 2001); and breast cancer (Hakkarainen et al., 7/ Cancer, 69:471-4, 1996); myelodysplastic syndrome (Dhodapkar et al., Leuk Res., 19:719-26, 1995).
- said prior art methods and findings do not validate the potential diagnostic and/or prognostic utility of determination of methylation status at other CpG positions located elsewhere within, or in the proximity of the calicitonin gene, particularly where such limited prior art-analyzed CpG positions are not part of CpG islands.
- Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays.
- the simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe are particularly suitable for fluorescence labels.
- the detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many otht are commercially available.
- Matrix Assisted Laser Desorption Ionization Mass Spectrometry is a very efficient development for the analysis of biomolecules (Karas &Hillenkamp, Anal Chem., 60:2299-301, 1988).
- An analyte is embedded in a light-absorbing matrix.
- the matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapour phase in an unfragmented manner.
- the analyte is ionized by collisions with matrix molecules.
- An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
- MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins.
- the analysis of nucleic acids is somewhat more difficult (Gut & Beck, Current Innovations and Future Trends, 1:147-57, 1995).
- the sensitivity with respect to nucleic acid analysis is approximately 100-times less than for peptides, and decreases disproportionally with increasing fragment size.
- the ionization process via the matrix is considerably less efficient.
- the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallisation.
- the present invention provides novel methods for the analysis of cell proliferative disorders involving analysis of a novel CpG island that was heretofore not associated with the development of cancer. Furthermore, the invention discloses genomic and chemically modified nucleic acid sequences, as well as ohgonucleotides and/or PNA-oligomers for analysis of cytosine methylation patterns within said region.
- the present invention is in part based on the discovery that genetic and epigenc parameters, in particular, the cytosine methylation patterns, of a novel CpG-rich region of the genome, upstream o f the c alcitonin gene, are p articularly useful for the diagnosis, prognosis, management and/or therapy of cancer and other cell proliferative disorders.
- Figure 1 shows the analysis of bisulfite-treated DNA using the MethylLightTM assay, performed according to EXAMPLE 1, herein below.
- the Y-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the dark grey bar (“A” in the legend) corresponds to tumor samples, whereas the white bar (“B”) corresponds to normal control tissue.
- the tumor samples are hypermethylated relative to normal control tissue.
- Figure 2 shows the amplification of bisulfite-treated DNA according to EXAMPLE 2, herein below.
- the lower trace (“B”) shows the amplification of DNA from normal colon tissue, while the upper trace (“A”) shows the amplification of DNA from tumor tissue.
- the X-axis shows the cycle number of the amplification, whereas the Y-axis shows the amount of amplificate detected.
- Figure 3 shows the analysis of bisulfite-treated DNA using the combined HeavyMethyl MethylLight assay according to EXAMPLE 2, herein below.
- the X-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the dark grey bar represents tumor samples, whereas the white bar represents normal control tissue.
- Figure 4 shows the level of methylation in breast tumor and healthy tissues as assessed according to EXAMPLE 2, herein below (by means of the Heavy Methyl assay).
- the Y-axis shows the degree of methylation within the region of the Calcitonin gene investigated. Tumor samples are represented by black diamonds, and normal breast tissue samples by white squares. As can be seen from the results, a significantly higher degree of methylation (hypermethylation) was observed in tumor samples relative to normal tissue samples.
- Figure 5 shows a methylation analysis of bisulfite-treated DNA from breast tumour and normal control tissue using the MethylLightTM assay, (according to EXAMPLE 4, herein below), and the combined HeavyMethyl MethylLight TM assay (according to EXAMPLE 5, herein below).
- the Y-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the black bars correspond to tumor samples, whereas the white bars correspond to normal control tissue.
- the bar charts on the left hand side of the X-axis show the percentage methylation measured using the combined (HeavyMethylTM) assay while the bar charts on the right show the analysis carried out by means of the MethylLightTM assay. Analysis by means of both assays shows that the breast tumor samples are significantly hypermethylated relative to normal control tissue.
- O/E Ratio refers to the frequency of CpG dinucleotides within a particular DNA sequence, and corresponds to the [number of CpG sites / (number of C bases x number of G bases)] x band length for each fragment.
- CpG island refers to a contiguous region of genomic DNA that satisfies the criteria of (1) having a frequency of CpG dinucleotides corresponding to an "Observed/Expected Ratio” >0.6, and (2) having a "GC Content” >0.5.
- CpG islands are typically, but not always, between about 0.2 to about 1 kb in length.
- methylation state refers to the presence or absence of 5-methylcytosine ("5-mCyt") at one or a plurality of CpG dinucleotides within a DNA sequence.
- Methylation states at one or more particular palindromic CpG methylation sites (each having two CpG CpG dinucleotide sequences) within a DNA sequence include "unmethylated,” “fully- methylated” and "hemi-methylated.”
- hemi-methylation refers to the methylation state of a palindromic CpG methylation site, where only a single cytosine in one of the two CpG dinucleotide sequences of the palindromic CpG methylation site is methylated (e.g., 5'-CC M GG- 3' (top strand): 3'-GGCC-5' (bottom strand)).
- hypomethylation refers to the methylation state corresponding to an increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
- hypomethylation refers to the methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
- microarray refers broadly to both 'DNA microarrays,' and 'DNA chip(s),' as recognized in the art, encompasses all art-recognized solid supports, and encompasses all methods for affixing nucleic acid molecules thereto or synthesis of nucleic acids thereon.
- hybridization is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
- "Stringent hybridization conditions,” as defined herein, involve hybridizing at 68°C in 5x SSC/5x Denhardt's solution 1.0% SDS, and washing in 0.2x SSC/0.1% SDS at ro ⁇ temperature, or involve the art-recognized equivalent thereof (e.g., conditions in which a hybridization is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable).
- Moderately stringent conditions involve including washing in 3x SSC at 42°C, or the art-recognized equivalent thereof.
- the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.
- Guidance regarding such conditions is available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at Unit 2.10.
- Genetic parameters are mutations and polymorphisms of genes and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms) .
- Epigenetic parameters are, in particular, cytosine methylations. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
- the present invention is based upon the identification of a CpG-rich region within the chromosomal region of the calcitonin gene family, and lying upstream (5') of the calcitonin gene
- CpG-rich island had not been associated with tumorigenesis and/or other proliferative disorders; previously published research concerning methylation analysis within the calcitonin gene being limited in scope to the associated promoter and first exon regions.
- the herein disclosed CpG-rich region lies approximately 1000 base pairs (1Kb) upstream of the transcription start site of the calcitonin gene.
- cancer-associated methylation patterns have only been associated with particular CpG dinucleotide sequences occurring closer to the vicinity of the transcription start site of said gene.
- An objective of the present invention is to provide improved methods for the diagnosis, prognosis, management and/or therapy of cell proliferative disorders by analysis of said novel CpG island.
- the present invention provides novel methods for the analysis of cell proliferative disorders involving analysis of a novel CpG island that was heretofore not associated with development of cancer.
- the invention discloses genomic and chemically modified nucleic acid sequences, as well as ohgonucleotides and/or PNA-oligomers for analysis of cytosine methylation patterns within said region.
- the present invention is in part based on the discovery that genetic and epigenetic parameters, in particular, the cytosine methylation patterns, of a novel CpG-rich region of the genome, u pstream o f t he c alcitonin g ene, a re p articularly u seful for t he d iagnosis, p rognosis, management and/or therapy of cancer and other cell proliferative disorders.
- An objective of the invention comprises analysis of the methylation state of the CpG dinucleotides within the genomic sequence according to SEQ ID NO:l and sequences complementary thereto.
- SEQ ID NO:l corresponds to a fragment of the CpG-rich region upstream of the calcitonin gene, wherein said fragment contains CpG dinucleotides exhibiting one or more disease-specific CpG methylation patterns.
- the methylation pattern of said fragment of the gene Calcitomn has heretofore not been analysed with regard to cancer and/or other cell proliferative disorders.
- the objective comprises analysis of a chemically modified nucleic acid comprising a contiguous sequence of at least 18 bases in length (or at least 16, 18, 20, 22, 23, 25, 30 or 35 bases in length), according to one of SEQ ID NO:2 to SEQ ID NO:5 and sequences complementary thereto.
- SEQ ID NO:2 through SEQ ID NO:5 provide chemically modified versions of the nucleic acid according to SEQ ID NO:l, wherein the chemical modification of said sequence results in the synthesis of a nucleic acid having a sequence that is unique and distinct from SEQ ID NO:l.
- the nucleic acid molecules according to SEQ ID NO:l to SEQ ID NO: 5 could not and were connected with the ascertainment of genetic and epigenetic parameters relevant to the analysis of cancer and/or other cell proliferative disorders.
- such analysis comprises the use of an oligonucleotide or oligomer for detecting the cytosine methylation state within genomic or pretreated (chemically modified) DNA, according to SEQ ID NO:l to SEQ ID NO:5.
- Said oligonucleotide or oligomer containing at least one contiguous base sequence having a length of at least nine (9) nucleotides (or at least 9, 12, 15, 16, 18, 20, 22, 23, 25, 30 or 35 nucleotides in length) which hybridizes, under stringent or moderately stringent conditions, to a pretreated nucleic acid sequence according to SEQ ID NO:2 to SEQ ID NO:5 and/or sequences complementary thereto, or to a genomic sequence comprising SEQ ID NO:l and/or sequences complementary thereto.
- the ohgonucleotides or oligomers according to the present invention constitute novel and effective tools useful to ascertain genetic and epigenetic parameters of the novel CpG-r island disclosed herein.
- the base sequence of said oligonucleotides or oligomers preferably contain at least one CpG, TpG or CpA dinucleotide.
- the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
- Particularly preferred oligonucleotides or oligomers according to the present invention are those in which the cytosine of the CpG dinucleotide is within the middle third of the oligonucleotide; that is, where the oligonucleotide is, for example, 13 bases in length, the CG, TG or CA dinucleotide is positioned within the fifth to ninth nucleotide from the 5'-end.
- oligonucleotides or o ligomers according to p articular embodiments o f the present invention are typically used in 'sets,' which contain at least one oligomer for analysis of each of the CpG dinucleotides of genomic sequence SEQ ID NO:l and sequences complementary thereto, or to the corresponding CpG, TpG or CpA dinucleotide within a sequence of the pretreated nucleic acids according to SEQ ID NO:2 to SEQ ID NO:5 and sequences complementary thereto.
- an oligonucleotide set contains at least one oligomer for each of the CpG dinucleotides within the gene Calcitonin in both the pretreated and genomic versions of said gene sequence according to SEQ ID NO:2 through SEQ ID NO:5 and SEQ ID NO:l, respectively.
- SEQ ID NO:2 the CpG dinucleotides within the gene Calcitonin in both the pretreated and genomic versions of said gene sequence according to SEQ ID NO:2 through SEQ ID NO:5 and SEQ ID NO:l, respectively.
- the present invention provides a set of at least three (3) (oligonucleotides and/or PNA-oligomers) useful for detecting the cytosine methylation state in pretreated genomic DNA (SEQ ID NO:2 to SEQ ID NO:5 and sequences complementary thereto) and genomic DNA (SEQ ID NO:l and sequences complementary thereto).
- T hese probes enable diagnosis, prognosis, and/or therapy o f genetic and epigenetic parameters of cell proliferative disorders.
- the set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in pretreated genomic DNA (SEQ ID NO:2 to SEQ ID NO:5, and sequences complementary thereto) and genomic DNA (SEQ ID NO:l, and sequences complementary thereto).
- SNPs single nucleotide polymorphisms
- the present invention provides a set of at least two (2) oligonucleotides that are used as 'primer' oligonucleotides for amplifying DNA sequences of one of SEQ ID NO:l to SEQ ID NO: 5 and sequences complementary thereto, or segments thereof.
- SEQ ID NO of length Y is equal to Y-(X-1).
- preferred sets are those limited to those oligomers that comprise at least one CpG, TpG or CpA dinucleotide.
- inventive 20-mer oligonucleotides include the following set of 946 oligomers (and the antisense set complementary thereto), indicated by polynucleotide positions with reference to SEQ ID NO:l :
- preferred sets are those limited to those oligomers that comprise at least one CpG, TpG or CpA dinucleotide.
- the o ligonucleotides o f the i nvention c an a lso b e m odified b y e hemically linking t he oligonucleotide to one or more moieties or conjugates to enhance the activity, stability or detection of the oligonucleotide.
- Such moieties or conjugates include chromophores, fluorophors, lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids, polyamines, polyethylene glycol (PEG), palmityl moieties, and others as disclosed in, for example, United States Patent Numbers 5,514,758, 5,565,552, 5,567,810, 5,574,142, 5,585,481,
- the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
- the oligonucleotide may include other appended groups such as peptides, and may include hybridization-triggered cleavage agents (Krol et al., BioTechniques 6:958-976, 1988) or intercalating agents (Zon, Pharm. Res. 5:539-549, 1988).
- the oligonucleotide may be conjugated to another molecule, e.g., a chromophore, fluorophor, peptide, hybridization-triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- another molecule e.g., a chromophore, fluorophor, peptide, hybridization-triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- the oligonucleotide may also comprise at least one art-recognized modified sugar and/or base moiety, or may comprise a modified backbone or non-natural internucleoside linkage. In preferred embodiments, at least one, and more preferably all members of a set of oligonucleotides is bound to a solid phase.
- an arrangement of different oligonucleotides and or PNA-oligomers (a so-called “array”), made according to the present invention, is present in a manner that it is likewise bound to a solid phase.
- Such an array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized, for example, in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice.
- the solid- phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
- the present invention provides a method for manufacturing an array fixed to a carrier material for analysis in connection with cell proliferative disorders, in which method at least one oligomer according to the present invention is coupled to a solid phase.
- Methods for manufacturing such arrays are known and described in, for example, US Patent No.5,744,305 by means of solid-phase chemistry and photo labile protecting groups.
- the present invention further provides a DNA chip for the analysis of cell proliferative disorders.
- DNA chips are known and described in, for example, US Patent No. 5,837,832.
- a subject matter of the present invention comprises a 'kit' which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case corresponds to or are complementary to an 18-base long segment of the nucleic acid sequences of SEQ ID NO:l to SEQ ID NO: 5 and sequences complementary thereto, oligonucleotides and/or PNA-oligomers, as well as instructions for carrying out and evaluating the described method.
- a kit of the present invention can also contain only part of the aforementioned components.
- the present invention further provides a method for ascertaining genetic and/or epigenetic parameters of the calcitonin gene within a subject by analyzing cytosine methylation and single nucleotide polymorphisms.
- Said method comprising contacting a nucleic acid comprising one or more sequences, from the group consisting of SEQ ID NO:l through SEQ ID NO:5, in a biological sample obtained from said subject with at least one reagent or a series of reagents, wherein said reagent or series of reagents, distinguishes between methylated and non methylated CpG dinucleotides within the target nucleic acid.
- said method comprises the following steps: In the first step, obtaininj sample of the tissue to be analysed.
- the source may be any suitable source, such as cells or cell components, cell lines, biopsies, blood, sputum, stool, urine, cerebrospinal fluid, tissue embedded i n p araffin s uch a s t issue from e yes, intestine, k idney, b rain, heart, p rostate, 1 ung, colon, breast or liver, histologic object slides, or combinations thereof.
- DNA is isolated from the sample. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing w ith g lass b eads. O nee t he n ucleic a cids h ave b een e xtracted the g enomic d ouble stranded DNA is used in the analysis.
- the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5 '-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior.
- cytosine bases which are unmethylated at the 5 '-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior.
- fragments of the pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of from about 100 to about 2,000 base pairs are amplified.
- the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Typically, the amplification is carried out using a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the set of primer oligonucleotides includes at least two oligonucleotides whose sequences are each reverse complementary or identical to an at least 18-base-pair long segment of the base sequences of SEQ ID NO:l to SEQ ID NO: 5 and sequences complementary thereto (or at least 22, 23, 25, 30, or 35 base-pairs in length).
- t he m ethylation s tatus o f p reselected CpG positions within the nucleic acid sequences comprising SEQ ID NO:2 to SEQ ID NO:5 may be detected by use of methylation-specific primer oligonucleotides.
- This technique MSP has been described in U.S. Patent No. 6,265,171 to Herman.
- the use of methylation status specific primers for the amplification of bisulfite treated DNA allows the differentiation between methylated and unmethylated nucleic acids.
- MSP primers pairs contain at least one primer which hybridizes to a bisulfite treated CpG dinucleotide. Therefore the sequence of said primers comprises at least one CG , TG or CA dinucleotide. MSP primers specific for non- methylated DNA contain a " at the 3' position of the C position in the CpG.
- the base sequence of said primers is required to comprise a sequence having a length of at least 9 (or at least 16, at least 18, or at least 25) nucleotides which hybridizes to a pretreated nucleic acid sequence according to SEQ ID NO:2 to SEQ ID NO: 5 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG, TpG or CpA dinucleotide.
- the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
- W here s aid 1 abels are m ass 1 abels, i t i s p referred t hat the 1 abeled amplificates have a single positive or negative net charge, allowing for better detectability in the mass spectrometer.
- the detection may be carried out and visualized by means of, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
- MALDI matrix assisted laser desorption/ionization mass spectrometry
- ESI electron spray mass spectrometry
- the amplificates obtained during the fourth step of the method are analysed in order to ascertain the methylation status of the CpG dinucleotides prior to the treatment.
- the amplificates were obtained by means of MSP amplification, the presence or absence of an amplificate is in itself indicative of the methylation state of the CpG positions covered by the primer, according to the base sequences of said primer.
- Amplificates obtained by means of both standard and methylation specific PCR may be further analyzed by means of hybridization-based methods such as, but not limited to, array technology and probe based technologies as well as by means of techniques such as sequencing and template directed extension.
- the amplificates synthesised in step four are subsequently hybridized t o an array o r a s et o f o ligonucleotides and/or PNA p robes.
- the hybridization takes place in the following manner: the set of probes used during the hybridization is preferably composed of at least 2 oligonucleotides or PNA-oligomers; in the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase; the non-hybridized fragments are subsequently removed; and said oligonucleotides contain at least one base sequence having a length of at least 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the present Sequence Listing; and the segment comprises at least one CpG , TpG or CpA. dinucleotide.
- said dinucleotide is present in the central third of the oligomer.
- s dinucleotide is preferably the fifth to ninth nucleotide from the 5 '-end of a 13-mer.
- One oligonucleotide exists for the analysis of each CpG dinucleotide within the sequence according to SEQ ID No:l, and the equivalent positions within SEQ ID NOS:2 to 5.
- Said oligonucleotides may also be present in the form of peptide nucleic acids. The non-hybridized amplificates are then removed.
- the hybridized amplificates are detected.
- labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
- the genomic methylation status of the CpG positions may be ascertained by means of oligonucleotide probes that are hybridised to the bisulfite treated DNA concurrently with the PCR amplification primers (wherein said primers may either be methylation specific or standard).
- oligonucleotide probes that are hybridised to the bisulfite treated DNA concurrently with the PCR amplification primers (wherein said primers may either be methylation specific or standard).
- a particularly preferred embodiment of this method is the use of fluorescence-based
- Real Time Quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996; also see US Patent No. 6,331,393) employing a dual-labeled fluorescent oligonucleotide probe (TaqManTM PCR, using an ABI Prism 7700 Sequence Detection System, Perkin Elmer Applied Biosystems, Foster City, California).
- the TaqManTM PCR reaction employs the use of a nonextendible interrogating oligonucleotide, called a TaqManTM probe, which is designed to hybridize to a GpC-rich sequence located between the forward and reverse amplification primers.
- the TaqManTM probe further comprises a fluorescent "reporter moiety” and a "quencher moiety” covalently bound to linker moieties (e.g., phosphoramidites) attached to the nucleotides of the TaqManTM oligonucleotide.
- linker moieties e.g., phosphoramidites
- the probe be methylation specific, as described in U.S. Patent No. 6,331,393, (hereby incorporated by reference in its entirety) also known as the MethylLightTM assay.
- TaqManTM detection methodology that are also suitable for use with the described invention include the use of dual-probe technology (LightcyclerTM) or fluorescent amplification primers (SunriseTM technology). Both these techniques may be adapted in a manner suitable for use with bisulfite treated DNA, and moreover for methylation analysis within CpG dinucleotides.
- Blocking probe oligonucleotides are hybridized to the bisulfite-treated nucleic acid concurrently with the PCR primers.
- PCR amplification of the nucleic acid is terminated at the 5' position of the blocking probe, such that amplification c nucleic acid is suppressed where the complementary sequence to the blocking probe is present.
- the probes may be designed to hybridize to the bisulfite treated nucleic acid in a methylation status specific manner. For example, for detection of methylated nucleic acids within a population of unmethylated nucleic acids, suppression of the amplification of nucleic acids which are unmethylated at the position in question would be carried out by the use of blocking probes comprising a 'CpG' at the position in question, as opposed to a 'CpA.'
- the fifth step of the method comprises the use of template-directed oligonucleotide extension, such as MS-SNuPE as described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
- template-directed oligonucleotide extension such as MS-SNuPE as described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
- the fifth step of the method comprises sequencing and subsequent sequence analysis of the amplificate generated in the third step of the method (Sanger F., et al., PNAS USA 74:5463-5467, 1977). Additional embodiments of the invention provide a method for the analysis of the methylation status of genomic DNA according to the invention (SEQ ID NO:l) without the need for pretreatment.
- the genomic DNA sample is isolated from tissue or cellular sources.
- tissue or cellular sources include cell lines, histological slides, body fluids, or tissue embedded in paraffin. Extraction may be by means that are standard to one skilled in the art, including but not limited to the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double- stranded DNA is used in the analysis.
- the DNA may be cleaved prior to the treatment, this may be any m eans s tandard i n t he s tate o f t he a rt, i n p articular w ith m ethylation-sensitive r estriction endonucleases.
- the DNA is then digested with one or more methylation sensitive restriction enzymes. The digestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of a specific CpG dinucleotide.
- the restriction fragments are amplified. This is preferably carried out using a polymerase chain reaction.
- the amplificates are detected.
- the detection may be by any means standard in the art, for example, but not limited to, gel electrophoresis analysis, hybridization analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI or ESI analysis.
- Suitable labels for use in the detection of the digested nucleic acid fragments include fluorophore labels, radionuclides and mass labels as described above.
- the oligomers according to the present invention, or arrays thereof, as well as a kit according to the present invention are useful for the diagnosis and/or therapy of cancer an ⁇ other cell proliferative disorders.
- the method is preferably used for the diagnosis and/or therapy of cell proliferative disorders by analysis of important genetic and/or epigenetic parameters within the novel CpG-rich region located upstream (5 1 ) of the calcitonin gene.
- the methods according to the present invention are used, for example, for the diagnosis and/or therapy of cell proliferative disorders.
- nucleic acids according to the present invention SEQ ID NO:l to SEQ ID NO:5, and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters associated with the gene Calcitonin.
- the present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with the calcitonin g ene, comprising analyzing methylation patterns of said gene, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and ancillary agents.
- a further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with the calcitonin gene, comprising analyzing methylation patterns of said gene, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and ancillary agents.
- the present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within the gene Calcitonin may be used as markers.
- Said parameters obtained by means o f the p resent invention m ay b e c ompared t o another s et o f genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
- a subject matter of the present invention is a kit comprising, for example, a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to a 18-base long segment of the base sequences specified in the appendix (SEQ ED NO:l through SEQ ID NO:5), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method.
- a bisulfite-containing reagent for example, a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to a 18-base long segment of the base sequences specified in the appendix (SEQ ED NO:l through SEQ ID NO:5), oligonucleotides and/or PNA-oligomers as well as instructions
- said kit may further comprise standard reagents for performing a CpG position-specific methylation analysis, wherein said analysis comprises one or more of the following techniques: MS-SNuPE, MSP, MethylLight TM, Heavy Methyl TM, and nucleic acid sequencing.
- MS-SNuPE MS-SNuPE
- MSP MethylLight TM
- Heavy Methyl TM and nucleic acid sequencing.
- a kit along the li of the present invention can also contain only part of the aforementioned components.
- methylation status of the CpG island disclosed under SEQ ID NO;l was analyzed using two alternative methods, hi the first example, a real time PCR was carried out upon bisulfite-treated DNA using fluorescent labeled probes in a real time PCR assay covering CpG positions of interest (a variant of the Taqman assay known as the MethyLightTM assay).
- MethyLightTM assay a variant of the Taqman assay known as the MethyLightTM assay.
- methylation status of the same region was analyzed by bisulfite treatment. This was followed by analysis of the treated nucleic acids using a MethylLightTM assay combined with the methylation specific blocking probes covering CpG positions (HeavyMethylTM assay).
- Methylation within colon cancer tissue was analyzed using a MethyLightTM Assay
- DNA was extracted from 34 colon adenocarcinoma samples and 42 colon normal adjacent tissues using a QiagenTM extraction kit.
- the DNA from each sample was treated using a bisulfite solution (hydrogen sulfite, disulf ⁇ te) according to the agarose-bead method (Olek et al 1996).
- the treatment is such that all non methylated cytosines within the sample are converted to thymidine. Conversely, 5-methylated cytosines within the sample remain unmodified.
- the methylation status was determined with a MethyLightTM assay designed for the CpG island of interest and a control fragment from the beta actin gene (Eads et al., 2001).
- the CpG island assay covers CpG sites in both the primers and the TaqmanTM style probe, while the control gene does not.
- the control gene is used as a measure of total DNA concentration, and the CpG island assay (methylation assay) determines the methylation levels at that site.
- the calcitonin gene CpG island assay was performed using the following primers and probes:
- Probe CGAATCTCTCGAACGATCGCATCCA (SEQ ID NO:8).
- the corresponding control assay was performed using the following primers and probes
- Reaction solution (900 nM primers; 300 nM probe; 3.5 mM magnesium chloride; 1 unit of taq polymerase; 200 ⁇ M dNTPs; 7 ⁇ l of DNA, in a final reaction volume of 20 ⁇ l); Cycling conditions: (95°C for 10 minutes; 95°C for 15 seconds; 67°C for 1 minute (3 cycles)); (95°C for 15 seconds, 64°C for 1 minute (3 cycles)); (95°C for 15 seconds, 62°C for 1 minute (3 cycles)); and (95°C for 15 seconds, 60°C for 1 minute (40 cycles)).
- Figure 1 shows the analysis of bisulfite-treated DNA using the MethylLightTM assay, performed according to this EXAMPLE 1.
- the Y-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the dark grey bar (“A” in the legend) corresponds to tumor samples, whereas the white bar (“B”) corresponds to normal control tissue.
- the tumor samples are substantially hypermethylated relative to normal control tissue.
- Methylation within colon and breast cancer tissue was analyzed using a HeavyMethyl MethyLightTM assay
- the colon and normal tissue DNA samples of EXAMPLE 1, above were also used to analyze methylation of the upstream calcitonin CpG island with a HeavyMethyl MethyLightTM (or HM MethyLightTM) assay, also referred to as the HeavyMethylTM assay.
- HM MethyLightTM or HM MethyLightTM assay
- the methylation status was determined with a HM MethyLightTM assay designed for the CpG island of interest and the same control gene assay described above.
- the CpG island assay covers CpG sites in both the blockers and the TaqmanTM style probe, while the control gene does not.
- the CpG island assay (methylation assay) was performed using the following primers and probes:
- Reaction solution (300 nM primers; 450 nM probe; 3.5 mM magnesium chloride; 2 units of taq polymerase; 400 ⁇ M dNTPs; and 7 ⁇ l of DNA, in a final reaction volume of 20 ⁇ l); Cycling conditions: (95°C for 10 minutes); (95°C for 15 seconds, 67°C for 1 minute (3 cycles)); (95°C for 15 seconds, 64°C for 1 minute (3 cycles); (95°C for 15 seconds, 62°C for 1 minute (3 cycles)); and (95°C for 15 seconds, 60°C for 1 minute (40 cycles)).
- FIG. 2 shows the amplification of bisulfite-treated DNA according to this EXAMPLE
- the lower trace (“B”) shows the amplification of DNA from normal colon tissue
- the upper trace (“A”) shows the amplification of DNA from tumor tissue.
- the X-axis shows the cycle number of the amplification
- the Y-axis shows the amount of amplificate detected.
- Figure 3 shows the analysis of bisulfite-treated DNA using the combined HeavyMethyl MethylLightTM assay according to this EXAMPLE 2.
- the X-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the dark grey bar represents tumor samples, whereas the white bar represents normal control tissue.
- Figure 4 shows the level of methylation in breast tumor and healthy tissues as assessed according to the methods of this EXAMPLE 2 (by means of the HeavyMethylTM assay).
- the Y- axis shows the degree of methylation within the region of the calcitonin gene investigated.
- Tumor samples are represented by black diamonds, and normal breast tissue samples by white squares.
- a significantly higher degree of methylation was observed in tumor samples than in healthy tissue samples.
- the level of significance as measured using a t-test was 0.012. . degree of differences observed between healthy normal and tumor samples using the assay was therefore somewhat higher in colon tissue than in breast tissue (however, see EXAMPLES 4 and 5 herein below, showing results from a larger number of tumor and control samples).
- the methylation status of a CpG dinucleotide site at nucleotide position 576 of SEQ ID NO:l was determined using methylation-sensitive restriction endonuclease digestion
- a fragment of the upstream region of the calcitonin gene (SEQ ID NO:l) was amplified by PCR using the primers CCTTAGTCCCTACCTCTGCT (SEQ ID NO: 16) and CTCATTTACACACACCCAAAC (SEQ ID NO: 17).
- the resultant amplificate, 378 bp in length, contained an informative CpG at nucleotide position 165 (corresponding to nucleotide position 576 of SEQ ID NO:l).
- the amplificate DNA was digested with the methylation- sensitive restriction endonuclease N ⁇ r /; recognition motif GGCGCC. Hydrolysis by said endonuclease i s b locked b y methylation o f the CpG at p osition 165 o f the amplificate. T he digest was used as a control.
- Genomic D ⁇ A was isolated from the samples using the D ⁇ A WizzardTM D ⁇ A isolation kit (Promega). Each sample was digested using Nar I according to manufacturer's recommendations (New England Biolabs).
- PCR primers CCTTAGTCCCTACCTCTGCT (SEQ ID NO:16) and CTCATTTACACACACCCAAAC (SEQ ID NO: 17).
- the PCR reactions were performed using a thermocycler (Eppendorf GmbH) using 10 ng of DNA, 6 pmole of each primer, 200 ⁇ M of each dNTP, 1.5 mM MgCl 2 and 1 Unit of HotstartTMTaq (Qiagen AG). The other conditions were as recommended by the Taq polymerase manufacturer.
- gene fragments were amplified by PCR performing a first denaturation step for 14 min at 96°C, followed by 30-45 cycles (step 2: 60 sec at 96°C, step 3: 45 sec at 52°C, step 4: 75 sec at 72°C) and a subsequent final elongation of 10 min at 72°C.
- step 2 60 sec at 96°C
- step 3 45 sec at 52°C
- step 4 75 sec at 72°C
- the presence of PCR products was analyzed by agarose gel electrophoresis.
- PCR products were detectable, with Nar 7-hydrolyzed DNA isolated wherein the tissue in question (breast or colon) contained up-methylated DNA, when step 2 to step 4 of the cycle program were repeated 34, 37, 39, 42 and 45-fold.
- PCR products were only detectable with Nar J-hydrolyzed D ⁇ A isolated from down-methylated tissue(breast or colon) when steps 2 to step 4 of the cycle program were repeated 42- and 45-fold.
- Methylation was analyzed in breast cancer tissue using a MethyLightTM assay
- DNA was extracted from 21 breast carcinoma samples and 17 normal breast tissues using a Qiagen extraction kit. The DNA from each sample was treated using a bisulfite solution
- the methylation status was determined with a MethyLightTM assay designed for the CpG island of interest and a control fragment from the beta actin gene (Eads et al., 2001).
- the CpG island assay covers CpG sites in both the primers and the TaqmanTM style probe, while the control gene does not.
- the control gene is used as a measure of total DNA concentration, and the CpG island assay (methylation assay) determines the methylation levels at that site.
- the calcitonin gene CpG island assay was performed using the following primers and probes:
- Probe CGAATCTCTCGAACGATCGCATCCA (SEQ ID NO:8).
- the corresponding control assay was performed using the following primers and probes Primer: TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO:9);
- Probe ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 11). The reactions were run in triplicate on each DNA sample with the following assay conditions:
- Reaction solution (900 nM primers; 300 nM probe; 3.5 mM Magnesium Chloride; 1 unit of taq polymerase; 200 ⁇ M dNTPs; 7 ml of DNA, in a final reaction volume of 20 ⁇ l);
- Cycling conditions (95°C for 10 minutes; 95°C for 15 seconds; 67°C for 1 minute (3 cycles)); (95°C for 15 seconds, 64°C for 1 minute (3 cycles)); (95°C for 15 seconds, 62°C for 1 minute (3 cycles)); and (95 °C for 15 seconds, 60°C for 1 minute (40 cycles)).
- the bar charts on the right-half of Figure 5 shows the methylation analysis of bisulfite-treated DNA carried out by means of the MethylLightTM assay, performed according to this EXAMPLE 4 (the left-half of this figure shows results from the combined HeavyMethyl MethylLightTM assay according to EXAMPLE 5, herein below).
- the Y-axis shows the percentage of methylation at the CpG positions covered by the probes.
- the black bars correspond to tumor samples, whereas the white bars correspond to normal control tissue.
- the mean PMR for normal samples was 0.94, with a standard deviation of 1.28.
- the mean PMR for tumor samples was 8.38, with a standard deviation of 11.18.
- Methylation in breast cancer tissue was analyzed using a HeavyMethyl MethyLightTM assay
- Example 4 The breast tumour and normal samples of Example 4, above, were also analyzed using the HeavyMethyl MethyLightTM (or HM MethyLightTM) assay, also referred to as the
- HeavyMethylTM assay The methylation status was determined with a HM MethyLightTM assay designed for the CpG island of interest and a control gene assay.
- the CpG island assay covers
- calcitonin gene CpG island assay (methylation assay) was performed using the following primers and probes:
- Probe ACCTCCGAATCTCTCGAACGATCGC (SEQ ID NO: 14);
- Blocker TGTTGAGGTTATGTGTAATTGGGTGTGA (SEQ ID NO:15).
- the reactions were each run in triplicate on each DNA sample with the following assay conditions: Reaction solution: (300 nM primers; 450 nM probe; 3.5 mM magnesium chloride; 2 units of taq polymerase; 400 ⁇ M dNTPs; and 7 ml of DNA, in a final reaction volume of 20 ⁇ l);
- the mean PMR for normal samples was 0.58, with a standard deviation of 0.94.
- mean PMR for tumor samples was 3.01, with a standard deviation of 3.91.
- the overall difference in methylation levels between tumor and normal samples is significant in a t-test
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03796298A EP1576190A4 (en) | 2002-08-08 | 2003-08-08 | METHODS AND NUCLEIC ACIDS FOR ANALYZING A CPG DINUCLEOTIDE METHYLATION STATE ASSOCIATED WITH THE CALCITONIN GENE |
| JP2004545233A JP2005536229A (ja) | 2002-08-08 | 2003-08-08 | カルシトニン遺伝子関連CpGジヌクレオチドのメチル化状態分析のための方法および核酸 |
| AU2003298546A AU2003298546A1 (en) | 2002-08-08 | 2003-08-08 | Methods and nucleic acids for the analysis of cpg dinucleotide methylation status associated with the calcitonin gene |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/215,890 US20040029121A1 (en) | 2002-08-08 | 2002-08-08 | Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene |
| US10/215,890 | 2002-08-08 | ||
| US10/281,076 | 2002-10-25 | ||
| US10/281,076 US20040029128A1 (en) | 2002-08-08 | 2002-10-25 | Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004035806A2 true WO2004035806A2 (en) | 2004-04-29 |
| WO2004035806A3 WO2004035806A3 (en) | 2005-07-28 |
Family
ID=32109763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/025044 Ceased WO2004035806A2 (en) | 2002-08-08 | 2003-08-08 | Methods and nucleic acids for the analysis of cpg dinucleotide methylation status associated with the calcitonin gene |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20040029128A1 (https=) |
| EP (1) | EP1576190A4 (https=) |
| JP (1) | JP2005536229A (https=) |
| AU (1) | AU2003298546A1 (https=) |
| WO (1) | WO2004035806A2 (https=) |
Families Citing this family (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110151438A9 (en) | 2001-11-19 | 2011-06-23 | Affymetrix, Inc. | Methods of Analysis of Methylation |
| US20050233340A1 (en) * | 2004-04-20 | 2005-10-20 | Barrett Michael T | Methods and compositions for assessing CpG methylation |
| EP2290073A3 (en) * | 2004-05-28 | 2011-08-31 | Asuragen, Inc. | Methods and compositions involving microRNA |
| EP2302055B1 (en) | 2004-11-12 | 2014-08-27 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US20060292585A1 (en) * | 2005-06-24 | 2006-12-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
| US7901882B2 (en) | 2006-03-31 | 2011-03-08 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
| US8084734B2 (en) * | 2006-05-26 | 2011-12-27 | The George Washington University | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
| US20090131348A1 (en) * | 2006-09-19 | 2009-05-21 | Emmanuel Labourier | Micrornas differentially expressed in pancreatic diseases and uses thereof |
| WO2008036776A2 (en) * | 2006-09-19 | 2008-03-27 | Asuragen, Inc. | Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention |
| AU2007333109A1 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | Functions and targets of let-7 micro RNAs |
| AU2007333107A1 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | miR-21 regulated genes and pathways as targets for therapeutic intervention |
| WO2008073915A2 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | Micrornas differentially expressed in leukemia and uses thereof |
| CA2671270A1 (en) * | 2006-12-29 | 2008-07-17 | Asuragen, Inc. | Mir-16 regulated genes and pathways as targets for therapeutic intervention |
| US20090131354A1 (en) * | 2007-05-22 | 2009-05-21 | Bader Andreas G | miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20090232893A1 (en) * | 2007-05-22 | 2009-09-17 | Bader Andreas G | miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| AU2008261951A1 (en) * | 2007-06-08 | 2008-12-18 | Asuragen, Inc. | miR-34 regulated genes and pathways as targets for therapeutic intervention |
| WO2009036332A1 (en) | 2007-09-14 | 2009-03-19 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
| WO2009052386A1 (en) * | 2007-10-18 | 2009-04-23 | Asuragen, Inc. | Micrornas differentially expressed in lung diseases and uses thereof |
| WO2009070805A2 (en) * | 2007-12-01 | 2009-06-04 | Asuragen, Inc. | Mir-124 regulated genes and pathways as targets for therapeutic intervention |
| WO2009086156A2 (en) * | 2007-12-21 | 2009-07-09 | Asuragen, Inc. | Mir-10 regulated genes and pathways as targets for therapeutic intervention |
| EP2260110B1 (en) * | 2008-02-08 | 2014-11-12 | Asuragen, INC. | miRNAs DIFFERENTIALLY EXPRESSED IN LYMPH NODES FROM CANCER PATIENTS |
| WO2009111643A2 (en) * | 2008-03-06 | 2009-09-11 | Asuragen, Inc. | Microrna markers for recurrence of colorectal cancer |
| EP2271757A2 (en) * | 2008-03-26 | 2011-01-12 | Asuragen, INC. | Compositions and methods related to mir-16 and therapy of prostate cancer |
| WO2009137807A2 (en) | 2008-05-08 | 2009-11-12 | Asuragen, Inc. | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
| WO2010056737A2 (en) * | 2008-11-11 | 2010-05-20 | Mirna Therapeutics, Inc. | Methods and compositions involving mirnas in cancer stem cells |
| US8110796B2 (en) | 2009-01-17 | 2012-02-07 | The George Washington University | Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays |
| US9490113B2 (en) * | 2009-04-07 | 2016-11-08 | The George Washington University | Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry |
| WO2013040251A2 (en) | 2011-09-13 | 2013-03-21 | Asurgen, Inc. | Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease |
| JP2021112127A (ja) * | 2018-04-26 | 2021-08-05 | 暁生 黒田 | 膵β細胞の傷害検査方法 |
| KR102728009B1 (ko) * | 2022-10-28 | 2024-11-08 | 주식회사 비츠로셀 | 고온 특성이 향상된 이온전도성 전구체 전해액 및 이를 포함하는 에너지 저장 장치 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6251594B1 (en) * | 1997-06-09 | 2001-06-26 | Usc/Norris Comprehensive Cancer Ctr. | Cancer diagnostic method based upon DNA methylation differences |
| US20040048254A1 (en) * | 2000-03-15 | 2004-03-11 | Alexander Olek | Diagnosis of diseases associated with tumor supressor genes and oncogenes |
| WO2002002807A2 (en) * | 2000-06-30 | 2002-01-10 | Epigenomics Ag | Diagnosis of diseases associated with cell signalling |
| EP1340818A1 (en) * | 2002-02-27 | 2003-09-03 | Epigenomics AG | Method and nucleic acids for the analysis of a colon cell proliferative disorder |
| WO2004020662A2 (en) * | 2002-08-27 | 2004-03-11 | Epigenomics Ag | Method and nucleic acids for the analysis of breast cell proliferative disorders |
-
2002
- 2002-10-25 US US10/281,076 patent/US20040029128A1/en not_active Abandoned
-
2003
- 2003-08-08 WO PCT/US2003/025044 patent/WO2004035806A2/en not_active Ceased
- 2003-08-08 JP JP2004545233A patent/JP2005536229A/ja not_active Withdrawn
- 2003-08-08 AU AU2003298546A patent/AU2003298546A1/en not_active Abandoned
- 2003-08-08 EP EP03796298A patent/EP1576190A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| EP1576190A2 (en) | 2005-09-21 |
| US20040029128A1 (en) | 2004-02-12 |
| JP2005536229A (ja) | 2005-12-02 |
| EP1576190A4 (en) | 2006-10-18 |
| AU2003298546A1 (en) | 2004-05-04 |
| AU2003298546A8 (en) | 2004-05-04 |
| WO2004035806A3 (en) | 2005-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1576190A2 (en) | Methods and nucleic acids for the analysis of cpg dinucleotide methylation status associated with the calcitonin gene | |
| US20040029121A1 (en) | Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene | |
| EP2115165B1 (en) | Methods and nucleic acids for analyses of cell proliferative disorders | |
| US20150275312A1 (en) | Method and nucleic acids for the analysis of a colon cell proliferative disorder | |
| EP1689889B1 (en) | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders | |
| US20040265833A1 (en) | Methods and nucleic acids for the analysis of colorectal cell proliferative disorders | |
| US20040146868A1 (en) | Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the development of peripheral zone prostate cancer | |
| US20060292564A1 (en) | Method and nucleic acids for the analysis of breast cell proliferative disorders | |
| US20070128592A1 (en) | Method and nucleic acids for the analysis of a lung cell proliferative disorder | |
| US20050064410A1 (en) | Method and nucleic acids for the analysis of colon cancer | |
| EP2099938B1 (en) | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders | |
| EP1395686A2 (en) | Method and nucleic acids for the differentiation of prostate tumors | |
| EP2966181B1 (en) | Methods and nucleic acids for analysis of bladder carcinoma | |
| EP1945806B1 (en) | Markers for the prediction of outcome of anthracycline treatment | |
| WO2005001140A2 (en) | Methods and nucleic acids for the analysis of colon cell proliferative disorders | |
| WO2006002344A1 (en) | Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders | |
| US20060210976A1 (en) | Methods and nucleic acids for the analysis of methylation patterns within the dd3 gene | |
| AU2002333385A1 (en) | Method and nucleic acids for the analysis of colon cancer | |
| AU2002345626A1 (en) | Method and nucleic acids for the differentiation of prostate tumors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2004545233 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003796298 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003796298 Country of ref document: EP |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2003796298 Country of ref document: EP |